adhesion molecules

Comparative Immunology, Microbiology and Infectious Diseases 48 (2016) 22–32

Contents lists available at ScienceDirect

Comparative Immunology, Microbiology and Infectious Diseases journal homepage: www.elsevier.com/locate/cimid

Ablation of CD11chi dendritic cells exacerbates Japanese encephalitis by regulating blood-brain barrier permeability and altering tight junction/adhesion molecules Jin Hyoung Kim a,1 , Ferdaus Mohd Altaf Hossain a,1 , Ajit Mahadev Patil a , Jin Young Choi a , Seong Bum Kim a , Erdenebelig Uyangaa a , Sang-Youel Park a,b , John-Hwa Lee a,b , Bumseok Kim a , Koanhoi Kim c , Seong Kug Eo a,b,∗ a

College of Veterinary Medicine and Bio-Safety Research Institute, Chonbuk National University, Iksan 54596, Republic of Korea Department of Bioactive Material Sciences, Graduate School, Chonbuk National University, Jeonju 54896, Republic of Korea c Department of Pharmacology, Pusan National University, School of Medicine, Yangsan 50612, Republic of Korea b

a r t i c l e

i n f o

Article history: Received 1 April 2016 Received in revised form 18 July 2016 Accepted 23 July 2016 Keywords: CD11chi DCs Japanese encephalitis virus Blood-brain barrier Tight junction Adhesion molecules

a b s t r a c t Japanese encephalitis (JE), characterized by extensive neuroinflammation following infection with neurotropic JE virus (JEV), is becoming a leading cause of viral encephalitis due to rapid changes in climate and demography. The blood-brain barrier (BBB) plays an important role in restricting neuroinvasion of peripheral leukocytes and virus, thereby regulating the progression of viral encephalitis. In this study, we explored the role of CD11chi dendritic cells (DCs) in regulating BBB integrity and JE progression using a conditional depletion model of CD11chi DCs. Transient ablation of CD11chi DCs resulted in markedly increased susceptibility to JE progression along with highly increased neuro-invasion of JEV. In addition, exacerbated JE progression in CD11chi DC-ablated hosts was closely associated with increased expression of proinflammatory cytokines (IFN-␤, IL-6, and TNF-␣) and CC chemokines (CCL2, CCL3, CXCL2) in the brain. Moreover, our results revealed that the exacerbation of JE progression in CD11chi DC-ablated hosts was correlated with enhanced BBB permeability and reduced expression of tight junction and adhesion molecules (claudin-5, ZO-1, occluding, JAMs). Ultimately, our data conclude that the ablation of CD11chi DCs provided a subsidiary impact on BBB integrity and the expression of tight junction/adhesion molecules, thereby leading to exacerbated JE progression. These findings provide insight into the secondary role of CD11chi DCs in JE progression through regulation of BBB integrity and the expression of tight junction/adhesion molecules. © 2016 Elsevier Ltd. All rights reserved.

1. Introduction Among all neurotropic causes of viral encephalitis, Japanese encephalitis virus (JEV) is considered to be the most serious, due to its neuropathological impacts, higher fatality rate, and permanent neuropsychiatric sequelae [1]. Currently, JEV is spreading to previously unaffected regions such as Indonesia, Pakistan, and northern Australia due to rapid changes in climate and demography [2,3]. Considerable progress has been made in our understanding of JE pathogenesis, an acute neuroinflammation caused by JEV infection,

∗ Corresponding author at: College of Veterinary Medicine and Bio-Safety Research Institute, Chonbuk National University, Iksan 54596, Republic of Korea. E-mail address: [email protected] (S.K. Eo). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.cimid.2016.07.007 0147-9571/© 2016 Elsevier Ltd. All rights reserved.

in both infected patients and murine models [4–9]. JEV replicates within monocytes/macrophages and dendritic cells (DCs) as primary target cells [10], through which the virus is routed from the periphery to the CNS, leading to neurological disorders [11]. Like acute viral encephalitis caused by other flaviviruses, JE is characterized by CNS infiltration of peripheral leukocytes in the perivascular space and parenchyma [11]. Furthermore, the blood-brain barrier (BBB) plays a critical role in regulating neuroinvasion of peripheral leukocytes, although it seems infrangible until the late phase of encephalitis [12,13]. Junctional proteins on infiltrated monocytes and macrophages contribute to contemporaneous interactions with the BBB as they drift across the barrier, and are responsible for virus influx into the brain and subsequent outcomes of neuro-inflammation [4,12]. The core structural and anatomical basis of BBB integrity is covalently related to the appearance of tight junction transcripts and adhesion molecules

J.H. Kim et al. / Comparative Immunology, Microbiology and Infectious Diseases 48 (2016) 22–32

regulating the microenvironment. Physiologically, tight junction proteins (TJPs) like claudins and occludin are connected to the cytoskeleton by cytoplasmic proteins zonula occludens (ZOs), and BBB integrity is correlated with the expression of TJPs and adhesion molecules [14]. The BBB and TJP transcripts contribute to maintaining a distinct internal atmosphere and controlling the diffusion of solutes and polarized molecules through the intercellular space [15]. Indeed, the BBB alters and can become highly compromised as encephalitis progresses, and simultaneous loss of TJ integrity is associated with brain migration of monocyte in human immunodeficiency virus (HIV) and West Nile virus (WNV) encephalitis [16,17]. Likewise, upon JEV infection, altered patterns of cellular tight junctions in non-neuronal cells results in alteration of BBB integrity supervening a critical role in viral dissemination, and exacerbation of encephalitis [18]. Thus, alterations in the BBB and adhesion molecules may be highly related to the severity of neurotropic disease pathogenesis. Based on various immunological functions like the ability to express MHC class II, naïve T cell-stimulating capacity and potency both in vivo and in vitro, DCs act as APCs [19,20]. Furthermore, DCs play critical roles in the regulation of innate immune responses such as crosstalk with NK cells as well as links between innate and adaptive immune responses against viral infections [21], resulting in specific types of CD4+ Th responses and establishing a memory T-cell pool using costimulatory signals from DCs [22]. However, the study of DCs in the progression of neuroinflammation induced by neurotropic viral infections relies on complex phenomena of multi-cellular interactions, immune homeostasis, and tolerization, due to their relationship with other innate immune cells, including macrophages and monocytes, at the level of differentiation [23,24]. CD11b+ Ly-6Chi monocytes tend to significantly dampen the immune-privileged CNS [25] and exacerbate the pathogenesis of viral encephalitis [26], and their CNS infiltration is highly related to increased production of inflammatory cytokines and chemokines [27], alteration of BBB integrity [28], and a reduction in transcripts of tight junctions and adhesion molecules [29]. Recently, a detailed map of the close relationship between Ly-6Chi monocytes and DCs at the level of differentiation sheds light on the role of DCs in JE progression through regulation of monocyte differentiation [30]. In addition, elevated levels of systemic pro-inflammatory cytokines in the sera of DC-ablated mice may be critically related to CNS infiltration of CD11b+ Ly-6Chi monocytes and other cellular components, along with alteration in the BBB [31,32]. However, very little is known regarding the role of DCs in regulating BBB integrity during JE progression. CD11c-DTR transgenic (Tg) mice, which express the diphtheria toxin receptor (DTR) gene under control of a cloned Itgax promoter and thus allow conditional DC depletion upon DT injection, are a critical tool in the study of DC immunology in neurotropic viral infections [33]. Here, we explored the role of DCs in the regulation of BBB integrity and JE progression using a conditional depletion model of DCs. We found that higher expression of proinflammatory cytokines and dampening of tight junction molecules were closely associated with BBB alterations, along with concurrent exacerbation of JE progression. Therefore, this fact provides insight into the secondary role of DCs in JE progression via regulation of BBB integrity, providing a mechanism that allows peripheral leukocytes to gain access into the CNS.

2. Materials and methods 2.1. Ethics statement All animal experiments described in the present study were conducted at Chonbuk National University according to the guidelines

23

set by the institutional Animal Care and Use Committees (IACUC) of Chonbuk Nation University (http://lac.honamlife.com/research 05.php) and were pre-approved by the Ethical Committee for Animal Experiments of Chonbuk National University (permission code 2013-0028), which has been fully accredited by the Korean Association for Laboratory Animal Sciences (KALAS), adopted by Council of the Korean Government for Animal Care. All experimental protocols requiring biosafety were approved by Institutional Biosafety Committees (IBC) of Chonbuk National University. 2.2. Animals, cells, and viruses C57BL/6 (H-2b ) mice (4–6 weeks old) were purchased from Samtako (O-San, Korea), and CD11c-DTR transgenic (Tg) mice (B6.FVB-Tg Itgax-DTR/EGFP 57Lan/J [DTR]) were obtained from Jackson Laboratories (Bar Harbor, ME). All mice were genotyped and bred in the animal facilities of Chonbuk National University. JEV Beijing-1 strain was propagated in the mosquito cell line (C6/36) using DMEM supplemented with 2% FBS, penicillin (100 U/ml), and streptomycin (100 U/ml), as described elsewhere [30]. The virus stocks were titrated by conventional plaque assay using BHK-21 cells (CCL-10; American Type Culture Collection), and stored in aliquots at −80 ◦ C until use. Primers specific for JEV and cytokines (Table 1) were synthesized at Bioneer Corp. (Daejeon, Korea) and used for PCR amplification of target genes. 2.3. Quantification of viral burden and cytokine expression Viral burden and the expression of cytokines and chemokines in inflammatory and lymphoid tissues were determined by quantitative SYBR Green-based real-time RT-PCR (real-time qRT-PCR). Mice were infected intraperitoneally (i.p.) with JEV (1.0 LD50 ) and tissues including brain, spinal cord, and spleen were harvested at 2, 4, and 6 dpi. Total RNAs extracted from tissues using easyBLUE (iNtRON, INC., Daejeon, Korea) were employed in real-time qRT-PCR using a CFX96TM Real-Time PCR Detection system (Bio-Rad Laboratories, Hercules, CA). Following reverse transcription of total RNAs with High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Foster, CA), each reaction mixture contained 2 ␮l of template cDNA, 10 ␮l of 2 × SYBR Primix Ex Taq, and 200 nM primers to a final volume of 20 ␮l. The reactions were denatured at 95 ◦ C for 30 s and then subjected to 45 cycles of 95 ◦ C for 5 s and 60 ◦ C for 20 s. After the reaction cycle was completed the temperature was increased from 65 ◦ C to 95 ◦ C at a rate of 0.2 ◦ C/15 s, and the fluorescence was measured every 5 s to construct a melting curve. A control sample that contained no template DNA was run with each assay, and all determinations were performed at least in duplicate to ensure reproducibility. The authenticity of the amplified product was determined by melting curve analysis. Viral RNA burden in the infected samples was expressed as viral RNA copies per microgram of RNA, and the relative ratio of cytokines and chemokines in infected samples to uninfected samples was determined. All data were analyzed using Bio-Rad CFX Manager, version 2.1 analysis software (Bio-Rad Laboratories). 2.4. Histological examination of the brain For histological examination of the brain, brain tissues derived from mock and JEV-infected mice were embedded in paraffin and 10-␮m sections were prepared and stained with H&E by the Pathology Lab (College of Veterinary Medicine, Chonbuk National University, Jeonju, Korea). Sections were analyzed using a Nikon Eclipse E600 microscope (Nikon, Tokyo, Japan). Photomicrographs were taken from coronal sections of the septo-striatal regions of the brain.

24

J.H. Kim et al. / Comparative Immunology, Microbiology and Infectious Diseases 48 (2016) 22–32

Table 1 Specific primers for the expression of cytokines, chemokines, tight junctions, adhesion molecules, and JEV RNA used in real-time qRT-PCR. Gene namea

Primer sequence (5 –3 )b

Position cDNA

Gene Bank ID

IL-1␤

FP: AAGTGATATTCTCCATGAGCTTTGT RP: TTCTTCTTTGGGTATTGCTTGG FP: TGG GAA ATC GTG GAA ATG AG RP: CTC TGA AGG ACT CTG GCT TTG FP: CGT CGT AGC AAA CCA CCA AG RP: TTG AAG AGA ACC TGG GAG TAG ACA FP: AAA AAC CTG GAT CGG AAC CAA RP: CGG GTC AAC TTC ACA TTC AAA G FP: CCA AGT CTT CTC AGC GCC AT RP: GAA TCT TCC GGC TGT AGG AGA AG FP: ATC CAG AGC TTG AGT GTG ACG C RP: AAG GCA AAC TTT TTG ACC GC FP: AGG ACA CCA AAG CAT GTG AG RP: GGC ATT CCT GCT GGT TAC A FP: TCT ACG AGG GAC TGT GGA TG RP: TCA GAT TCA GCA AGG AGT CG FP: GTG GAA CGC TCA GAT TTC AT RP: TGG ACA TTA AGG CAG CAT CT FP: GCT GTG ATG TGT GTG AGC TG RP: GAC GGT CTA CCT GGA GGA AC FP: GTC CGC TGT GCT TTG AGA ACT RP: CGG AAA CGA ATA CAC GGT GAT FP: ACC CTC CCT CCT TTC CTT AC RP: CTA GGA CTC TTG CCC AAT CC FP: GGC TTA GCG CTC ACA TCC A RP: GCT GGC CAC CCT CTC TTC TT FP: TGG AAT CCT GTG GCA TCC ATG AAA C RP: TAA AAC GCA GCT CAG TAA CAG TCC G

535–559 679–700 209–228 442–462 438–457 564–587 347–367 426–447 158–177 206–228 194–215 264–283 6227–6246 6295–6313 350–369 414–433 1054–1073 1131–1150 2054–2074 2105–2125 338–358 391–411 1136–1182 1238–1257 4132–4150 4207–4226 885–909 1209–1233

NM 008361

IL-6 TNF-␣ CCL2 CCL3 CXCL2 ZO-1 Claudin-1 Claudin-5 Occludin ICAM-1 JAM JEV ␤-actin a b

NM 031168 NM 013693 NM 011333 NM 011337.2 NM 009140.2 NM 009386.2 NM 016674.4 NM 013805.4 NM 008756 NM 010493.2 NM 172647.2 AB920399.1 NM 007393.3

IL, interleukin; TNF-␣, tumor necrosis factor-␣. FP, forward primer; RP, reverse primer.

2.5. Confocal microscopy for tight junction and adhesion molecules For confocal microscopy of brain tissue, brains were collected and frozen in optimum cutting temperature (OCT) compound (Sakura Fine Technical Co., Tokyo, Japan) following vigorous heart perfusion with HBSS. After freezing, 6–7-␮m-thick sections were cut, air-dried, and fixed in cold solution (1:1 mixture of acetone and methanol) for 15 min at −20 ◦ C. Non-specific binding was blocked with 10% normal goat serum and sections were permeabilized with 0.1% Triton X-100. Staining was performed by incubating sections overnight in a moist chamber at 4 ◦ C with antibody cocktail including antibodies against JEV (Abcam, Cambridge, UK), mouse CD11b, biotin conjugated (BD Biosciences), and tight junction and adhesion molecules (ZO-1, claudin-5, and JAM). Primary antibodies were detected with secondary FITC-conjugated goat anti-mouse IgG, FITC-conjugated streptavidin, and PE-conjugated goat anti-mouse antibodies. Nuclei were counterstained with DAPI (4 6-diamidino-2-phenylindole) (Sigma-Aldrich). Finally, fluorescence was observed by confocal laser scanning microscope (Carl Zeiss, Zena, Germany). To check the expression of tight junction and adhesion molecules in the BBB, representative photomicrographs were taken from the cerebral microvascular areas of the brain. 2.6. Determination of BBB permeability, tight junctions and adhesion molecules BBB permeability was determined by visualizing and measuring the amount of Evans blue dye extravasated into the brain with some modifications, as described earlier [6]. Briefly, JEVinfected mice were injected i.p. with 800 ␮l of 1% (w/v) Evans blue dye (Sigma-Aldrich) 4 dpi and perfused via intracardiac puncture with HBSS containing heparin 1 h later. Brains were subsequently removed, weighed, and stored at −80 ◦ C following visualization with a high resolution digital camera. For Evans Blue quantification, brain tissues were homogenized in 1 ml of PBS, and 1 ml

of 100% trichloroacetic acid (TCA) (Sigma-Aldrich) was added to the homogenate to precipitate proteins. The mixture was then vigorously shaken for 2 min and cooled for 30 min at 4 ◦ C. After centrifugation (30 min at 4,000 × g), the absorbance of the supernatant was measured at 620 nm using a spectrophotometer. The amount of extravasated Evans blue dye was quantified as microgram of dye per gram of brain tissue using a standard curve. BBB integrity was also evaluated by determining the expression of tight junction and adhesion molecules (ZO-1, claudin-1, claudin-5, occludin, ICAM-1, and JAM) using real-time qRT-PCR with a CFX96TM Real-Time PCR Detection system (Bio-Rad Laboratories, Hercules, CA). 2.7. Statistical analysis All data were expressed as the average ± standard deviation, and statistically significant differences between groups were analyzed with unpaired two-tailed Student’s t-tests for leukocyte population analysis and in vitro experiments or ANOVA and post-hoc testing for multiple comparisons of the mean. The statistical significance of viral burden and in vivo cytokine gene expression was evaluated by Mann-Whitney or unpaired two-tailed Student’s t-tests. Kaplan-Meier survival curves were analyzed by the log rank test. p-values ≤ 0.05 were considered significant. All data were analyzed with Prism software (GraphPadPrism4, San Diego, CA). 3. Results 3.1. Ablation of CD11chi DCs exacerbates JE In order to examine the role of CD11chi DC in JE progression, we employed a CD11c-DTR transgenic mouse model [33] that expresses the diphtheria toxin receptor (DTR) gene under control of a cloned Itgax promoter, allowing conditional DC depletion following in vivo treatment with DT. The transient ablation of CD11chi DCs was induced by DT (2 ng/gm) injection without significantly affecting the number and localization of other cell

J.H. Kim et al. / Comparative Immunology, Microbiology and Infectious Diseases 48 (2016) 22–32

25

Fig. 1. The ablation of CD11chi DCs leads to highly enhanced JE susceptibility. CD11c-DTR mice were injected i.p. with DT every other day from -1 to 7 days after JEV infection (0.1, 1.0, and 2.0 LD50 ). (A) Survival rate. The proportion of surviving mice per group (n = 13–15) was monitored until day 13 after infection. (B) Clinical score for behavioral signs of encephalitis. Mice infected with JEV were examined daily and clinical scores were recorded, depending on behavioral signs (0, no detectable sign of disease; 1, ruffled fur; 2, slightly hunched back and ruffled fur; 3, very hunched back and lethargy; and 4, death). Data represent the average and standard error for each group. (C) Changes in body weight. Changes in body weight are expressed as the average percentage ± SEM of body weight relative to the time of challenge. *, p < 0.05; **, p < 0.01; ***, p < 0.001 between vehicle- and DT-treated groups.

populations (data not shown), as previously described [30]. Using this conditional depletion model of CD11chi DCs, we compared the susceptibility of CD11chi DC-ablated mice to JE progression with vehicle-treated CD11c-DTR mice. As expected, CD11chi DC-ablated mice showed highly increased susceptibility to JE progression,

compared to those of vehicle-treated CD11c-DTR mice (Fig. 1A). Notably, CD11chi DC ablation resulted in 100% mortality following infection with JEV at 1.0 and 2.0 LD50 doses within 12 dpi, whereas vehicle-treated CD11c-DTR mice showed 40% and 80% mortality, respectively. In addition, CD11chi DC-ablated mice showed approx-

26

J.H. Kim et al. / Comparative Immunology, Microbiology and Infectious Diseases 48 (2016) 22–32

Fig. 2. Histological examination of the CNS of CD11chi DC-ablated mice during JE. (A) Representative photomicrographs of brain sections stained with H&E. CD11c-DTR mice were injected i.p. with DT every other day from -1 to 7 days after JEV infection (1.0 LD50 ). Photomicrographs were taken from coronal sections of the septo-striatal regions of the brain in vehicle (a)- and DT (b)-treated CD11c-DTR mice, vehicle-treated CD11c-DTR mice followed by JEV infection (c, 4 dpi; d, 6 dpi), and DT-treated CD11c-DTR mice followed by JEV infection (e, 4 dpi; f, 6 dpi). The arrows denote the area of interest. (B) Perivascular infiltration of mononuclear inflammatory cells in the cerebrum from CD11chi DC-ablated mice. Photomicrographs were taken from coronal sections of the caudal diencephalon regions of brain in vehicle-treated CD11c-DTR mice followed by JEV infection (a, 200×) and DT-treated CD11c-DTR mice followed by JEV infection (b, 200×; c, 400× of area denoted by white square) 5 dpi. The arrows denote the areas where higher numbers of mononuclear inflammatory cells were observed in the perivascular areas of CD11chi DC-ablated mice.

imately 60–70% mortality upon JEV infection at 0.5 LD50 , and all vehicle-treated CD11c-DTR mice survived. However, there was no significant difference in mean day of death (MDD) between DT and vehicle-treated CD11c-DTR mice, even though vehicle-treated CD11c-DTR mice experienced moderately prolonged survival. In support, CD11chi DC-ablated mice showed rapid and severe signs of clinical score for behavioral signs of encephalitis such as hunched back, lethargy, and paralysis, compared to vehicle-treated CD11cDTR mice (Fig. 1B). Furthermore, CD11chi DC-ablated mice that received JEV infection at 0.1 and 1.0 LD50 doses, but not 2.0 LD50 , displayed more apparent loss of body weight, depending on infection date, when compared with those of vehicle-treated CD11c-DTR mice (Fig. 1C). Together, these results clearly indicate that CD11chi DC ablation greatly increases susceptibility to JE progression. To better understand severe neuroinflammation in the CNS of CD11chi DC-ablated mice following JEV infection, we examined cellular infiltration in the brain by histological examination. As expected, CD11chi DC-ablated mice had earlier and higher recruitment of inflammatory cells into the brain, compared to vehicle-treated CD11c-DTR mice after JEV infection (Fig. 2A). Notably, the exacerbated infiltration of mononuclear inflammatory cells was observed in the cerebral cortex regions of the brain in CD11chi DC-ablated mice. In addition, more mononuclear inflam-

matory cells were found in the perivascular areas of the brain in CD11chi DC-ablated mice (Fig. 2B). Taken together, these results indicate that CD11chi DCs are essential for the control of neuroinflammatory progression in the CNS following JEV infection.

3.2. Elevated viral burden in the CNS and spleen of DC-ablated mice The severity of viral encephalitis caused by neurotrophic viruses such as JEV is closely associated with CNS-invasion of virus through peripheral leukocytes, including monocytes, macrophages, and DCs [31,34]. To obtain a clearer understanding of JE progression in CD11chi DC-ablated mice, viral RNA burden was determined in extraneural and neural tissues. As expected, CD11c-DTR mice that received DT contained markedly higher levels of JEV RNA levels in extraneural tissues (spleen) and neural tissues (brain, spinal cord) with 10- to 1000-fold increases, compared to those of vehicletreated CD11c-DTR mice (Fig. 3). Notably, CD11chi DC-ablated mice displayed a pattern of gradually increasing JEV RNA copy number in their CNS compared to vehicle-treated CD11c-DTR mice, depending on the number of days post-infection. This result indicates that selective ablation of CD11chi DCs resulted in an increased viral

J.H. Kim et al. / Comparative Immunology, Microbiology and Infectious Diseases 48 (2016) 22–32

27

Fig. 3. Highly increased levels of viral burden in the CNS of CD11chi DC-ablated mice. CD11c-DTR mice were injected i.p. with DT every other day from -1 to 7 days after JEV infection (1.0 LD50 ). Viral burden in the spleen, brain, and spinal cord of mice was assessed by real-time qRT-PCR at the indicated dpi. The viral RNA load is expressed by viral RNA copy number per microgram of total RNA (n = 6). Each symbol represents the levels of an individual mouse; the horizontal line indicates the median of each group. *, p < 0.05; **, p < 0.01; ***, p < 0.001 between vehicle- and DT-treated groups.

burden in extraneural and neural tissues after JEV infection and concurrently enhanced susceptibility to JEV infection. 3.3. Elevated pro-inflammatory cytokines in the CNS of DC-ablated mice Acute viral encephalitis caused by JEV and other neurotropic viruses is overwhelming, with the progression of CNS degeneration through dysregulated immunological responses along with elevated secretion of proinflammatory cytokines and chemokines [31,32,34,35]. Furthermore, because CNS-invasion of JEV is likely mediated by CNS-infiltration of peripheral leukocytes governed by the expression of chemokines in the CNS, we examined cytokine and chemokine expression levels in inflammatory tissues to determine the neuroinflammation patterns and associated relationships with CD11chi DCs during JE progression. Our results revealed that enhanced levels of IL-1␤, IL-6, and TNF-␣ in the CNS (brain and spinal cord) were coupled to severe progression of JE in CD11chi DC-ablated mice (Fig. 4A). In addition, CD11chi DC-ablated mice showed enhanced expression of pro-inflammatory cytokines in the spleen on 4 dpi, compared to vehicle-treated CD11c-DTR mice. A similar pattern in the expression levels of CC chemokines (CCL2, CCL3) in the spleen and immune-privileged CNS of CD11chi DCablated mice was observed (Fig. 4B). With little exception, CD11chi DC-ablated mice exhibited lower levels of CXCL2 expression, a major chemoattractant of granulocytes, in neural tissues, including the brain and spinal cord, compared to vehicle-treated CD11cDTR mice. Collectively, these results indicate that exacerbated progression of JE in CD11chi DC-ablated mice is closely associated with enhanced expression of pro-inflammatory cytokines and chemokines in the CNS, thereby providing an increase in CNS invasion of virus through CNS infiltration of peripheral leukocytes. 3.4. Ablation of CD11chi DCs enhances BBB permeability during JE progression The ablation of CD11chi DCs facilitates severe inflammation and viral burden in immune privileged CNS tissue along with early orchestrated production of pro-inflammatory cytokines such as IL6 and TNF-␣, leading to altered BBB permeability [11,34,36,37]. Accordingly, we assessed whether CD11chi DC ablation could modulate BBB permeability and, possibly, earlier CNS entry of virus from the periphery, thereby inducing enhanced CNS inflammation. BBB permeability was addressed in vivo by visualizing (Fig. 5A) and quantifying (Fig. 5B) the relative levels of extravasated Evans blue dye in the brain. Injection of DT in CD11c-DTR mice as a negative control group did not cause any change in BBB permeability, whereas CD11chi DC ablation led to increased BBB permeabil-

ity after JEV infection compared to vehicle-treated CD11c-DTR mice. This result implies that the ablation of CD11chi DCs provides enhanced permeability of the BBB during JE progression, thereby resulting in easy CNS infiltration of virus. 3.5. CD11chi DCs modulate the expression of tight junction and adhesion molecules Since tight junctions play a major role in the regulation of BBB permeability and their disruption is a hallmark of CNS abnormalities [38], we also measured the expression of TJPs (ZO-1, occludin, and claudins) and adhesion molecules (JAM-1 and ICAM1) known to be important for recruitment of inflammatory cells. While CD11c-DTR mice showed no significantly reduced expression of ZO-1, claudin-1, claudin-5, occludin, ICAM-1 or JAM only with DT injection, JEV infection of CD11c-DTR mice induced reduction of all tight junction and adhesion molecules except claudin-1 (Fig. 6A). Such JEV-induced reduction of tight junction and adhesion molecules, except ICAM-1, was further enhanced by the ablation of CD11chi DCs, which indicates that tight junction and adhesion molecules are severely down-regulated in CD11chi DC-ablated mice following JEV infection. This down-regulated expression of tight junction molecules in CD11chi DC-ablated mice was also confirmed by confocal microscopy. The expression of ZO-1, claudin-5, and JAM in the cerebral microvascular areas of the brain was comparable between vehicle- and DT-treated CD11c-DTR mice, whereas CD11chi DC ablation induced lower expression of ZO-1, claudin-5, and JAM following JEV infection, as shown by weaker fluorescence intensity and narrower layers compared to JEV-infected CD11c-DTR mice that received vehicle (Fig. 6B). This finding demonstrates that CD11chi DCs are involved in maintaining BBB integrity following JEV infection. Therefore, it is likely that altered BBB permeability in CD11chi DC-ablated mice facilitates severe neuro-inflammation and viral entry in the CNS, thereby leading to an increased rate of neurological disorder. 4. Discussion BBB permeability is an important criterion in the progression of viral encephalitis caused by neurotropic viruses such as JEV and WNV. Peripheral leukocytes require communication with the BBB to infiltrate the CNS. The enhanced CNS-infiltration of peripheral leukocytes, including Ly-6Chi monocytes, is believed to facilitate greater inoculation of virus from the periphery to the CNS [4,38,39]. Here, we observed that exacerbation of JE progression in CD11chi DC-ablated mice was closely associated with enhanced BBB permeability and a reduction of tight junction and adhesion molecules. Furthermore, this decreased expression of tight junction and adhe-

28

J.H. Kim et al. / Comparative Immunology, Microbiology and Infectious Diseases 48 (2016) 22–32

Fig. 4. Expression of pro-inflammatory cytokines and chemokines in lymphoid and inflamed tissues. CD11c-DTR mice were injected i.p. with DT every other day from -1 to 7 days after JEV infection (1.0 LD50 ). The expression levels of cytokines (A) and chemokines (B) were assessed by real-time qRT-PCR using total RNA extracted from the spleen, brain, and spinal cord of CD11c-DTR mice at the indicated dpi. Data show the average ± SEM of the indicated cell populations derived from at least five mice per group. *, p < 0.05; **, p < 0.01; ***, p < 0.001 among the indicated groups.

sion molecules on the BBB was visualized by confocal microscopy. Also, the altered integrity of the BBB appeared to enhance CNS inoculation with JEV. Ultimately, our data suggest a secondary role for CD11chi DCs in controlling JE progression through the regulation of BBB permeability and the expression of tight junction and adhesion molecules. During JE progression, the systemic-CNS interface is highly compromised, causing severe neurological damage in the CNS that leads to inflammation, irreparable neuronal loss, and death. Interactions among immune cells, inflammatory cytokines, the BBB, and tight junction transcripts may all participate in the exact mechanisms underlying the course of JE. Several murine models have demonstrated that JEV overwhelms the BBB and causes concurrent disorders in the CNS that initiate the expression of cytokines (IL-1, IL-6, TNF-␣, IL-18), chemokines, other immunerelated proteins, and complement factors [8,11,34,36]. Similarly, our data support that exuberant expression of pro-inflammatory cytokines and chemokines in the CNS of CD11chi DC-ablated mice exacerbated JE progression and concurrent BBB disintegrity, as corroborated by Evans blue extravasation and altered expression of tight junction and adhesion molecules. CD11chi DCs have long been postulated to be professional APCs against viral infections due to their capacity to stimulate naïve T cells and expression of MHC class II and costimulatory molecules [19,21,22]. In addition, CD11chi DCs play an important role in regulating viral replication at the periphery by facilitating type I IFN (IFN-I) innate responses [40]. Although our data may discount an innate role for CD11chi DCs in regulating viral replication at the periphery and subsequently limiting the supply of JEV into the CNS, the dysregulation of BBB integrity following ablation of CD11chi DCs in JE progression provides another evidence that CD11chi DCs restrict CNS-invasion of JEV from the periphery. In further support, the disintegrity of the BBB was closely associated with enhanced JEV burden in the CNS. However, it is thought that the presence of JEV in the CNS is accompanied by an early, dramatic increase in the level of inflammatory cytokines and chemokines in the brain prior to

enhancement of BBB permeability [4]. This notion suggests that JEV could initially gain access into the brain via unknown pathways before the BBB permits movement of greater amounts of JEV from the periphery to the CNS. Therefore, the enhancement of BBB permeability appears to be a subsidiary process caused by exuberant production of pro-inflammatory cytokines during the course of JE. CNS infiltration of CD11b+ Ly-6Chi monocytes is a hallmark of CNS inflammation, including neurotrophic viral infection [11,25,30,41,42]. These cells migrate into the infected brain, where they differentiate into DCs, macrophages and arguably, the microglia population [31,34,43]. Because infected infiltrating cells, including Ly-6Chi monocytes, act as a Trojan horse, the entry of neurotrophic virus from the periphery into the brain is associated with breakdown of the BBB [38,39,44]. However, it is not clear whether BBB integrity is the only predictor of neuroinflammation, because viral entry into the CNS is also mediated via axonal transport [45]. The stark study on essential role of BBB integrity in neuroinflammation caused by a neurotrophic virus was raised from WNV infection using TLR3-deficient mice [38]. TLR3-deficient mice exhibited reduced viral burden and neuroinflammation that was closely associated with reduced BBB permeability by the lack of IL-6 and TNF-␣ after WNV infection [38]. In support, TNF-␣ receptor I KO mice showed significantly lower mortality in association with reduced leakiness of the BBB [39]. Similarly, our results demonstrate the importance of BBB integrity in JE progression, because ablation of CD11chi DCs provided a disintegrated BBB and increased the lethality of viral encephalitis. As mentioned, it is likely that enhanced BBB permeability in DC-depleted mice is a secondary consequence during the progression of CNS inflammation, because DCs are a crucial player in controlling initial viral infection at the periphery. The failure to control viral replication in the periphery results in enormous and systematic production of pro-inflammatory cytokines (IL-6 and TNF-␣), thereby inducing enhanced BBB permeability. The disintegration of the BBB by systemic cytokines is a very complicated process involving vari-

J.H. Kim et al. / Comparative Immunology, Microbiology and Infectious Diseases 48 (2016) 22–32

29

Fig. 5. Ablation of CD11chi DCs enhances BBB permeability during JE. CD11c-DTR mice were injected i.p. with DT (2 ng/g) -1 and 1 day after JEV infection (1.0 LD50 ). (A) Evans blue staining of whole brain. One percent Evans blue dye solution was administered 3 dpi. BBB permeability was visualized following vigorous heart perfusion. CD11c-DTR mice injected with poly(I:C) were used for positive controls. (B) The amount of Evans blue dye diffused into the whole brain. The amount of Evans blue dye was quantified by measuring the absorbance after tissue homogenization and precipitation. Data represent the average ± SEM of 6–8 mice per group. ***, p < 0.001 compared with the levels of the indicated group (for interpretation of the references to color in this figure, the reader is referred to the web version of this article.)

ous molecules, including tight junction and adhesion molecules. Thus, although leukocyte infiltration in the brain is a critical host defense mechanism for control of neuronal infection, the virus has

also evolved to combat host immunity by using the host’s own systemic inflammatory cytokine responses to open the BBB and gain access to neurons.

30

J.H. Kim et al. / Comparative Immunology, Microbiology and Infectious Diseases 48 (2016) 22–32

Fig. 6. The expression of transcripts encoding tight junction and adhesion molecules. CD11c-DTR mice were injected i.p. with DT (2 ng/g) -1 and 1 day after JEV infection (1.0 LD50 ). (A) The expression of transcripts encoding tight junction and adhesion molecules in the brain. The expression of tight junction and adhesion molecule transcripts was determined by real-time qRT-PCR 2 dpi. Data represent the average ± SEM of the levels derived from 6 to 8 mice per group. (B) Confocal microscopy for the expression of tight junction and adhesion molecules in the brain. Brain sections prepared 3 dpi were co-stained for CD11b (red), the nuclear stain DAPI (blue), and tight junction and adhesion molecules (ZO-1, claudin-5, and JAM) (green). Representative photomicrographs were taken from cerebral microvascular areas of brain. p-values in bar graphs were derived from comparison with the levels of the indicated group (for interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

J.H. Kim et al. / Comparative Immunology, Microbiology and Infectious Diseases 48 (2016) 22–32

Our findings imply that overexpression of inflammatory cytokines and chemokines may be associated with severe neuroinflammatory reactions in the immune-privileged CNS of CD11chi DC-ablated mice. Increased expression of inflammatory cytokines augments inflammation-associated disruption of the BBB [8,11,34,36]. The increased expression of chemokines and proinflammatory cytokines is associated with BBB disruption in several CNS diseases [44,46]. Of note, others have also observed the disruptive effects of TNF-␣, IFN-␤ and IL-6 on BBB integrity [37]. We found that the conditional ablation of CD11chi DC modulated BBB permeability during the progression of neuroinflammation, thereby exacerbating JE progression. Moreover, a signature point defining neurotropic viral pathogenesis has been already highlighted as the correlation among cytokine expressions, BBB integrity, and concomitant alteration of TJP transcripts [37,46–48]. In such regards, we found a distinct relationship among cytokines expressions, BBB disruption, and TJPs expression. We measured expression levels of claudin-5, ZO-1, occludins, and JAMs, and then validated those findings using confocal microscopy. We found a significantly lower level of those transcripts in all JEV-infected CD11c-DTR mice compared to the mock-infected group. Others have also observed decreased expression of claudin-5, ZO-1, occludins, and JAMs upon viral infections, followed by disruption of the BBB and increased severity of infections [29]. Likewise, WNV infection leads to an increase in BBB permeability with subsequent pathogenesis due to alteration of TJPs, and inflammatory cytokines play a coinciding role [49]. Our experiments revealed greater BBB permeability in CD11c-DTR mice compared to vehicletreated mice upon JEV infection. This finding was postulated in an earlier study demonstrating that elevated TNF-␣ downregulates TJPs (Claudin family) through reduction of transepithelial resistance (TER), ultimately increasing BBB permeability [47,50]. Moreover, claudin-5 is a key cell adhesion molecule of the brain endothelium, forming the backbone of TJ strands with paracellular permeability traits. Thus, the decreased expression of related transcripts exacerbates infections [51,52]. Along with CNS disorders, lower levels of Claudin family proteins, occludin, ZO-1, and ␣- and ␤-catenin in JEV infection downregulate endothelial permeability, resulting in simultaneous non-neural invasion [18]. In conclusion, our data demonstrate that ablation of CD11chi DC results in increased viral burden, higher expression levels of proinflammatory cytokines and chemokines, lower transcripts encoding tight junction and adhesion molecules, and subsequent dampening of BBB permeability, ultimately resulting in exacerbation of JE progression. Therefore, our results conclude a potential importance of CD11chi DCs in JEV progressions, and widen the window understanding significant role of CD11chi DCs in modulating BBB integrity and alteration of tight junction transcripts and adhesion molecule expression.

Acknowledgements This study was supported by a National Research Foundation of Korea (NRF) grant, funded by the Korean Government (MISP) (2013R1A4A1069486, http://www.nrf.re.kr). The providers of funding had no role in study design, data collection and analysis, the decision to publish, or preparation of the manuscript. We would like to thank Dr. Yoon-Young Choi, Center for University Research Facility (CURF) at Chonbuk National University, for technical assistance with confocal laser scanning microscopy. Also, the authors would like to thank LG Yonam Foundation for supports to oversea study of SKE.

31

References [1] G.L. Campbell, S.L. Hills, M. Fischer, J.A. Jacobson, C.H. Hoke, J.M. Hombach, A.A. Marfin, T. Solomon, T.F. Tsai, V.D. Tsu, A.S. Ginsburg, Estimated global incidence of Japanese encephalitis: a systematic review, Bull. World Health Organ. 89 (766–774) (2011), 774A–774E. [2] A.F. van den Hurk, S.A. Ritchie, J.S. Mackenzie, Ecology and geographical expansion of Japanese encephalitis virus, Annu. Rev. Entomol. 54 (2009) 17–35. [3] D.E. Impoinvil, M. Baylis, T. Solomon, Japanese encephalitis: on the one health agenda, Curr. Top. Microbiol. Immunol. 365 (2013) 205–247. [4] F. Li, Y. Wang, L. Yu, S. Cao, K. Wang, J. Yuan, C. Wang, M. Cui, Z.F. Fu, Viral infection of the central nervous system and neuroinflammation precede blood-brain barrier disruption during japanese encephalitis virus infection, J. Virol. 89 (2015) 5602–5614. [5] J. Ye, R. Jiang, M. Cui, B. Zhu, L. Sun, Y. Wang, A. Zohaib, Q. Dong, X. Ruan, Y. Song, W. He, H. Chen, S. Cao, Etanercept reduces neuroinflammation and lethality in mouse model of Japanese encephalitis, J. Infect. Dis. 210 (2014) 875–889. [6] Y.W. Han, J.Y. Choi, E. Uyangaa, S.B. Kim, J.H. Kim, B.S. Kim, K. Kim, S.K. Eo, Distinct dictation of Japanese encephalitis virus-induced neuroinflammation and lethality via triggering TLR3 and TLR4 signal pathways, PLoS Pathog. 10 (2014) e1004319. [7] G.J. Sips, J. Wilschut, J.M. Smit, Neuroinvasive flavivirus infections, Rev. Med. Virol. 22 (2012) 69–87. [8] A.C. German, K.S. Myint, N.T. Mai, I. Pomeroy, N.H. Phu, J. Tzartos, P. Winter, J. Collett, J. Farrar, A. Barrett, A. Kipar, M.M. Esiri, T. Solomon, A preliminary neuropathological study of Japanese encephalitis in humans and a mouse model, Trans. R. Soc. Trop. Med. Hyg. 100 (2006) 1135–1145. [9] S.B. Kim, J.Y. Choi, J.H. Kim, E. Uyangaa, A.M. Patil, S.Y. Park, J.H. Lee, K. Kim, Y.W. Han, S.K. Eo, Amelioration of Japanese encephalitis by blockage of 4-1BB signaling is coupled to divergent enhancement of type I/II IFN responses and Ly-6C(hi) monocyte differentiation, J. Neuroinflammation 12 (2015) 216. [10] A.G. Aleyas, J.A. George, Y.W. Han, M.M. Rahman, S.J. Kim, S.B. Han, B.S. Kim, K. Kim, S.K. Eo, Functional modulation of dendritic cells and macrophages by Japanese encephalitis virus through MyD88 adaptor molecule-dependent and -independent pathways, J. Immunol. 183 (2009) 2462–2474. [11] R.L. Terry, D.R. Getts, C. Deffrasnes, C. van Vreden, I.L. Campbell, N.J. King, Inflammatory monocytes and the pathogenesis of viral encephalitis, J. Neuroinflammation 9 (2012) 270. [12] G. Gras, M. Kaul, Molecular mechanisms of neuroinvasion by monocytes-macrophages in HIV-1 infection, Retrovirology 7 (2010) 30. [13] J.J. Miner, B.P. Daniels, B. Shrestha, J.L. Proenca-Modena, E.D. Lew, H.M. Lazear, M.J. Gorman, G. Lemke, R.S. Klein, M.S. Diamond, The TAM receptor Mertk protects against neuroinvasive viral infection by maintaining blood-brain barrier integrity, Nat. Med. 21 (2015) 1464–1472. [14] C. Coisne, B. Engelhardt, Tight junctions in brain barriers during central nervous system inflammation, Antioxid. Redox. Signal. 15 (2011) 1285–1303. [15] A.M. Marchiando, W.V. Graham, J.R. Turner, Epithelial barriers in homeostasis and disease, Annu. Rev. Pathol. 5 (2010) 119–144. [16] Y. Persidsky, D. Heilman, J. Haorah, M. Zelivyanskaya, R. Persidsky, G.A. Weber, H. Shimokawa, K. Kaibuchi, T. Ikezu, Rho-mediated regulation of tight junctions during monocyte migration across the blood-brain barrier in HIV-1 encephalitis (HIVE), Blood 107 (2006) 4770–4780. [17] S. Verma, Y. Lo, M. Chapagain, S. Lum, M. Kumar, U. Gurjav, H. Luo, A. Nakatsuka, V.R. Nerurkar, West Nile virus infection modulates human brain microvascular endothelial cells tight junction proteins and cell adhesion molecules: transmigration across the in vitro blood-brain barrier, Virology 385 (2009) 425–433. [18] T. Agrawal, V. Sharvani, D. Nair, G.R. Medigeshi, Japanese encephalitis virus disrupts cell–cell junctions and affects the epithelial permeability barrier functions, PLoS One 8 (2013) e69465. [19] R.M. Steinman, B. Gutchinov, M.D. Witmer, M.C. Nussenzweig, Dendritic cells are the principal stimulators of the primary mixed leukocyte reaction in mice, J. Exp. Med. 157 (1983) 613–627. [20] H.C. Probst, J. Lagnel, G. Kollias, M. van den Broek, Inducible transgenic mice reveal resting dendritic cells as potent inducers of CD8+ T cell tolerance, Immunity 18 (2003) 713–720. [21] B.L. Kelsall, C.A. Biron, O. Sharma, P.M. Kaye, Dendritic cells at the host-pathogen interface, Nat. Immunol. 3 (2002) 699–702. [22] D.J. Zammit, L.S. Cauley, Q.M. Pham, L. Lefrancois, Dendritic cells maximize the memory CD8 T cell response to infection, Immunity 22 (2005) 561–570. [23] F. Ginhoux, S. Jung, Monocytes and macrophages: developmental pathways and tissue homeostasis, Nat. Rev. Immunol. 14 (2014) 392–404. [24] M. Guilliams, F. Ginhoux, C. Jakubzick, S.H. Naik, N. Onai, B.U. Schraml, E. Segura, R. Tussiwand, S. Yona, Dendritic cells, monocytes and macrophages: a unified nomenclature based on ontogeny, Nat. Rev. Immunol. 14 (2014) 571–578. [25] F. Ginhoux, M. Greter, M. Leboeuf, S. Nandi, P. See, S. Gokhan, M.F. Mehler, S.J. Conway, L.G. Ng, E.R. Stanley, I.M. Samokhvalov, M. Merad, Fate mapping analysis reveals that adult microglia derive from primitive macrophages, Science 330 (2010) 841–845. [26] B.P. Chen, W.A. Kuziel, T.E. Lane, Lack of CCR2 results in increased mortality and impaired leukocyte activation and trafficking following infection of the

32

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35] [36]

[37]

[38]

[39]

[40]

J.H. Kim et al. / Comparative Immunology, Microbiology and Infectious Diseases 48 (2016) 22–32 central nervous system with a neurotropic coronavirus, J. Immunol. 167 (2001) 4585–4592. B.T. Fife, G.B. Huffnagle, W.A. Kuziel, W.J. Karpus, CC chemokine receptor 2 is critical for induction of experimental autoimmune encephalomyelitis, J. Exp. Med. 192 (2000) 899–905. J.D. Morrey, A.L. Olsen, V. Siddharthan, N.E. Motter, H. Wang, B.S. Taro, D. Chen, D. Ruffner, J.O. Hall, Increased blood-brain barrier permeability is not a primary determinant for lethality of West Nile virus infection in rodents, J. Gen. Virol. 89 (Pt 2) (2008) 467–473. L.M. Dallasta, L.A. Pisarov, J.E. Esplen, J.V. Werley, A.V. Moses, J.A. Nelson, C.L. Achim, Blood-brain barrier tight junction disruption in human immunodeficiency virus-1 encephalitis, Am. J. Pathol. 155 (1999) 1915–1927. J.H. Kim, J.Y. Choi, S.B. Kim, E. Uyangaa, A.M. Patil, Y.W. Han, S.Y. Park, J.H. Lee, K. Kim, S.K. Eo, CD11c(hi) dendritic cells regulate Ly-6C(hi) monocyte differentiation to preserve immune-privileged CNS in lethal neuroinflammation, Sci. Rep. 5 (2015) 17548. C.J. Chen, Y.C. Ou, S.Y. Lin, S.L. Raung, S.L. Liao, C.Y. Lai, S.Y. Chen, J.H. Chen, Glial activation involvement in neuronal death by Japanese encephalitis virus infection, J. Gen. Virol. 91 (Pt 4) (2010) 1028–1037. Y.W. Han, S.K. Singh, S.K. Eo, The roles and perspectives of toll-Like receptors and CD4(+) helper T cell subsets in acute viral encephalitis, Immune Network 12 (2012) 48–57. S. Jung, D. Unutmaz, P. Wong, G. Sano, K. De los Santos, T. Sparwasser, S. Wu, S. Vuthoori, K. Ko, F. Zavala, E.G. Pamer, D.R. Littman, R.A. Lang, In vivo depletion of CD11c+ dendritic cells abrogates priming of CD8+ T cells by exogenous cell-associated antigens, Immunity 17 (2002) 211–220. A. Ghoshal, S. Das, S. Ghosh, M.K. Mishra, V. Sharma, P. Koli, E. Sen, A. Basu, Proinflammatory mediators released by activated microglia induces neuronal death in Japanese encephalitis, Glia 55 (2007) 483–496. D. Ghosh, A. Basu, Japanese encephalitis-a pathological and clinical perspective, PLoS Negl. Trop. Dis. 3 (2009) e437. M.K. Mishra, K. Dutta, S.K. Saheb, A. Basu, Understanding the molecular mechanism of blood-brain barrier damage in an experimental model of Japanese encephalitis: correlation with minocycline administration as a therapeutic agent, Neurochem. Int. 55 (2009) 717–723. H.E. de Vries, M.C. Blom-Roosemalen, M. van Oosten, A.G. de Boer, T.J. van Berkel, D.D. Breimer, J. Kuiper, The influence of cytokines on the integrity of the blood-brain barrier in vitro, J. Neuroimmunol. 64 (1996) 37–43. T. Wang, T. Town, L. Alexopoulou, J.F. Anderson, E. Fikrig, R.A. Flavell, Toll-like receptor 3 mediates West Nile virus entry into the brain causing lethal encephalitis, Nat. Med. 10 (2004) 1366–1373. B. Shrestha, B. Zhang, W.E. Purtha, R.S. Klein, M.S. Diamond, Tumor necrosis factor alpha protects against lethal West Nile virus infection by promoting trafficking of mononuclear leukocytes into the central nervous system, J. Virol. 82 (2008) 8956–8964. M. Swiecki, S. Gilfillan, W. Vermi, Y. Wang, M. Colonna, Plasmacytoid dendritic cell ablation impacts early interferon responses and antiviral NK and CD8(+) T cell accrual, Immunity 33 (2010) 955–966.

[41] D.R. Getts, R.L. Terry, M.T. Getts, M. Muller, S. Rana, B. Shrestha, J. Radford, N. Van Rooijen, I.L. Campbell, N.J. King, Ly6c+ inflammatory monocytes are microglial precursors recruited in a pathogenic manner in West Nile virus encephalitis, J. Exp. Med. 205 (2008) 2319–2337. [42] L. Izikson, R.S. Klein, I.F. Charo, H.L. Weiner, A.D. Luster, Resistance to experimental autoimmune encephalomyelitis in mice lacking the CC chemokine receptor (CCR)2, J. Exp. Med. 192 (2000) 1075–1080. [43] N.D. Lewis, J.D. Hill, K.W. Juchem, D.E. Stefanopoulos, L.K. Modis, RNA sequencing of microglia and monocyte-derived macrophages from mice with experimenal autoimmune encephalomyelitis illustrates a changing phenotype with disease course, J. Neuroimmuol. 277 (2014) 26–38. [44] T. Barichello, G.D. Fagundes, J.S. Generoso, A. Paula Moreira, C.S. Costa, J.R. Zanatta, L.R. Simoes, F. Petronilho, F. Dal-Pizzol, M. Carvalho Vilela, A. Lucio Teixeira, Brain-blood barrier breakdown and pro-inflammatory mediators in neonate rats submitted meningitis by Streptococcus pneumoniae, Brain Res. 1471 (2012) 162–168. [45] M.A. Samuel, H. Wang, V. Siddharthan, J.D. Morey, M.S. Diamond, Axonal tranport mediates West Nile virus entry into the central nervous system and induces acute flaccid paralysis, Proc. Natl. Acad. Sci. U. S. A. 104 (2007) 17140–17145. [46] A.L. Olsen, J.D. Morrey, D.F. Smee, R.W. Sidwell, Correlation between breakdown of the blood-brain barrier and disease outcome of viral encephalitis in mice, Antiviral Res. 75 (2007) 104–112. [47] M. Fiala, D.J. Looney, M. Stins, D.D. Way, L. Zhang, X. Gan, F. Chiappelli, E.S. Schweitzer, P. Shapshak, M. Weinand, M.C. Graves, M. Witte, K.S. Kim, TNF-alpha opens a paracellular route for HIV-1 invasion across the blood-brain barrier, Mol. Med. 3 (1997) 553–564. [48] Y. Persidsky, A. Ghorpade, J. Rasmussen, J. Limoges, X.J. Liu, M. Stins, M. Fiala, D. Way, K.S. Kim, M.H. Witte, M. Weinand, L. Carhart, H.E. Gendelman, Microglial and astrocyte chemokines regulate monocyte migration through the blood-brain barrier in human immunodeficiency virus-1 encephalitis, Am. J. Pathol. 155 (1999) 1599–1611. [49] M.S. Diamond, R.S. Klein, West Nile virus: crossing the blood-brain barrier, Nat. Med. 10 (2004) 1294–1295. [50] M. Mei, R.L. Xiang, X. Cong, Y. Zhang, J. Li, X. Yi, K. Park, J.Y. Han, L.L. Wu, G.Y. Yu, Claudin-3 is required for modulation of paracellular permeability by TNF-alpha through ERK1/2/slug signaling axis in submandibular gland, Cell Signal. 27 (2015) 1915–1927. [51] T. Nitta, M. Hata, S. Gotoh, Y. Seo, H. Sasaki, N. Hashimoto, M. Furuse, S. Tsukita, Size-selective loosening of the blood-brain barrier in claudin-5-deficient mice, J. Cell Biol. 161 (2003) 653–660. [52] D. Gunzel, A.S. Yu, Claudins and the modulation of tight junction permeability, Physiol. Rev. 93 (2013) 525–569.