ABC transporters affect the elimination and toxicity of CdTe quantum dots in liver and kidney cells

Toxicology and Applied Pharmacology 303 (2016) 11–20

Contents lists available at ScienceDirect

Toxicology and Applied Pharmacology journal homepage: www.elsevier.com/locate/ytaap

ABC transporters affect the elimination and toxicity of CdTe quantum dots in liver and kidney cells Mingli Chen a, Huancai Yin a, Pengli Bai a, Peng Miao a,b, Xudong Deng c, Yingxue Xu a,b, Jun Hu a, Jian Yin a,⁎ a b c

CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163, PR China University of Chinese Academy of Sciences, Beijing 100049, PR China Department of Chemical Engineering, McMaster University, Hamilton, Ontario, L8S 4L7, Canada

a r t i c l e

i n f o

Article history: Received 29 January 2016 Revised 4 April 2016 Accepted 26 April 2016 Available online 27 April 2016 Keywords: Quantum dot elimination Liver cells Kidney cells P-glycoprotein Multi-resistance associated proteins

a b s t r a c t This paper aimed to investigate the role of adenosine triphosphate-binding cassette (ABC) transporters on the efflux and the toxicity of nanoparticles in liver and kidney cells. In this study, we synthesized CdTe quantum dots (QDs) that were monodispersed and emitted green fluorescence (maximum peak at 530 nm). Such QDs tended to accumulate in human hepatocellular carcinoma cells (HepG2), human kidney cells 2 (HK-2), and Madin-Darby canine kidney (MDCK) cells, and cause significant toxicity in all the three cell lines. Using specific inhibitors and inducers of P-glycoprotein (Pgp) and multidrug resistance associated proteins (Mrps), the cellular accumulation and subsequent toxicity of QDs in HepG2 and HK-2 cells were significantly affected, while only slight changes appeared in MDCK cells, corresponding well with the functional expressions of ABC transporters in cells. Moreover, treatment of QDs caused concentration- and time- dependent induction of ABC transporters in HepG2 and HK-2 cells, but such phenomenon was barely found in MDCK cells. Furthermore, the effects of CdTe QDs on ABC transporters were found to be greater than those of CdCl2 at equivalent concentrations of cadmium, indicating that the effects of QDs should be a combination of free Cd2+ and specific properties of QDs. Overall, these results indicated a strong dependence between the functional expressions of ABC transporters and the efflux of QDs, which could be an important reason for the modulation of QDs toxicity by ABC transporters. © 2016 Elsevier Inc. All rights reserved.

1. Introduction Possessing unique optical and electrical properties such as brightness, photo-stability, narrow emission and broad absorption, fluorescent quantum dots (QDs) have been widely used in biomedical investigation such as bio-imaging, gene delivery and combined therapy (Yi et al., 2014; Li et al., 2015; Wegner and Hildebrandt, 2015). Unfortunately, such growing applications increased the likelihood of workplace and environmental exposures to QDs, which might accumulate in cells and tissues, and induce harmful side effects (Hoshino et al., 2007; Valizadeh et al., 2012). The reported harmful effects of QDs includes DNA damage, altering cell growth, and inducing cell apoptosis, which have been found in cells derived from human, rat, zebrafish and even micro-organisms (Hardman, 2006; Tang et al., 2008, 2013; Monras et al., 2014). Thus, it is really important to systematically investigate the toxicity of QDs and the corresponding mechanisms, to realize widespread applications of QDs in biology. A number of experiments have been carried out on the toxic mechanism of QDs, and their results revealed that the released heavy metals ⁎ Corresponding author at: CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, 88 Keling Road, Suzhou, Jiangsu 215163, PR China. E-mail address: [email protected] (J. Yin).

http://dx.doi.org/10.1016/j.taap.2016.04.017 0041-008X/© 2016 Elsevier Inc. All rights reserved.

(Cho et al., 2007; Monras et al., 2014) were significant contributors to cytotoxicity of QDs. But the experiments using human kidney 2 (HK2) cells suggested that, CdTe QDs were much more cytotoxic than CdCl2 solutions when reaching identical intracellular Cd2+ concentration, implying that the cytotoxicity of CdTe QDs cannot be attributed solely to the toxic effect of free Cd2+ (Su et al., 2010). Such a conclusion was supported by Tang et al. (2013), whose experiments using zebrafish liver cells revealed that, ZnS shells could reduce QD toxicity by hindering the release of Cd2+, but it didn't eliminate the toxic effects caused by the nanoparticles themselves. Although the exact mechanism for the toxicity of nanoparticles themselves is still unclear, it is important to investigate the uptake and elimination of QDs in cells, and their effects on the cytotoxicity of QDs. Given their small size, QDs cross the plasma membrane primarily through pinocytosis, a distinct set of endocytosis mechanisms, which also mediates the uptake of several cell nutrients. By employing multiple inhibitors that suppressed specific internalization processes, Gprotein-coupled receptor and low density lipoprotein receptor/scavenger receptor were found to responsible for the uptake of QDs in human epidermal keratinocytes (Zhang and Monteiro-Riviere, 2009). Unfortunately, the excretion mode of QDs in cells is rarely investigated, although which should also be important in the accumulation of QDs. On the other hand, adenosine triphosphate-binding cassette (ABC)

12

M. Chen et al. / Toxicology and Applied Pharmacology 303 (2016) 11–20

transporters like P-glycoprotein (Pgp) and multi-resistance associated protein1–5 (Mrp1–5) are believed to constitute a general mechanism of tolerance to chemicals in human and animals (Luckenbach et al., 2014; van der Schoor et al., 2015), but whether they participate in the efflux of QDs are still unclear. In the limited reports, Al-Hajaj et al. (2011) found a significant contribution of P-glycoprotein (Pgp) to the efflux of QDs in human embryonic kidney cells and human hepatocellular carcinoma (HepG2) cells. However, the possible involvement of other transporters in the elimination of QDs, and their effects on the toxicity of QDs still need further investigation. Therefore, the goal of this study was to evaluate the possible involvement of three major ABC transporters, including Pgp, Mrp1 and Mrp2 in the excretion of commonly used CdTe QDs in mammalian cells. Experiments were carried out in the presence or absence of a number of specific inhibitors and activators of Pgp and Mrps. Cellular accumulation experiments were conducted in Madin-Darby canine kidney (MDCK) cells and two human model cell lines: HepG2 and HK-2. These cell lines are particularly relevant to excretion studies as injected QDs tend to accumulate preferentially in the liver and kidney of treated animals (Choi et al., 2009; Nurunnabi et al., 2013). Furthermore, the involvement of free Cd2 + in the action of QDs and the effects of ABC transporters on the toxicity of QDs were also evaluated. 2. Materials and methods 2.1. Cell lines and reagents HepG2 cells (ATCC HB8065) were graciously provided by Dr Lifang Jiang (Zhejiang University, Hangzhou, China). HK-2 and MDCK cells were purchased from Shanghai Cell Bank, Chinese Academy of Sciences. Cadmium chloride hemi (pentahydrate), methyl thiazolyl tetrazolium (MTT), MK571, sodium borohydride, reversin 205 (REV), rifampin (RIF), poly dimethyl diallyl ammonium chloride (PDADMAC), thioglycolic acid, and tellurium powder were purchased from Sigma-Aldrich (St Louis, MO, USA). Probenecid (PB) was from MP Biomedicals Inc. (Aurora, OH, USA). Cyclosporine A (CsA) was from Shanghai Sangon Biological Technology & Services Co. Ltd. (Shanghai, China). Fetal bovine serum was obtained from Hangzhou Sijiqing Biological Eng. Material Co. Ltd. (Hangzhou, China). Dulbecco's modified eagle medium (DMEM) basal medium was from Gibco (Gaithersburg, USA). The reagents for total protein measurement with the bicinchoninic acid (BCA) method were from Pierce (Rockford, IL, USA), and the Bradford assay kit was from Beyotime Biotechnology (Haimen, China). Aqueous solutions were prepared using Millipore water Milli-Q Water Systems (Millipore Corp., Bedford, MA, USA). All the other chemicals used in this study were obtained from local chemical suppliers and were all of reagent grade. 2.2. Quantum dots preparation 100 mL thioglycolic acid-stabilized CdTe QDs were prepared as described before (Peng et al., 2007). After then, the CdTe QD colloid was irradiated for 12 h with a 250-W xenon lamp at room temperature to increase the photoluminescence intensity of QDs. CdTe QDs were precipitated by adding 200 mL of 2-propanol from the dispersion and collected by centrifugation at 15,000 rpm for 15 min. The obtained CdTe QDs were dried at room temperature under vacuum and then re-dispersed in 50 mL of PDADMAC solution (0.35 wt.%, pH 7.0) for 10 min. After adding 150 mL of 2-propanol to precipitate the QDs again and centrifugation, the QDs were dispersed in 50 mL of Milli-Q water. This procedure was repeated 3 times to remove any unbounded polymer. The finally obtained positively charged CdTe QDs were dispersed in 100 mL of phosphate-buffered saline (PBS, 0.01 M, pH7.4) and used for the subsequent experiments. The amount of cadmium in the QD solutions was quantified by atomic absorption spectrometry (AA240FS-GTA120; Varian Inc., Palo Alto, CA, USA), and the value was determined to be 10% of QDs

concentration. Transmission electron microscopy images of QDs were taken by placing a drop of the CdTe QDs dispersion in PBS onto a carbon film-supported copper grid. The size and shape of the particles were determined using a Tecnai G220 TEM instrument (FEI, Portland, USA) operating at 200 kV. Absorption spectra (380–700 nm) were recorded using an Agilent Cary 300 Scan UV/vis spectrophotometer (Agilent Technologies Inc., Palo Alto, CA, USA), and the emission spectra (380– 700 nm) were recorded on a Hitachi F-4600 fluorescence spectrophotometer (Hitachi Co. Ltd., Tokyo, Japan) in 1 × 1 cm quartz cells. 2.3. Cell culture and treatment HepG2, HK-2 and MDCK cells were cultured in DMEM basal medium supplemented with 100 U/mL penicillin, 100 μg/mL streptomycin and 10% fetal bovine serum. Cells were maintained in 24-well plates at 37 °C, 5% CO2 in a humidified atmosphere. After reaching 80% of confluence, cells were washed with PBS, treated with medium containing QDs, QDs and/or drugs, and incubated at 37 °C for the time intervals indicated. All treatments were replicated three times. To investigate the cytotoxicity of CdTe QDs, cells were treated by QDs at the concentrations of 1, 2.5, 5, 10, 25, 50, 100, 200, and 400 mg/L for 24 h, cell viability was recorded after then. Cellular accumulation of QDs in each cell line was also detected at lower concentrations (5, 10, 25 and 50 mg/L), as the higher concentrations of QDs caused too severe damage to the HK-2 and MDCK cells (cell viability b 20%). Inhibitors and inducers of Pgp and Mrps were used to investigate the role of ABC transporters in the elimination and toxicity of QDs. In the previous reports, CsA and REV were usually used as inhibitors of Pgp (Sharom et al., 1999; Ye et al., 2013). Meanwhile, MK571 and PB were often applied in the inhibition of Mrps (Luna-Tortos et al., 2010; Furugen et al., 2013). Moreover, rifampin was known to increase the activity of Pgp and Mrps through activating pregnane X receptor (Martin et al., 2008; Lemmen et al., 2013). The following concentrations of inhibitors/inducers were applied in this experiment: CsA (5, 10, and 20 μM), REV (2.5, 5, and 10 μM), MK571 (5, 10, and 20 μM), PB (100, 200, and 400 μM), and RIF (10, 25, and 50 μM). All the inhibitors were added with QDs together, and treated the cells for 24 h. Meanwhile, RIF was added 15 h before the treatment of QDs for 24 h. These concentrations of inhibitors and inducers were proved to be non-toxic in all of the three cell lines (Supplementary Fig. S1) and caused significant alteration of the activities of Pgp and Mrps in HepG2 and HK-2 cells (Supplementary Fig. S2). The concentrations of QDs were selected around their LD50 in each cell line. Stocks of RIF, REV, CsA, and MK571 were prepared in dimethyl sulfoxide (DMSO), and PB was dissolved in 1 M NaOH firstly. All of these stocks were then diluted in culture medium before use, and the final pH of medium was adjusted to 7.5 after the addition of NaOH. The final concentration of DMSO in each treatment was b 0.1%, which had no adverse effects on cell lines. To determine the inductive effects of QDs on ABC transporters, HepG2, HK-2 and MDCK cells in 24-well plates were washed with PBS and then cultured in 1 mL medium containing 0.5 and 1 mg/L QDs (containing 0.05 and 0.1 mg/L cadmium). Treatments with 0.082 mg/L and 0.163 mg/L of CdCl2 (containing 0.05 and 0.1 mg/L of cadmium) were done for comparison purposes. After 24 and 48 h of treatment, cells in each group were collected for PCR and western blot analysis. No evident mortality was observed in any of the treatment during the exposure period. Stocks of CdCl2 were prepared in PBS, and diluted in culture medium before use. 2.4. Confocal laser scanning microscopy In order to determine whether the synthesized quantum dots could enter cells, HepG2, HK-2 and MDCK cells were respectively cultured on a circular cover slip and treated with 1 mg/L CdTe QDs, which caused no significant toxicity in all three cell lines. After then, cells were fixed with

M. Chen et al. / Toxicology and Applied Pharmacology 303 (2016) 11–20

4% paraformaldehyde at 4 °C overnight and washed with PBS three times. Fluorescence micrographs of cells were acquired with a DFC350FX monochrome digital camera connected to a TCS SP5 II confocal microscope (Leica microsystems, Wetzlar, Germany) using a FITC filter at ×63 oil immersion lens (Oil). 2.5. Cell viability assay For HepG2, HK-2 and MDCK cells, the percentage of cell survival was measured using MTT assay. After incubation with the corresponding concentrations of QDs, or QDs + inhibitors/inducers, 500 μL PBS was first added to each well to wash off the unattached dead cells. Then, to each well was added 500 μL PBS and 150 μL MTT solution (5 mg/mL dissolved in PBS) and incubated for 3 h at 37 °C. At the end of incubation, the solution was removed and the formazan crystals were dissolved in 1.5 mL acidified-isopropanol for 1 h at 25 °C. The absorbance was measured using a Synergy HT multi-mode microplate reader (BioTek Instruments, Winooski, VT, USA) at a wavelength of 570 nm (Yin et al., 2008). Cell viability was expressed as the percentage of absorbance normalized to the negative control at the same time. The median lethal dose (LD50) was determined by fitting cell viability curves. 2.6. QDs accumulation After reaching 80% of confluence, cells in 24-well plates were washed with PBS, and treated with the medium containing QDs or QDs and inhibitors/inducers. After then, cells were washed with PBS, lysed in 0.5 mL 1% Triton-100 solutions, and then centrifuged at 12,000 rpm for 10 min to precipitate cellular fragments. The fluorescence of lysates was then measured in a microplate fluorescence reader (Synergy 2, BioTek, USA) using excitation/emission wavelengths of 340/530 nm. The amounts of QDs accumulated in each cell line were quantified with a standard curve (0–1000 ng/L). The values were normalized to the viable cell numbers (cell viability × total cell numbers, ng/105 cells) in each well. The cell numbers in each well was obtained using a standard curve method (0–106 cells), which was based on the total protein content as measured with bicinchoninic acid method. All treatments were replicated three times. 2.7. Quantitative real-time RT-PCR Total RNA was extracted with a commercial kit (Axygen Scientific, Inc., USA). The RNA quality was checked by 260/280 nm absorption using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc., USA). First-strand cDNA was prepared as previously described (Wilkening and Bader, 2003). Gene expression of Pgp, Mrp1 and Mrp2 in each cell line was evaluated by qPCR. Amplification, which was performed with the 2 × SYBR-Green PCR Master Mix and an ABI 7500 real-time PCR system (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. In brief, reactions were done in 25 μL volumes containing 200 nM of each primer, 5 μL cDNA (3 ng), and 12.5 μL 2 × SYBR Green Master Mix Reagent. Reactions were run using the manufacturer's recommended cycling parameters of 95 °C for 10 min, 40 cycles of 94 °C for 10 s, and 58 °C for 10 s and 72 °C for 30 s, and finished with 3 min elongation at 72 °C. No-template controls were used for each pair of primers. The values of each transporter were normalized to the values of GAPDH and expressed relative to the respective control cells using the 2−ΔΔC(t) method as previously described (Zhu et al., 2009). Amplification specificity/quality was assessed by analyzing product melting curves. Sequences of primers were obtained from literature and listed in Table 1. 2.8. Western blot analysis

commercial kit (Pierce, Rockford, IL, USA) and quantified using the Bradford assay (Beyotime Biotechnology, Haimen, China). A total of 50 μg protein was separated on 8% SDS-PAGE, transferred to polyvinylidene fluoride (PVDF) membranes, and then blocked with 5% nonfat milk. After then, the membrane was incubated with the following monoclonal antibodies: Anti-Mdr1 (diluted 1:600), Mrp2 (diluted 1:600) and anti-Na+/K+-ATPase all from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA) at 4 °C overnight. Among them, Na+/K+ATPase was used as a loading control. The PVDF membranes were then incubated with horseradish peroxidase-conjugated secondary antibodies (diluted 1:2000) from Rockland (Gilbertsville, PA, USA) at room temperature for 1 h. Protein bands were detected with enhanced chemiluminescence using a Kodak X-ray film processor. Band intensities were measured by densitometry using Image-pro-plus (version 6.0; Media Cybernetics, Silver Spring, MD, USA).

2.9. Statistical analysis All data reported in the text are mean ± SEM of three independent experiments with each in triplicates. Evaluation of the data was carried out using the Statistical Package for Social Sciences (version 15.0, SPSS Inc., Chicago, Illinois, USA). Comparisons between multiple groups were performed with one-way ANOVA post-hoc tests; results for different treatments were compared with control groups using Dunnett's test for statistical comparisons. Significant differences are indicated by *p b 0.05.

3. Results 3.1. QDs characterization As revealed in Fig. 1A, CdTe QDs was separately monodispersed with a diameter of 5.06 ± 0.98 nm. To further characterize the synthesized QDs, absorption and fluorescence spectra of QDs were recorded in PBS. Fig. 1B shows a representative UV/Vis absorption spectrum (380– 700 nm) of QDs as well as fluorescence spectrum (380–700 nm) recorded upon excitation at 340 nm. The synthesized QDs exhibited broad absorption and well-resolved fluorescence spectra. The maximum emission appeared at 530 nm, which indicated a green fluorescence. Furthermore, CdTe QDs could easily accumulated in the subcellular compartments of cells like organelles and vacuoles (Fig. 1C).

Table 1 Sequence of primers for RT-PCR. Gene GAPDH, human Pgp, human

b

Mrp1, humanc Mrp2, humana GAPDH, dog Pgp, dog

b

Mrp1, dogb Mrp2, dogb a

Western blot analysis was conducted as described before (Nguyen et al., 2013). Briefly, membrane proteins were extracted using

13

b c

b

a

Sense Anti-sense Sense Anti-sense Sense Anti-sense Sense Anti-sense Sense Anti-sense Sense Anti-sense Sense Anti-sense Sense Anti-sense

Primer(5′–3′)

Product size (bp)

CCGTCTAGAAAAACCTGCC AGCCAAATTCGTTGTCATACC CCGAACACATTGGAAGGAA CTTTGCCATCAAGCAGCAC AAGGTGGACGAGAACCAGAA AACAGGGCAGCAAACAGAAC GTGTTTCCACAGAGCGGCTAG GCTAGGCTGATATCAAGGAG ATTCCACGGCACAGTCAAG TACTCAGCACCAGCATCACC TTGCTGGTTTTGATGATGGA CTGGACCCTGAATCTTTTGG GGCTCTGCTTCCCCTTCTAC GGATTTTGCCCCAACTTCTT TTGGCTTACTCCTGCCTGTT CCAGTGTCAGAGGTTGCTTG

218

Was obtained from literature (Dietrich et al., 2004). Was obtained from literature (Kuteykin-Teplyakov et al., 2010). Was obtained from (Cai et al., 2014).

217 110 222 117 190 165 187

14

M. Chen et al. / Toxicology and Applied Pharmacology 303 (2016) 11–20

M. Chen et al. / Toxicology and Applied Pharmacology 303 (2016) 11–20

15

3.2. Cytotoxicity of QDs A concentration-dependent decrease in the cell viability of HepG2, MDCK and HK-2 cells were observed after a 24 h exposure of CdTe QDs (Fig. 2). Upon treatment of CdTe QDs, significant toxicity was observed at a concentration of 10 mg/L in HepG2 cells, 5 mg/L in HK-2 and 2.5 mg/L in MDCK cells (*p b 0.05, the sign was not marked in the figure as it could not be seen clearly). 100 mg/L of QDs induced super large portion of death (N80%) for MDCK and HK-2 cells, while the same concentrations of QDs reduced the viability of HepG2 cells to 26.04 ± 4.33% of controls. The LD50 values for MDCK, HK-2, and HepG2 were 16.32, 24.18, and 48.04 mg/L respectively. These results revealed that the cell lines derived from kidneys was more sensitive than that from liver, and HK-2 seemed to be more resistant to the toxicity of CdTe QDs compared to MDCK cells. 3.3. Cellular accumulation of QDs Generally, all the three cell lines exhibited a dose-dependent accumulation of CdTe QDs (Fig. 3). For example, 25 mg/L QDs treatment caused a cellular accumulation of 3.36 ± 0.45 ng QDs per 105 HepG2 cells, and higher concentrations (50 mg/L) of QDs significantly increased the intracellular accumulation within the 24 h treatment (5.15 ± 0.46 ng/105 cells, p b 0.001). Similarly, the cellular accumulation of QDs increased from 3.26 ± 0.35 ng/105 cells to 10.69 ± 1.52 ng/105 cells in HK-2 cells after the treatment of 10–50 mg/L QDs. And the values increased from 4.02 ± 0.35 ng/105 cells to 13.06 ± 1.61 ng/105 cells in MDCK cells. Accordingly, HK-2 and MDCK cells showed higher accumulation of QDs compared to HepG2 cells after the treatment of same concentrations of QDs. For instance, 10 mg/L CdTe QDs resulted in a cellular accumulation of 2.83 ± 0.12 ng/105 cells in HepG2 cells, and the values were 4.49 ± 0.63 ng/105 cells in HK-2 cells and 5.67 ± 0.80 ng/105 cells in MDCK cells. 3.4. Effects of transporter inhibitors and inducers on the cellular accumulation of QDs The accumulation of CdTe QDs co-administered with different transporter inhibitors or inducers were detected to study the role of Pgp and Mrps in protecting cells against QDs. The concentrations of QDs used in this experiment were selected around the LD50 of QDs, which is 50 mg/L in HepG2, 25 mg/L in HK-2 and 15 mg/L in MDCK cells. All the inhibitors and inducers have been proved to cause a concentrationdependent alteration of the activities of Pgp and Mrps in HepG2 and HK-2 cells using Rhodamine 123 and calcein as substrates, but they caused only slight effects in MDCK cells (Fig. S2). Such results also indicated significant activities of Pgp and Mrps in HepG2 and HK-2 cells, but not in MDCK cells. It was observed that inhibitors of ABC transporter significantly enhanced the cellular accumulation of QDs in HepG2 cells and HK-2 cells, in a dose-dependent manner (Fig. 4). For example, co-treatment of 50 mg/L QDs with 100 μM PB caused the intracellular accumulation of 6.02 ± 0.62 ng/105 HepG2 cells, which was significantly higher than that treated by QDs alone (5.15 ± 0.46 ng/105 cells). And the addition of 400 μM PB increased the cellular accumulation to 10.22 ± 0.46 ng/105 cells in HepG2 cells. The most significant accumulation of QDs was found after the addition of 20 μM MK571, which were 12.19 ± 1.31 ng/105 cells in HepG2 cells. In HK-2 cells, 5, 10 and 20 μM CsA resulted in a cellular accumulation of 6.35 ± 1.17, 7.45 ± 0.76, and 7.97 ± 0.38 ng/105 cells, respectively. The most obvious enhancement of cellular accumulation in HK-2 cells was found after the treatment of 10 μM REV, 11.70 ± 0.73 ng/105 cells. The enhancement

Fig. 2. Cytotoxicity of CdTe QDs. HepG2, HK-2 and MDCK cells were treated for 24 h with increasing concentrations of CdTe QDs. Cell viability was given as percentage of untreated controls, which were set 100%, and plotted versus log concertation of QDs. Data represent mean ± SEM of three independent experiments with each in triplicates.

of QD accumulation by MK571 in HepG2 seemed to be slightly higher than that in HK-2 cells (2.36 folds vs. 1.96 folds). As shown in Fig. 5, dose-dependent reduction of cellular accumulation of QDs was found after pre-treatment of RIF. For instance, the pre-treatment of 10 μM RIF caused a cellular accumulation of 3.71 ± 0.12 ng/105 cells in HepG2 cells, but the value decreased to 3.00 ± 0.12 ng/105 cells after the pre-treatment of 25 μM RIF. Similarly, the treatment of 10–50 μM RIF caused a cellular accumulation of 4.58 ± 0.27–3.24 ± 0.11 ng/10 5 cells, which were significantly lower than the cells treated by QDs alone (7.14 ± 0.78 ng/105 cells, *p b 0.05). For MDCK cells, the effects of inhibitors and inducers were much slighter compared to HepG2 and HK-2 cells (Figs. 4C & 5), although significant alteration could also be detected at the highest exerted concentration of inhibitors including CsA and REV. That is, co-treatment of 20 μM CsA and 15 mg/L CdTe QDs caused a cellular accumulation of 8.18 ± 0.25 ng/105 cells compared to 7.35 ± 0.73 ng/105 cells without REV treatment (p b 0.05). In addition, 10 μM REV enhanced the cellular accumulation of QDs to 8.64 ± 0.81 ng/105 cells. 3.5. Induction of ABC transporters in the exposure of QDs and Cd2+ After treatment of QDs, mRNA expressions of Mrp1, Mrp2 and Pgp were respectively detected at 24 and 48 h. As a result, treatment of QDs and Cd2 + resulted in a concentration- and time-dependent increase in expressions of ABC transporters in HepG2 and HK-2 cells (Fig. 6). The abundance of Pgp in HepG2 cells was enriched by a factor of 1.57 ± 0.13 in the exposure of 1 mg/L QDs for 24 h, and the values reached 2.98 ± 0.22 folds of the control levels after the treatment of 1 mg/L QDs for 48 h. As for HK-2 cells, the highest level of Pgp was 3.12 ± 0.21 folds of the control levels, which was obtained after the treatment of 1 mg/L QDs for 48 h. A similar trend was also found for Mrps in HepG2 and HK-2 cells. In addition, mRNA expression of Mrp2 was not found in HK-2 cells, while no ABC transporters were found in MDCK cells except for a weak expression of Pgp (the molar concentration ratio of Pgp to GAPDH was around 0.1 in MDCK cells). And the induction of Pgp in MDCK cells was also very slight, as the mRNA expression of Pgp was only 1.35 ± 0.19 folds of the control levels (p b 0.05) after 48 h treatment of 1 mg/L QDs. In addition, CdCl2 caused

Fig. 1. Characterization of CdTe QDs. (A) Transmission electron micrographs (TEM) of QDs, indicating diameters of the particles; (B) UV/vis absorption (dotted line) and fluorescence emission (spectra solid line) of QDs. Excitation wavelength = 340 nm; (C) accumulation of QDs in HepG2 (left), HK-2 (middle) and MDCK (right) cells. Here showed merged photos of phase-contrast images and corresponding confocal fluorescence images. Original magnification: ×630.

16

M. Chen et al. / Toxicology and Applied Pharmacology 303 (2016) 11–20

Fig. 3. Dose-dependent accumulation of CdTe QDs in HepG2, HK-2 and MDCK cells. Data represent mean ± SEM of three independent experiments with each in triplicates. *p b 0.05, **p b 0.01, and ***p b 0.001 compared with groups treated by 5 mg/L QDs.

lower effects on the expressions of ABC transporters as compared with QDs. For instance, the gene expressions of Mrp1 in HepG2 cells was induced by a factor of 2.37 ± 0.17 in the exposure of 0.1 mg/L Cd2+ for 48 h, and the values were 3.11 ± 0.27 in the same treatment of 1 mg/L QDs (p b 0.001). To further confirm the effects of QDs and Cd2+ on the expressions of ABC transporters, protein levels of Mrp1 and Pgp were subsequently evaluated in HepG2 and HK-2 cells, and the results indicated a concentration-dependent enhancement by 48 h treatment of QDs and Cd2+ (Fig. 7). Generally, the most significant increase of Pgp expression in HepG2 cells was found in the treatment of 1 mg/L QDs, 458.24 ± 71.87% of control levels, which was significantly higher than that by 0.1 mg/L Cd2 (398.41 ± 52.54%, p b 0.05). Meanwhile, Mrp1 exhibited a maximum mean increase of 418.15 ± 50.36% after exposure of 1 mg/L QDs, which was also significant higher than 295.63 ± 45.11%percent induction by 0.1 mg/L Cd2+ (p b 0.01). In HK-2 cells, the most obvious induction of Pgp and Mrp1 was both found in the exposure of 1 mg/L QDs, which were 281.41 ± 61.14% and 314.21 ± 40.81% of control levels respectively. Such values were significantly higher than that by 0.1 mg/L Cd2 + (198.23 ± 41.14% and 253.84 ± 38.23%, p b 0.05), as well.

3.6. Effects of transporter inhibitors and inducers on the toxicity of QDs As shown in Fig. 8, a concentration-dependent enhancement of QDsinduced toxicity by each inhibitor of Pgp and/or Mrps was observed in HepG2 cells and HK-2 cells. For example, cell viability of HepG2 cells after the single treatment of 50 mg/L QDs was 50.69 ± 2.78%, but it decreased to 39.56 ± 6.08% after a co-treatment of 5 μM REV, and this value was further reduced to 32.54 ± 7.41% after addition of 10 μM REV. Similarly, the cell viability was 53.79 ± 3.87% when HK-2 cells were treated by 25 mg/L QDs alone, but it decreased to 42.82 ± 4.99% after a co-treatment of 10 μM CsA, and this value was further reduced to 33.15 ± 5.21% after an addition of 20 μM CsA. The most obvious decrease of cell viability in HepG2 cells was observed when 50 mg/L QDs were co-treated with 20 μM MK571 (12.88 ± 4.31% vs. 50.69 ± 2.78%, p b 0.001). In HK-2 cells, the most significant enhancement of QDsinduced toxicity was also observed when 25 mg/L QDs was co-treated with 20 μM MK571 (24.88 ± 1.31% vs. 53.79 ± 3.87%, p b 0.001). The enhancement of QD toxicity by MK571 in HepG2 seemed to significantly higher than that in HK-2. On the contrary, such phenomenon was barely observed in MDCK cells, except for the co-treatment of 15 mg/L CdTe QDs with 20 μM CsA (39.21 ± 2.40% vs. 50.97 ± 3.93%, p b 0.05) or 10 μM REV (40.04 ± 2.98%, p b 0.05).

Fig. 4. Effects of inhibitors on the accumulation of CdTe QDs. (A) HepG2 cells, (B) HK-2 cells and (C) MDCK cells were exposed to QDs or QDs + inhibitors for 24 h. Data represent mean ± SEM of three independent experiments with each in triplicates. *p b 0.05, **p b 0.01, and ***p b 0.001 compared with groups treated by QDs alone.

As shown in Fig. 9, RIF exhibited a concentration-dependent reduction on the toxicity of CdTe QDs. Pre-treatment of 10 μM RIF before 50 mg/L QDs treatment caused a final cell viability of 72.39 ± 7.30% after 24 h of culture, which was significantly higher than that caused by 50 mg/L QDs alone in HepG2 cells (50.69 ± 2.78%, p b 0.05).

M. Chen et al. / Toxicology and Applied Pharmacology 303 (2016) 11–20

17

Fig. 5. Effects of RIF on the accumulation of CdTe QDs. HepG2, HK-2, and MDCK cells were exposed to RIF for 15 h before the treatment of QDs. QD accumulation was detected as described in Materials and methods. Data represent mean ± SEM of three independent experiments with each in triplicates. QD-control: 50 mg/L for HepG2 cells, 25 mg/L for HK-2 cells, and 15 mg/L for MDCK cells. **p b 0.01, and ***p b 0.001 compared with groups treated by QD-Control.

Furthermore, addition of 50 μM RIF resulted in a final cell viability of 93.08 ± 3.16%. In HK-2 cells, 10 μM RIF significantly decreased the toxicity of 25 mg/L QDs (65.14 ± 4.15% vs. 53.79 ± 3.87%, p b 0.05), and 50 μM RIF caused a much more significant alteration in QDs-treated HK-2 cells (80.71 ± 2.89%, p b 0.001). On the contrary, RIF caused no significant reduction on QDs-induced toxicity in MDCK cells. 4. Discussion Despite a number of long-term studies, there is no certainty on the efflux mechanism of QDs. In vivo studies have revealed that QDs were more preferentially excreted through liver and kidney (Choi et al., 2009), where ABC transporters like Pgp and Mrps played an important role in the elimination of chemicals and drugs (Szakacs et al., 2008; van der Schoor et al., 2015). Here, we further investigated the involvement of ABC transporters in the efflux and toxicity of QDs in different types of cell lines. In this experiment, CdTe QDs exhibited significant accumulation in all three cell lines (Figs. 1C & 3), and the values were determined to be MDCK N HK-2 N HepG2. Among the cell lines studied, HepG2 (Zegers and Hoekstra, 1998; Lee and Piquette-Miller, 2001) and HK-2 cells (Jenkinson et al., 2012) were believed to possess a significant and comprehensive expression of ABC transporters, which were rarely found in wild-type MDCK cells (Horio et al., 1989; Youdim et al., 2004). And HK-2 cells were found to be lack of transporters like Mrp2, which might be also involved in the transportation of QDs (Jenkinson et al., 2012). These observations correlated well with our results (Figs. 6 & S2) and suggested that ABC transporters significantly affected the accumulation and the subsequent toxicity of CdTe QDs. Such assumption was examined by the interaction between QDs and ABC transporters in each cell line. First, the accumulation of QDs could be largely affected by the inhibitors or inducers of ABC transporters in HepG2 and HK-2 cells (Figs. 4 & 5), which was barely found in MDCK cells. These observations were constant with some previous studies, which showed that the inhibitors of efflux transporters increased the accumulation and the toxicity of chemicals to hepatocytes (Susukida et al., 2015), vincristine-resistant human oral cancer cells (Xi et al., 2010) and human renal proximal tubule epithelial cells (Wen et al., 2014). On the other hand, inducers of transporters significantly reduced the cellular accumulation of chemicals in HepG2 cells (Rigalli et al., 2011) and proximal tubule cells of human and mouse (Wen et al., 2014). These chemicals were

Fig. 6. Induction of gene expressions of ABC transporter in HepG2 (A), HK-2 (B) and MDCK cells (C) after exposure to CdTe QDs and CdCl2. The values for each transporter were normalized to GAPDH and expressed relative to the untreated control. Data represent mean ± SEM of three independent experiments. *p b 0.05, **p b 0.01, and ***p b 0.001 compared with untreated control, which was set as 1.0 in this experiment. #p b 0.05, ## p b 0.01, and ###p b 0.001 compared with groups treated by QDs at equivalent concentrations of cadmium.

18

M. Chen et al. / Toxicology and Applied Pharmacology 303 (2016) 11–20

Fig. 7. Effect of CdTe QDs and Cd2+ on the protein expressions of ABC transporters in HepG2 (A) and HK-2 (B). HepG2 and HK-2 cells were treated by QDs and CdCl2 for 48 h, and the protein expression of ABC transporters was analyzed by western blot assay. Transporter expressions were normalized to Na+/K+-ATPase (Na/K-ATPase) and expressed as the percentage of control group using the software Image-pro-plus. *p b 0.05, **p b 0.01, and ***p b 0.001 compared with untreated control. #p b 0.05 and ## p b 0.01 compared with groups treated by QDs at equivalent concentrations of cadmium.

usually considered to be the substrates of ABC transporters, suggesting that both Pgp and Mrps might contribute to resistance towards CdTe QDs On the other hand, it was found that the accumulation of QDs were more significantly affected by MK571 and PB (Figs. 4 & 6), indicating that Mrps might be more important in the efflux of QDs than Pgp. Based on the previous reports, Pgp can actively pump out hydrophobic as well as amphipathic substrates (Kaur et al., 2014). On the contrary, MRPs substrates are relatively hydrophilic compounds like sulfate, glucuronide, and glutathione metabolites (Zamek-Gliszczynski et al., 2006), which might also include the water-soluble QDs used in this experiment. Second, mRNA and protein expressions of Pgp and Mrps in HepG2 and HK-2 cells were significantly induced by CdTe QDs (Figs. 6 & 7). It has been reported that drugs like doxorubicin and chemical toxicants like 3-methylcholanthrene could significantly induce the expression of ABC transporters in HepG2 cells and rat liver epithelial cells, respectively. Such phenomenon was considered to be a general biological defense

Fig. 8. Effects of inhibitors on the toxicity of CdTe QDs. (A) HepG2 cells, (B) HK-2 cells and (C) MDCK cells were exposed to QDs or QDs + inhibitors for 24 h. Cell viability was detected and given as percentage of untreated controls, which were set 100%. Data represent mean ± SEM of three independent experiments with each in triplicates. *p b 0.05, **p b 0.01, and ***p b 0.001 compared with groups treated by QDs alone.

mechanism for the protection of cells against toxicants (Fardel et al., 1996; Komori et al., 2014). Our results correlated well with them and indicated that ABC transporters also played an important role in the

M. Chen et al. / Toxicology and Applied Pharmacology 303 (2016) 11–20

Fig. 9. Effects of RIF on the toxicity of QDs. HepG2, HK-2, and MDCK cells were exposed to RIF for 15 h before the treatment of QDs. Cell viability was detected and given as percentage of untreated controls, which were set 100%. Data represent mean ± SEM of three independent experiments with each in triplicates. QD-control: 50 mg/L for HepG2 cells, 25 mg/L for HK-2 cells, and 15 mg/L for MDCK cells. *p b 0.05, **p b 0.01, and ***p b 0.001 compared with groups treated by QD-Control.

protection of cells against QDs. Upon entering cells, QDs caused a concentration-dependent production of reactive oxygen species (ROS) and the subsequent induction of the expression of Nrf2 (Zhang et al., 2015), which was the key transcriptional factor of antioxidant responsive element-driven genes including Pgp and Mrps (Adachi et al., 2007; Perez et al., 2011). On the other hand, CdSe QDs (Tang et al., 2008) has been reported to cause a concentration-dependent overload of cytoplasmic calcium in hippocampal neurons, which was also believed to be involved in the regulation of Pgp in S2 cells (Luo et al., 2013). All of these effects depend on the accumulation of QDs, which could be an explanation for the concentration-dependent promotion of ABC transporter expressions by QDs. It needs to be mentioned that, Cd2+ were also believed to enhance the expression of ABC transporters in fibroblast cells (Lim et al., 2010) and yeasts (Mielniczki-Pereira et al., 2011), but the effects were less pronounced compared to that of CdTeQDs in this experiment (Figs. 6 & 7), suggesting that the action of CdTeQDs should be a combination of free Cd2+ and other properties of QDs. The involved properties could be the nanoscale effects of nanoparticles, which caused enriched distribution of QDs and Cd2 + in perinuclear areas, and more significant effects of QDs in cells (Adachi et al., 2007). Correspondingly well with the accumulation, the LD50 of QDs were determined to be MDCK N HK-2 N HepG2 cells (Fig. 3). And the toxicity could be significantly altered by the inhibitors and inducers of ABC transporters in HepG2 and HK-2 cells as well (Figs. 7 & 8). It seemed that the ABC transporter-mediated efflux of QDs could an important modulator of the QDs-induced toxicity. As revealed by Su et al. (2010), the cytotoxicity of CdTe QDs should be the combined effects of released Cd2 + and the nanoscale effect of QDs. Such a phenomenon was also found in this experiment as the toxicity of QDs was significantly higher than that of CdCl2 at equivalent concentrations of cadmium (Supplementary Table S1). And ABC transporters were believed to be important modulators for the cellular accumulation of Cd2+ in zebrafish embryos and human cells respectively (Lee et al., 2011; Yin et al., 2015). In this respect, the modulation of QDs toxicity by ABC transporters could be attributed to the combination of the efflux of Cd2+ and QDs together. As for MDCK cells, its low expression of ABC transporters could be an important reason for the higher accumulation of QDs and the weaker effects of corresponding inhibitors and inducers. Besides ABC transporters examined in this experiment, the roles of other transport or metabolic pathways cannot be ignored as well. For example, X-AG cysteine transporter was found to be important in the uptake of cysteine-functionalized QDs (Al-Hajaj et al., 2011). As the amino transporters are usually bidirectional, it is possible that they

19

could also be involved in the excretion of QDs. Besides, oxidative stress was also involved in the toxicity of QDs (Park et al., 2012; Nguyen et al., 2013; Qu et al., 2013), it was probable that anti-oxidant system including glutathione and glutathione-related enzymes were important in the detoxification of such chemical toxicants (Nguyen et al., 2013). Furthermore, metallothioneins were believed to protect against Cd by forming complex with Cd for the subsequent elimination (Cartularo et al., 2015), which could affect the cytotoxicity of QDs, as well. The role of these elements warrants further examination. Overall, the data reported here showed strong evidence that ABC transporters were involved in the cellular efflux and toxicity of CdTe QDs in liver and kidney cells. And the efflux of QDs could be an effective modulator for the toxicity of QDs. However, we only investigated one type of QDs which could be pumped out by ABC transporters, while the relationship between ABC transporters and other types of QDs, with various chemical compositions, different sizes and surface coatings, still needs some further investigations. Moreover, since the effects of free Cd2+ could only partially explain the inductive effects of CdTeQDs on ABC transporters, the involvement of other properties should be studied in the future experiment. Transparency document The Transparency document associated with this article can be found, in online version. Acknowledgement This work was supported by grants from the National Natural Science Foundation of China (No. 21307154 & 31400847), Natural Science Foundation of Jiangsu Province (No·BK20140376), Industry-University Collaboration Project of Jiangsu Province (No.·BY2014063), and partly by the Hi-Tech Research and Development (863) Program of China (No. 2014AA020905). Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.taap.2016.04.017. References Adachi, T., Nakagawa, H., Chung, I., Hagiya, Y., Hoshijima, K., Noguchi, N., Kuo, M.T., Ishikawa, T., 2007. Nrf2-dependent and -independent induction of ABC transporters ABCC1, ABCC2, and ABCG2 in HepG2 cells under oxidative stress. J. Exp. Ther. Oncol. 6, 335–348. Al-Hajaj, N.A., Moquin, A., Neibert, K.D., Soliman, G.M., Winnik, F.M., Maysinger, D., 2011. Short ligands affect modes of QD uptake and elimination in human cells. ACS Nano 5, 4909–4918. Cai, J., Chen, S., Zhang, W., Zheng, X., Hu, S., Pang, C., Lu, J., Xing, J., Dong, Y., 2014. Salvianolic acid A reverses paclitaxel resistance in human breast cancer MCF-7 cells via targeting the expression of transgelin 2 and attenuating PI3 K/Akt pathway. Phytomedicine 21, 1725–1732. Cartularo, L., Laulicht, F., Sun, H., Kluz, T., Freedman, J.H., Costa, M., 2015. Gene expression and pathway analysis of human hepatocellular carcinoma cells treated with cadmium. Toxicol. Appl. Pharmacol. 288, 399–408. Cho, S.J., Maysinger, D., Jain, M., Roder, B., Hackbarth, S., Winnik, F.M., 2007. Long-term exposure to CdTe quantum dots causes functional impairments in live cells. Langmuir: ACS J. Surf. Colloids 23, 1974–1980. Choi, H.S., Ipe, B.I., Misra, P., Lee, J.H., Bawendi, M.G., Frangioni, J.V., 2009. Tissue- and organ-selective biodistribution of NIR fluorescent quantum dots. Nano Lett. 9, 2354–2359. Dietrich, C.G., Geier, A., Salein, N., Lammert, F., Roeb, E., Oude Elferink, R.P., Matern, S., Gartung, C., 2004. Consequences of bile duct obstruction on intestinal expression and function of multidrug resistance-associated protein 2. Gastroenterology 126, 1044–1053. Fardel, O., Lecureur, V., Corlu, A., Guillouzo, A., 1996. P-glycoprotein induction in rat liver epithelial cells in response to acute 3-methylcholanthrene treatment. Biochem. Pharmacol. 51, 1427–1436. Furugen, A., Yamaguchi, H., Tanaka, N., Shiida, N., Ogura, J., Kobayashi, M., Iseki, K., 2013. Contribution of multidrug resistance-associated proteins (MRPs) to the release of prostanoids from A549 cells. Prostaglandins Other Lipid Mediat. 106, 37–44.

20

M. Chen et al. / Toxicology and Applied Pharmacology 303 (2016) 11–20

Hardman, R., 2006. A toxicologic review of quantum dots: toxicity depends on physicochemical and environmental factors. Environ. Health Perspect. 114, 165–172. Horio, M., Chin, K.V., Currier, S.J., Goldenberg, S., Williams, C., Pastan, I., Gottesman, M.M., Handler, J., 1989. Transepithelial transport of drugs by the multidrug transporter in cultured Madin-Darby canine kidney cell epithelia. J. Biol. Chem. 264, 14880–14884. Hoshino, A., Manabe, N., Fujioka, K., Suzuki, K., Yasuhara, M., Yamamoto, K., 2007. Use of fluorescent quantum dot bioconjugates for cellular imaging of immune cells, cell organelle labeling, and nanomedicine: surface modification regulates biological function, including cytotoxicity. J. Artif. Organs 10, 149–157. Jenkinson, S.E., Chung, G.W., van Loon, E., Bakar, N.S., Dalzell, A.M., Brown, C.D., 2012. The limitations of renal epithelial cell line HK-2 as a model of drug transporter expression and function in the proximal tubule. Pflugers Arch. 464, 601–611. Kaur, V., Garg, T., Rath, G., Goyal, A.K., 2014. Therapeutic potential of nanocarrier for overcoming to P-glycoprotein. J. Drug Target. 22, 859–870. Komori, Y., Arisawa, S., Takai, M., Yokoyama, K., Honda, M., Hayashi, K., Ishigami, M., Katano, Y., Goto, H., Ueyama, J., Ishikawa, T., Wakusawa, S., 2014. Ursodeoxycholic acid inhibits overexpression of P-glycoprotein induced by doxorubicin in HepG2 cells. Eur. J. Pharmacol. 724, 161–167. Kuteykin-Teplyakov, K., Luna-Tortos, C., Ambroziak, K., Loscher, W., 2010. Differences in the expression of endogenous efflux transporters in MDR1-transfected versus wildtype cell lines affect P-glycoprotein mediated drug transport. Br. J. Pharmacol. 160, 1453–1463. Lee, G., Piquette-Miller, M., 2001. Influence of IL-6 on MDR and MRP-mediated multidrug resistance in human hepatoma cells. Can. J. Physiol. Pharmacol. 79, 876–884. Lee, W.K., Torchalski, B., Kohistani, N., Thevenod, F., 2011. ABCB1 protects kidney proximal tubule cells against cadmium-induced apoptosis: roles of cadmium and ceramide transport. Toxicol. Sci.: Off. J. Soc. Toxicol. 121, 343–356. Lemmen, J., Tozakidis, I.E., Galla, H.J., 2013. Pregnane X receptor upregulates ABCtransporter Abcg2 and Abcb1 at the blood-brain barrier. Brain Res. 1491, 1–13. Li, J., Zhuan, Z., Jiang, B., Zhao, P., Lin, C., 2015. Advances and perspectives in nanoprobes for noninvasive lymph node mapping. Nanomedicine (London) 10, 1019–1036. Lim, S.C., Hahm, K.S., Lee, S.H., Oh, S.H., 2010. Autophagy involvement in cadmium resistance through induction of multidrug resistance-associated protein and counterbalance of endoplasmic reticulum stress WI38 lung epithelial fibroblast cells. Toxicology 276, 18–26. Luckenbach, T., Fischer, S., Sturm, A., 2014. Current advances on ABC drug transporters in fish. Comp. Biochem. Physiol., Part C: Toxicol. Pharmacol. 165, 28–52. Luna-Tortos, C., Fedrowitz, M., Loscher, W., 2010. Evaluation of transport of common antiepileptic drugs by human multidrug resistance-associated proteins (MRP1, 2 and 5) that are overexpressed in pharmacoresistant epilepsy. Neuropharmacology 58, 1019–1032. Luo, L., Sun, Y.J., Yang, L., Huang, S., Wu, Y.J., 2013. Avermectin induces P-glycoprotein expression in S2 cells via the calcium/calmodulin/NF-kappaB pathway. Chem. Biol. Interact. 203, 430–439. Martin, P., Riley, R., Back, D.J., Owen, A., 2008. Comparison of the induction profile for drug disposition proteins by typical nuclear receptor activators in human hepatic and intestinal cells. Br. J. Pharmacol. 153, 805–819. Mielniczki-Pereira, A.A., Hahn, A.B., Bonatto, D., Riger, C.J., Eleutherio, E.C., Henriques, J.A., 2011. New insights into the Ca2+-ATPases that contribute to cadmium tolerance in yeast. Toxicol. Lett. 207, 104–111. Monras, J.P., Collao, B., Molina-Quiroz, R.C., Pradenas, G.A., Saona, L.A., Duran-Toro, V., Ordenes-Aenishanslins, N., Venegas, F.A., Loyola, D.E., Bravo, D., Calderon, P.F., Calderon, I.L., Vasquez, C.C., Chasteen, T.G., Lopez, D.A., Perez-Donoso, J.M., 2014. Microarray analysis of the Escherichia coli response to CdTe-GSH Quantum Dots: understanding the bacterial toxicity of semiconductor nanoparticles. BMC Genomics 15, 1099. Nguyen, K.C., Willmore, W.G., Tayabali, A.F., 2013. Cadmium telluride quantum dots cause oxidative stress leading to extrinsic and intrinsic apoptosis in hepatocellular carcinoma HepG2 cells. Toxicology 306, 114–123. Nurunnabi, M., Khatun, Z., Huh, K.M., Park, S.Y., Lee, D.Y., Cho, K.J., Lee, Y.K., 2013. In vivo biodistribution and toxicology of carboxylated graphene quantum dots. ACS Nano 7, 6858–6867. Park, J., Song, W.Y., Ko, D., Eom, Y., Hansen, T.H., Schiller, M., Lee, T.G., Martinoia, E., Lee, Y., 2012. The phytochelatin transporters AtABCC1 and AtABCC2 mediate tolerance to cadmium and mercury. Plant J. 69, 278–288. Peng, H., Zhang, L., Kjallman, T.H., Soeller, C., Travas-Sejdic, J., 2007. DNA hybridization detection with blue luminescent quantum dots and dye-labeled single-stranded DNA. J. Am. Chem. Soc. 129, 3048–3049. Perez, M.J., Gonzalez-Sanchez, E., Gonzalez-Loyola, A., Gonzalez-Buitrago, J.M., Marin, J.J., 2011. Mitochondrial genome depletion dysregulates bile acid- and paracetamolinduced expression of the transporters Mdr1, Mrp1 and Mrp4 in liver cells. Br. J. Pharmacol. 162, 1686–1699. Qu, G., Wang, X., Wang, Z., Liu, S., Jiang, G., 2013. Cytotoxicity of quantum dots and graphene oxide to erythroid cells and macrophages. Nanoscale Res. Lett. 8, 198.

Rigalli, J.P., Ruiz, M.L., Perdomo, V.G., Villanueva, S.S., Mottino, A.D., Catania, V.A., 2011. Pregnane X receptor mediates the induction of P-glycoprotein by spironolactone in HepG2 cells. Toxicology 285, 18–24. Sharom, F.J., Yu, X., Lu, P., Liu, R., Chu, J.W., Szabo, K., Muller, M., Hose, C.D., Monks, A., Varadi, A., Seprodi, J., Sarkadi, B., 1999. Interaction of the P-glycoprotein multidrug transporter (MDR1) with high affinity peptide chemosensitizers in isolated membranes, reconstituted systems, and intact cells. Biochem. Pharmacol. 58, 571–586. Su, Y., Hu, M., Fan, C., He, Y., Li, Q., Li, W., Wang, L.H., Shen, P., Huang, Q., 2010. The cytotoxicity of CdTe quantum dots and the relative contributions from released cadmium ions and nanoparticle properties. Biomaterials 31, 4829–4834. Susukida, T., Sekine, S., Ogimura, E., Aoki, S., Oizumi, K., Horie, T., Ito, K., 2015. Basal efflux of bile acids contributes to drug-induced bile acid-dependent hepatocyte toxicity in rat sandwich-cultured hepatocytes. Toxicol. in Vitro 29, 1454–1463. Szakacs, G., Varadi, A., Ozvegy-Laczka, C., Sarkadi, B., 2008. The role of ABC transporters in drug absorption, distribution, metabolism, excretion and toxicity (ADME-Tox). Drug Discov. Today 13, 379–393. Tang, M., Xing, T., Zeng, J., Wang, H., Li, C., Yin, S., Yan, D., Deng, H., Liu, J., Wang, M., Chen, J., Ruan, D.Y., 2008. Unmodified CdSe quantum dots induce elevation of cytoplasmic calcium levels and impairment of functional properties of sodium channels in rat primary cultured hippocampal neurons. Environ. Health Perspect. 116, 915–922. Tang, S., Allagadda, V., Chibli, H., Nadeau, J.L., Mayer, G.D., 2013. Comparison of cytotoxicity and expression of metal regulatory genes in zebrafish (Danio rerio) liver cells exposed to cadmium sulfate, zinc sulfate and quantum dots. Metallomics: Integrated Biometal Sci. 5, 1411–1422. Valizadeh, A., Mikaeili, H., Samiei, M., Farkhani, S.M., Zarghami, N., Kouhi, M., Akbarzadeh, A., Davaran, S., 2012. Quantum dots: synthesis, bioapplications, and toxicity. Nanoscale Res. Lett. 7, 480. van der Schoor, L.W., Verkade, H.J., Kuipers, F., Jonker, J.W., 2015. New insights in the biology of ABC transporters ABCC2 and ABCC3: impact on drug disposition. Expert Opin. Drug Metab. Toxicol. 11, 273–293. Wegner, K.D., Hildebrandt, N., 2015. Quantum dots: bright and versatile in vitro and in vivo fluorescence imaging biosensors. Chem. Soc. Rev. 44, 4792–4834. Wen, X., Gibson, C.J., Yang, I., Buckley, B., Goedken, M.J., Richardson, J.R., Aleksunes, L.M., 2014. MDR1 transporter protects against paraquat-induced toxicity in human and mouse proximal tubule cells. Toxicol. Sci. 141, 475–483. Wilkening, S., Bader, A., 2003. Influence of culture time on the expression of drugmetabolizing enzymes in primary human hepatocytes and hepatoma cell line HepG2. J. Biochem. Mol. Toxicol. 17, 207–213. Xi, G.M., Sun, B., Jiang, H.H., Kong, F., Yuan, H.Q., Lou, H.X., 2010. Bisbibenzyl derivatives sensitize vincristine-resistant KB/VCR cells to chemotherapeutic agents by retarding P-gp activity. Bioorg. Med. Chem. 18, 6725–6733. Ye, L., Yang, X., Yang, Z., Gao, S., Yin, T., Liu, W., Wang, F., Hu, M., Liu, Z., 2013. The role of efflux transporters on the transport of highly toxic aconitine, mesaconitine, hypaconitine, and their hydrolysates, as determined in cultured Caco-2 and transfected MDCKII cells. Toxicol. Lett. 216, 86–99. Yi, X., Wang, F., Qin, W., Yang, X., Yuan, J., 2014. Near-infrared fluorescent probes in cancer imaging and therapy: an emerging field. Int. J. Nanomedicine 9, 1347–1365. Yin, J., Li, D., Hu, W., Meng, Q., 2008. Effects of glycyrrhizic acid on cocklebur-induced hepatotoxicity in rat and human hepatocytes. Phytother. Res. 22, 395–400. Yin, H., Bai, P., Miao, P., Chen, M., Hu, J., Deng, X., Yin, J., 2015. Functional expressions of adenosine triphosphate-binding cassette transporters during the development of zebrafish embryos and their effects on the detoxification of cadmium chloride and beta-naphthoflavone. J. Appl. Toxicol (on line) http://dx.doi.org/10.1002/jat.3225. Youdim, K.A., Qaiser, M.Z., Begley, D.J., Rice-Evans, C.A., Abbott, N.J., 2004. Flavonoid permeability across an in situ model of the blood-brain barrier. Free Radic. Biol. Med. 36, 592–604. Zamek-Gliszczynski, M.J., Hoffmaster, K.A., Nezasa, K., Tallman, M.N., Brouwer, K.L., 2006. Integration of hepatic drug transporters and phase II metabolizing enzymes: mechanisms of hepatic excretion of sulfate, glucuronide, and glutathione metabolites. Eur. J. Pharm. Sci. 27, 447–486. Zegers, M.M., Hoekstra, D., 1998. Mechanisms and functional features of polarized membrane traffic in epithelial and hepatic cells. Biochem. J. 336 (Pt 2), 257–269. Zhang, L.W., Monteiro-Riviere, N.A., 2009. Mechanisms of quantum dot nanoparticle cellular uptake. Toxicol. Sci. 110, 138–155. Zhang, T., Hu, Y., Tang, M., Kong, L., Ying, J., Wu, T., Xue, Y., Pu, Y., 2015. Liver toxicity of cadmium telluride quantum dots (CdTe QDs) due to oxidative stress in vitro and in vivo. Int. J. Mol. Sci. 16, 23279–23299. Zhu, X.Q., Jiang, S.S., Zhu, X.J., Zou, S.W., Wang, Y.H., Hu, Y.C., 2009. Expression of aquaporin 1 and aquaporin 3 in fetal membranes and placenta in human term pregnancies with oligohydramnios. Placenta 30, 670–676.