ABCB4 Heterozygous Gene Mutations Associated With Fibrosing Cholestatic Liver Disease in Adults

GASTROENTEROLOGY 2008;135:131–141

ABCB4 Heterozygous Gene Mutations Associated With Fibrosing Cholestatic Liver Disease in Adults MARIANNE ZIOL,*,‡ VÉRONIQUE BARBU,§,㛳 OLIVIER ROSMORDUC,¶,㛳 ANNONCIADE FRASSATI–BIAGGI,* NATHALIE BARGET,*,# BRIGITTE HERMELIN,§,㛳 GEORGES L. SCHEFFER,** SELMA BENNOUNA,# JEAN–CLAUDE TRINCHET,#,‡‡ MICHEL BEAUGRAND,#,‡‡ and NATHALIE GANNE–CARRIÉ#,‡‡

Background & Aims: Adenosine triphosphate-binding cassette subfamily B, member 4 (ABCB4) mutations have not been investigated in patients with unexplained cholestasis. We aimed to investigate ABCB4 mutations in adult patients with unexplained anicteric cholestasis and to describe liver injury associated with ABCB4 mutations. Methods: Between February 2004 and March 2007, all adults with unexplained cholestasis despite multiple investigations including liver biopsy and 124 healthy volunteers had ABCB4 sequencing. Fibrosis, bile duct lesions, inflammatory infiltrate, activation of myofibroblasts and multidrug-resistant P-glycoprotein 3 (MDR3) immunostaining were assessed on patients’ liver biopsy specimens. Results: Thirty-two patients were included (23 females, 16 – 69 years of age). Eight different ABCB4 heterozygous mutations were found in 11 patients (34%). Seven of these mutations (exons 4, 6, 14, 18, 23) were never detected in the control group. One mutation (exon 15) was detected in 4 patients (12.5%) and 4 controls (3%). At the time of liver biopsy, the main clinical and biologic characteristics were similar in the 32 patients regardless of ABCB4 mutation. The histologic pattern in patients with a mutation consisted of portal fibrosis with ductular reaction and strong macrophagic infiltrate of portal tracts without significant periportal and lobular necroinflammatory lesions or cholangitis. Fibrosis score and macrophagic infiltration of portal tracts were significantly increased in patients with ABCB4 mutation (P ⴝ .01). Absence or reduced MDR3 canalicular immunostaining was demonstrated in all patients with ABCB4 mutations tested. Conclusions: Heterozygous ABCB4 mutations were detected in 34% of adults with unexplained cholestasis, for the most part without biliary symptoms, and could result in significant liver fibrosis.

B

ile compounds are actively secreted from hepatocytes by different members of the adenosine triphosphate-binding-cassette superfamily at the canalicular

membrane. The multidrug-resistant P-glycoprotein 3 (MDR3) encoded by the adenosine triphosphate-binding cassette subfamily B, member 4 (ABCB4) gene is one of the bile salts transporters and acts as a phospholipid flippase.1,2 According to animals studies,2– 4 ABCB4 gene mutations lead to the production of bile with low biliary phospholipid content, increased lithogenicity, and high detergent power, which causes damage to the luminal membrane of the hepatobiliary system. ABCB4 gene mutations result in a spectrum of cholestatic liver diseases starting in neonatal life or in late adulthood and including progressive familial intrahepatic cholestasis type 3 (PFIC3),5,6 low phospholipid-associated cholelithiasis (LPAC),7,8 and intrahepatic cholestasis of pregnancy (ICP).9 –13 PFIC3 is an autosomal recessive liver disorder of childhood characterized by high serum ␥-glutamyltransferase activity and, histologically, by ductular reaction and portal inflammatory infiltrate in the early stages without ductopenia or bile duct lesions. At a later stage, between 4 and 13 years of age, portal fibrosis develops and can lead to biliary cirrhosis.6 LPAC syndrome has been defined by clinical features including at least 2 of the following: under 40 years of age at the first onset of cholelithiasis symptoms, recurrence of symptoms after cholecystectomy, intrahepatic hyperechogenic foci, sludge, or microlithiasis.7,8 ICP is characterized by the occurrence of cholestasis in the third trimester of pregnancy in women with an otherwise normal medical history. Family observations of typical episodes of ICP in heterozygous mothers of children with PFIC3 provide arguments for a link between ABCB4 gene defect and ICP.9 On aggregate, ABCB4 mutations reportedly account for up to 15% of all ICP.9 –13 Abbreviations used in this paper: ABCB4, adenosine triphosphatebinding cassette, subfamily B, member 4; DAMs, disease-associated mutations; ICP, intrahepatic cholestasis of pregnancy; LPAC, low phospholipid-associated cholelithiasis; MDR3, multidrug-resistant P-glycoprotein 3; PFIC3, progressive familial intrahepatic cholestasis type 3. © 2008 by the AGA Institute 0016-5085/08/$34.00 doi:10.1053/j.gastro.2008.03.044

CLINICAL–LIVER, PANCREAS, AND BILIARY TRACT

*Laboratoire d’anatomie et de cytologie pathologique, AP-HP Hôpital Jean Verdier, Bondy, France; ‡UPRES EA3406, Université Paris 13, Bobigny, France; § Laboratoire Commun de Biologie et Génétique Moléculaires, AP-HP Hôpital Saint-Antoine, Paris, France; 㛳UMPC Univ Paris 06, UMRS-893, Paris, France; ¶Service d’Hépatologie, AP-HP Hôpital Saint-Antoine, Paris, France; #Service d’Hépato-Gastroenterologie, AP-HP Hôpital Jean Verdier, Bondy, France; **Department of Pathology, VU Medical Center, Amsterdam, The Netherlands; and ‡‡UPRES EA3409, Université Paris 13, Bobigny, France;

132

ZIOL ET AL

In adults, the extent and outcome of liver histologic injury associated with ABCB4 mutations have been rarely reported. To our knowledge, only 5 cases with a liver biopsy have been reported in adults.6,7,14 So far, ABCB4 mutations have never been investigated in patients with unexplained chronic cholestasis. In this study, we aimed to (1) investigate ABCB4 mutations in adults with unexplained chronic anicteric cholestasis and (2) describe liver injury associated with ABCB4 mutations.

Patients and Methods Patients

CLINICAL–LIVER, PANCREAS, AND BILIARY TRACT

Between February 2004 and March 2007, all consecutive patients referred to our liver unit for chronic unexplained anicteric cholestasis including those who had previously undergone investigations were systematically investigated for ABCB4 gene sequencing after providing informed written consent. Unexplained anicteric cholestasis was defined by normal serum bilirubin levels with increased serum alkaline phosphatase and/or ␥-glutamyl transpeptidases more than 1.5 times the upper limit of normal values in the absence of (1) drug intake; (2) daily alcohol intake ⬎40 g/day; (3) serum hepatitis B virus surface antigen, serum antibodies against hepatitis C virus and human immunodeficiency virus; (4) imaging abnormalities of the biliary tree assessed by either biliary endoscopic ultrasonography, biliary magnetic resonance imaging, or cholangiography; (5) serum antimitochondria M2, antinuclear, and pANCA antibodies. Furthermore, all patients enrolled had an available liver biopsy and no explanation for cholestasis such as florid destructive chronic cholangitis,15 sclerosing cholangitis, granulomatous hepatitis, or nonalcoholic steatohepatitis. At the time of gene sequencing, all patients underwent an abdominal ultrasonography to assess specifically the presence of intrahepatic hyperechogenic foci, sludge, or microlithiasis.

ABCB4 Gene Sequencing ABCB4 gene screening was done using polymerase chain reaction (PCR) amplification and DNA sequencing of exons 2 to 28 and all splice junctions. In addition, to assess the frequency of mutations in the general population, the 6 exons involved by mutations in the selected patients were sequenced in a control group of 124 healthy volunteers matched for sex (female, 65%), age (mean, 39 years; range, 17– 82 years), and ethnic background (white, 100%). Genomic DNA was obtained from peripheral white blood cells using standard procedures. We designed specific primers to amplify exons and splice junctions using the Massachusetts Institute of Technology website (Table 1). Each PCR contained 200-ng genomic DNA, with each primer at a concentration of 0.4 ␮mol/L, 0.08 ␮mol/L deoxynucleoside triphosphates (Pharmacia, Piscataway, NJ), 1.5 mmol/L magnesium

GASTROENTEROLOGY Vol. 135, No. 1

Table 1. Primer Pairs Used for Amplification of the ABCB4 Coding Exons, 2 to 28 Exon

Forward primer (5=¡3=)

Reverse primer (5=¡3=)

2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28

GGAGAGGGTGTACTTGG CTTTGTAGTACCTTCGACAG GAGGAGAAATTCCATTCCAC TAAAAACCTGGCAATGCC GCTGCCAGATGATCGATTTC GTTTGTTGGATGTCTACTTC GTGCCTTTAAACTTTTCTCC GCCGAGTGTGACTCGGAC CTATGTTACATATACATCAC GACATTCCAGGTCCTATTTTTGG CAAACTGAATCGAATTATTCCC GGTAGGATGTTTTTCATG GACAAAGCTCCATGTTGTC ATCCAAGTGCTTAACTGTG TACATCCATTTGGAGACAC GCCTTTTCTATGTCTACAG CTCAAGCCACTATTTATGAG CAACTCATAACTTTGCTAC GGTCTCCCCTAAATTTCCTC GCTGGAGCGCATGCATTTG CTTGAACAGATTATGCCTTTGG CTTAAACCCACTCGGCC GACTTTCAAACATCATGGAG CTGGCACCAGAACTATACC GAAGCTGCTGACACCC AATAGAACTGTCAACTGTTAAGC GATTAGAAAGGTAACATTTTC

AGGCATCAACCGATTTTTAC TTGTGCTCAAGCAACCCTCC CAACTCCCAAATTTTTACCC MAACTCTGTAATTGGAAATTATC CCATCATGGAGCTCATCACTT CCTGAACAGGTACAAGTACG CGAGAAGGGTTAATATTAGG GGTCTAACCACATGCTATTTTC GTACAACTTATTCAATGTAGTTG AGGAAAAGGCACATAAGTATC GCTTGGTTCTTCCCACTTAC CCTTTGAAGAATAAACTCAG CTGTTTCTCAGCCCAGACTC GTATAGCATTCACTGGATC GCAAGGCTAAGAATTTC AGAAGCAGCAGCTGATG AGAATTTGGAAGCTCCATTAG CATGCATATCGACATAACAATAAG CAAGTGTGGGTATGCTACATG GTTGTAGTGGGCACAAA TCCTAGTCACATCAAAAAGC CACAGGAGTCATTTTTTTCCTAC CTTATCCTGTAGCTATAATC ATTATGACAATATTGGTTGGGC GAAGTGCCTTGTCCAAGTTG TTTTCCCCCTGTGCTTG GGGTCTTCTAAATTGATC

chloride, and 1.25 U Taq polymerase. PCR products were purified on a Sephadex (Pharmacia) column and sequenced with Big Dye Terminator Chemistry (Applied Biosystems, Applera France S.A., Courtaboeuf, France). Identification and localization of ABCB4 gene mutations and single nucleotide polymorphisms were assessed by sequence comparisons with SeqScape Software (version 2.5; Applied Biosystems).

Histologic Analysis Picrosirius red and H&E and safran stained liver biopsy sections were reassessed by 2 pathologists (M.Z. and A.F.B.) unaware of the sequencing analysis results. In addition, paraffin-embedded liver biopsy sections were immunostained using anti-␣-smooth muscle cell actin, cytokeratin 19, CD15, and CD68 monoclonal antibodies (Dako, Glostrup, Denmark) after heat-induced antigen retrieval in 0.01 mmol/L EDTA buffer at pH 8 as previously described16 with 3,3=-diaminobenzidine tetrahydrochloride (DAB) as the chromogen. The following criteria were assessed: Portal fibrosis was graded according to the Ishak scoring system17 on picrosirius red-stained sections. Significant fibrosis was defined as an Ishak fibrosis score strictly above 2 (ie, fibrous expansion of most portal tracts with portal to portal bridging). The peculiar aspect of biliary type fibrosis defined as a jigsaw pattern of portal fibrosis was reported when present. Ductopenia was defined as a loss of more than 50% of bile ducts when more than 10 portal tracts were observed. Ductular reaction was evaluated on cytokeratin 19 immunostained sections and recorded as absent or present when most portal tracts exhibited ductular reaction. Bile duct lesions

July 2008

ABCB4 HETEROZYGOUS MUTATION

133

Table 2. Main Characteristics of Patients at the Time of Liver Biopsy According to ABCB4 Gene Sequencing

Sex, male/female Age, mean (range) Number of patients ⱕ40 y Body mass index, mean ⫾ SD (kg/m2) Alkaline phosphatases, mean ⫾ SD (IU/L, ULN ⬍110) ␥-Glutamyl Transferase (IU/L, ULN ⬍45) Alanine aminotransferases (IU/L, ULN ⬍40) Medical history before or at liver biopsy Cholecystectomy for symptomatic gallstone (total/before 40 y of age) Recurrent symptoms after cholecystectomy Intrahepatic microlithiasis Complete LPAC syndrome Clinical history of ICP or hormonal triggered cholestasis

ABCB4 point mutation, n ⫽ 11

No ABCB4 point mutation, n ⫽ 21

3/8 38 (16 ⫾ 57) 5 24 ⫾ 4 165 ⫾ 118 214 ⫾ 176 227 ⫾ 345

6/15 42 (16 ⫾ 69) 12 25 ⫾ 4 186 ⫾ 131 320 ⫾ 514 97 ⫾ 105

4/2 2 2 1 3

8/5 2 4 3 3

P valuea .9 .4 .5 .4 .3 .2 .9/.9 .9 .9 .9 .9

were graded as absent or slight when only mild lymphocytic exocytosis was observed. Patients with florid destructive lesions of bile duct defined by alteration of biliary epithelial cells with disruption of bile duct basement membrane15 had been already excluded from the study. Portal polymorphonuclear and macrophages infiltration was assessed on CD15 and CD68 immunostained sections, respectively, as absent or mild when scarce infiltrate was observed and marked when numerous cells were detected in portal tracts. For the assessment of myofibroblastic transformation, ␣-smooth muscle cell actin immunostaining was semiquantitatively evaluated as previously described by separately taking into account portal or septal areas and zone 1,2,3 expression.18

MDR3 Immunostaining Part of the liver biopsy exceeding 20 mm was immediately snap frozen in liquid nitrogen and stored at ⫺80°C. MDR3 immunostaining was performed using monoclonal antibody (P3II-26) provided by Dr Scheffer.19 Briefly, tissue sections (5 micrometers thick) were cut in cryostat and placed on poly-L-Lysine coated glass slides fixed in aceton for 10 minutes and air-dried. Sections were incubated for 1 hour with the primary antibody (dilution, 1/10) at room temperature after inhibition of endogenous peroxydases. Binding was detected using the Envision system (Dako, Glostrup, Denmark) and DAB as chromogen. To check tissue immune reactivity, we used a monoclonal antibody directed against another MDR transporter protein, MRP2 (clone M2III-6 provided by Dr Scheffer).

Statistical Analysis The characteristics of patients with and without ABCB4 mutations were compared using ␹2 test or Fisher exact test for noncontinuous variables and nonparametric Mann–Whitney test for continuous data. All tests were

performed using Statview (SAS Institute, Cary, NC). Significance was accepted when P ⬍ .05.

Results Individuals From February 2004 to March 2007, 32 white patients (23 females, 16 – 69 years of age) were selected for ABCB4 gene molecular study. None were relatives, except 2 (mother and daughter). Twelve had prior investigations for cholestasis (mean follow-up before enrolment: 64 months [range, 1.5–250]). The main clinical and biologic characteristics of patients according to ABCB4 mutations at the time of liver biopsy are summarized in Table 2. Age, sex, body mass index, liver enzymes abnormalities, and medical history regarding cholelithiasis symptoms did not differ in patients with or without ABCB4 mutation. None of the patients had prophylactic treatment with ursodesoxycholic acid (UDCA) at the time of liver biopsy.

Characterization of ABCB4 Gene Mutations For the purpose of this study, only ABCB4 sequence alterations that led to premature truncation of the protein, small deletions, insertions, and missense mutations were considered as potential disease-associated mutations (DAMs). Eight different heterozygous point mutations were identified in 11 patients (Table 3). As described in Figure 1, 3 (T175A, R590Q, A934T) have been previously described in patients with LPAC or ICP.8,13 Conversely, 5 (R47X, V526F, A539T, R545G, I738L) have not been previously described.20 The frequency of each mutation is indicated in Figure 1. Three patients were compound heterozygotes; 2 of them were relatives and had the same mutations. Seven out of the 8 point mutations were never detected in the control group. The c.1769G⬎A (R590Q) mutation in exon 15

CLINICAL–LIVER, PANCREAS, AND BILIARY TRACT

ULN, upper limit of normal value; ICP, intrahepatic cholestasis of pregnancy; LPAC, low phospholipids-associated cholelithiasis. aMean values were compared using Mann–Whitney test and categories using ␹2 test or Fisher exact test.

134

ZIOL ET AL

GASTROENTEROLOGY Vol. 135, No. 1

CLINICAL–LIVER, PANCREAS, AND BILIARY TRACT

Figure 1. Summary of the mutations identified in our patients with unexplained cholestasis and of the known mutations described in patients with progressive familial intrahepatic cholestasis type 3 (PFIC3), low phospholipid associated cholelithiasis (LPAC) syndrome, and intrahepatic cholestasis of pregnancy (ICP). The frequency of each of the mutations found in our study is indicated in circles. The new mutations found in our patients are mentioned in bold. Other indicated mutations have been described in references de Vree et al,5 Jacquemin et al,6 Rosmorduc et al,7,8 Gendrot et al,10 Dixon et al,11 Pauli–Magnus et al,12 Floreani et al,13 and Keitel et al.21 (Modified from Oude Elferink et al.20)

was found in 4 individuals in both patients (12.5%) and control groups (3%).

Clinical Phenotype Associated With ABCB4 Mutations At the time of liver biopsy, only 1 (case 10) among the 11 patients with ABCB4 DAMs fulfilled the criteria for LPAC syndrome defined by at least 2 of the following features: age under 40 years at the first onset of symptoms; recurrence of cholelithiasis symptoms after cholecystectomy; or intrahepatic hyperechogenic foci, sludge, or microlithiasis.7,8 All patients except 4 were asymptomatic at the time of liver biopsy. These 4 patients underwent laparoscopic cholecystectomy for symptomatic cholelithiasis but did not fulfil criteria for LPAC syndrome except case 10: one patient aged 53 years at the time of the first biliary symptom (case 4) had intrahepatic hyperechogenic foci but no recurrence of symptoms after cholecystectomy; the second patient was 18 years old (case 6) but had no recurrence

of symptoms or intrahepatic hyperechogenic foci, sludge, or microlithiasis; the third patient, aged 51 (case 8) years, had recurrent symptoms and persistent abnormal liver tests after cholecystectomy without intrahepatic microlithiasis at the time of liver biopsy. The main indication for liver biopsy was asymptomatic increased liver enzymes (63.6%). The onset of liver enzyme abnormalities was triggered by steroid sexual hormones in 3 women either after the onset of oral contraception (cases 2 and 6) or during the first trimester of pregnancy (case 1). At the moment of gene sequencing, 3 out of the 11 patients with ABCB4 DAMs developed LPAC syndrome: patients 1 and 7 had cholecystectomy for symptomatic lithiasis 3 years after liver biopsy, at 26 and 39 years of age, respectively, and asymptomatic intrahepatic foci were discovered few years later; intrahepatic hyperechoic foci were assessed 30 months after liver biopsy in a 51-year-old woman with recurrent symptoms after cholecystectomy (case

July 2008

ABCB4 HETEROZYGOUS MUTATION

135

Table 3. Clinical Characteristics at the Time of Liver Biopsy and ABCB4 Heterozygous Point Mutations Identified in 11 Patients With Unexplained Anicteric Cholestasis Cholelithiasis symptoms (age at the onset)

Recurrence of cholelithiasis after cholecystectomy

Intrahepatic hyperechogenic foci, sludge, or microlithiasis

ICPa or steroid sexual triggered cholestasisb

Case

Sex

Age

1

F

23

No

__

No

Yesa

2

F

16

No

—

No

Yesb

3 4

F M

50 53

No Yes (53 y)

— No

No Yes

No —

5 6 7 8 9 10 11

F F M F F F M

47 18 28 52 57 48 29

No Yes (18 y) No Yes (51 y) No Yes (32 y) No

— No — Yes — Yes —

No No No No No Yes No

No Yesb — No No No —

ABCB heterozygous mutation

Exon

Nonsense Missense Nonsense Missense Missense Missense Missense Missense Missense Missense Missense Missense Missense Missense

4c 6 4c 6 18c 14c 15 23 15 18c 15 15 14c 14c

Location and nucleotide changes c. c. c. c. c. c. c. c. c. c. c. c. c. c.

139C⬎T 523A⬎G 139C⬎T 523A⬎G 2212A⬎C 1615G⬎A 1769G⬎A 2800G⬎T 1769G⬎A 2212A⬎C 1769G⬎A 1769G⬎A 1633A⬎G 1576G⬎T

Amino acid changes R47X T175A R47X T175A I738L A539T R590Q A934T R590Q I738L R590Q R590Q R545G V526F

(intrahepatic cholestasis of pregnancy). sexual triggered cholestasis. cThese mutations have not been previously detected in PFIC3, LPAC, or ICP. bSteroid

8). In aggregate, at the moment of gene sequencing, 6 out of 11 patients had had biliary symptoms (cases 1, 4, 6, 7, 8, 10), but only 4 completely fulfilled LPAC criteria (cases 1, 7, 8, 10) (Table 3). After diagnosis of ABCB4 DAMs, patients received UDCA (15 mg/kg/day) with a significant biologic improvement in all cases except 2 (Figure 2).

Liver Histologic Phenotype Associated With ABCB4 Mutations More than 10 portal tracts were represented for each liver biopsy. The fibrosis score was significantly higher in patients with ABCB4 DAMs compared with patients without mutation (nonparametric Mann–Whit-

Figure 2. Evolution of serum ␥-glutamyl transferase during ursodesoxycholic acid treatment (15 mg/kg/day) in patients with ABCB4 heterozygous disease-associated mutation. Despite a good compliance to treatment, cases 4 and 7 had recurrent cholelithiasis symptoms related to intrahepatic microlithiasis a few months after cholecystectomy. Evolution of serum alkaline phosphatases during treatment was similar to serum gammaglutamyl transferase (data not shown).

ney test, P ⫽ .008) and significant fibrosis (F3 or F4 according to Ishak scoring) was observed in 4 out of 11 mutated patients vs 1 out of 21 non mutated patients (Fisher exact test, P ⫽ .01) (Table 4). No cirrhosis was observed. Ductular reaction (Figure 3A) was observed in all but 1 patient with mutation (90%) and in 10 out of 21 patients without (47%) (P ⫽ .049). Bile duct lesion did not differ between the 2 groups. Ductopenia was identified once in patients with and without mutation. Strong portal infiltration by macrophages was mostly observed in patients with mutation compared with patients without (P ⫽ .01). Moreover, periductal macrophages and exocytosis of macrophages through some of the interlobular bile duct were observed without florid destructive lesions (Figure 3B). Lobular and periportal necroinflammatory lesions were absent or mild with no difference between the groups. No histologic cholestasis was observed regardless of the groups. ␣-Smooth muscle cell actin immunostaining showed myofibroblastic activation in portal tracts in most patients regardless of the groups. Myofibroblastic activation of sinusoidal stellate cells was also detected in most patients with no differences within the groups. No periductular reinforcement was observed (Figure 3B). In 1 case only (Figure 3C), a cholesterol crystal shape was observed in the lumen of an interlobular bile duct. In summary, all patients with ABCB4 mutations except 1 (case 2) had portal fibrosis, ductular reaction, and a predominantly macrophagic infiltration of the portal tract with no or mild periportal or lobular necroinflammatory lesions. Patients with chronic destructive cholangitis had been excluded from the study, but mild lesions of bile ducts (exocytosis, mild periductal sclerosis) were

CLINICAL–LIVER, PANCREAS, AND BILIARY TRACT

aICP

136

ZIOL ET AL

GASTROENTEROLOGY Vol. 135, No. 1

Table 4. Histologic Characteristics According to ABCB4 Gene Sequencing

CLINICAL–LIVER, PANCREAS, AND BILIARY TRACT

Fibrosis grading (Ishak score) F0 F1 F2 F3 F4 Fibrogenesis: ␣-SMA semi-quantitative assessment (mean) In portal tracts In periportal areas Total score Biliary type fibrosis Bile duct lesions Absent Mild Bile duct reaction (cytokeratin 19 immunostaining) None or mild Significant Ductopenia Macrophage infiltration in portal tract (CD68 immunostaining)b Mild Strong with confluent groups of macrophages Polymorphonuclear infiltration (CD15 immunostaining)b Absent Significant MDR3 immunostaining (frozen section)c Absent or weak canalicular staining Strong canalicular staining

ABCB4 point mutation, n ⫽ 11

No ABCB4 point mutation, n ⫽ 21

0 2 5 2 2

3 9 8 1 0

P valuea .008

0.7 0.1 1.6 7

1.2 0.3 2.7 10

.1 .2 .1 .5

8 3

18 3

.6

1 10 1

11 10 1

.049

2 8

17 3

.01

5 5

16 4

4 0

0 7

.9

.4

.003

SMA, smooth muscle actin. aMean values were compared using Mann–Whitney test and categories using the ␹2 or Fisher exact test. bIn 2 patients (1 with mutation and 1 without), immunostaining was not done because of insufficient sample available. cPerformed when frozen part of liver biopsy was available: in 4 patients with ABCB4 mutation and in 7 patients without.

observed in 3 out of 11 cases. In one patient with ABCB4 mutations (case 7) who had 2 liver biopsies within a 6-year period, significant progression of portal fibrosis was observed (Figure 3D). No periductular sclerosis, ductopenia, or histologic cholestasis developed.

MDR3 Immunostaining Frozen sections of the liver biopsy were available in 4 patients with ABCB4 mutation (cases 5, 7, 9, 11) and in 7 patients without DAMs. As described previously,19 MDR3 immunostaining showed a strong and continuous canalicular expression equally distributed throughout the lobule in the 7 patients without DAMs (Figure 4a– d). In the 4 patients with mutation, no MDR3 staining was detected in one case (case 7), and a faint and discontinuous canalicular staining was observed in the other cases (Figure 4e– h). No cytoplasmic staining was observed. To confirm the immunoreactivity of the samples, we checked that positive canalicular staining with MRP2 (clone M2III-6 provided by Dr Scheffer) was observed in all samples (Figure 4, insets).

Clinical and Histopathologic Diagnosis in Patients Without ABCB4 DAMs In patients without ABCB4 mutations, 5 had minor lesions, 1 had abnormalities of liver cell plates

suggestive of diffuse regenerative nodular hyperplasia, 5 had a predominant perisinusoidal fibrosis without ductular reaction, and, finally, 10 had histologic findings similar to those observed in patients with mutations. Five patients had a phenotype very suggestive of ABCB4 mutation including cholecystectomy for cholesterol gallbladder gallstone before 40 years of age, clinical and biochemical features of chronic cholestasis, and cholestasis during pregnancy. Three patients fulfilled criteria for LPAC syndrome because of recurrent symptoms after cholecystectomy. The frozen part of the liver biopsy samples was available for 2 of these 3 patients, and MDR3 immunostaining showed a canalicular expression similar to that described in normal liver. MDR3 immunostaining performed in 7 out of the 21 patients without mutation was similar to that described in normal liver. Fifteen out of these 21 patients were treated with UDCA (15 mg/kg/day) with favorable outcome.

Discussion This study is a prospective data collection in a well-defined cohort of patients with unexplained cholestasis. It reveals a high frequency of ABCB4 heterozygous mutations in adults with unexplained cholestasis

ABCB4 HETEROZYGOUS MUTATION

137

CLINICAL–LIVER, PANCREAS, AND BILIARY TRACT

July 2008

Figure 3. Histologic features representative of the abnormalities observed in patients with ABCB4 mutations. (A) Portal tracts were enlarged (F2 stage according to the Ishak scoring system) with accumulation of collagen (b) associated with ductular proliferation evidenced on cytokeratin 19 immunostaining (c). Portal tracts inflammatory infiltrate was moderate, and neither interlobular destructive bile duct lesions nor periportal or lobular necroinflammatory lesions were observed (a). Case 8, serial sections, hematoxylin, eosin, and saffron (a); picrosirius red (b); cytokeratin 19 (c); original magnification, ⫻5. (B) Activation of portal myofibroblasts and macrophage infiltration of portal tracts in patients with ABCB4 mutations. (a) Most portal tracts displayed positive cells for ␣-smooth muscle cell actin. Activated portal myofibroblast surrounded reactive ductules. No peculiar distribution around the interlobular bile duct was observed. (b) Portal tracts infiltrate was predominantly made of macrophages evidenced on CD68 immunostaining. Exocytosis of macrophages through an interlobular bile duct was sometimes detected (c). (C) In case 2, the shape of a cholesterol crystal (arrow) was observed on 1 section of the paraffin-embedded liver biopsy sample. The cholesterol crystal appears to be engulfed by a macrophage infiltrating the wall of the interlobular bile duct. H&E staining. Original magnification, ⫻100. (D) Fibrosis progression in ABCB4 mutations. Case 7 underwent a first liver biopsy for unexplained anicteric cholestasis when he was 28 years old. Fibrous expansion of most portal tracts with short fibrous septa (F2 according to Ishak scoring system17) was observed (a). Six years later, recurrence of abnormal liver enzymes after cholecystectomy leads to a second liver biopsy. Portal fibrosis had significantly progressed to bridging fibrosis (F4 according to the Ishak scoring system) associated with perisinusoidal fibrosis (b). Picrosirius red staining; original magnification, ⫻5.

(11 out of 32 patients, 34%). Five out of the 8 point mutations found in our patients had not been previously described. The causality between ABCB4 mutations and cholestatic liver disease has not been formally demonstrated by functional analysis, and defects in other genes or a combined genetic disorder of hepatobiliary transporter proteins could be involved.21 However, we assume

that ABCB4 mutations found in this study represent at least a risk factor for cholestasis for the following reasons. First, 7 out of the 8 mutations found in our patients were never found in the 124 healthy volunteers. In addition, we (B.H., O.R.) did not previously detect any of these DAMs in 2 control groups consisting of 28 patients presenting a classic form of gallstone disease without

138

ZIOL ET AL

GASTROENTEROLOGY Vol. 135, No. 1

CLINICAL–LIVER, PANCREAS, AND BILIARY TRACT

Figure 4. Immunohistochemical detection of MDR3 in patients with anicteric cholestasis. MDR3 immune reactivity strongly outlines, as continuous pattern, the bile canaliculi network in patients without ABCB4 mutations (a– d). In contrast, case 7 (e) with both missense ABCB4 heterozygous mutation and nonsynonymous polymorphism did not disclose any staining. Cases 5 (f), 7 (g), 9 (h), and 11 (e) with missense heterozygous mutation showed a faint and discontinuous staining compared with controls. For positive control of the antigenic preservation of the tissue, immunostaining with another member of ABC transporters (MRP2clone M2III-6 encoded by ABCC2) showed a strong canalicular staining (insets in e, f, g, h). a– h: MDR3 (P3II-26) immunostaining, original magnification, ⫻1000; insets in e, f, g, and h: MRP2 (M2III-6) immunostaining, original magnification, ⫻500.

LPAC criteria and of 33 patients with various chronic liver disease.8 Only 1 previously reported mutation (R590Q) observed in 4 patients was also detected in 4 controls, raising the question of its relevance in the pathogenesis of the liver disease. The c.1769G⬎A (R590Q) mutation in exon 15 has already been described as a genetic variability but predicted to have functional consequences.22 Second, 3 out of the 8 mutations have been previously reported in LPAC or ICP as shown in Figure 1. Third, 4 of the 5 new mutations are located very close to the nucleotide-binding domain 1 where numer-

ous others functional mutations were found (Figure 1), suggesting their pathologic role. Last, although we did not perform bile analysis or MDR3 molecular studies, we evidenced a common histologic pattern in patients with ABCB4 mutations with a more pronounced fibrosis compared with the 21 patients without mutations associated with a tremendously reduced MDR3 immunostaining in the subgroup of patients with available frozen liver biopsy sections. The present study reports for the first time that isolated liver test abnormalities can be associated with

ABCB4 mutation. Indeed, it must be pointed out that 7 patients with ABCB4 mutations had no biliary symptoms at the time of liver biopsy. Although most patients were asymptomatic at the time of liver biopsy, biliary symptoms or hyperechoic foci further developed and led to complete LPAC criteria in 2 previously asymptomatic patients. This suggests that unexplained anicteric cholestasis should be added to the spectrum of manifestations associated with ABCB4 DAMs. We describe liver histologic features associated with ABCB4 DAMs in adults. Until now, histologic lesions have been described only in 5 adults with ABCB4 mutations. A 20-year-old man with PFIC3 and biliary cirrhosis was reported by Jacquemin et al.6 Three patients from 22 to 60 years of age with LPAC syndrome and either ABCB4 homozygous missense mutation or heterozygous single nucleotide insertion were reported by Rosmorduc et al.7 Liver histology revealed portal inflammation, ductular reaction, and intracanalicular and hepatocellular cholestasis without bile duct lesions in all cases, associated with extensive portal fibrosis only in the 2 patients with homozygous mutation. The fifth case was a 47-year-old woman with heterozygous ABCB4 missense mutation who developed cholelithiasis in adolescence, followed by recurrent ICP and finally biliary cirrhosis revealed by ascites.14 In our 11 patients with heterozygous ABCB4 mutations, significant portal fibrosis defined as fibrous expansion of most portal tracts with portal to portal bridging (F3 or F4 according to Ishak score) was observed in 4 cases, whereas only 1 patient without ABCB4 DAMs had significant fibrosis (P ⫽ .01). Apart from higher fibrosis scores, patients with ABCB4 mutations had most often bile duct reaction, strong portal macrophagic infiltrate, and absence of significant periportal and lobular necroinflammatory lesions. However, these features were not specific because 3 out of 21 patients without ABCB4 DAMs also fulfilled these histologic criteria. In addition, 1 patient (case 7) with a new ABCB4 DAMs (I738L), who had 2 consecutive liver biopsies within a 6-year period, had significant progressive portal fibrosis. Thus, our study showed that heterozygous ABCB4 mutation can result in significant liver fibrosis of biliary type with marked macrophagic infiltration of portal tracts. These histologic features were similar to those described in early stages of PFIC3,6 but no cirrhosis developed in our cases. MDR3 liver immunostaining has been previously described in children with PFIC3 related to homozygous ABCB4 mutations.5,6,23 Using the same antiMDR3 antibody that we used on frozen liver sections, several patterns have been detected5,6,23: complete absence of staining in 10 patients, faint staining in 2, and a normal canalicular expression in 4. MDR3 expression was described in only 1 patient with heterozygous

ABCB4 HETEROZYGOUS MUTATION

139

mutation14: reduced expression was observed with the signal spreading to the basolateral membrane suggesting altered cellular trafficking of the molecule. In our study, no (1 case) or faint (3 cases) MDR3 immunostaining was observed in all 4 liver biopsies from patients with heterozygous ABCB4 mutations, whereas all 7 patients without mutations showed strong MDR3 canalicular staining. Thus, we evidenced a clear decrease of MDR3 immunostaining in patients with heterozygous mutations. Whether the pattern of MDR3 immunostaining is related to disease severity cannot be addressed by this study, but case 7 with no MDR3 expression had severe and progressive liver fibrosis, whereas other patients had reduced staining and mild disease with F2 fibrosis and no ductular reaction. Positive control for the immune reactivity of the frozen tissue was provided by a strong and continuous MRP2 canalicular staining. Reduced immunostaining does not necessarily mean reduced or absent expression that could have been evidenced by a Western blot, not performed in our study because of the lack of sufficient material (part of liver biopsy samples not needed for histologic evaluation). It could also be linked to (1) conformational change of the protein leading to a modified affinity for the antibody and (2) abnormal trapping of the expressed protein. The monoclonal antibody we used is directed against the 629 – 692 amino acid sequence of ABCB4,19 whereas, in the 4 tested patients, mutations were not located in this part of the gene. Thus, the first hypothesis is hardly convincing. Regarding the second hypothesis, Durand– Schneider et al24 recently reported that experimentally developed missense mutations of MDR1 could lead to intracellular retention of the mutant protein. We did detect in 3 cases faint and fuzzy staining, but it was always restricted to the canalicular membrane, and no cytoplasmic staining was observed, although conventional microscopy could not determine on which side of the membrane the staining was located. Our findings suggest that clinical, biologic, and histologic abnormalities observed in heterozygous gene mutation could be related to dramatically decreased immunostaining of the phospholipid flippase at the canalicular pole of the hepatocyte. If confirmed by a larger study, MDR3 immunostaining on frozen liver biopsy sections would represent a valuable diagnosis tool for the detection of ABCB4 mutation. Mice deficient in the canalicular phospholipids flippase (Mdr2⫺/⫺ mice) could be considered as a model for human ABCB4 deficiency. These mice spontaneously develop periportal biliary fibrosis.25 The pathogenesis has been related to a sequence of events including disruption of the tight junctions and basement membrane of the bile duct and bile leakage into the portal tracts leading to fibrogenesis driven by periportal and or peribiliary myofibroblats.3,26 We did not

CLINICAL–LIVER, PANCREAS, AND BILIARY TRACT

July 2008

140

ZIOL ET AL

CLINICAL–LIVER, PANCREAS, AND BILIARY TRACT

perform bile analysis in our patients for ethical and technical reasons, but the strong portal infiltrate predominantly made of macrophages with a periductal distribution and exocytosis through the interlobular bile duct (Figure 3) detected in all patients with ABCB4 mutations could represent an indirect consequence for bile leakage into portal tracts. Popov et al3 described a highly increased number of ␣-smooth muscle actin expression in portal tracts. In our study, all patients with ABCB4 heterozygous mutation showed ␣-smooth muscle cell actin myofibroblasts in portal tracts, suggesting progressive fibrogenesis in all patients. Ductopenia was observed in a 62-year-old women (case 3) with F4 fibrosis. Accordingly, progression to periductular fibrosis or to ductopenia cannot be excluded in ABCB4 heterozygous mutated patients. Although no histologic liver disease has been described in mice with heterozygous Mdr2 mutation under normal conditions,4 the phospholipids secretion rate was decreased.27 Moreover, in pathologic conditions such as cold ischemic injury after liver transplantation, these Mdr2⫹/⫺ mice develop bile duct injury, whereas wildtype mice do not.28 In addition, evidence of extensive fibrosis has already been reported in a patient with proven heterozygous mutations.14 In conclusion, our study shows that isolated liver test abnormalities are associated with ABCB4 mutations in a significant subset (34%) of patients with or without previous biliary symptoms. Heterozygous ABCB4 mutations were associated with portal fibrosis, ductular reaction, macrophage infiltration of portal tracts, and absent or reduced MDR3 liver immunostaining. These results suggest that ABCB4 heterozygous mutations could induce liver injury leading to significant and progressive biliary fibrosis. An early diagnosis of this biliary disease would be beneficial because of the potential preventive effect of UDCA on fibrosis progression and biliary complications.

GASTROENTEROLOGY Vol. 135, No. 1

7.

8.

9.

10.

11.

12.

13.

14.

15. 16.

17. 18.

19.

20.

References 1. Smit J, Shinkel A, Mol C, et al. Tissue distribution of the human MDR3 P glycoprotein. Lab Invest 1994;71:638 – 649. 2. Smith A, de Vree J, Ottenhoff R, et al. Hepatocyte specific expression of the human MDR3 P-glycoprotein gene restores the biliary phosphatidylcholine excretion absent in mdr2 (⫺/⫺) mice. Hepatology 1998;28:530 –536. 3. Popov Y, Patsenker E, Fickert P, et al. Mdr2 (Abcb4) ⫺/⫺ mice spontaneously develop severe biliary fibrosis via massive dysregulation of pro- and antifibrogenic genes. J Hepatol 2005;43: 1045–1054. 4. Smit JJ, Schinkel AH, Oude Elferink RP, et al. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993;75:451– 462. 5. de Vree J, Jacquemin E, Sturm E, et al. Mutations in the MDR3 gene cause progressive familial intrahepatic cholestasis. Proc Natl Acad Sci U S A 1998;95:282–287. 6. Jacquemin E, de Vree J, Cresteil D, et al. The wide spectrum of multidrug resistance 3 deficiency: from neonatal cholesta-

21.

22.

23.

24.

25.

sis to cirrhosis of adulthood. Gastroenterology 2001;120: 1448 –1458. Rosmorduc O, Hermelin B, Poupon R. MDR3 gene defect in adults with symptomatic intrahepatic and gallbladder cholesterol cholelithiasis. Gastroenterology 2001;120:1459 –1467. Rosmorduc O, Hermelin B, Boelle PY, et al. ABCB4 gene mutation-associated cholelithiasis in adults. Gastroenterology 2003; 125:452– 459. Jacquemin E, Cresteil D, Manouvrier S, et al. Heterozygous nonsense mutation of the MDR3 gene in familial intrahepatic cholestasis of pregnancy. Lancet 1999;353:210 –211. Gendrot C, Bacq Y, Brechot MC, et al. A second heterozygous MDR3 nonsense mutation associated with intrahepatic cholestasis of pregnancy. J Med Genet 2003;40:e32. Dixon PH, Weerasekera N, Linton KJ, et al. Heterozygous MDR3 missense mutation associated with intrahepatic cholestasis of pregnancy: evidence for a defect in protein trafficking. Hum Mol Genet 2000;9:1209 –1217. Pauli-Magnus C, Lang T, Meier Y, et al. Sequence analysis of bile salt export pump (ABCB11) and multidrug resistance p-glycoprotein 3 (ABCB4, MDR3) in patients with intrahepatic cholestasis of pregnancy. Pharmacogenetics 2004;14:91–102. Floreani A, Carderi I, Paternoster D, et al. Hepatobiliary phospholipid transporter ABCB4, MDR3 gene variants in a large cohort of italian women with intrahepatic cholestasis of pregnancy. Dig Liver Dis 2008;40:366 –370. Lucena J, Herrero J, Quiroga J, et al. A multidrug resistance 3 gene mutation causing cholelithiasis, cholestasis of pregnancy, and adulthood biliary cirrhosis. Gastroenterology 2003; 124:1037–1042. MacSween R, Burt A, Portmann B, et al. Pathology of the liver. Churchill Livingstone, 2002. Pileri S, Roncador G, Ceccarelli C, et al. Antigen retrieval techniques in immunohistochemistry: comparison of different methods. J Pathol 1997;183:116 –123. Ishak K, Baptista A, Bianchi L, et al. Histological grading and staging of chronic hepatitis. J Hepatol 1995;22:696 – 699. Schmitt-Graff A, Kruger S, Bochard F, et al. Modulation of ␣ smooth muscle actin and desmin expression in perisinusoidal cells of normal and diseased human livers. Am J Pathol 1991; 138:1233–1242. Scheffer GL, Kool M, Heijn M, et al. Specific detection of multidrug resistance proteins MRP1, MRP2, MRP3, MRP5, and MDR3 P-glycoprotein with a panel of monoclonal antibodies. Cancer Res 2000;60:5269 –5277. Oude Elferink RP, Paulusma CC. Function and pathophysiological importance of ABCB4 (MDR3 P-glycoprotein). Pflugers Arch 2007; 453:601– 610. Keitel V, Vogt C, Haussinger D, et al. Combined mutations of canalicular transporter proteins cause severe intrahepatic cholestasis of pregnancy. Gastroenterology 2006;131:624 – 629. Lang T, Haberl M, Jung D, et al. Genetic variability, haplotype structures, and ethnic diversity of hepatic transporters MDR3 (ABCB4) and bile salt export pump (ABCB11). Drug Metab Dispos 2006;34:1582–1599. Keitel V, Burdelski M, Warskulat U, et al. Expression and localization of hepatobiliary transport proteins in progressive familial intrahepatic cholestasis. Hepatology 2005;41:1160 – 1172. Durand-Schneider A, Abarane A, Delautier D, et al. Effect of missense mutations of the MDR3 gene identified in patients with progressive familial intrahepatic cholestasis type III (abstr). Hepatology 2006;44(Suppl 1):622A. Mauad TH, van Nieuwkerk CM, Dingemans KP, et al. Mice with homozygous disruption of the mdr2 P-glycoprotein gene. A novel

animal model for studies of nonsuppurative inflammatory cholangitis and hepatocarcinogenesis. Am J Pathol 1994;145: 1237–1245. 26. Fickert P, Zollner G, Fuchsbichler A, et al. Ursodeoxycholic acid aggravates bile infarcts in bile duct-ligated and Mdr2 knockout mice via disruption of cholangioles. Gastroenterology 2002;123: 1238 –1251. 27. Oude Elferink RP, Ottenhoff R, van Wijland M, et al. Regulation of biliary lipid secretion by mdr2 P-glycoprotein in the mouse. J Clin Invest 1995;95:31–38.

ABCB4 HETEROZYGOUS MUTATION

141

28. Hoekstra H, Porte RJ, Tian Y, et al. Bile salt toxicity aggravates cold ischemic injury of bile ducts after liver transplantation in Mdr2⫹/⫺ mice. Hepatology 2006;43:1022–1031.

Received February 2, 2007. Accepted March 21, 2008. Address requests for reprints to: N. Ganne-Carrié, MD, Service d’Hépato-Gastroenterologie, AP-HP, Hôpital Jean Verdier, 93140 Bondy. UPRES EA3409, Université Paris 13, Bobigny, France. e-mail: [email protected]; fax: (33) 1-48-02-62-02.

CLINICAL–LIVER, PANCREAS, AND BILIARY TRACT

July 2008