- Email: [email protected]
A zein gene of maize is transcribed from two widely separated promoter regions
Cell, Vol. 34, 1015-1022, October 1983, Copyright 0 1983 by MIT
0092.8674/83/101015-08$02.00/O
A Zein Gene of Maize Is Transcribed from Two Widely Separated Promoter Regions Peter Langridge and Giinter lnstitut ftir Biologie III Universittit Freiburg Sch&nzlestrasse 1 D-7800 Freiburg Federal Republic of Germany
Feix
Summary The zein proteins are the major storage proteins of maize endosperm. They are made from large amounts of zein RNAs of several distinct sizes, ranging from the small 900 base final size RNA to precursor forms of over 3800 bases. The 900 base mRNA and the smallest precursor mRNA of 1800 bases are transcribed from two distinct promoter regions, Pl and P2. In vitro transcription of a maize genomic clone containing a zein gene pMLl allowed both promoters to be mapped. The sequence of pML1, covering the two promoter regions, contained consensus transcription start sequences at both of the predicted promoters. Sl mapping with RNA prepared from maize endosperm showed that both Pl and P2 are active in vivo as double starts. Introduction The principal storage proteins of maize endosperm are the zein proteins which consist of two major protein size classes of 19,000 and 21,000 daltons with some varietal heterogeneity (Gianazza et al., 1976; Burr et al., 1976). There are several interesting features of zein synthesis. It is highly tissue- and development-specific, occurring only in endosperm from 14 days after pollination (Jones et al., 1977). The synthesis is highly efficient since as much as 70% of the endosperm protein is zein. The proteins themselves are made as precursors with a short signal peptide to allow their insertion and deposition in protein bodies (Soave and Salamini, 1982). The zeins are coded for by a complex multigene system probably in excess of 100 genes although it is not clear if all of these genes are active (Wienand and Feix, 1980; Soave and Salamini, 1982). We have recently shown that a number of zein specific transcripts, tentatively termed precursor mRNAs, exist in maize endosperm in addition to a final sized mRNA of 900 bases (Langridge et al. 1982). The precursor RNAs range in size from 1800 bases to over 3800 bases and are extracted from maize endosperm in high concentrations, usually exceeding the amount in the small 900 base RNA. Because no zein genes have been found to date that contain intervening sequences (Spena et al., 1982, Wienand et al., 1981; Pintor-Toro et al., 1982; Hagen and Rubenstein, 1981), it is assumed that the precursor mRNAs are transcribed to include regions flanking the zein genes. Hybrids have been formed between a maize genomic clone containing a zein gene and the 1800 base precursor
RNA and analyzed as R-loops in the electron microscope (Langridge et al., 1982). It was found that the precursor mRNA extended 900 bases to the 5’ side of the zein coding sequence. It remained unclear, however, as to how the larger transcripts are produced and whether or not they are processed to yield the small mRNAs. Transcription of zein genes in vitro with extracts prepared from Xenopus oocyte germinal vesicles (Langridge et al., 1982) provided a means for studying the transcription signals preceding the zein coding sequences on genomic clones. The transcriptional analysis has been extended using both the Xenopus and the Hela cell extract systems to demonstrate two in vitro active promoters, one producing an RNA equivalent to the 1800 base precursor RNA and the second a 900 base zein mRNA. Sequencing of 1303 base pairs at the 5’ end of the zein gene and Si mapping of RNA isolated from developing maize endosperm have confirmed the in vitro determined transcription starts. It is suggested therefore that the large zein specific mRNAs represent part of a complex expression mechanism employed to obtain intensive zein synthesis. Results In Vitro Transcription of a Cloned Zein Gene Cell-free transcription systems have increasingly been used for the identification and localization of promoter sequences on cloned DNA fragments of various origins (Telford et al., 1979; Matsui, 1982). However transcription of plant nuclear genes has not been successful to date. Recently, we showed that a cloned maize DNA fragment (pML1) coding for a 21,000 dalton zein protein could be transcribed by extracts from oocyte germinal vesicles of Xenopus frogs (Langridge et al., 1982). These studies have now been extended. The zein gene is located slightly to one side of a cloned 3.4 kb Eco RI maize DNA fragment with enough flanking sequences on both sides to accomodate signal structures (Pintor-Toro et al., 1982). The DNA fragment was shown by electron microscopy to form Rloops with a 1600 base RNA, covering the zein gene (800 bases) and extending a further 800 bases in the 5’ direction (Langridge et al., 1982), making this DNA fragment particularly suitable for the search for signal structures of RNA synthesis. After correction for the shorter contour length of RNA/DNA hybrids relative to DNA/DNA hybrids (Phillippsen et al., 1978), these RNAs are equivalent to the 900 and 1800 base zein RNAs. Transcription of this clone with oocyte germinal vesicle extracts led predominantly to the synthesis of the small final sized zein mRNA of 900 bases, but readily detectable amounts of the 1800 base precursor RNA were also visible (Figure 1, lane A). The upper band seen in lane A of Figure 1 is due to runthrough transcription of the maize DNA fragment, presumably as a result of failure of the polymerase to terminate (the template must be circularized for polymerase II in the Xenopus extracts (Harland et al. 1983)).
Cell 1016
1800
-
900
e
Figure 1. Transcrrptron Extracts
of pMLl
with Xenopus
Oocyte
Germinal
Vesicle
The 3.4 kb insert of the maize genomic pML1 (0.3 pg) was circularized by self-ligation and used as template in transcription assays containing the extracts to 10 Xenopus oocyte germinal vesicles per assay. The transcriptron products were fractionated on a formaldehyde-agarose gel, the gel dried and autoradiographed. The normal products are shown in lane A. In lane B, 1.5 mM S-adenosylhomocysteine was included in the assay. In lane C, 0.4 pg/ml a-amanitin was added to the assay. The size of the major RNAs are shown in bases.
However, the results indicated that the oocyte-derived transcription system generally initiates and terminates correctly. It should be noted that since the zein gene does not contain intervening sequences, no mRNA splicing is required. The transcription of the zein gene was completely inhibited by 5-adenosylhomocysteine (Figure 1, lane B) and a-amanitin at 0.4 pg/ml (Figure 1, lane C). Both inhibitors are known to be specific for polymerase II (Jove and Manley, 1982; Roeder, 1976). Furthermore, it was previously shown that the transcripts are derived from only one strand and hybridize in “Southern” experiments to the central region of pML1 (Langridge et al., 1982). We have also found that only the central Pvu II fragment of pML1 carries promoter activity (data not shown).
The results shown in Figure 1 do not allow us to differentiate between the possibilities that there is only a single transcription start signal on pML1 and subsequent processing occurs to yield the smaller and dominant 900 base RNA or that two separate promoters are responsible for the two transcripts. Because only circular DNA fragments are active in the oocyte system (Harland et al., 1983) it is not feasible to map the promoter signals by premature termination of transcription at restriction endonuclease cleavage sites within the zein gene. If the zein terminator is removed from the transcription template, the polymerases will run around the molecule terminating at undefined positions, if at all. In this respect note the large band seen in lane A of Figure 1, produced by failure of correct termination. In the in vitro transcription system prepared from Hela cell extracts, both circular (Figure 2, lane A) and linear (lane B) pML1 inserts are active. However, the Hela system will only produce the larger 1800 base zein RNA. The transcription is inhibited by low concentrations of cy-amanitin (0.4 pg/ml) and by 5adenosylhomocysteine (Figure 2, lanes C and D, respectively) confirming the transcripts as products of polymerase II activity. It can also be shown by “Southern” hybridization that the Hela transcription products with pML1 as template are specific for the central part of pML1, indicating both specific initiation and termination (Figure 3). Because linear DNA fragments of pML1 are active as templates in the Hela system, it was possible to map the transcription starts by premature transcription termination at restriction endonuclease sites within the zein gene. Two such sites were used, at Hint II and at Hinf I (see Figure 4). In each case the insert of pML1 was cleaved with the enzyme and the resultant fragment mixture added to the Hela extract. The Hinf l-digested DNA was transcribed to yield two RNAs of approximately 700 and 330 bases (Figure 2, lane E). The 700 base RNA is 200 bases shorter than the final size zein mRNA (900 bases) and would represent a transcript begun just in front of the zein gene (P2 in Figure 4) and terminating at the Hinf I cut 200 bases before the 3’ end of the zein gene. The small 330 base RNA may be produced from PI (Figure 4) and terminated at the Hinf I site 200 bases downstream. The Hint II-digested pML1 insert also yields two transcripts when used as template in the Hela cell extracts (Figure 2, lane F). The larger 1500 base transcript extends from Pl to the Hint II cut, 350 bases before the 3’ end of the zein gene and the 500 base RNA would cover the region from P2 to the same Hint II cut. Both RNAs are, as expected, about 350 bases shorter than the in vivo RNAs. However, this result indicates that the specificity of the Hela system for Pi can be overcome by removal of the 3’ end of the zein gene. Sequence Analysis of pML1 The results of the in vitro transcription experiments indicate that two promoters, designated Pl and P2, are involved in the transcription of the zein gene in pML1. The first pro-
Zern Gene 1017
Promoters
A
ABCDEF
5600
ES
t
1800 1500 *
1370 700
b
500
-
Figure 2. Transcrrptron
870 440
of pML1 with Hela Cell Extracts
Insert isolated from pML1 (0.5 pg) was added to Hela cell extract transcriptron assay as circular (self-ligated) DNA (lane A) or linear DNA, (lanes B-F). Lanes C and D show the products obtarned if 1.5 mM S-adenosylhomocysteine or 0.4 rg/ml a-amantin (respectively) are Included in the assay. The products in lane E were transcribed from Hinf I-digested pML1 insert DNA. Lane F contains the products obtained after Hint II digestion of the pMLl insert. The RNA transcriptron products were separated on a formaldehyde-agarose gel, transferred to nitrocellulose, and the nitrocellulose was autoradiographed. The size of the major RNAs are Indicated in bases.
moter, PI, is 1000 bases upstream of the zein gene start and the second promoter, P2, lies directly before the gene, The nature of these transcription start signals was analyzed by sequencing the large central Pvu II fragment of pMLl which contains the 5’ end of the zein gene (positions 1 to 128) and 1176 bases in the 5’ direction from the gene, The sequencing strategy employed is shown in Figure 4 and the sequence of the 1303 base pair fragment is given in Figure 5. The N-terminal region of the zein gene, positions 1 to 128, includes the signal peptide and has been found to agree closely with a published cDNA sequence (Geraghty et al., 1981) and the mRNA coding region of a genomic clone (Spena et al., 1982) for a 21,000 dalton zein protein.
Figure 3. “Southern”
of Hela Transcription
Products
wrth pMLl
Lane A shows the ethrduim bromide starned pattern of Pvu II-digested pMLl (the 1370 bp band has subsquently been shown by sequencing to be 1303 bp long). The DNAs from lane A were transferred to nitrocellulose and hybridized with the transcription products obtained in the Hela system with linear pML1 insert as template. The autoradiograph of the hybridized bands is shown in lane 6. The DNA sizes are given in base pairs.
The region 5’ to the zein gene is on the average 67% A+T and contains only short reading frames, none preceded by recognizable TATA or CAAT sequences. However, in the region directly before the zein gene, positions -50 to -300, are several potential transcription start signal sequences. These could be the P2 promoter. The only other region that contains sequences similar to the consensus promoter sequences (Corden et al., 1980) is found at positions -1070 (TATA) and -1105 (CAAT). This would correspond to the predicted position of PI as described by both the in vitro experiments and the electron microscopy of R-loops between pML1 and the 1800 base mRNA. The region around the proposed PI promoter (but not the P2 promoter) contains a six base inverted repeat (see insert to Figure 5) that may have transcriptional signifi-
Cell
1018
PI v I’ , . . v 0 .
vv 11
500 Base Pairs
Him I I Pvu I I Hinf I Taq I Sau 3A
t
P2 . 1
v ,
I I I I I I I I
ZEIN
I
I D Transcripts from Hinf I digested Template
,I b c
v
.O
.
I I I ,
0
re-z=== Figure 4. The Maize insert of pML1: RestrictIon
1
1 GENE Z- 1800 Base RNA - 900 Base RNA
I I I A LW
. V.
Map, Transcription
Map, and Sequencing
Transcripts frownHint II digested Template
Sequencing Strategy
Strategy
The upper line shows the maize Insert of pML1 with the location of the zein gene and the two promoter regions, PI and P2. Relevant restriction sites are also given. RNA transcripts derived from the two promoters are indicated as arrows stretching from their promoters to the zein gene terminus or to the Hinf I or Hint II restriction sites. The sequencing strategy is shown at the bottom of the figure with a fine restriction map of the central Pvt. Ii fragment. The arrows Indicate the directlon and extent of sequencing for eadh fragment.
cance. A further interesting structure in the region sequenced is found between positions -750 and -780 where a 14 base tandem repeat lies. In Vivo Transcription Starts The transcription starts used in vivo to produce the 900 and 1800 base RNAs in maize endosperm were determined by single-strand nuclease digestion of hybrids formed between endosperm RNA and the zein genomic clone pML1. Poly (rA) RNA from 20 day old endosperm was hybridized to the single strands of the Taq I-Pvu II fragment of pML1 covering nucleotides -193 to +128 labeled at their 5’ ends with 32P. After digestion with the single-strand-specific mung bean nuclease, the protected DNA fragments were sized on a 6% polyacrylamide sequencing gel alongside Maxam-Gilbert sequencing reactions of the same labeled DNA strand. The first four lanes of Figure 6 show that G, A, C+T, and C>T reactions and lane E shows the mung bean nuclease protected bands of the DNA strand 5’ labeled at the Pvu II site (nucleotide +128). There are two clearly dominant bands visible in lane E that correspond to the arrows shown in the region of P2 in Figure 5. It can be seen in Figure 5 that these starts are preceded by TATA and CAAT boxes that conform to published consensus sequences (Corden et al., 1980). The opposing DNA strand, 5’ end-labeled at the Taq I site (nucleotide -193) formed no hybrids with the RNA that could be seen after mung bean nuclease digestion (data not shown). Transcription start signals were also found in the region
of the proposed PI promoter. In this case, the DNA fragment Pvu II-Hinf I (covering positions -1176 to -835) was again end-labeled at the 5’ ends, strand separated, and the individual strands hybridized to poly (rA) RNA from maize endosperm. It has been shown that up to 10% of the zein specific mRNA in 20 day old endosperm poly (rA) RNA is in the form of the 1800 base precursor RNA (Langridge et al., 1982). The results obtained after mung bean nuclease digestion of the hybrids formed betweeen zein RNA and the DNA 5’ end-labeled at Hinf I are shown in Figure 7. The complementary DNA strand formed on detectable hybrids. The sequencing reactions are shown in lanes A, B, C, and D and the nuclease protected bands are shown in lane E. As in Figure 6, two distinct bands can be seen corresponding to the arrows shown in Figure 5 in the Pl promoter region. The two starts are preceded by the TATA and CAAT sequences noted earlier. The first of the starts also lies within the inverted repeat structure of Pi (insert of Figure 5). Discussion In considering the results presented, it is important to bear two features of zein synthesis in mind. First, the zein genes are highly active; during peak zein synthesis 80% to 90% of the endosperm protein synthesis is zein. Second, the zein specific RNAs are present in endosperm tissue as several distinct size classes ranging from 900 bases to over 3800 bases. Furthermore, the larger mRNAs exceed the 900 base RNA in concentration. The analysis of the
Zein Gene Promoters 1019
CTGTTiGTCACCAAClCAAAATAGT~GGTGCCTGTiTGACACCAAiTATCCTCTA~CACAAAGAA~T~GT -1101 I ’ Pl GATGGAGGAT~CGATCCGGC~CAGATCCA~~~CAT~TTGGGTGAT~C~TGCCTAAiG~TGGTTGTiTTAGTGTTA~TTTGGGCAT~TTGG
iATTAGATTTAGGGTATGGGAAAAATTTTAiTTCCATTTG~TGATGTTAG~TATACATCT~TTTTGATTC~ACAGTTACA~TTCAACAGA~ -801
iCCATTGAATiATTCATGACBTATATCTTG~TATTGCTTT~TGTCAGCGG~ATATATTTC~AACGACTCAiGTAAAAGTT~TACACGATT~T -601
aTACTAAAGCAAGTTGTAATCAAGAACACTiGAGGTGTGC~CCAATTGCC~CATTTAGAT~TAATCATTCiAATTTTGGT~ATCCTATGT -501
AAAAAAAATCCTATATAAAAtGACAATTTTtCTTGTAGGTdGTGGAAAGTdTCTTTCCAGCAAAGACTATdTATATAATCCGTAAAGCCG -201
GTCAAAATCGdGTAGATGCCdTACCATCTAtACCTTATCT~TTGTTTGGAdAAAAG~~~CAAAAAdA~~~dGTCTCCTGTdTAAGCACACI 1 P2 AAATTTTGGTATGTATGTCCAATCGTGTAT~CATC~CCTAiAATATTT~G~GCATTCAGA~ACACACCTA~GGAAGCGCA~TAGCAACG -1 aTGGCTACCAAGATATTATCClCTCCTGCGCiCTGCCTTTGiGAGCGCACA~TGGTCATATCCACAATGCTCATTCCAAAGT tlO0 MetAlaThrLys I leLeuSerLeuLeuArgSerAlaPheValSerAlaGlnTrpSerTyrP~oGlnCysSerLeuAlaProSerAla I 1elleProLys ~CCTCCCACCAGTTACTTCAATGGGCAG +I28
PheLeuProProValThrSerMetGly
rTGGGT ‘ATAG’ CAE -1076 TCCA
Figure 5. Nucleotide
Sequence
of the 1303 Base Pair Pvu II Fragment
-1029
of pML1
The transcribed DNA strand and the first 42 amino acids of the zein protein are shown. starts for Pi and the arrows at nucleotides -52 and -65 are the P2 in vivo starts. These after nuclease digestion one extra nucleoside remains on the protected DNA fragment In and a tandem repeat between nucleotides -751 and -781 is shown with arrows. The
transcription of a zein gene and the sequence of the gene’s 5’ noncoding region are therefore important in the understanding of zein synthesis. The results presented suggest that two promoter regions (Pl and P2) lie to the 5’ side of the zein gene in the clone pML1. Each promoter appears to be active both in vivo and in vitro and may consist of double starts. The two promoters are separated from each other by 1000 bases of A+T-rich DNA sequence with no apparent protein coding or other function. The short tandem repeat, however, in the region between the two promoters may be the remnant of some previous rearrangement. Such repeats
The arrows at nucleotldes -1038 and -1048 are the m vivo transcription correspond to two bases in front of the bands in Figures 6 and 7 since with one less charge. Potential TATA and CAAT sequences are boxed Insert shows an inverted repeat in the PI region.
are, for example, seen after the excision of mobile genetic elements (Roeder and Fink, 1983). The identification of the zein promoters was made possible by the success of the in vitro transcription system to yield identifiable products. The Xenopus oocyte germinal vesicle extracts were previously shown to transcribe the zein gene in the maize genomic clone of pMLl (Langridge et al., 1982). The transcripts were shown to be both specifically initiated and terminated and to be transcribed only from circularized template. The Xenopus system showed a distinct preference for P2 as the transcription start although transcripts from PI were also readily seen.
Cell 1020
A
BCD
E
A T A -2
A1
Figure 7. Sl Mapping
Frgure 6. Si Mapprng
of the P2 Promoter
Region
Maxam-Gilbert sequencing reaction of the DNA fragment covering nucleotides -93 to +128 (labeled at +128) are shown in lane A (G reaction), lane B (A reaction), lane C (C+T reaction), and lane D (C>T reaction). After hybrrdization of the DNA strand with poly (rA) RNA from 20 days postpollination maize endosperm and mung bean nuclease digestion, the protected bands shown in lane E were obtained. The sequence in the region of the nuclease protected bands and the exact location of the bands (arrows) are shown to the left.
The promoter specificity of the Hela system differs from that of the Xenopus system in that PI is exclusively used when a full-length pML1 insert is provided as template. P2, however, is also recognized by the Hela polymerase II as a transcription start if PI is disconnected or if the structural
of the Pi Promoter
Region
Maxam-Gilbert sequencrng reactions of the DNA fragment coverrng nucleotides -1176 to -835 (labeled at -835) are shown in lane A (G reaction), lane B (A reaction), lane C (C+T reaction), and lane D (C>T reaction). After hybrrdization of the DNA strand with poly (rA) RNA from 20 days postpollination maize endosperm and mung bean nuclease digestron, the protected bands shown in lane E were obtained. The sequence in the region of the nuclease protected bands and the location of the bands (arrows) are given on the left. As a result of the weakness of the nuclease protected bands in lane E, the gel was exposed twice, 4 days for the sequencing reactions and 10 days for lane E.
gene is shortened. The preference shown for Pi could be related to the possible secondary structure around PI (McKnight and Kingsbury, 1982). This reflects the in vivo situation where the amount of the 1800 base transcript exceeds that of the 900 base transcript. The ability of the Hela polymerase to both initiate and terminate is unusual. Termination is not always achieved; frequently the polymerase will run through to the end of the DNA template. It was found important to purify the
Zein Gene 1021
Promoters
template DNA after recovery from agarose gels (see Experimental Procedures). Furthermore, of the large number of zein genomic clones that we have isolated, only few were able to terminate correctly; the majority gave runthrough transcription. We have also found that in a transcription system prepared by the method of Manley et al. (1980) but using rat hepatoma cells, no termination could be achieved. Taken together the in vitro transcription results appear to reflect the in vivo situation well. Both Pl and P2 were shown to represent starts of endosperm zein mRNAs. The double starts found at each promoter region have been observed for a rat tryptophane oxygenase gene (Schmid et al., 1982) and may allow more efficient use of the promoters. In the case of Pl the two starts could be related to two potential TATA sequences upstream. There is still apparent conflict in the literature about the significance of TATA and CAAT consensus sequences (Grosveld et al., 1982; Struhl, 1982; Osborne et al., 1982; Matsui, 1982) and inverted repeat structures (Gorman et al., 1982; McKnight and Kingsbury, 1982) in determining the activity of promoters, but all three features are found in the Pl region and only an inverted repeat fails in P2. The consensus sequences tend to fit better to the animal sequences (Corden et al., 1980) rather than to those published for plants (Messing et al., 1983). The sequence of pML1 is the first to cover the 5’ region of a 21,000 dalton zein gene so extensively. Spena et al. (1982) sequenced a 21,000 zein gene to 215 bases upstream of the protein start, We find good homology in the 3’ direction from the mRNA start but to the 5’ side of the start there is very little homology. Because the sequences in the region of Pl and for most of the region between PI and P2 are not included in the sequence of Spena et al. (1982) we do not know if the structures seen in pML1 are common to other zein genes of this class. One can, however, envisage three possible uses for the long A+T-rich sequence between Pl and P2. First, it may function to attract and bind control proteins or nucleic acids. Second, the region may be involved in the insertion or excision of controlling or regulatory sequences: in this respect the tandem repeat may be significant. A third possible function may simply be to separate the two promoters sufficiently to allow polymerase binding at both PI and P2. The presence of such A+T-rich sequences surrounding and separating genes has been reported for a number of eucaryotic gene systems (Moreau et al., 1981, 1982; Kimmel and Firtel, 1983). In conclusion, it appears that high expression rate of the zein genes is achieved by a complex promoter system. Two promoter regions preceding a zein gene in a maize genomic clone each contain double starts for zein mRNAs. The first, and probably more important, promoter produces a 1800 base mRNA and the second a 900 base RNA. These results account for the synthesis of two zein RNA size classes but further study will be necessary to understand the origins of the larger zein precursor RNAs. Furthermore, the zein proteins are coded by a complex gene family with probably over 100 genes, our results apply to
one of these genes and differences could well exist in the mechanism of expression of different zein genes. Experimental Reagents Restrrction purchased chemicals
Procedures
endonucleases, from Bethesda Other reagents
T4 DNA ligase, and mung bean nuclease were Research Laboratories, Boehringer, or PL Biowere obtained from Merck or Serva.
In Vitro Transcription The Hela transcription system was purchased from New England Nuclear and used as described by the manufacturers. Xenopus oocyte germrnal vesicles were prepared as described by Birkenmeier et al. (1978). DNA (0.3 fig) was added to the extracts of IO germinal vesicles as circularized (self-ligated) molecules. The assays contained 70 mM NH&I, 70 mM MgClz, 0.1 mM Na,EDTA, 2.5 mM DTE, 1% (w/v) polyvinylpyrolidone, 10 mM Hepes (pH 7.8) 50 pM each of ATP, CTP, and UTP, and 10 &i a-3zP-GTP (500 Cr/mmole) in a reaction volume of 20 pl. The assays were incubated for 3 hr at 22°C and the RNA recovered after phenol/chloroform/SDS extraction as follows: to each assay 100 ~1 0.3 M NaAcetate (pH 4.8), 100 @I 1% SDS and 200 ~1 phenol/chloroform (1 :I) was added and vigorously mixed. The lower phenol/chloroform phase was removed and the aqeuous phase plus interphase was extracted twice with chloroform. After the ftnal extractron the aqueous phase was ethanolprecipitated. The RNA was subsequently fractionated on formaldehyde agarose gels as described previously (Langridge et al., 1982). These gels were either directly autoradiographed or the RNA was frrst transferred to nitrocellulose and the nitrocellulose was autoradiographed. The latter procedure gave fewer background problems and was used for the Hela transcription system products. All DNAs were cleaned prior to the transcription assays by QN’-butanol extraction as described by Langridge et al. (1980). DNA Sequencing The nucleotide sequence of the Isolated 1303 Pvu II fragment of pML1 (Pintor-Toro et al., 1982) was determined by the method of Maxam and Gilbert (1980). The sequence was analyzed by the computer programm of Kroger and Kroger-Block (1982). Mapping of In Vivo Transcription Starts The method used was modified from those described by Berk and Sharp (1977) and Bach et al. (1981). RNA was prepared from 20 day postpollination marze endosperm as previously described (Langridge et al., 1982). Poly (rA) RNA was recovered over oligo-dT cellulose columns and hybridized with single DNA strands 32P-labeled at therr 5’ ends wrth T4-polynucleotide kinase. For each hybridization 50 pg of poly (rA) RNA was mixed with the labeled DNA in 40mM Mops (pH 6.8) 400 mM NaCI. 1 mM EDTA, and 80% formamide, denatured by heating for 2 mm at 70°C and allowed to hybridize overnight at 40°C. The mixture was diluted with IO volumes (500 ~1) 30 mM NaAcetate (pH 4.6) 50 mM NaCI, 4 mM ZnClp, 5% (v/v) glycerine, and 500 U mung bean nuclease I and incubated 90 min at 37°C. After nuclease digestion the resistant RNA-DNA hybrids were ethanolprecipitated, redissolved in 20 mM NaOH, 1 mM EDTA, boiled for 5 min and loaded onto a 6% sequencing gel beside sequencing reactions. Acknowledgments The excellent technical assistance of Mrs. E. Brutzer and Mrs. H. Jonas is gratefully acknowledged. We also thank Dr. M. Kroger for his guidance during sequencing and Mr. G. Strittmatter and Prof. H. Kossel for their Instruction with the Sl mapping method. This work was supported by the Deutsche Forschungsgemeinschaft (SFB 206 and FE 62/6-l) and the Bundesministerium fur Forschung and Technologie (PTB 8394). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “adverfisement” in accordance wrth 18 U.S.C. Section 1734 solely to Indicate this fact. Received
June 22, 1983
Cell 1022
References Bach, R., Grummt, I., and Allet, B. (1981). The nucieotide sequence of the initiation region of the ribosomal transcription unit from mouse Nucl. Acids Res. 9, 1559-1569. Berk, A. J., Sharp, P. A. (1977). Sizing and mapping of early adenovirus mRNAs by gel electrophoresis of Sl endonuclease-digested hybrids. Cell 12, 721-732. Birkenmeier, E. H., Brown, D. D., and Jordan, E. (1978). A nuclear extract of Xenopus laevts oocytes that accurately transcribes 5s RNA genes. Cell 75, 1077-1086. Burr, B., and Burr, F. A. (1976). Zein synthesis in maize endosperm by polyribosomes attached to protein bodies. Proc. Nat. Acad. Sci. USA 73, 515-519. Corden, J., Wasylyk, B., Buchwalder, A., Sassone-Corsi, P., Kedinger, L., and Chambon, C. (1980). Promoter sequences of eukaryotic protein-coding genes. Science 209, 1406-I 414. Geraghty, D., Pfeifer, M. A., Rubenstein, I.( and Messing, J. (1981). The primary structure of a plant storage protein: zein. Nucl. Acids Res. 9, 51635174. Granazza, E., Rrghetti, P. H., Pioli, F., Galante, E., and Soave, C. (1976). Size and charge heterogeneity of zein in normal and opaque-2 maize endosperm. Maydica 27, I-17. Gorman, L. M., Merlino, G. T., Willingham, M. C., Pastan, I., and Howard, B. H. (1982). The rous sarcoma virus long terminal repeat is a strong promoter when introduced into a variety of eukaryotic cells by DNAmediated infection. Proc. Nat. Acad. Sci. USA 79, 6777-6781.
Moreau, J.. Matyash-Smirnragurna, L., and Scherrer. K. (1981). Systematic punctuation of eukaryotic DNA by A+T-rich sequences. Proc. Nat. Acad. Sci. USA 78, 1341-1345. Moreau, J., Marcaud, L., Maschat, F., Kejzlarova-Lepesant, J., Lepesant, J.-A., and Scherrer, K. (1982). A+T-rich linkers define functional domains in eukaryotic DNA. Nature 295, 260-262. Osborne, T. F., Gaynor, R. B., and Berk, A. J. (1982). The TATA homology and the mRNA 5’ untranslated sequence are not required for expression of essential adenovirus EIA functions. Cell 29, 139-148. Phillippsen, P., Thomas, M., Kramer, R. A., and Davis, R. W. (1978). Unique arrangement of coding sequences for 5S, 5.8S, 185 and 255 ribosomal RNA in Saccharomyces cerevisiae as determined by R-loop and hybridization analysis. J. Mol. Biol. 723, 387-404. Prntor-Toro, J. A., Langridge, P., and Feix, G. (1982). Isolation and characterization of maize genes coding for zein proteins of the 21,000 dalton size class. Nucl. Acids Res. 70, 3845-3860. Roeder, R. G. (1976). Eukaryotic nuclear RNA polymerases. In RNA Polymerase. R. Losick and M. Chamberlin, eds. (Cold Spring Harbor, New York: Cold Sprrng Harbor Laboratory), pp. 285-239. Roeder. G. S., and Fink, G. R. (1983). Transposable elements rn yeast. In Mobile Genetic Elements. J. A. Shapiro, ed. (New York: Academic Press), pp. 299-328. Schmid, W., Scherer, G., Dan& U., Zentgraf, H., Matthias, P., Strange, C. M., Rowekamp, W., and Schlitz, G. (1982). Isolation and characterisatron of the rat tryptophan oxygonase gene. EMBO J. 7, 1287-1293. Soave, C., and Salamini, F. (1982). Zein proteins: a mutigene maize endosperm. Qual. Plant Foods Hum. Natr. 37, 191-203.
family from
Grosveld, G. C., deBoer, E., Shewmaker, C. K., and Flavell, R. A. (1982). DNA sequences necessary for transcrrption of the rabbit P-globin gene in viva. Nature 295, 120-I 26.
Spena, A., Viotti, A., and Pirrotta, V. (1982). A homologous repetitive block structure underlres the heterogeneity of heavy and light chain zein genes. EMBO J. 7, 1589-1594.
Hagen, C., and Rubenstein, I. (1981). Complex in maize. Gene 73, 239-249.
Struhl, K. (1982). The yeast his3 promoter contains elements. Proc. Nat. Acad. Sci. USA 79, 7385-7389.
organization
of zein genes
Harland, R. M., Weintraub, H.. and McKnight, S. L. (1983). Transcription of DNA injected into Xenopus oocytes is influenced by template topology. Nature 302, 38-43. Jones, R. A., in maize Ill. composition Plant Physiol.
Larkins, 8. A., and Tsai, C. Y. (1977). Storage protein synthesis Developmental changes in membrane-bound polyribosome and in vitro protein synthesis of normal and opaque-2 maize. 59, 733-737.
Jove, R., and Manley, J. L. (1982). Transcrrption initiation by RNA polymerase II is inhibited by S-adenosylhomocysteine. Proc. Nat. Acad. SCI. USA 79, 5842-5846. Kimmel, A. R., and Firtel, R. A. (1983). Sequence organrzation in Dictyostelium: unique structure at the 5’.ends of protein coding genes. Nucl. Acds Res. 7 7, 541-552. Kroger, M., and Kroger-Block, A. (1982). A flexible new computer for handling DNA sequence data. Nucl. Acids Res. 70, 229-236.
program
Langridge, J., Langridge, P., and Berquist, P. L. (1980). Extraction acids from agarose gels. Anal. Biochem. 703, 264-271.
of nucleic
Langridge, P., Pintor-Toro, J. A., and Felix, G. (1982). Zern precursor from maize endosperm. Mol. Gen. Genet. 787, 432-438.
mRNAs
Manley, J. L., Fire, A., Cano, A., Sharp, P. A., and Gefter, M. L. (1980). DNA-dependent transcription of adenovirus genes in a soluble whole-cell extract. Proc. Nat. Acad. Sci. USA 77, 3855-3859. Matsui, T. (1982). In vitro accurate initiation of transcription on the adenovirus type 2 IVa 2 gene which does not contain a TATA box. Nucl. Acids Res. 70, 7089-7101. Maxam, A. M., and Gilbert W. (1980). Sequencing end-labeled DNA with base-specific chemical cleavages. In Methods in Enzymology. Volume 65. L. Grossmann and K. Moldave, eds. (New York: Academic Press), pp. 499-560. McKnight, S. L., and Kingsbury, R. (1982). Transcriptional control of a eukaryotic protein-coding gene. Science 277, 316-324.
signals
Messing, J., Geraghty, D., Herdecker, G., Nien-Tai, H., Kridl, J., and Rubenstein, I. (1983). Plant gene structure. In Genetic Engineering in Plants A. Hollaender, ed. (New York: Plenum Press), in press.
at least two distinct
Telford, T. L., Kressmann, A., Koski, R. A., Grosschedl, R., Muller, F., Clarkson, S. G., and Birnstiel, M. L. (1979). Delimination of a promoter for RNA polymerase Ill by means of a functional test. Proc. Nat. Acad. Sci. USA 76, 2590-2594. Wienand, U., and Feix, G. (1980). Zein specific of maize DNA. FEBS Lett. 176, 14-16.
restriction
enzyme fragments
Wienand, U., Langridge, P., and Feix, G. (1981). Isolation and characterization of a genomic sequence of maize coding for a zein gene. Mol. Gen. Genet. 782, 440-444.
0092.8674/83/101015-08$02.00/O
A Zein Gene of Maize Is Transcribed from Two Widely Separated Promoter Regions Peter Langridge and Giinter lnstitut ftir Biologie III Universittit Freiburg Sch&nzlestrasse 1 D-7800 Freiburg Federal Republic of Germany
Feix
Summary The zein proteins are the major storage proteins of maize endosperm. They are made from large amounts of zein RNAs of several distinct sizes, ranging from the small 900 base final size RNA to precursor forms of over 3800 bases. The 900 base mRNA and the smallest precursor mRNA of 1800 bases are transcribed from two distinct promoter regions, Pl and P2. In vitro transcription of a maize genomic clone containing a zein gene pMLl allowed both promoters to be mapped. The sequence of pML1, covering the two promoter regions, contained consensus transcription start sequences at both of the predicted promoters. Sl mapping with RNA prepared from maize endosperm showed that both Pl and P2 are active in vivo as double starts. Introduction The principal storage proteins of maize endosperm are the zein proteins which consist of two major protein size classes of 19,000 and 21,000 daltons with some varietal heterogeneity (Gianazza et al., 1976; Burr et al., 1976). There are several interesting features of zein synthesis. It is highly tissue- and development-specific, occurring only in endosperm from 14 days after pollination (Jones et al., 1977). The synthesis is highly efficient since as much as 70% of the endosperm protein is zein. The proteins themselves are made as precursors with a short signal peptide to allow their insertion and deposition in protein bodies (Soave and Salamini, 1982). The zeins are coded for by a complex multigene system probably in excess of 100 genes although it is not clear if all of these genes are active (Wienand and Feix, 1980; Soave and Salamini, 1982). We have recently shown that a number of zein specific transcripts, tentatively termed precursor mRNAs, exist in maize endosperm in addition to a final sized mRNA of 900 bases (Langridge et al. 1982). The precursor RNAs range in size from 1800 bases to over 3800 bases and are extracted from maize endosperm in high concentrations, usually exceeding the amount in the small 900 base RNA. Because no zein genes have been found to date that contain intervening sequences (Spena et al., 1982, Wienand et al., 1981; Pintor-Toro et al., 1982; Hagen and Rubenstein, 1981), it is assumed that the precursor mRNAs are transcribed to include regions flanking the zein genes. Hybrids have been formed between a maize genomic clone containing a zein gene and the 1800 base precursor
RNA and analyzed as R-loops in the electron microscope (Langridge et al., 1982). It was found that the precursor mRNA extended 900 bases to the 5’ side of the zein coding sequence. It remained unclear, however, as to how the larger transcripts are produced and whether or not they are processed to yield the small mRNAs. Transcription of zein genes in vitro with extracts prepared from Xenopus oocyte germinal vesicles (Langridge et al., 1982) provided a means for studying the transcription signals preceding the zein coding sequences on genomic clones. The transcriptional analysis has been extended using both the Xenopus and the Hela cell extract systems to demonstrate two in vitro active promoters, one producing an RNA equivalent to the 1800 base precursor RNA and the second a 900 base zein mRNA. Sequencing of 1303 base pairs at the 5’ end of the zein gene and Si mapping of RNA isolated from developing maize endosperm have confirmed the in vitro determined transcription starts. It is suggested therefore that the large zein specific mRNAs represent part of a complex expression mechanism employed to obtain intensive zein synthesis. Results In Vitro Transcription of a Cloned Zein Gene Cell-free transcription systems have increasingly been used for the identification and localization of promoter sequences on cloned DNA fragments of various origins (Telford et al., 1979; Matsui, 1982). However transcription of plant nuclear genes has not been successful to date. Recently, we showed that a cloned maize DNA fragment (pML1) coding for a 21,000 dalton zein protein could be transcribed by extracts from oocyte germinal vesicles of Xenopus frogs (Langridge et al., 1982). These studies have now been extended. The zein gene is located slightly to one side of a cloned 3.4 kb Eco RI maize DNA fragment with enough flanking sequences on both sides to accomodate signal structures (Pintor-Toro et al., 1982). The DNA fragment was shown by electron microscopy to form Rloops with a 1600 base RNA, covering the zein gene (800 bases) and extending a further 800 bases in the 5’ direction (Langridge et al., 1982), making this DNA fragment particularly suitable for the search for signal structures of RNA synthesis. After correction for the shorter contour length of RNA/DNA hybrids relative to DNA/DNA hybrids (Phillippsen et al., 1978), these RNAs are equivalent to the 900 and 1800 base zein RNAs. Transcription of this clone with oocyte germinal vesicle extracts led predominantly to the synthesis of the small final sized zein mRNA of 900 bases, but readily detectable amounts of the 1800 base precursor RNA were also visible (Figure 1, lane A). The upper band seen in lane A of Figure 1 is due to runthrough transcription of the maize DNA fragment, presumably as a result of failure of the polymerase to terminate (the template must be circularized for polymerase II in the Xenopus extracts (Harland et al. 1983)).
Cell 1016
1800
-
900
e
Figure 1. Transcrrptron Extracts
of pMLl
with Xenopus
Oocyte
Germinal
Vesicle
The 3.4 kb insert of the maize genomic pML1 (0.3 pg) was circularized by self-ligation and used as template in transcription assays containing the extracts to 10 Xenopus oocyte germinal vesicles per assay. The transcriptron products were fractionated on a formaldehyde-agarose gel, the gel dried and autoradiographed. The normal products are shown in lane A. In lane B, 1.5 mM S-adenosylhomocysteine was included in the assay. In lane C, 0.4 pg/ml a-amanitin was added to the assay. The size of the major RNAs are shown in bases.
However, the results indicated that the oocyte-derived transcription system generally initiates and terminates correctly. It should be noted that since the zein gene does not contain intervening sequences, no mRNA splicing is required. The transcription of the zein gene was completely inhibited by 5-adenosylhomocysteine (Figure 1, lane B) and a-amanitin at 0.4 pg/ml (Figure 1, lane C). Both inhibitors are known to be specific for polymerase II (Jove and Manley, 1982; Roeder, 1976). Furthermore, it was previously shown that the transcripts are derived from only one strand and hybridize in “Southern” experiments to the central region of pML1 (Langridge et al., 1982). We have also found that only the central Pvu II fragment of pML1 carries promoter activity (data not shown).
The results shown in Figure 1 do not allow us to differentiate between the possibilities that there is only a single transcription start signal on pML1 and subsequent processing occurs to yield the smaller and dominant 900 base RNA or that two separate promoters are responsible for the two transcripts. Because only circular DNA fragments are active in the oocyte system (Harland et al., 1983) it is not feasible to map the promoter signals by premature termination of transcription at restriction endonuclease cleavage sites within the zein gene. If the zein terminator is removed from the transcription template, the polymerases will run around the molecule terminating at undefined positions, if at all. In this respect note the large band seen in lane A of Figure 1, produced by failure of correct termination. In the in vitro transcription system prepared from Hela cell extracts, both circular (Figure 2, lane A) and linear (lane B) pML1 inserts are active. However, the Hela system will only produce the larger 1800 base zein RNA. The transcription is inhibited by low concentrations of cy-amanitin (0.4 pg/ml) and by 5adenosylhomocysteine (Figure 2, lanes C and D, respectively) confirming the transcripts as products of polymerase II activity. It can also be shown by “Southern” hybridization that the Hela transcription products with pML1 as template are specific for the central part of pML1, indicating both specific initiation and termination (Figure 3). Because linear DNA fragments of pML1 are active as templates in the Hela system, it was possible to map the transcription starts by premature transcription termination at restriction endonuclease sites within the zein gene. Two such sites were used, at Hint II and at Hinf I (see Figure 4). In each case the insert of pML1 was cleaved with the enzyme and the resultant fragment mixture added to the Hela extract. The Hinf l-digested DNA was transcribed to yield two RNAs of approximately 700 and 330 bases (Figure 2, lane E). The 700 base RNA is 200 bases shorter than the final size zein mRNA (900 bases) and would represent a transcript begun just in front of the zein gene (P2 in Figure 4) and terminating at the Hinf I cut 200 bases before the 3’ end of the zein gene. The small 330 base RNA may be produced from PI (Figure 4) and terminated at the Hinf I site 200 bases downstream. The Hint II-digested pML1 insert also yields two transcripts when used as template in the Hela cell extracts (Figure 2, lane F). The larger 1500 base transcript extends from Pl to the Hint II cut, 350 bases before the 3’ end of the zein gene and the 500 base RNA would cover the region from P2 to the same Hint II cut. Both RNAs are, as expected, about 350 bases shorter than the in vivo RNAs. However, this result indicates that the specificity of the Hela system for Pi can be overcome by removal of the 3’ end of the zein gene. Sequence Analysis of pML1 The results of the in vitro transcription experiments indicate that two promoters, designated Pl and P2, are involved in the transcription of the zein gene in pML1. The first pro-
Zern Gene 1017
Promoters
A
ABCDEF
5600
ES
t
1800 1500 *
1370 700
b
500
-
Figure 2. Transcrrptron
870 440
of pML1 with Hela Cell Extracts
Insert isolated from pML1 (0.5 pg) was added to Hela cell extract transcriptron assay as circular (self-ligated) DNA (lane A) or linear DNA, (lanes B-F). Lanes C and D show the products obtarned if 1.5 mM S-adenosylhomocysteine or 0.4 rg/ml a-amantin (respectively) are Included in the assay. The products in lane E were transcribed from Hinf I-digested pML1 insert DNA. Lane F contains the products obtained after Hint II digestion of the pMLl insert. The RNA transcriptron products were separated on a formaldehyde-agarose gel, transferred to nitrocellulose, and the nitrocellulose was autoradiographed. The size of the major RNAs are Indicated in bases.
moter, PI, is 1000 bases upstream of the zein gene start and the second promoter, P2, lies directly before the gene, The nature of these transcription start signals was analyzed by sequencing the large central Pvu II fragment of pMLl which contains the 5’ end of the zein gene (positions 1 to 128) and 1176 bases in the 5’ direction from the gene, The sequencing strategy employed is shown in Figure 4 and the sequence of the 1303 base pair fragment is given in Figure 5. The N-terminal region of the zein gene, positions 1 to 128, includes the signal peptide and has been found to agree closely with a published cDNA sequence (Geraghty et al., 1981) and the mRNA coding region of a genomic clone (Spena et al., 1982) for a 21,000 dalton zein protein.
Figure 3. “Southern”
of Hela Transcription
Products
wrth pMLl
Lane A shows the ethrduim bromide starned pattern of Pvu II-digested pMLl (the 1370 bp band has subsquently been shown by sequencing to be 1303 bp long). The DNAs from lane A were transferred to nitrocellulose and hybridized with the transcription products obtained in the Hela system with linear pML1 insert as template. The autoradiograph of the hybridized bands is shown in lane 6. The DNA sizes are given in base pairs.
The region 5’ to the zein gene is on the average 67% A+T and contains only short reading frames, none preceded by recognizable TATA or CAAT sequences. However, in the region directly before the zein gene, positions -50 to -300, are several potential transcription start signal sequences. These could be the P2 promoter. The only other region that contains sequences similar to the consensus promoter sequences (Corden et al., 1980) is found at positions -1070 (TATA) and -1105 (CAAT). This would correspond to the predicted position of PI as described by both the in vitro experiments and the electron microscopy of R-loops between pML1 and the 1800 base mRNA. The region around the proposed PI promoter (but not the P2 promoter) contains a six base inverted repeat (see insert to Figure 5) that may have transcriptional signifi-
Cell
1018
PI v I’ , . . v 0 .
vv 11
500 Base Pairs
Him I I Pvu I I Hinf I Taq I Sau 3A
t
P2 . 1
v ,
I I I I I I I I
ZEIN
I
I D Transcripts from Hinf I digested Template
,I b c
v
.O
.
I I I ,
0
re-z=== Figure 4. The Maize insert of pML1: RestrictIon
1
1 GENE Z- 1800 Base RNA - 900 Base RNA
I I I A LW
. V.
Map, Transcription
Map, and Sequencing
Transcripts frownHint II digested Template
Sequencing Strategy
Strategy
The upper line shows the maize Insert of pML1 with the location of the zein gene and the two promoter regions, PI and P2. Relevant restriction sites are also given. RNA transcripts derived from the two promoters are indicated as arrows stretching from their promoters to the zein gene terminus or to the Hinf I or Hint II restriction sites. The sequencing strategy is shown at the bottom of the figure with a fine restriction map of the central Pvt. Ii fragment. The arrows Indicate the directlon and extent of sequencing for eadh fragment.
cance. A further interesting structure in the region sequenced is found between positions -750 and -780 where a 14 base tandem repeat lies. In Vivo Transcription Starts The transcription starts used in vivo to produce the 900 and 1800 base RNAs in maize endosperm were determined by single-strand nuclease digestion of hybrids formed between endosperm RNA and the zein genomic clone pML1. Poly (rA) RNA from 20 day old endosperm was hybridized to the single strands of the Taq I-Pvu II fragment of pML1 covering nucleotides -193 to +128 labeled at their 5’ ends with 32P. After digestion with the single-strand-specific mung bean nuclease, the protected DNA fragments were sized on a 6% polyacrylamide sequencing gel alongside Maxam-Gilbert sequencing reactions of the same labeled DNA strand. The first four lanes of Figure 6 show that G, A, C+T, and C>T reactions and lane E shows the mung bean nuclease protected bands of the DNA strand 5’ labeled at the Pvu II site (nucleotide +128). There are two clearly dominant bands visible in lane E that correspond to the arrows shown in the region of P2 in Figure 5. It can be seen in Figure 5 that these starts are preceded by TATA and CAAT boxes that conform to published consensus sequences (Corden et al., 1980). The opposing DNA strand, 5’ end-labeled at the Taq I site (nucleotide -193) formed no hybrids with the RNA that could be seen after mung bean nuclease digestion (data not shown). Transcription start signals were also found in the region
of the proposed PI promoter. In this case, the DNA fragment Pvu II-Hinf I (covering positions -1176 to -835) was again end-labeled at the 5’ ends, strand separated, and the individual strands hybridized to poly (rA) RNA from maize endosperm. It has been shown that up to 10% of the zein specific mRNA in 20 day old endosperm poly (rA) RNA is in the form of the 1800 base precursor RNA (Langridge et al., 1982). The results obtained after mung bean nuclease digestion of the hybrids formed betweeen zein RNA and the DNA 5’ end-labeled at Hinf I are shown in Figure 7. The complementary DNA strand formed on detectable hybrids. The sequencing reactions are shown in lanes A, B, C, and D and the nuclease protected bands are shown in lane E. As in Figure 6, two distinct bands can be seen corresponding to the arrows shown in Figure 5 in the Pl promoter region. The two starts are preceded by the TATA and CAAT sequences noted earlier. The first of the starts also lies within the inverted repeat structure of Pi (insert of Figure 5). Discussion In considering the results presented, it is important to bear two features of zein synthesis in mind. First, the zein genes are highly active; during peak zein synthesis 80% to 90% of the endosperm protein synthesis is zein. Second, the zein specific RNAs are present in endosperm tissue as several distinct size classes ranging from 900 bases to over 3800 bases. Furthermore, the larger mRNAs exceed the 900 base RNA in concentration. The analysis of the
Zein Gene Promoters 1019
CTGTTiGTCACCAAClCAAAATAGT~GGTGCCTGTiTGACACCAAiTATCCTCTA~CACAAAGAA~T~GT -1101 I ’ Pl GATGGAGGAT~CGATCCGGC~CAGATCCA~~~CAT~TTGGGTGAT~C~TGCCTAAiG~TGGTTGTiTTAGTGTTA~TTTGGGCAT~TTGG
iATTAGATTTAGGGTATGGGAAAAATTTTAiTTCCATTTG~TGATGTTAG~TATACATCT~TTTTGATTC~ACAGTTACA~TTCAACAGA~ -801
iCCATTGAATiATTCATGACBTATATCTTG~TATTGCTTT~TGTCAGCGG~ATATATTTC~AACGACTCAiGTAAAAGTT~TACACGATT~T -601
aTACTAAAGCAAGTTGTAATCAAGAACACTiGAGGTGTGC~CCAATTGCC~CATTTAGAT~TAATCATTCiAATTTTGGT~ATCCTATGT -501
AAAAAAAATCCTATATAAAAtGACAATTTTtCTTGTAGGTdGTGGAAAGTdTCTTTCCAGCAAAGACTATdTATATAATCCGTAAAGCCG -201
GTCAAAATCGdGTAGATGCCdTACCATCTAtACCTTATCT~TTGTTTGGAdAAAAG~~~CAAAAAdA~~~dGTCTCCTGTdTAAGCACACI 1 P2 AAATTTTGGTATGTATGTCCAATCGTGTAT~CATC~CCTAiAATATTT~G~GCATTCAGA~ACACACCTA~GGAAGCGCA~TAGCAACG -1 aTGGCTACCAAGATATTATCClCTCCTGCGCiCTGCCTTTGiGAGCGCACA~TGGTCATATCCACAATGCTCATTCCAAAGT tlO0 MetAlaThrLys I leLeuSerLeuLeuArgSerAlaPheValSerAlaGlnTrpSerTyrP~oGlnCysSerLeuAlaProSerAla I 1elleProLys ~CCTCCCACCAGTTACTTCAATGGGCAG +I28
PheLeuProProValThrSerMetGly
rTGGGT ‘ATAG’ CAE -1076 TCCA
Figure 5. Nucleotide
Sequence
of the 1303 Base Pair Pvu II Fragment
-1029
of pML1
The transcribed DNA strand and the first 42 amino acids of the zein protein are shown. starts for Pi and the arrows at nucleotides -52 and -65 are the P2 in vivo starts. These after nuclease digestion one extra nucleoside remains on the protected DNA fragment In and a tandem repeat between nucleotides -751 and -781 is shown with arrows. The
transcription of a zein gene and the sequence of the gene’s 5’ noncoding region are therefore important in the understanding of zein synthesis. The results presented suggest that two promoter regions (Pl and P2) lie to the 5’ side of the zein gene in the clone pML1. Each promoter appears to be active both in vivo and in vitro and may consist of double starts. The two promoters are separated from each other by 1000 bases of A+T-rich DNA sequence with no apparent protein coding or other function. The short tandem repeat, however, in the region between the two promoters may be the remnant of some previous rearrangement. Such repeats
The arrows at nucleotldes -1038 and -1048 are the m vivo transcription correspond to two bases in front of the bands in Figures 6 and 7 since with one less charge. Potential TATA and CAAT sequences are boxed Insert shows an inverted repeat in the PI region.
are, for example, seen after the excision of mobile genetic elements (Roeder and Fink, 1983). The identification of the zein promoters was made possible by the success of the in vitro transcription system to yield identifiable products. The Xenopus oocyte germinal vesicle extracts were previously shown to transcribe the zein gene in the maize genomic clone of pMLl (Langridge et al., 1982). The transcripts were shown to be both specifically initiated and terminated and to be transcribed only from circularized template. The Xenopus system showed a distinct preference for P2 as the transcription start although transcripts from PI were also readily seen.
Cell 1020
A
BCD
E
A T A -2
A1
Figure 7. Sl Mapping
Frgure 6. Si Mapprng
of the P2 Promoter
Region
Maxam-Gilbert sequencing reaction of the DNA fragment covering nucleotides -93 to +128 (labeled at +128) are shown in lane A (G reaction), lane B (A reaction), lane C (C+T reaction), and lane D (C>T reaction). After hybrrdization of the DNA strand with poly (rA) RNA from 20 days postpollination maize endosperm and mung bean nuclease digestion, the protected bands shown in lane E were obtained. The sequence in the region of the nuclease protected bands and the exact location of the bands (arrows) are shown to the left.
The promoter specificity of the Hela system differs from that of the Xenopus system in that PI is exclusively used when a full-length pML1 insert is provided as template. P2, however, is also recognized by the Hela polymerase II as a transcription start if PI is disconnected or if the structural
of the Pi Promoter
Region
Maxam-Gilbert sequencrng reactions of the DNA fragment coverrng nucleotides -1176 to -835 (labeled at -835) are shown in lane A (G reaction), lane B (A reaction), lane C (C+T reaction), and lane D (C>T reaction). After hybrrdization of the DNA strand with poly (rA) RNA from 20 days postpollination maize endosperm and mung bean nuclease digestron, the protected bands shown in lane E were obtained. The sequence in the region of the nuclease protected bands and the location of the bands (arrows) are given on the left. As a result of the weakness of the nuclease protected bands in lane E, the gel was exposed twice, 4 days for the sequencing reactions and 10 days for lane E.
gene is shortened. The preference shown for Pi could be related to the possible secondary structure around PI (McKnight and Kingsbury, 1982). This reflects the in vivo situation where the amount of the 1800 base transcript exceeds that of the 900 base transcript. The ability of the Hela polymerase to both initiate and terminate is unusual. Termination is not always achieved; frequently the polymerase will run through to the end of the DNA template. It was found important to purify the
Zein Gene 1021
Promoters
template DNA after recovery from agarose gels (see Experimental Procedures). Furthermore, of the large number of zein genomic clones that we have isolated, only few were able to terminate correctly; the majority gave runthrough transcription. We have also found that in a transcription system prepared by the method of Manley et al. (1980) but using rat hepatoma cells, no termination could be achieved. Taken together the in vitro transcription results appear to reflect the in vivo situation well. Both Pl and P2 were shown to represent starts of endosperm zein mRNAs. The double starts found at each promoter region have been observed for a rat tryptophane oxygenase gene (Schmid et al., 1982) and may allow more efficient use of the promoters. In the case of Pl the two starts could be related to two potential TATA sequences upstream. There is still apparent conflict in the literature about the significance of TATA and CAAT consensus sequences (Grosveld et al., 1982; Struhl, 1982; Osborne et al., 1982; Matsui, 1982) and inverted repeat structures (Gorman et al., 1982; McKnight and Kingsbury, 1982) in determining the activity of promoters, but all three features are found in the Pl region and only an inverted repeat fails in P2. The consensus sequences tend to fit better to the animal sequences (Corden et al., 1980) rather than to those published for plants (Messing et al., 1983). The sequence of pML1 is the first to cover the 5’ region of a 21,000 dalton zein gene so extensively. Spena et al. (1982) sequenced a 21,000 zein gene to 215 bases upstream of the protein start, We find good homology in the 3’ direction from the mRNA start but to the 5’ side of the start there is very little homology. Because the sequences in the region of Pl and for most of the region between PI and P2 are not included in the sequence of Spena et al. (1982) we do not know if the structures seen in pML1 are common to other zein genes of this class. One can, however, envisage three possible uses for the long A+T-rich sequence between Pl and P2. First, it may function to attract and bind control proteins or nucleic acids. Second, the region may be involved in the insertion or excision of controlling or regulatory sequences: in this respect the tandem repeat may be significant. A third possible function may simply be to separate the two promoters sufficiently to allow polymerase binding at both PI and P2. The presence of such A+T-rich sequences surrounding and separating genes has been reported for a number of eucaryotic gene systems (Moreau et al., 1981, 1982; Kimmel and Firtel, 1983). In conclusion, it appears that high expression rate of the zein genes is achieved by a complex promoter system. Two promoter regions preceding a zein gene in a maize genomic clone each contain double starts for zein mRNAs. The first, and probably more important, promoter produces a 1800 base mRNA and the second a 900 base RNA. These results account for the synthesis of two zein RNA size classes but further study will be necessary to understand the origins of the larger zein precursor RNAs. Furthermore, the zein proteins are coded by a complex gene family with probably over 100 genes, our results apply to
one of these genes and differences could well exist in the mechanism of expression of different zein genes. Experimental Reagents Restrrction purchased chemicals
Procedures
endonucleases, from Bethesda Other reagents
T4 DNA ligase, and mung bean nuclease were Research Laboratories, Boehringer, or PL Biowere obtained from Merck or Serva.
In Vitro Transcription The Hela transcription system was purchased from New England Nuclear and used as described by the manufacturers. Xenopus oocyte germrnal vesicles were prepared as described by Birkenmeier et al. (1978). DNA (0.3 fig) was added to the extracts of IO germinal vesicles as circularized (self-ligated) molecules. The assays contained 70 mM NH&I, 70 mM MgClz, 0.1 mM Na,EDTA, 2.5 mM DTE, 1% (w/v) polyvinylpyrolidone, 10 mM Hepes (pH 7.8) 50 pM each of ATP, CTP, and UTP, and 10 &i a-3zP-GTP (500 Cr/mmole) in a reaction volume of 20 pl. The assays were incubated for 3 hr at 22°C and the RNA recovered after phenol/chloroform/SDS extraction as follows: to each assay 100 ~1 0.3 M NaAcetate (pH 4.8), 100 @I 1% SDS and 200 ~1 phenol/chloroform (1 :I) was added and vigorously mixed. The lower phenol/chloroform phase was removed and the aqeuous phase plus interphase was extracted twice with chloroform. After the ftnal extractron the aqueous phase was ethanolprecipitated. The RNA was subsequently fractionated on formaldehyde agarose gels as described previously (Langridge et al., 1982). These gels were either directly autoradiographed or the RNA was frrst transferred to nitrocellulose and the nitrocellulose was autoradiographed. The latter procedure gave fewer background problems and was used for the Hela transcription system products. All DNAs were cleaned prior to the transcription assays by QN’-butanol extraction as described by Langridge et al. (1980). DNA Sequencing The nucleotide sequence of the Isolated 1303 Pvu II fragment of pML1 (Pintor-Toro et al., 1982) was determined by the method of Maxam and Gilbert (1980). The sequence was analyzed by the computer programm of Kroger and Kroger-Block (1982). Mapping of In Vivo Transcription Starts The method used was modified from those described by Berk and Sharp (1977) and Bach et al. (1981). RNA was prepared from 20 day postpollination marze endosperm as previously described (Langridge et al., 1982). Poly (rA) RNA was recovered over oligo-dT cellulose columns and hybridized with single DNA strands 32P-labeled at therr 5’ ends wrth T4-polynucleotide kinase. For each hybridization 50 pg of poly (rA) RNA was mixed with the labeled DNA in 40mM Mops (pH 6.8) 400 mM NaCI. 1 mM EDTA, and 80% formamide, denatured by heating for 2 mm at 70°C and allowed to hybridize overnight at 40°C. The mixture was diluted with IO volumes (500 ~1) 30 mM NaAcetate (pH 4.6) 50 mM NaCI, 4 mM ZnClp, 5% (v/v) glycerine, and 500 U mung bean nuclease I and incubated 90 min at 37°C. After nuclease digestion the resistant RNA-DNA hybrids were ethanolprecipitated, redissolved in 20 mM NaOH, 1 mM EDTA, boiled for 5 min and loaded onto a 6% sequencing gel beside sequencing reactions. Acknowledgments The excellent technical assistance of Mrs. E. Brutzer and Mrs. H. Jonas is gratefully acknowledged. We also thank Dr. M. Kroger for his guidance during sequencing and Mr. G. Strittmatter and Prof. H. Kossel for their Instruction with the Sl mapping method. This work was supported by the Deutsche Forschungsgemeinschaft (SFB 206 and FE 62/6-l) and the Bundesministerium fur Forschung and Technologie (PTB 8394). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “adverfisement” in accordance wrth 18 U.S.C. Section 1734 solely to Indicate this fact. Received
June 22, 1983
Cell 1022
References Bach, R., Grummt, I., and Allet, B. (1981). The nucieotide sequence of the initiation region of the ribosomal transcription unit from mouse Nucl. Acids Res. 9, 1559-1569. Berk, A. J., Sharp, P. A. (1977). Sizing and mapping of early adenovirus mRNAs by gel electrophoresis of Sl endonuclease-digested hybrids. Cell 12, 721-732. Birkenmeier, E. H., Brown, D. D., and Jordan, E. (1978). A nuclear extract of Xenopus laevts oocytes that accurately transcribes 5s RNA genes. Cell 75, 1077-1086. Burr, B., and Burr, F. A. (1976). Zein synthesis in maize endosperm by polyribosomes attached to protein bodies. Proc. Nat. Acad. Sci. USA 73, 515-519. Corden, J., Wasylyk, B., Buchwalder, A., Sassone-Corsi, P., Kedinger, L., and Chambon, C. (1980). Promoter sequences of eukaryotic protein-coding genes. Science 209, 1406-I 414. Geraghty, D., Pfeifer, M. A., Rubenstein, I.( and Messing, J. (1981). The primary structure of a plant storage protein: zein. Nucl. Acids Res. 9, 51635174. Granazza, E., Rrghetti, P. H., Pioli, F., Galante, E., and Soave, C. (1976). Size and charge heterogeneity of zein in normal and opaque-2 maize endosperm. Maydica 27, I-17. Gorman, L. M., Merlino, G. T., Willingham, M. C., Pastan, I., and Howard, B. H. (1982). The rous sarcoma virus long terminal repeat is a strong promoter when introduced into a variety of eukaryotic cells by DNAmediated infection. Proc. Nat. Acad. Sci. USA 79, 6777-6781.
Moreau, J.. Matyash-Smirnragurna, L., and Scherrer. K. (1981). Systematic punctuation of eukaryotic DNA by A+T-rich sequences. Proc. Nat. Acad. Sci. USA 78, 1341-1345. Moreau, J., Marcaud, L., Maschat, F., Kejzlarova-Lepesant, J., Lepesant, J.-A., and Scherrer, K. (1982). A+T-rich linkers define functional domains in eukaryotic DNA. Nature 295, 260-262. Osborne, T. F., Gaynor, R. B., and Berk, A. J. (1982). The TATA homology and the mRNA 5’ untranslated sequence are not required for expression of essential adenovirus EIA functions. Cell 29, 139-148. Phillippsen, P., Thomas, M., Kramer, R. A., and Davis, R. W. (1978). Unique arrangement of coding sequences for 5S, 5.8S, 185 and 255 ribosomal RNA in Saccharomyces cerevisiae as determined by R-loop and hybridization analysis. J. Mol. Biol. 723, 387-404. Prntor-Toro, J. A., Langridge, P., and Feix, G. (1982). Isolation and characterization of maize genes coding for zein proteins of the 21,000 dalton size class. Nucl. Acids Res. 70, 3845-3860. Roeder, R. G. (1976). Eukaryotic nuclear RNA polymerases. In RNA Polymerase. R. Losick and M. Chamberlin, eds. (Cold Spring Harbor, New York: Cold Sprrng Harbor Laboratory), pp. 285-239. Roeder. G. S., and Fink, G. R. (1983). Transposable elements rn yeast. In Mobile Genetic Elements. J. A. Shapiro, ed. (New York: Academic Press), pp. 299-328. Schmid, W., Scherer, G., Dan& U., Zentgraf, H., Matthias, P., Strange, C. M., Rowekamp, W., and Schlitz, G. (1982). Isolation and characterisatron of the rat tryptophan oxygonase gene. EMBO J. 7, 1287-1293. Soave, C., and Salamini, F. (1982). Zein proteins: a mutigene maize endosperm. Qual. Plant Foods Hum. Natr. 37, 191-203.
family from
Grosveld, G. C., deBoer, E., Shewmaker, C. K., and Flavell, R. A. (1982). DNA sequences necessary for transcrrption of the rabbit P-globin gene in viva. Nature 295, 120-I 26.
Spena, A., Viotti, A., and Pirrotta, V. (1982). A homologous repetitive block structure underlres the heterogeneity of heavy and light chain zein genes. EMBO J. 7, 1589-1594.
Hagen, C., and Rubenstein, I. (1981). Complex in maize. Gene 73, 239-249.
Struhl, K. (1982). The yeast his3 promoter contains elements. Proc. Nat. Acad. Sci. USA 79, 7385-7389.
organization
of zein genes
Harland, R. M., Weintraub, H.. and McKnight, S. L. (1983). Transcription of DNA injected into Xenopus oocytes is influenced by template topology. Nature 302, 38-43. Jones, R. A., in maize Ill. composition Plant Physiol.
Larkins, 8. A., and Tsai, C. Y. (1977). Storage protein synthesis Developmental changes in membrane-bound polyribosome and in vitro protein synthesis of normal and opaque-2 maize. 59, 733-737.
Jove, R., and Manley, J. L. (1982). Transcrrption initiation by RNA polymerase II is inhibited by S-adenosylhomocysteine. Proc. Nat. Acad. SCI. USA 79, 5842-5846. Kimmel, A. R., and Firtel, R. A. (1983). Sequence organrzation in Dictyostelium: unique structure at the 5’.ends of protein coding genes. Nucl. Acds Res. 7 7, 541-552. Kroger, M., and Kroger-Block, A. (1982). A flexible new computer for handling DNA sequence data. Nucl. Acids Res. 70, 229-236.
program
Langridge, J., Langridge, P., and Berquist, P. L. (1980). Extraction acids from agarose gels. Anal. Biochem. 703, 264-271.
of nucleic
Langridge, P., Pintor-Toro, J. A., and Felix, G. (1982). Zern precursor from maize endosperm. Mol. Gen. Genet. 787, 432-438.
mRNAs
Manley, J. L., Fire, A., Cano, A., Sharp, P. A., and Gefter, M. L. (1980). DNA-dependent transcription of adenovirus genes in a soluble whole-cell extract. Proc. Nat. Acad. Sci. USA 77, 3855-3859. Matsui, T. (1982). In vitro accurate initiation of transcription on the adenovirus type 2 IVa 2 gene which does not contain a TATA box. Nucl. Acids Res. 70, 7089-7101. Maxam, A. M., and Gilbert W. (1980). Sequencing end-labeled DNA with base-specific chemical cleavages. In Methods in Enzymology. Volume 65. L. Grossmann and K. Moldave, eds. (New York: Academic Press), pp. 499-560. McKnight, S. L., and Kingsbury, R. (1982). Transcriptional control of a eukaryotic protein-coding gene. Science 277, 316-324.
signals
Messing, J., Geraghty, D., Herdecker, G., Nien-Tai, H., Kridl, J., and Rubenstein, I. (1983). Plant gene structure. In Genetic Engineering in Plants A. Hollaender, ed. (New York: Plenum Press), in press.
at least two distinct
Telford, T. L., Kressmann, A., Koski, R. A., Grosschedl, R., Muller, F., Clarkson, S. G., and Birnstiel, M. L. (1979). Delimination of a promoter for RNA polymerase Ill by means of a functional test. Proc. Nat. Acad. Sci. USA 76, 2590-2594. Wienand, U., and Feix, G. (1980). Zein specific of maize DNA. FEBS Lett. 176, 14-16.
restriction
enzyme fragments
Wienand, U., Langridge, P., and Feix, G. (1981). Isolation and characterization of a genomic sequence of maize coding for a zein gene. Mol. Gen. Genet. 782, 440-444.