- Email: [email protected]
H19 in porcine parthenogenetic fetuses and placentas
Animal Reproduction Science 139 (2013) 101–108
Contents lists available at SciVerse ScienceDirect
Animal Reproduction Science journal homepage: www.elsevier.com/locate/anireprosci
Aberrant expression of Igf2/H19 in porcine parthenogenetic fetuses and placentas Xiaolei Han 1 , Hongsheng Ouyang 1 , Xianju Chen 1 , Yongye Huang, Yuning Song, Mingjun Zhang, Daxin Pang, Liangxue Lai, Zhanjun Li ∗ Jilin Provincial Key Laboratory of Animal Embryo Engineering, College of Animal Sciences, Jilin University, Changchun 130062, China
a r t i c l e
i n f o
Article history: Received 12 December 2012 Received in revised form 2 April 2013 Accepted 14 April 2013 Available online 19 April 2013 Keywords: Pig Parthenogenetic H19 Igf2 Methylation
a b s t r a c t The aberrant expression of imprinted genes induces parthenogenetic fetal and placental dysplasia, thus leading to failures in embryonic development. Igf2 and H19 are co-expressed in endoderm and mesoderm-derived tissues and play an important role in normal embryo and extraembryonic development. In this study, the expression and methylation of Igf2/H19 in porcine parthenogenetic fetuses and placentas which had grown 28 days was examined first time to further characterize mammalian parthenogenesis. Weight and morphological comparisons were conducted between parthenogenetic embryos on Day 28 and normal fertilized embryos (control). The results indicated that parthenogenetic fetuses and placentas had smaller weights and volumes than those of the control. In addition, quantitative RT-PCR (qRT-PCR) analysis was performed to determine Igf2/H19 expression levels, showing that the expression of H19 was up-regulated, while Igf2 expression was almost undetectable in both parthenogenetic fetuses and placentas. As a potential mechanism underlying this disrupted expression, the methylation of Igf2/H19 DMR3 was detected using bisulfite sequencing PCR analysis, which revealed the significant hypomethylation of DMR3 in parthenogenetic fetuses and placentas. These results suggest that disruption of Igf2/H19 expression in parthenogenetic fetuses and placentas contributes to implantation failure and/or abortion in swine parthenogenesis, which might be associated with differential methylation patterns in the imprinting control region of imprinted genes. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Parthenogenesis is a form of asexual reproduction, in which an oocyte develops into an embryo without fertilization (Hikichi et al., 2007). Parthenogenetic (PA) mammals could serve as important biological research models and novel sources for the derivation of PA pluripotent cell lines (Brevini and Gandolfi, 2008). However, natural parthenogenesis primarily exists in lower animals, such as insects
∗ Corresponding author at: College of Animal Sciences, 5333#, Xi’an Road, Changchun 130062, China. Tel.: +86 431 87836175; fax: +86 431 87980131. E-mail address: lizj [email protected] (Z. Li). 1 These authors contributed to the article equally. 0378-4320/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.anireprosci.2013.04.008
and plants, and there are no known instances of naturally occurring mammalian parthenogenesis in the wild. Thus, many attempts have been made to develop PA animal models in the last few years. Parthenogenesis has been artificially induced in mice (Kono et al., 2004). However, until recently, the successful generation of parthenogenetic (PA) pigs has not been reported. Previous studies have shown that both maternal and paternal genomes are essential for embryogenesis and lacking either one could lead to developmental failure (McGrath and Solter, 1984). It had been shown that paternally expressed imprinted genes were required for the development of extraembryonic tissues (Surani et al., 1984). Embryos generated through parthenogenetic activation lack paternally expressed imprinted genes. In addition, the diploid PA embryo should theoretically have
102
X. Han et al. / Animal Reproduction Science 139 (2013) 101–108
double doses of maternally expressed imprinted genes. PA embryos develop to the segmentation period and are easily lost during gestation in many species. In rabbits, sheep and cattle, implanted PA embryos die at 12, 21, and 30 days of gestation, respectively (Zhu et al., 2003). Studies have shown that genomic imprinting plays a key role in this abnormal phenomenon (Reik and Dean, 2001; Platonov, 2005). Currently, there are approximately 140 imprinted genes that have been identified in mammals (http://igc.otago.ac.nz/home.html). Thus, the appropriate expression of imprinted genes might be required to rescue the hypoplasia of parthenogenesis. The imprinted gene insulin-like growth factor II (Igf2) is critical for mammalian growth, fetal cell division and differentiation, and metabolic regulation (O’Dell and Day, 1998). The H19 gene, which encodes a 2.3-kb non-coding mRNA, is strongly expressed during embryogenesis (Gabory et al., 2006). The Igf2 and H19 genes are located on chromosome 7 in mice, chromosome 2p1.7 in pigs and chromosome 11p15.5 in humans (http://igc.otago.ac.nz/home.html). H19 is closely linked with Igf2, which is expressed by the paternal allele, while H19 is transcribed from the maternal allele (Park et al., 2009). These two genes were the first endogenous imprinted genes identified (Viville and Surani, 1995), and the expression of these genes is regulated through DNA methylation via the CCCTC-binding factor (Park et al., 2009). Studies have shown that an antisense H19 transcript regulates Igf2 transcription through the activation of a novel promoter in mouse myoblasts (Tran et al., 2012). However, although the H19 gene was discovered over 20 years ago, the precise function of this gene remains unknown. Due to the important role of Igf2/H19 in fetal and placental development, these two genes might also be critical for PA fetal development. There have been many reports concerning the expression and methylation of Igf2/H19. However, the role of Igf2/H19 in the development of porcine PA fetuses and placentas is limited. Therefore, in the present study, we examined the morphology, Igf2/H19 expression and DMR3-mediated methylation of PA fetuses and placentas.
2. Materials and methods
hormone, 0.5 g/ml luteinizing hormone, 75 g/ml penicillin and 50 g/ml streptomycin. 2.2. The parthenogenetic activation of MII oocytes After maturation culturing for 42 to 44 h at 38.5 ◦ C in humidified air containing 5% CO2 , the cumulus cells of COCs were removed from the oocytes through repeated pipetting in a PVA-TL HEPES stock solution supplemented with 0.1% hyaluronidase. Rounded oocytes with an extruded first polar body and intact cytoplasm were selected. The selected oocytes were pooled in a chamber filled with fusion medium (0.3 M mannitol, 1.0 mM CaCl2 ·2H2 O, 1.0 mM MgCl2 ·6H2 O, and 0.5 mM Hepes), and 2 DC pulses of 1.2 kV/cm for 30 s were subsequently administered using a BTX Electro Cell Manipulator 2001 (BTX, San Diego, CA). After activation, the oocytes were cultured in PZM-3 medium supplemented with 7.5 g/ml cytochalasin B for 4 h. The embryos were cultured in PZM-3 medium at 38.5 ◦ C in a humidified atmosphere containing 5% CO2 for 24 h until embryo transfer. 2.3. Embryo transfer and fetuses harvest One day after parthenogenetic activation, the embryos were transferred into the oviduct of the surrogate sow. Pregnancy was determined on Day 28 after embryo transfer using ultrasound examination, then the pregnant sows subjected to PA embryo transfer or artificial insemination were anesthetized, and the fetuses and placentas were collected from each uterine horn. The brain, liver, trunk, and placenta of the collected fetuses were individually placed in cryovials and stored in liquid nitrogen until further use. 2.4. Fetal fibroblast cell harvest The collected fetuses were digested with collagenase (200 IU/ml) and DNase I (25 KU/ml) after the head, viscera, limbs and tail were discarded. The cell pellets was pooled in 10-cm culture plates (Nunc, Roskilde, Danmark) after washing and digestion, and the cells were subsequently frozen and stored in liquid nitrogen. The cell freezing medium contained 90% FBS and 10% dimethyl sulfoxide (DMSO; Amresco). One or two days before use, the cells were thawed and cultured.
2.1. Porcine oocyte collection and in vitro maturation 2.5. RNA isolation and synthesis of cDNA Oocyte collection and in vitro maturation was performed as previously described (Lai et al., 2002). The ovaries were collected and transported to the laboratory in saline supplemented with penicillin and streptomycin and maintained at 30 to 35 ◦ C. The oocyte–cumulus complexes (COCs) were aspirated from 3- to 6-mm ovarian follicles using an 18-gauge needle attached to a 10-cc syringe, and COCs with at least three uniform layers of cumulus cells were selected. Subsequently, COCs were cultured in TCM199 medium containing 0.1% PVA, 3.05 mM d-glucose, 0.91 mM sodium pyruvate, 10 ng/ml epidermal growth factor, 0.57 mM cysteine, 0.5 g/ml follicle-stimulating
TRNzol-A+ reagent (TIANGEN, Beijing, China) was used to extract total RNA from the PA (N = 3) and control (N = 3) samples according to the manufacturer’s instructions. The residual DNA was digested using DNase I (Fermentas). The treated RNA was used as a template for reverse transcription. First strand cDNA was synthesized using a BioRT cDNA First Strand Synthesis kit (Bioer Technology, Hangzhou, China) at a final reaction volume of 20 l containing 2 l of 5X RT Buffer, 1 l of dNTP mixture (10 mM), 0.5 l of Oligo-dTs, 0.5 l of RNase inhibitor (40 U/l), 0.5 l of AMV Reverse Transcriptase, and 1 g of treated RNA at 42 ◦ C for
X. Han et al. / Animal Reproduction Science 139 (2013) 101–108
103
Table 1 Primers used in this study. Genes
Primer sequences (5 -3 )
Size of PCR products (bp)
Tm (◦ C)
Reference/sequence accession numbers
GAPDH
ATTCCACGGCACAGTCAAGG ACATACTCAGCACCAGCATCG GTGGACATCAGGAAGGACCTCTA ATGATCTTGATCTTCATGGTGCT AAGAGTGCTCTTCCGTAG TGTCATAGCGGAAGAACTTG CTCAAACGACAAGAGATGGT AGTGTAGTGGCTCCAGAATG GGTTTTAGGGGGATATTTTTT TTAAAAAAACATTACTTCCATATAC GATTTTTAGGTTTGTTATTATTT CAAATATTCAATAAAAAAACCC
120
58
NM 001206359.1
137
58
(Park et al., 2011)
156
58
(Park et al., 2011)
122
58
(Park et al., 2011)
/
/
(Park et al., 2009)
208
/
(Park et al., 2009)
ˇ-ACTIN Igf2 H19 DMR3 outside DMR3 inside
45 min. The samples were subsequently incubated at 95 ◦ C for 5 min to complete the reverse transcription reaction.
2.6. Selection of reference genes for gene expression The expression of each imprinted gene was evaluated based on the amplification of the reference genes expressed in fetuses and placentas using qRT-PCR. To confirm the reference gene stability, the threshold cycles (CT values) were compared among 18S, GAPDH and ˇ-ACTIN (RefFinder, http://www.leonxie.com/referencegene.php? type=reference#). The lowest export value represented the most stable reference gene.
2.7. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) The target genes were amplified using the BioEasy SYBR Green I Real Time PCR Kit (Bioer Technology, Hangzhou, China) according to the manufacturer’s instructions, with the following reaction conditions: an initial denaturation step at 95 ◦ C for 3 min, 40 cycles of denaturation at 95 ◦ C for 10 s, annealing at 55 ◦ C for 15 s, and extension at 72 ◦ C for 30 s. Amplification and detection were performed using a BIO-RAD iQ5 Multicolor Real-Time PCR Detection System. The detection of gene expression was performed three times among templates harvested from three different samples. The 2− CT formula was used to determine the relative gene expression (Livak and Schmittgen, 2001).
2.8. DNA isolation and bisulfite treatment The genomic DNA was isolated using the TIANmp Genomic DNA Kit (TIANGEN, Beijing, China) from the PA (N = 3) and control (N = 3) samples, then the genomic DNA was subjected to bisulfite treatment using a CpGenomeTM Turbo Bisulfite Modification Kit (Millipore). Approximately 200 ng of DNA was denatured using 0.3 N NaOH at 37 ◦ C for 10 min. Subsequently, 120 l of fresh DNA modification reagent was added, and the reaction mixture was incubated at 70 ◦ C for 40 min. After modification, the DNA was desalted, purified, and eluted with 25 l of elution buffer. The purified DNA was stored at -20 ◦ C until further use.
2.9. Bisulfite sequencing PCR (BSP) analysis The DMR3 outside and DMR3 inside primers for the nested PCR amplification of bisulfite-treated DNA are described in Table 1. The first amplification was performed using Taq Plus PCR Master Mix (TIANGEN, Beijing, China) under the following reaction conditions: one cycle at 94 ◦ C for 3 min; 35 cycles of denaturation at 94 ◦ C for 30 s, annealing at 55 ◦ C for 30 s and extension at 72 ◦ C for 1 min, followed by a final extension cycle at 72 ◦ C for 5 min. The second PCR amplification was performed under the same conditions, except the extension was conducted at 72 ◦ C for 40 s. The PCR products were purified using a TIANgel Midi Purification Kit (Tiangen, Beijing, China) and cloned into the PGM-T vector (Tiangen, Beijing, China). Subsequently, the product was transformed into DH5␣ cells (Tiangen, Beijing, China). Ten positive plasmid clones were sequenced at Tiangen Corporation. All experiments were repeated at least three times. 2.10. Statistical analysis The weight and gene expression of the PA and control samples were compared using students t tests with SPSS 16.0 software (SPSS Inc., Chicago, IL, USA). 3. Results 3.1. Production of parthenogenetic fetuses In the present study, the parthenogenetic fetuses were firstly produced. As shown in Table 2, embryo transfer were performed into 6 recipient sows with 210 embryos on Table 2 In vivo development of porcine parthenogenetic embryo. Recipient sows
No. of embryos transferred
Pregnancy on day 28
No. of fetuses collected
0251 0561 595 592 0608 L0330
160 180 217 283 220 200
Yes Yes No No Yes Yes
17 7 None None 5 7
104
X. Han et al. / Animal Reproduction Science 139 (2013) 101–108
Fig. 1. Weight and morphological comparisons between Day 28 PA and Control samples A. Morphological comparisons were performed between PA and control fetuses on Day 28 of gestation. It shows obviously that the PA fetuses were smaller than the control. Fetal (B) and placental (C) weight was compared between control (N = 23) and PA (N = 18) at Day 28 of gestation. N indicates the number of observations. This data is presented as mean ± SEM. *p < 0.05.
average. Using ultrasound examination, 4 of these recipient sows were detected to be pregnant on Day 23. Finally, a total of 36 parthenogenetic fetuses and placentas were collected on Day 28.
were observed in the PA fetuses and placentas compared with the control samples (Fig. 1B and C). Thus, the abortion or resorption of defective fetuses and abnormal placentas occurs later.
3.2. Day 28 PA samples showed smaller morphology and weight
3.3. Aberrant gene expression of H19 and Igf2 in PA samples
A morphological comparison was performed between the PA (N = 23) and control (N = 18) fetuses which have grown 28 days. As shown in Fig. 1A, the PA fetuses were smaller than the control samples. Notably, the sizes of the fetuses differed, even among the same sample of PA fetuses (the small size is indicated with an arrow), suggesting that development among PA fetuses was unsynchronized. Significant reductions in the weight of fetuses and placentas
The expression of reference genes also varies under different circumstances. To select suitable reference genes for fetus, placenta, liver, brain, torso, and fibroblast cells, the gene stability of 18S, GAPDH and ˇ-ACTIN were determined. As shown in Fig. 2, GAPDH is a relatively stable reference gene for fetus (A), liver (C), torso (E), and fibroblast cells (F), and ˇ-ACTIN is a stable reference gene for placenta (B) and brain (D). Therefore, the housekeeping genes GAPDH and
X. Han et al. / Animal Reproduction Science 139 (2013) 101–108
105
Fig. 2. The selection of sable reference genes for gene expression analysis using online tool of RefFinder. Potential housekeeping genes in PA samples were selected by RefFinder, A: Fetus, B: Placenta, C: Liver, D: Brain, E: Torso, F: Cell.
ˇ-ACTIN were selected as reference genes for the subsequent experiments. A two-fold increase in the expression of H19 in PA samples containing double maternal chromosomes is expected. However, although the H19 genes exhibited significant higher expression levels in PA fetuses and placentas than those in the control samples (Fig. 3A), the data showed that the expression of H19 was not two-fold as anticipated. Instead, disordered expression was observed. Similar results were observed for the expression of Igf2. Theoretically, PA samples are not expected to contain Igf2
mRNA. However, the results revealed that Igf2 mRNA was detected in PA samples, despite the conspicuously low expression levels (Fig. 3B). Therefore, we hypothesized that the expression of both H19 and Igf2 was disrupted. To further confirm this hypothesis, experiments were conducted in the liver, brain, torso, and fibroblast cells of PA and control samples (Fig. 3A and B). Expectedly, the results were consistent with those of previous studies showing that the expression of H19 in most tested organs was higher than two-fold compared with that in the control and the expression of Igf2 was almost undetectable.
106
X. Han et al. / Animal Reproduction Science 139 (2013) 101–108
Fig. 3. Relative expression levels of Igf2/H19 in PA sample of fetuses, placentas, liver, brain, torso, and fibroblast cells. The expression of H19 (A) and Igf2 (B) was analyzed by quantitative real-time PCR (qRT-PCR), after normalization relative to reference gene which is listed in Fig. 2, and then calculated by the method of 2− CT. This data is presented as mean ± SEM. Each bar represents the average value of three samples. Three repeats were performed on every sample. *p < 0.05; **p < 0.01.
3.4. Typical hypomethylation of Igf2/H19 DMR3
4. Discussion
DNA methylation plays an important role in the regulation of imprinting gene expression. Bisulfate sequencing of Igf2/H19 DMR3 was performed to identify the mechanism underlying the aberrant expression of H19 and Igf2. The results showed that methylation level of Igf2/H19 DMR3 was lower in PA fetuses (7 ± 10%) compared with that in control fetuses (49 ± 12%) (Fig. 4A and B). Similarly, the methylation of Igf2/H19 DMR3 in the control placentas (71 ± 20%) was significantly higher than that in PA placentas (17 ± 15%) (Fig. 4C and D). These results indicated that methylation in PA fetuses and placentas were low compared with that in the control samples.
In the present study, the PA fetuses weighed less than those in the control. The smaller volume and lower weight of the PA fetuses and placentas potentially reflects developmental failures. The increased expression of maternally expressed imprinted genes potentially restricts the growth of PA fetuses. In addition, the nutrient levels of PA fetuses are inadequately supplied through the maternal environment. A network of imprinted genes, such as Igf2, Igf2r, Cdkn1c and Grb10, are expressed in the embryo and placentas, which act prenatally to determine set points of energy metabolism (Charalambous et al., 2007). In addition, a recent study has shown that the expression of pleckstrin homology-like domain family A member 2 (PHLDA2)
X. Han et al. / Animal Reproduction Science 139 (2013) 101–108
107
Fig. 4. The methylation status of Igf2/H19 DMR3 in porcine parthenogenetic fetuses and placentas. H19 DMR3 methylation patterns in Control fetuses (A), PA fetuses (B), Control placentas (C), and PA placentas (D) were detected by BSP. Open and closed circles represent unmethylated and methylated CpG sites, respectively. Each horizontal line means an independent clone of amplified PCR products.
was associated with birth weight (Lim et al., 2012). Thus, the reduced weight of PA fetuses might result from the disrupted expression of imprinted genes, which is likely associated with abnormal energy metabolism. The expression of Igf2 is positively associated with early embryonic development. A previous study has shown that when Igf2 is added to defined culture medium for the culture of 2-cell embryos, the blastocyst-forming rate, ICM mitogenesis, and protein synthesis were stimulated, supporting a role for this gene in early development (Harvey and Kaye, 1992). This result suggests that an increased Igf2 concentration enhances pre-implantation development. However, as shown in the present study, the expression of Igf2 in different organs from PA fetuses was low, which might restrict PA embryo development. Certainly, although with thoroughly washing, it still could not be excluded the possibility that there was maternal blood contamination in the collected samples, what may also be account for the detection of a small amount of Igf2 transcript in the PA samples. In ovine, however, a previous study showed that no differences in the expression of Igf2 were observed between PA and IVF at the two cell-stage, while significantly higher Igf2 expression in PA morulae and blastocysts was observed compared with IVF embryos (Bebbere et al., 2010), suggesting that Igf2 might play different roles in different species. The H19 expression in PA fetuses and placentas was significantly up-regulated compared with that in the control samples. Similar results were shown in mice, and the expression of H19 in PA fetuses was approximately 5-fold higher than that in control bi-parental fetuses (Sotomaru et al., 2002). Similar to pigs, a previous study showed that the expression of H19 in the PA blastocyst was higher
than that in the IVF blastocyst (Park et al., 2011). The high level of H19 expression might contribute to the developmental failures observed in PA embryos. The lethal effects were manifested through the ectopic expression of the H19 gene in mice (Brunkow and Tilghman, 1991), but the loss of this gene was not lethal (Leighton et al., 1995). The down-regulation of H19 expression enhances the complete differentiation of PA ESCs into all 3 germ layers (Ragina et al., 2012), indicating that the moderate expression of H19 is important for embryonic development. DNA methylation plays a critical role in the regulation of gene transcription and expression. Therefore, the methylation of Igf2/H19 DMR3 in both PA fetuses and placentas was also determined in the present study. The results showed that the methylation of Igf2/H19 DMR3 was low in PA fetuses and placentas compared with that in the control samples. Previous studies have shown that the Igf2/H19 DMR3 was fully methylated and hemimethylated in parthenogenetic zygotes and in vitro fertilized zygotes, respectively (Park et al., 2008). However, in the present study, the methylation varied in different fetuses or placentas. On one hand, the extent of reprogramming would be not the same in different PA embryos. On the other hand, disruption of the expression of certain genes reciprocally affects the methylation of Igf2/H19 DMR3. Whatever, DNA methylation is only one of many potential epigenetic modifications. Further research is needed to identify other modifications, such as histone acetylation, and phosphorylation. In conclusion, the results of the present study showed the aberrant expression of H19 and Igf2 in PA samples. Adjusting the expression of H19 and Igf2 to adequate levels could potentially contribute to the full-term development
108
X. Han et al. / Animal Reproduction Science 139 (2013) 101–108
of PA fetuses. In 2004, parthenogenetic mice were generated through blocking the expression of H19 and increasing the activity of Igf2 (Kono et al., 2004). Recently, viable mice were produced through the oocyte-injection of genetically engineered haploid stem cells (Li et al., 2012). Thus, the harvesting of parthenogenetic pigs could largely benefit future medical research. Acknowledgements The authors would like to thank Qingkai Guo, Jian Wang, Xue Chen, Peiyan Hu and Yong Fang from the Embryo Engineering Center for technical assistance. This work was financially supported through funding from the National Natural Science Foundation of China (Grant No. 31201080). The Project was also funded through a grant from the Key Laboratory of Regenerative Biology, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences. References Bebbere, D., Bogliolo, L., Ariu, F., Fois, S., Leoni, G.G., Succu, S., Berlinguer, F., Ledda, S., 2010. Different temporal gene expression patterns for ovine pre-implantation embryos produced by parthenogenesis or in vitro fertilization. Theriogenology 74, 712–723. Brevini, I.A.L., Gandolfi, F., 2008. Parthenotes as a source of embryonic stem cells. Cell Proliferat. 41, 20–30. Brunkow, M.E., Tilghman, S.M., 1991. Ectopic expression of the H19 gene in mice causes prenatal lethality. Genes Dev. 5, 1092–1101. Charalambous, M., da Rocha, S.T., Ferguson-Smith, A.C., 2007. Genomic imprinting, growth control and the allocation of nutritional resources: consequences for postnatal life. Curr. Opin. Endocrinol. Diabetes Obesity 14, 3–12. Gabory, A., Ripoche, M.A., Yoshimizu, T., Dandolo, L., 2006. The H19 gene: regulation and function of a non-coding RNA. Cytogenet. Genome Res. 113, 188–193. Harvey, M.B., Kaye, P.L., 1992. IGF-2 stimulates growth and metabolism of early mouse embryos. Mech. Dev. 38, 169–173. Hikichi, T., Wakayama, S., Mizutani, E., Takashima, Y., Kishigami, S., Van Thuan, N., Ohta, H., Bui, H.T., Nishikawa, S.I., Wakayama, Differentiation potential of parthenogenetic embryT., 2007. onic stem cells is improved by nuclear transfer. Stem Cells 25, 46–53. Kono, T., Obata, Y., Wu, Q.L., Niwa, K., Ono, Y., Yamamoto, Y., Park, E.S., Seo, J.S., Ogawa, H., 2004. Birth of parthenogenetic mice that can develop to adulthood. Nature 428, 860–864. Lai, L., Kolber-Simonds, D., Park, K.W., Cheong, H.T., Greenstein, J.L., Im, G.S., Samuel, M., Bonk, A., Rieke, A., Day, B.N., Murphy, C.N., Carter, D.B., Hawley, R.J., Prather, R.S., 2002. Production of alpha-1,3-galactosyltransferase knockout pigs by nuclear transfer cloning. Science 295, 1089–1092.
Leighton, P.A., Saam, J.R., Ingram, R.S., Stewart, C.L., Tilghman, S.M., 1995. An enhancer deletion affects both H19 and Igf2 expression. Genes Dev. 9, 2079–2089. Li, W., Shuai, L., Wan, H., Dong, M., Wang, M., Sang, L., Feng, C., Luo, G.Z., Li, T., Li, X., Wang, L., Zheng, Q.Y., Sheng, C., Wu, H.J., Liu, Z., Liu, L., Wang, X.J., Zhao, X.Y., Zhou, Q., 2012. Androgenetic haploid embryonic stem cells produce live transgenic mice. Nature 490, 407–411. Lim, A.L., Ng, S., Leow, S.C., Choo, R., Ito, M., Chan, Y.H., Goh, S.K., Tng, E., Kwek, K., Chong, Y.S., Gluckman, P.D., Ferguson-Smith, A.C., 2012. Epigenetic state and expression of imprinted genes in umbilical cord correlates with growth parameters in human pregnancy. J. Med. Genet. 49, 689–697. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(−Delta Delta C) method. Methods 25, 402–408. McGrath, J., Solter, D., 1984. Completion of mouse embryogenesis requires both the maternal and paternal genomes. Cell 37, 179–183. O’Dell, S.D., Day, I.N.M., 1998. Molecules in focus insulin-like growth factor II (IGF-II). Int. J. Biochem. Cell Biol. 30, 767–771. Park, C.H., Kim, H.S., Ka, H., Lee, C.K., 2008. Methylation status of differentially methylated regions at Igf2/H19 locus in porcine gametes. Biol. Reprod., 135. Park, C.H., Kim, H.S., Lee, S.G., Lee, C.K., 2009. Methylation status of differentially methylated regions at Igf2/H19 locus in porcine gametes and preimplantation embryos. Genomics 93, 179–186. Park, C.H., Uh, K.J., Mulligan, B.P., Jeung, E.B., Hyun, S.H., Shin, T., Ka, H., Lee, C.K., 2011. Analysis of imprinted gene expression in normal fertilized and uniparental preimplantation porcine embryos. PLoS ONE 6, e22216. Platonov, E.S., 2005. Genomic imprinting and problem of parthenogenesis in mammals. Ontogenez 36, 300–309. Ragina, N.P., Schlosser, K., Knott, J.G., Senagore, P.K., Swiatek, P.J., Chang, E.A., Fakhouri, W.D., Schutte, B.C., Kiupel, M., Cibelli, J.B., 2012. Downregulation of H19 improves the differentiation potential of mouse parthenogenetic embryonic stem cells. Stem Cells Dev. 21, 1134–1144. Reik, W., Dean, W., 2001. DNA methylation and mammalian epigenetics. Electrophoresis 22, 2838–2843. Sotomaru, Y., Katsuzawa, Y., Hatada, I., Obata, Y., Sasaki, H., Kono, T., 2002. Unregulated expression of the imprinted genes H19 and Igf2r in mouse uniparental fetuses. J. Biol. Chem. 277, 12474–12478. Surani, M.A., Barton, S.C., Norris, M.L., 1984. Development of reconstituted mouse eggs suggests imprinting of the genome during gametogenesis. Nature 308, 548–550. Tran, V.G., Court, F., Duputie, A., Antoine, E., Aptel, N., Milligan, L., Carbonell, F., Lelay-Taha, M.N., Piette, J., Weber, M., Montarras, D., Pinset, C., Dandolo, L., Forne, T., Cathala, G., 2012. H19 antisense RNA can upregulate Igf2 transcription by activation of a novel promoter in mouse myoblasts. PLoS ONE 7. Viville, S., Surani, M.A., 1995. Towards unravelling the Igf2/H19 imprinted domain. Bioessays 17, 835–838. Zhu, J., King, T., Dobrinsky, J., Harkness, L., Ferrier, T., Bosma, W., Schreier, L.L., Guthrie, H.D., DeSousa, P., Wilmut, I., 2003. In vitro and in vivo developmental competence of ovulated and in vitro matured porcine oocytes activated by electrical activation. Cloning Stem Cells 5, 355–365.
Contents lists available at SciVerse ScienceDirect
Animal Reproduction Science journal homepage: www.elsevier.com/locate/anireprosci
Aberrant expression of Igf2/H19 in porcine parthenogenetic fetuses and placentas Xiaolei Han 1 , Hongsheng Ouyang 1 , Xianju Chen 1 , Yongye Huang, Yuning Song, Mingjun Zhang, Daxin Pang, Liangxue Lai, Zhanjun Li ∗ Jilin Provincial Key Laboratory of Animal Embryo Engineering, College of Animal Sciences, Jilin University, Changchun 130062, China
a r t i c l e
i n f o
Article history: Received 12 December 2012 Received in revised form 2 April 2013 Accepted 14 April 2013 Available online 19 April 2013 Keywords: Pig Parthenogenetic H19 Igf2 Methylation
a b s t r a c t The aberrant expression of imprinted genes induces parthenogenetic fetal and placental dysplasia, thus leading to failures in embryonic development. Igf2 and H19 are co-expressed in endoderm and mesoderm-derived tissues and play an important role in normal embryo and extraembryonic development. In this study, the expression and methylation of Igf2/H19 in porcine parthenogenetic fetuses and placentas which had grown 28 days was examined first time to further characterize mammalian parthenogenesis. Weight and morphological comparisons were conducted between parthenogenetic embryos on Day 28 and normal fertilized embryos (control). The results indicated that parthenogenetic fetuses and placentas had smaller weights and volumes than those of the control. In addition, quantitative RT-PCR (qRT-PCR) analysis was performed to determine Igf2/H19 expression levels, showing that the expression of H19 was up-regulated, while Igf2 expression was almost undetectable in both parthenogenetic fetuses and placentas. As a potential mechanism underlying this disrupted expression, the methylation of Igf2/H19 DMR3 was detected using bisulfite sequencing PCR analysis, which revealed the significant hypomethylation of DMR3 in parthenogenetic fetuses and placentas. These results suggest that disruption of Igf2/H19 expression in parthenogenetic fetuses and placentas contributes to implantation failure and/or abortion in swine parthenogenesis, which might be associated with differential methylation patterns in the imprinting control region of imprinted genes. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Parthenogenesis is a form of asexual reproduction, in which an oocyte develops into an embryo without fertilization (Hikichi et al., 2007). Parthenogenetic (PA) mammals could serve as important biological research models and novel sources for the derivation of PA pluripotent cell lines (Brevini and Gandolfi, 2008). However, natural parthenogenesis primarily exists in lower animals, such as insects
∗ Corresponding author at: College of Animal Sciences, 5333#, Xi’an Road, Changchun 130062, China. Tel.: +86 431 87836175; fax: +86 431 87980131. E-mail address: lizj [email protected] (Z. Li). 1 These authors contributed to the article equally. 0378-4320/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.anireprosci.2013.04.008
and plants, and there are no known instances of naturally occurring mammalian parthenogenesis in the wild. Thus, many attempts have been made to develop PA animal models in the last few years. Parthenogenesis has been artificially induced in mice (Kono et al., 2004). However, until recently, the successful generation of parthenogenetic (PA) pigs has not been reported. Previous studies have shown that both maternal and paternal genomes are essential for embryogenesis and lacking either one could lead to developmental failure (McGrath and Solter, 1984). It had been shown that paternally expressed imprinted genes were required for the development of extraembryonic tissues (Surani et al., 1984). Embryos generated through parthenogenetic activation lack paternally expressed imprinted genes. In addition, the diploid PA embryo should theoretically have
102
X. Han et al. / Animal Reproduction Science 139 (2013) 101–108
double doses of maternally expressed imprinted genes. PA embryos develop to the segmentation period and are easily lost during gestation in many species. In rabbits, sheep and cattle, implanted PA embryos die at 12, 21, and 30 days of gestation, respectively (Zhu et al., 2003). Studies have shown that genomic imprinting plays a key role in this abnormal phenomenon (Reik and Dean, 2001; Platonov, 2005). Currently, there are approximately 140 imprinted genes that have been identified in mammals (http://igc.otago.ac.nz/home.html). Thus, the appropriate expression of imprinted genes might be required to rescue the hypoplasia of parthenogenesis. The imprinted gene insulin-like growth factor II (Igf2) is critical for mammalian growth, fetal cell division and differentiation, and metabolic regulation (O’Dell and Day, 1998). The H19 gene, which encodes a 2.3-kb non-coding mRNA, is strongly expressed during embryogenesis (Gabory et al., 2006). The Igf2 and H19 genes are located on chromosome 7 in mice, chromosome 2p1.7 in pigs and chromosome 11p15.5 in humans (http://igc.otago.ac.nz/home.html). H19 is closely linked with Igf2, which is expressed by the paternal allele, while H19 is transcribed from the maternal allele (Park et al., 2009). These two genes were the first endogenous imprinted genes identified (Viville and Surani, 1995), and the expression of these genes is regulated through DNA methylation via the CCCTC-binding factor (Park et al., 2009). Studies have shown that an antisense H19 transcript regulates Igf2 transcription through the activation of a novel promoter in mouse myoblasts (Tran et al., 2012). However, although the H19 gene was discovered over 20 years ago, the precise function of this gene remains unknown. Due to the important role of Igf2/H19 in fetal and placental development, these two genes might also be critical for PA fetal development. There have been many reports concerning the expression and methylation of Igf2/H19. However, the role of Igf2/H19 in the development of porcine PA fetuses and placentas is limited. Therefore, in the present study, we examined the morphology, Igf2/H19 expression and DMR3-mediated methylation of PA fetuses and placentas.
2. Materials and methods
hormone, 0.5 g/ml luteinizing hormone, 75 g/ml penicillin and 50 g/ml streptomycin. 2.2. The parthenogenetic activation of MII oocytes After maturation culturing for 42 to 44 h at 38.5 ◦ C in humidified air containing 5% CO2 , the cumulus cells of COCs were removed from the oocytes through repeated pipetting in a PVA-TL HEPES stock solution supplemented with 0.1% hyaluronidase. Rounded oocytes with an extruded first polar body and intact cytoplasm were selected. The selected oocytes were pooled in a chamber filled with fusion medium (0.3 M mannitol, 1.0 mM CaCl2 ·2H2 O, 1.0 mM MgCl2 ·6H2 O, and 0.5 mM Hepes), and 2 DC pulses of 1.2 kV/cm for 30 s were subsequently administered using a BTX Electro Cell Manipulator 2001 (BTX, San Diego, CA). After activation, the oocytes were cultured in PZM-3 medium supplemented with 7.5 g/ml cytochalasin B for 4 h. The embryos were cultured in PZM-3 medium at 38.5 ◦ C in a humidified atmosphere containing 5% CO2 for 24 h until embryo transfer. 2.3. Embryo transfer and fetuses harvest One day after parthenogenetic activation, the embryos were transferred into the oviduct of the surrogate sow. Pregnancy was determined on Day 28 after embryo transfer using ultrasound examination, then the pregnant sows subjected to PA embryo transfer or artificial insemination were anesthetized, and the fetuses and placentas were collected from each uterine horn. The brain, liver, trunk, and placenta of the collected fetuses were individually placed in cryovials and stored in liquid nitrogen until further use. 2.4. Fetal fibroblast cell harvest The collected fetuses were digested with collagenase (200 IU/ml) and DNase I (25 KU/ml) after the head, viscera, limbs and tail were discarded. The cell pellets was pooled in 10-cm culture plates (Nunc, Roskilde, Danmark) after washing and digestion, and the cells were subsequently frozen and stored in liquid nitrogen. The cell freezing medium contained 90% FBS and 10% dimethyl sulfoxide (DMSO; Amresco). One or two days before use, the cells were thawed and cultured.
2.1. Porcine oocyte collection and in vitro maturation 2.5. RNA isolation and synthesis of cDNA Oocyte collection and in vitro maturation was performed as previously described (Lai et al., 2002). The ovaries were collected and transported to the laboratory in saline supplemented with penicillin and streptomycin and maintained at 30 to 35 ◦ C. The oocyte–cumulus complexes (COCs) were aspirated from 3- to 6-mm ovarian follicles using an 18-gauge needle attached to a 10-cc syringe, and COCs with at least three uniform layers of cumulus cells were selected. Subsequently, COCs were cultured in TCM199 medium containing 0.1% PVA, 3.05 mM d-glucose, 0.91 mM sodium pyruvate, 10 ng/ml epidermal growth factor, 0.57 mM cysteine, 0.5 g/ml follicle-stimulating
TRNzol-A+ reagent (TIANGEN, Beijing, China) was used to extract total RNA from the PA (N = 3) and control (N = 3) samples according to the manufacturer’s instructions. The residual DNA was digested using DNase I (Fermentas). The treated RNA was used as a template for reverse transcription. First strand cDNA was synthesized using a BioRT cDNA First Strand Synthesis kit (Bioer Technology, Hangzhou, China) at a final reaction volume of 20 l containing 2 l of 5X RT Buffer, 1 l of dNTP mixture (10 mM), 0.5 l of Oligo-dTs, 0.5 l of RNase inhibitor (40 U/l), 0.5 l of AMV Reverse Transcriptase, and 1 g of treated RNA at 42 ◦ C for
X. Han et al. / Animal Reproduction Science 139 (2013) 101–108
103
Table 1 Primers used in this study. Genes
Primer sequences (5 -3 )
Size of PCR products (bp)
Tm (◦ C)
Reference/sequence accession numbers
GAPDH
ATTCCACGGCACAGTCAAGG ACATACTCAGCACCAGCATCG GTGGACATCAGGAAGGACCTCTA ATGATCTTGATCTTCATGGTGCT AAGAGTGCTCTTCCGTAG TGTCATAGCGGAAGAACTTG CTCAAACGACAAGAGATGGT AGTGTAGTGGCTCCAGAATG GGTTTTAGGGGGATATTTTTT TTAAAAAAACATTACTTCCATATAC GATTTTTAGGTTTGTTATTATTT CAAATATTCAATAAAAAAACCC
120
58
NM 001206359.1
137
58
(Park et al., 2011)
156
58
(Park et al., 2011)
122
58
(Park et al., 2011)
/
/
(Park et al., 2009)
208
/
(Park et al., 2009)
ˇ-ACTIN Igf2 H19 DMR3 outside DMR3 inside
45 min. The samples were subsequently incubated at 95 ◦ C for 5 min to complete the reverse transcription reaction.
2.6. Selection of reference genes for gene expression The expression of each imprinted gene was evaluated based on the amplification of the reference genes expressed in fetuses and placentas using qRT-PCR. To confirm the reference gene stability, the threshold cycles (CT values) were compared among 18S, GAPDH and ˇ-ACTIN (RefFinder, http://www.leonxie.com/referencegene.php? type=reference#). The lowest export value represented the most stable reference gene.
2.7. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) The target genes were amplified using the BioEasy SYBR Green I Real Time PCR Kit (Bioer Technology, Hangzhou, China) according to the manufacturer’s instructions, with the following reaction conditions: an initial denaturation step at 95 ◦ C for 3 min, 40 cycles of denaturation at 95 ◦ C for 10 s, annealing at 55 ◦ C for 15 s, and extension at 72 ◦ C for 30 s. Amplification and detection were performed using a BIO-RAD iQ5 Multicolor Real-Time PCR Detection System. The detection of gene expression was performed three times among templates harvested from three different samples. The 2− CT formula was used to determine the relative gene expression (Livak and Schmittgen, 2001).
2.8. DNA isolation and bisulfite treatment The genomic DNA was isolated using the TIANmp Genomic DNA Kit (TIANGEN, Beijing, China) from the PA (N = 3) and control (N = 3) samples, then the genomic DNA was subjected to bisulfite treatment using a CpGenomeTM Turbo Bisulfite Modification Kit (Millipore). Approximately 200 ng of DNA was denatured using 0.3 N NaOH at 37 ◦ C for 10 min. Subsequently, 120 l of fresh DNA modification reagent was added, and the reaction mixture was incubated at 70 ◦ C for 40 min. After modification, the DNA was desalted, purified, and eluted with 25 l of elution buffer. The purified DNA was stored at -20 ◦ C until further use.
2.9. Bisulfite sequencing PCR (BSP) analysis The DMR3 outside and DMR3 inside primers for the nested PCR amplification of bisulfite-treated DNA are described in Table 1. The first amplification was performed using Taq Plus PCR Master Mix (TIANGEN, Beijing, China) under the following reaction conditions: one cycle at 94 ◦ C for 3 min; 35 cycles of denaturation at 94 ◦ C for 30 s, annealing at 55 ◦ C for 30 s and extension at 72 ◦ C for 1 min, followed by a final extension cycle at 72 ◦ C for 5 min. The second PCR amplification was performed under the same conditions, except the extension was conducted at 72 ◦ C for 40 s. The PCR products were purified using a TIANgel Midi Purification Kit (Tiangen, Beijing, China) and cloned into the PGM-T vector (Tiangen, Beijing, China). Subsequently, the product was transformed into DH5␣ cells (Tiangen, Beijing, China). Ten positive plasmid clones were sequenced at Tiangen Corporation. All experiments were repeated at least three times. 2.10. Statistical analysis The weight and gene expression of the PA and control samples were compared using students t tests with SPSS 16.0 software (SPSS Inc., Chicago, IL, USA). 3. Results 3.1. Production of parthenogenetic fetuses In the present study, the parthenogenetic fetuses were firstly produced. As shown in Table 2, embryo transfer were performed into 6 recipient sows with 210 embryos on Table 2 In vivo development of porcine parthenogenetic embryo. Recipient sows
No. of embryos transferred
Pregnancy on day 28
No. of fetuses collected
0251 0561 595 592 0608 L0330
160 180 217 283 220 200
Yes Yes No No Yes Yes
17 7 None None 5 7
104
X. Han et al. / Animal Reproduction Science 139 (2013) 101–108
Fig. 1. Weight and morphological comparisons between Day 28 PA and Control samples A. Morphological comparisons were performed between PA and control fetuses on Day 28 of gestation. It shows obviously that the PA fetuses were smaller than the control. Fetal (B) and placental (C) weight was compared between control (N = 23) and PA (N = 18) at Day 28 of gestation. N indicates the number of observations. This data is presented as mean ± SEM. *p < 0.05.
average. Using ultrasound examination, 4 of these recipient sows were detected to be pregnant on Day 23. Finally, a total of 36 parthenogenetic fetuses and placentas were collected on Day 28.
were observed in the PA fetuses and placentas compared with the control samples (Fig. 1B and C). Thus, the abortion or resorption of defective fetuses and abnormal placentas occurs later.
3.2. Day 28 PA samples showed smaller morphology and weight
3.3. Aberrant gene expression of H19 and Igf2 in PA samples
A morphological comparison was performed between the PA (N = 23) and control (N = 18) fetuses which have grown 28 days. As shown in Fig. 1A, the PA fetuses were smaller than the control samples. Notably, the sizes of the fetuses differed, even among the same sample of PA fetuses (the small size is indicated with an arrow), suggesting that development among PA fetuses was unsynchronized. Significant reductions in the weight of fetuses and placentas
The expression of reference genes also varies under different circumstances. To select suitable reference genes for fetus, placenta, liver, brain, torso, and fibroblast cells, the gene stability of 18S, GAPDH and ˇ-ACTIN were determined. As shown in Fig. 2, GAPDH is a relatively stable reference gene for fetus (A), liver (C), torso (E), and fibroblast cells (F), and ˇ-ACTIN is a stable reference gene for placenta (B) and brain (D). Therefore, the housekeeping genes GAPDH and
X. Han et al. / Animal Reproduction Science 139 (2013) 101–108
105
Fig. 2. The selection of sable reference genes for gene expression analysis using online tool of RefFinder. Potential housekeeping genes in PA samples were selected by RefFinder, A: Fetus, B: Placenta, C: Liver, D: Brain, E: Torso, F: Cell.
ˇ-ACTIN were selected as reference genes for the subsequent experiments. A two-fold increase in the expression of H19 in PA samples containing double maternal chromosomes is expected. However, although the H19 genes exhibited significant higher expression levels in PA fetuses and placentas than those in the control samples (Fig. 3A), the data showed that the expression of H19 was not two-fold as anticipated. Instead, disordered expression was observed. Similar results were observed for the expression of Igf2. Theoretically, PA samples are not expected to contain Igf2
mRNA. However, the results revealed that Igf2 mRNA was detected in PA samples, despite the conspicuously low expression levels (Fig. 3B). Therefore, we hypothesized that the expression of both H19 and Igf2 was disrupted. To further confirm this hypothesis, experiments were conducted in the liver, brain, torso, and fibroblast cells of PA and control samples (Fig. 3A and B). Expectedly, the results were consistent with those of previous studies showing that the expression of H19 in most tested organs was higher than two-fold compared with that in the control and the expression of Igf2 was almost undetectable.
106
X. Han et al. / Animal Reproduction Science 139 (2013) 101–108
Fig. 3. Relative expression levels of Igf2/H19 in PA sample of fetuses, placentas, liver, brain, torso, and fibroblast cells. The expression of H19 (A) and Igf2 (B) was analyzed by quantitative real-time PCR (qRT-PCR), after normalization relative to reference gene which is listed in Fig. 2, and then calculated by the method of 2− CT. This data is presented as mean ± SEM. Each bar represents the average value of three samples. Three repeats were performed on every sample. *p < 0.05; **p < 0.01.
3.4. Typical hypomethylation of Igf2/H19 DMR3
4. Discussion
DNA methylation plays an important role in the regulation of imprinting gene expression. Bisulfate sequencing of Igf2/H19 DMR3 was performed to identify the mechanism underlying the aberrant expression of H19 and Igf2. The results showed that methylation level of Igf2/H19 DMR3 was lower in PA fetuses (7 ± 10%) compared with that in control fetuses (49 ± 12%) (Fig. 4A and B). Similarly, the methylation of Igf2/H19 DMR3 in the control placentas (71 ± 20%) was significantly higher than that in PA placentas (17 ± 15%) (Fig. 4C and D). These results indicated that methylation in PA fetuses and placentas were low compared with that in the control samples.
In the present study, the PA fetuses weighed less than those in the control. The smaller volume and lower weight of the PA fetuses and placentas potentially reflects developmental failures. The increased expression of maternally expressed imprinted genes potentially restricts the growth of PA fetuses. In addition, the nutrient levels of PA fetuses are inadequately supplied through the maternal environment. A network of imprinted genes, such as Igf2, Igf2r, Cdkn1c and Grb10, are expressed in the embryo and placentas, which act prenatally to determine set points of energy metabolism (Charalambous et al., 2007). In addition, a recent study has shown that the expression of pleckstrin homology-like domain family A member 2 (PHLDA2)
X. Han et al. / Animal Reproduction Science 139 (2013) 101–108
107
Fig. 4. The methylation status of Igf2/H19 DMR3 in porcine parthenogenetic fetuses and placentas. H19 DMR3 methylation patterns in Control fetuses (A), PA fetuses (B), Control placentas (C), and PA placentas (D) were detected by BSP. Open and closed circles represent unmethylated and methylated CpG sites, respectively. Each horizontal line means an independent clone of amplified PCR products.
was associated with birth weight (Lim et al., 2012). Thus, the reduced weight of PA fetuses might result from the disrupted expression of imprinted genes, which is likely associated with abnormal energy metabolism. The expression of Igf2 is positively associated with early embryonic development. A previous study has shown that when Igf2 is added to defined culture medium for the culture of 2-cell embryos, the blastocyst-forming rate, ICM mitogenesis, and protein synthesis were stimulated, supporting a role for this gene in early development (Harvey and Kaye, 1992). This result suggests that an increased Igf2 concentration enhances pre-implantation development. However, as shown in the present study, the expression of Igf2 in different organs from PA fetuses was low, which might restrict PA embryo development. Certainly, although with thoroughly washing, it still could not be excluded the possibility that there was maternal blood contamination in the collected samples, what may also be account for the detection of a small amount of Igf2 transcript in the PA samples. In ovine, however, a previous study showed that no differences in the expression of Igf2 were observed between PA and IVF at the two cell-stage, while significantly higher Igf2 expression in PA morulae and blastocysts was observed compared with IVF embryos (Bebbere et al., 2010), suggesting that Igf2 might play different roles in different species. The H19 expression in PA fetuses and placentas was significantly up-regulated compared with that in the control samples. Similar results were shown in mice, and the expression of H19 in PA fetuses was approximately 5-fold higher than that in control bi-parental fetuses (Sotomaru et al., 2002). Similar to pigs, a previous study showed that the expression of H19 in the PA blastocyst was higher
than that in the IVF blastocyst (Park et al., 2011). The high level of H19 expression might contribute to the developmental failures observed in PA embryos. The lethal effects were manifested through the ectopic expression of the H19 gene in mice (Brunkow and Tilghman, 1991), but the loss of this gene was not lethal (Leighton et al., 1995). The down-regulation of H19 expression enhances the complete differentiation of PA ESCs into all 3 germ layers (Ragina et al., 2012), indicating that the moderate expression of H19 is important for embryonic development. DNA methylation plays a critical role in the regulation of gene transcription and expression. Therefore, the methylation of Igf2/H19 DMR3 in both PA fetuses and placentas was also determined in the present study. The results showed that the methylation of Igf2/H19 DMR3 was low in PA fetuses and placentas compared with that in the control samples. Previous studies have shown that the Igf2/H19 DMR3 was fully methylated and hemimethylated in parthenogenetic zygotes and in vitro fertilized zygotes, respectively (Park et al., 2008). However, in the present study, the methylation varied in different fetuses or placentas. On one hand, the extent of reprogramming would be not the same in different PA embryos. On the other hand, disruption of the expression of certain genes reciprocally affects the methylation of Igf2/H19 DMR3. Whatever, DNA methylation is only one of many potential epigenetic modifications. Further research is needed to identify other modifications, such as histone acetylation, and phosphorylation. In conclusion, the results of the present study showed the aberrant expression of H19 and Igf2 in PA samples. Adjusting the expression of H19 and Igf2 to adequate levels could potentially contribute to the full-term development
108
X. Han et al. / Animal Reproduction Science 139 (2013) 101–108
of PA fetuses. In 2004, parthenogenetic mice were generated through blocking the expression of H19 and increasing the activity of Igf2 (Kono et al., 2004). Recently, viable mice were produced through the oocyte-injection of genetically engineered haploid stem cells (Li et al., 2012). Thus, the harvesting of parthenogenetic pigs could largely benefit future medical research. Acknowledgements The authors would like to thank Qingkai Guo, Jian Wang, Xue Chen, Peiyan Hu and Yong Fang from the Embryo Engineering Center for technical assistance. This work was financially supported through funding from the National Natural Science Foundation of China (Grant No. 31201080). The Project was also funded through a grant from the Key Laboratory of Regenerative Biology, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences. References Bebbere, D., Bogliolo, L., Ariu, F., Fois, S., Leoni, G.G., Succu, S., Berlinguer, F., Ledda, S., 2010. Different temporal gene expression patterns for ovine pre-implantation embryos produced by parthenogenesis or in vitro fertilization. Theriogenology 74, 712–723. Brevini, I.A.L., Gandolfi, F., 2008. Parthenotes as a source of embryonic stem cells. Cell Proliferat. 41, 20–30. Brunkow, M.E., Tilghman, S.M., 1991. Ectopic expression of the H19 gene in mice causes prenatal lethality. Genes Dev. 5, 1092–1101. Charalambous, M., da Rocha, S.T., Ferguson-Smith, A.C., 2007. Genomic imprinting, growth control and the allocation of nutritional resources: consequences for postnatal life. Curr. Opin. Endocrinol. Diabetes Obesity 14, 3–12. Gabory, A., Ripoche, M.A., Yoshimizu, T., Dandolo, L., 2006. The H19 gene: regulation and function of a non-coding RNA. Cytogenet. Genome Res. 113, 188–193. Harvey, M.B., Kaye, P.L., 1992. IGF-2 stimulates growth and metabolism of early mouse embryos. Mech. Dev. 38, 169–173. Hikichi, T., Wakayama, S., Mizutani, E., Takashima, Y., Kishigami, S., Van Thuan, N., Ohta, H., Bui, H.T., Nishikawa, S.I., Wakayama, Differentiation potential of parthenogenetic embryT., 2007. onic stem cells is improved by nuclear transfer. Stem Cells 25, 46–53. Kono, T., Obata, Y., Wu, Q.L., Niwa, K., Ono, Y., Yamamoto, Y., Park, E.S., Seo, J.S., Ogawa, H., 2004. Birth of parthenogenetic mice that can develop to adulthood. Nature 428, 860–864. Lai, L., Kolber-Simonds, D., Park, K.W., Cheong, H.T., Greenstein, J.L., Im, G.S., Samuel, M., Bonk, A., Rieke, A., Day, B.N., Murphy, C.N., Carter, D.B., Hawley, R.J., Prather, R.S., 2002. Production of alpha-1,3-galactosyltransferase knockout pigs by nuclear transfer cloning. Science 295, 1089–1092.
Leighton, P.A., Saam, J.R., Ingram, R.S., Stewart, C.L., Tilghman, S.M., 1995. An enhancer deletion affects both H19 and Igf2 expression. Genes Dev. 9, 2079–2089. Li, W., Shuai, L., Wan, H., Dong, M., Wang, M., Sang, L., Feng, C., Luo, G.Z., Li, T., Li, X., Wang, L., Zheng, Q.Y., Sheng, C., Wu, H.J., Liu, Z., Liu, L., Wang, X.J., Zhao, X.Y., Zhou, Q., 2012. Androgenetic haploid embryonic stem cells produce live transgenic mice. Nature 490, 407–411. Lim, A.L., Ng, S., Leow, S.C., Choo, R., Ito, M., Chan, Y.H., Goh, S.K., Tng, E., Kwek, K., Chong, Y.S., Gluckman, P.D., Ferguson-Smith, A.C., 2012. Epigenetic state and expression of imprinted genes in umbilical cord correlates with growth parameters in human pregnancy. J. Med. Genet. 49, 689–697. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(−Delta Delta C) method. Methods 25, 402–408. McGrath, J., Solter, D., 1984. Completion of mouse embryogenesis requires both the maternal and paternal genomes. Cell 37, 179–183. O’Dell, S.D., Day, I.N.M., 1998. Molecules in focus insulin-like growth factor II (IGF-II). Int. J. Biochem. Cell Biol. 30, 767–771. Park, C.H., Kim, H.S., Ka, H., Lee, C.K., 2008. Methylation status of differentially methylated regions at Igf2/H19 locus in porcine gametes. Biol. Reprod., 135. Park, C.H., Kim, H.S., Lee, S.G., Lee, C.K., 2009. Methylation status of differentially methylated regions at Igf2/H19 locus in porcine gametes and preimplantation embryos. Genomics 93, 179–186. Park, C.H., Uh, K.J., Mulligan, B.P., Jeung, E.B., Hyun, S.H., Shin, T., Ka, H., Lee, C.K., 2011. Analysis of imprinted gene expression in normal fertilized and uniparental preimplantation porcine embryos. PLoS ONE 6, e22216. Platonov, E.S., 2005. Genomic imprinting and problem of parthenogenesis in mammals. Ontogenez 36, 300–309. Ragina, N.P., Schlosser, K., Knott, J.G., Senagore, P.K., Swiatek, P.J., Chang, E.A., Fakhouri, W.D., Schutte, B.C., Kiupel, M., Cibelli, J.B., 2012. Downregulation of H19 improves the differentiation potential of mouse parthenogenetic embryonic stem cells. Stem Cells Dev. 21, 1134–1144. Reik, W., Dean, W., 2001. DNA methylation and mammalian epigenetics. Electrophoresis 22, 2838–2843. Sotomaru, Y., Katsuzawa, Y., Hatada, I., Obata, Y., Sasaki, H., Kono, T., 2002. Unregulated expression of the imprinted genes H19 and Igf2r in mouse uniparental fetuses. J. Biol. Chem. 277, 12474–12478. Surani, M.A., Barton, S.C., Norris, M.L., 1984. Development of reconstituted mouse eggs suggests imprinting of the genome during gametogenesis. Nature 308, 548–550. Tran, V.G., Court, F., Duputie, A., Antoine, E., Aptel, N., Milligan, L., Carbonell, F., Lelay-Taha, M.N., Piette, J., Weber, M., Montarras, D., Pinset, C., Dandolo, L., Forne, T., Cathala, G., 2012. H19 antisense RNA can upregulate Igf2 transcription by activation of a novel promoter in mouse myoblasts. PLoS ONE 7. Viville, S., Surani, M.A., 1995. Towards unravelling the Igf2/H19 imprinted domain. Bioessays 17, 835–838. Zhu, J., King, T., Dobrinsky, J., Harkness, L., Ferrier, T., Bosma, W., Schreier, L.L., Guthrie, H.D., DeSousa, P., Wilmut, I., 2003. In vitro and in vivo developmental competence of ovulated and in vitro matured porcine oocytes activated by electrical activation. Cloning Stem Cells 5, 355–365.