- Email: [email protected]
Absence of expression of RhD by human trophoblast cells
Absence of expression of RhD by human trophoblast cells Alexandra Benachi, MD, a Henk S.P. Garritsen, MD, PhO, b Catherine M. Howard, Phi), a Phillip Bennett, MD, PhD, a and Nicholas M. Fisk, MB, Phl) a London, United Kingdom, and Mi~nsteg, Germany OBJECTIVE: Our purpose was to determine whether the RhD gene is expressed in trophoblast at any stage of gestation. STUDY DESIGN: Trophoblast and fetal tissue were obtained from 18 pregnancies at 8 to 40 weeks' gestation. Deoxyribonucleic acid and ribonucleic acid were extracted from trophoblast, Complementary deoxyribonucleic acid was synthesized from ribonucleic acid, and reverse transcriptase-polymerase chain reaction was performed using primers specific for the RhD gene. Deoxyribonucleic acid was extracted from fetal tissue to determine the fetal RhD status by means of polymerase chain reaction. Antigen expression was also sought by analytic cytometric analysis (flow cytometry and immunocytochemistry) using a monoclonal anti-D antibody. RESULTS: Trophoblast was studied from various combinations of RhD-positive and RhD-negative fetuses (on deoxyribonucleic acid) from mothers to find no RhD gene expression in any sample. Flow cytometry and immunocytochemistry confirmed this by demonstrating no RhD antigen sites on trophoblast cells. CONCLUSION: Contrary to a previous report, we conclude that the RhD gene is not expressed in human trophoblast in any trimester. (Am J Obstet Gyneco11998;178:294-9.)
Key words: Rhesus D expression, h u m a n trophoblast
The RhD a n t i g e n causes Rh a l l o i m m u n i z a t i o n , an i m p o r t a n t cause of perinatal morbidity and mortality. RhD is abundantly present on cells of the erythroid lineage and has b e e n d o c u m e n t e d from as early as the colony-forming unit-erythrocyte stage, 1 with the antigens persisting t h r o u g h o u t the life of the erythrocyte. Alloimmunization is generally thought to be caused by transfer of fetal erythrocytes into the maternal circulation. Only one study has addressed whether RhD is expressed in other reproductive tissues.2 This showed, by means of immunocytochemistry, that trophoblast also expresses the RhD antigen. Trophoblast expression might explain the p h e n o m e n o n of very early sensitization at gestations when circulating fetal blood volume is too small to be considered capable of initiating an antibody response in the mother. Trophoblasts are one of the three fetal cell types d e m o n s t r a t e d n o r m a l l y to be present in the maternal circulation. Fetal deoxyribonucleic acid (DNA) has been shown to be present in maternal blood from as early as 5 weeks' gestation, too early for nucleated erythrocytes to be the source. 3 This is an imFrom the Royal Postgraduate Medical School, Institute of Obstetrics and Gynaecology, Queen Charlotte's and Chelsea Hospital, a and Institut fiir Transfusionmedizin/Transplantationsimmunologie, Westfiilische Wilhelms Universitdt. b Supported by a NATO Collaborative Research Grant. Received for publication May 27, 1997; revisedJuly 2, 1997; accepted August 5, 1997. Reprints not availablefrom the authors. Copyright 9 1998 by Mosby, Inc. 0002-9378/98 $5.00 + 0 6/1/85195 294
portant clinical issue because alloimmunization could occur in a n e m b r y o n i c molar pregnancies, the trophoblast from which was also shown to express the RhD antigen.2 Although identification of fetal cells in the maternal circulation holds exciting prospects for noninvasive prenatal diagnosis, work in this field has been delayed by the lack of fetally specific antigens to facilitate cell sorting. 4, 5 This applies especially to isolation of trophoblast because most antitrophoblast antibodies are not highly specific. Most cell sorting strategies in this field target nucleated erythrocytes, leukocytes, or trophoblasts. If trophoblast did express the RhD antigen, this would be a truly specific fetal marker for fetal cell sorting in pregnancies in which the mother is RhD negative and the fetus is RhD positive. Sorting with an anti-D monoclonal antibody would thus simultaneously target both nucleated erythrocytes and trophoblasts. The aim of our study was to confirm expression of the RhD gene in trophoblast using sensitive molecular and immunophenotyping techniques. Material and m e t h o d s
Tissue. Trophoblast was collected from 18 pregnancies, either at termination of pregnancy or after cesarean section, together with samples of fetal tissue or umbilical cord blood, respectively. All women gave informed consent in accordance with institutional ethics committee approval and national guidelines on fetal tissue research. Tissue samples were snap frozen in liquid nitrogen immediately after collection and stored at -70 ~ C. A RhDpositive cord blood samp!e was also collected as a positive
Benachi et al.
Volmne 178, Number 2 AmJ Obstet Gynecol
control for RhD expression. Blood samples were stored at 4~ Nucleic acid extraction. Ribonucleic acid (RNA) was extracted for reverse transcriptase-polymerase chain reaction analysis of RhD expression in trophoblast. DNA was isolated from trophoblast to determine the fetal RhD status and from fetal tissue to confirm the trophoblast result. RNA and DNA were extracted using TRIzol reagent (Gibco BRL Life Technologies, Paisley, United Kingdom). One h u n d r e d milligrams of tissue was homogenized in 1 ml of TRIzol and 0.2 ml of chloroform was added, separating the solution into an aqueous and organic phase. RNA was isolated from the aqueous phase after centrifugation by precipitation with isopropanol. RNA was then dissolved in 20 p,1 of 1 m l n o l / L ethylenediaminetetraacetic acid and stored at -70 ~ C. DNA was isolated from the interphase after ethanol precipitation, dissolved in 8 m m o l / L sodium hydroxide, and stored at 4 ~ C. RNA, and DNA concentrations were determined by spectrophotometry. Reverse transcriptase-polymerase chain reaction. Complementary DNA (cDNA) was synthesized from 10 tll of RNA in a 20 [tl reaction mixture consisting of 0.2 m m o l / L deoxynucleotides, triphosphates, 50 U myeloid leukemia virus reverse transcriptase, and 100 ng primers in standard reverse transcriptase (Gibco BRL). cDNA complementary to the RhD gene was synthesized using the D2B primer from exon 10 of the RhD gene (Table I). Random hexanucleotide primers were used to synthesize a total cDNA population. Ten microliters of RNA was denatured at 70 ~ C for 5 minutes, and 10 gl of reaction mix was added and incubated at 37 ~ C for 60 minutes. The reaction was stopped by heating to 95 ~ C for 5 minutes. Heminested polymerase chain reaction analysis was then carried out using three oligonucleotide primers from within the RhD gene (Fig. 1). The first r o u n d of polymerase chain reaction was performed with primers DIB (from exon 7 of the RhD) and D2B; the second with D2B a n d D3B (from exon 7 of the RhD). Each polymerase chain reaction took place in a 50 gl volume consisting of 1.5 m m o l / L magnesium chloride, 100 ng of each primer, 0.2 m m o l / L each of deoxythymidine triphosphate, deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, and 1 U of Taq polymerase. The DNA template for the first round of polymerase chain reaction was 5 gl of cDNA; 5 gl of DNA product from the first reaction was used as template for the second round. Polymerase chain reaction was also carried out using primers within the housekeeping reduced glyceraldehyde-phosphate dehydrogenase gene, as a messenger RNA (mRNA) expression control, in a 25 gl reaction (with reagents essentially as described above) using 2:5 ~tl of the total cDNA population as a template. Polymerase chain reaction for RhD type. A single r o u n d
D1B
D gene
D3B
IN I 1 o i
,,,I~..41AI
Cc Ee gene
ElN
D2B
-Ib,---IP~
Nr r NN I rglNI
295
A2
..II~-~41-, A3
A4
D1 B D3 B
~
7 INNI
"ID'-~91"
A1 A2 A3 primer with full sequence homology primer with partial sequence homology Fig. 1. Diagram showing the annealing sites for each of the primers used for the RhD and RhCcEe gene sequences. Each gene consists of 10 exons with high homology except within exons 7 and 10.
of polymerase chain reaction using two sets of primers corresponding to the RhCcEe and RhD genes, 6, 7 respectively (Table I), was carried out to determine the RhD status of fetal trophoblast and tissue. A 50 gl reaction was performed with reagents as described above and 5 gl of DNA template. For each polymerase chain reaction 30 cycles of polymerase chain reaction were performed with an initial denaturation of 95 ~ C for 5 minutes, and subsequent cycles of 1 minute at 95 ~ C, 1 minute at the appropriate a n n e a l i n g temperature (Table I), and 1 minute at 72 ~ C. Final denaturation was at 72 ~ C for 5 minutes. DNA products were electrophoresed on 3% agarose gels, stained with ethidium bromide, and visualized u n d e r ultraviolet light. The presence of one polymerase chain reaction product of 136 base pairs indicated amplification only from the Rh CcEe gene and therefore an RhD-negative fetus. Two polymerase chain reaction products of 136 base pairs and 186 base pairs indicated amplification from both genes and therefore that the fetus was RhD positive. Flow cytometry. Single cells were isolated from trophoblast samples by mechanical disruption of the sample. A total of 104 to 105 isolated cells was incubated with a biotinylated anti-D monoclonal antibody (gift from Prof. J.E Cartron, INSERM Paris) for 15 minutes at 40 ~ C. After incubation, cells were washed three times (5 minutes, 1200 revolutions/min centrifugation) with 1 ml of phosphate-buffered saline solution. After discarding the phosphate-buffered saline solution, the remaining pellet was incubated for 15 minutes at 40 ~ C with 10 gl of pretitered streptavidin phycoerythrin (Becton/Dickinson, Oxford, United Kingdom; No. 349023) and 10 gl pretitered glycophorin-A fluorescein-conjugated monoclonal antibody (Immunotech, No. 0772), a directly labeled specific antibody for erythroid lineage associated cells. 8 The cells were washed twice after this incubation
296 Benachi et al.
February 1998 AmJ ObstetGynecol
Table I. The sequences of oligonucleotide primers and the annealing temperature for each primer pair Primer
Annealing temperature
Sequence
D1B D2B D3B A1 A2 A3 A4 Reduced glyceraldehyde-phosphate dehydrogenase forward Reduced glyceraldehyde-phosphate dehydrogenase reverse
TGTTGTAACCGAGTGCTGGGGA TTACTGGATGACCACCATCATATAT CAGCTCCATCATGGGCTACAAC TGTGTTGTAACCGAGT ACATGCCATTGCCG TAAGCAAAAGCATCCAA ATGGTGAGATTCTCCT CCACCCATGGCAAATTCCATGGCA
65 48 58
TCTAGACGGCAGGTCAGGTCCACC
Table II. RhD genotype of mothers, fetuses, and trophoblast studied
First trimester Second trimester Third trimester
Maternal RhD
No. of fetal samples
Fetal RAD positive
11 RH+ 3 Rh1 Rh+ 1Rh2 Rh+ 0Rh-
11 3 1 1 2 0
11/11 3/3 1/1
Fetal RhD negative
Trophoblast RhD positive (DNA) 11/11 3/3 1/1
1/1 2/2 --
using phosphate-buffered saline solution. Finally, 300 p.1 of phosphate-buffered saline solution was added to the pellet, Which was gently dissolved. A negative control sample was also prepared using Simultest Control, which conrains murine monoclonal IgG1 and IgG2 andbodies coupled, respectively, to fluorescein-conjugated monoclonal antibody and phycoerythrin. The antibodies are specific for keyhole limpet hemocyanin, an antigen not expressed on h u m a n cells (Becton/Dickinson, No. 340041). Flow cytometric measurements were performed on a Facscan (Becton/Dickinson) using Lysis II software. Only single cells were evaluated and 5000 to 10,000 such events were scrutinized. Immunocytochemistry. Cells were isolated as described and incubated for 15 minutes with the same biofinylated m o n o c l o n a l Rh-D antibody. Cells were washed three times (5 minutes, 1200 revolutions/rain centrifugation) with 1 ml of phosphate-buffered saline solution. After discarding the phosphate-buffered saline solution, the remaining pellet was incubated simultaneously for 15 minutes with 10 gl of pretitered 2.8 gm streptavidincoated magnetic beads (Dynal AS Norway, Dynabeads M280 streptavidin, No. 112.050). Cells were washed once more with phosphate-buffered saline solution a n d cytospinned on a microscopic slide (Shandon Cyto centrifuge, Astmoor, United Kingdom). The slides were air-
Trophoblast TrophoblastRhD RhD messenger negative RNA (DNA) expression
1/1 2/2
None None None None None
dried for 1 hour a n d stained with a May-GrfinwaldGiemsa stain for cytologic evaluation. Results Trophoblast samples from 14 patients in the first trimester (8.5 to 13 weeks), two in the second trimester (17 weeks), a n d two in the third trimester (39 to 40 weeks) were analyzed. Maternal RhD type, which had been previously determined immunologically, was RhD positive in 14 and RhD negative in 4 (Table II). The fetal tissue and trophoblast RhD status was d e t e r m i n e d in each case by polymerase chain reaction amplification of DNA with primers within the RhD a n d CcEe gene. Seventeen fetuses were RhD positive and one was RhD negative for both tissue and trophoblast (Table II). No RhD expression was detected in any trophoblast sample, whereas expression was seen in the RhD-positive cord blood sample (Figure. 2). The presence of RNA was confirmed by reverse transcriptase-polymerase chain reaction analysis with primers from the reduced glyceraldehyde phosphate dehydrogenase gene, expression of which was observed in each sample. Figure. 3 shows the flow cytometric analysis of a representative sample, in this case a sample from a RhD-posifive fetus with an RhD-negative mother. X and Y axes display the "green" (fluorescein isothiocyanate) fluorescence
Benachi et al.
Volume 178, Number 2 AmJ Obstet Gynecol
+ve ~ntrol
RhD positive ~ trophoblast
m
297
'-
~
RT-PCR for RhD mRNA E A
i ~.
RT-PCR for GAPDH mRNA
!.~...i~!~,.:l... i~'!! . .. ,:.~."~,~,:'.':~/I : ......
__"z~ A
i'6~
.....
i~
---),
-ItxFL1-Helght
9
_
.. ",
.
..-'.. ?..
.
9 9
.~.
9 ,t t.*>s'l
Fig. 2. Polymerase chain reaction products showing specific RhD expression in control fetal erythrocytes but not in trophoblast. Reduced glyceraldehyde-phosphate dehydrogenase expression is shown to confirm RNA integrity.
^ N |
"
t I
1';
"
This study clearly d e m o n s t r a t e s that RhD is n o t expressed by h u m a n trophoblast. O u r original aim was to examine trophoblast expression in the first trimester to assess the usefulness of anti-D cell sorting for noninvasive p r e n a t a l diagnosis 9 With negative findings in the first
~. v . . . .
.~.,'.;,,
:
.t
i
~ 9
.
.
.
.
.
.
.
. ...:.'0.",,~:
, .......
: .~:,
I
"
"
9 :
.,
.
]
9 ". :
...':"Z~;/:~.
9
..
B
FLI
-H'~FL
"l'~
l-Heigh~
9 ..,
.:,,.,.~.,..,
.. "1"6~
,,:..'~::,?
"~;
.~!..':'
';."
~:i.~..~,...::..... ~;."
;" ::~ ~::L;.:;
d,~ ......
..
9
. 9
9
.
I|
a n d the "red" (phycoerythrin) fluorescence, respectively. Both scales are a logarithmic display of the fluorescence intensity. Each dot represents one cell. In Fig. 3, A (the negative control sample), all cells can be f o u n d in the lower left quadrant. The sample i n c u b a t e d with the phycoerythrin-labeled RhD antibody a n d glycophorin A-fluorescein isothiocyanate antibody (Fig. 3, B) displays distinct p o p u l a t i o n s of cells in the u p p e r right q u a d r a n t (RhD-positive a n d glycophorin A-positive events), lower left q u a d r a n t (RhD-negative a n d glycophorin A-negative events), a n d lower right q u a d r a n t (RhD-negative a n d glyc o p h o r i n A-positive events). These were considered to c o r r e s p o n d with fetal erythrocytes, trophoblast cells, a n d maternal.erythrocytes, T h e paucity of trophoblast cell n u m b e r in the lower left q u a d r a n t may be attributed to the difficulty disaggregating trophoblast into single cells. Figure. 4 displays the results of the i m m u n o c y t o c h e m i c a l approach. Figure. 4, A, displays a cluster of RhD-positive erythrocytes, with streptavidin-coated m a g n e t i c beads (brown) detected o n the individual cells in contrast to Fig. 4, B, in which n o beads are attached to the external m e m b r a n e s of the trophoblast tissue9
, ".:
";;'~l:.~bN~";':"~lt;.,,,.,,~,,~7[~/, ,, :~,~ ,~':~'".
1~
9
~
---)
Fig. 3. Results of flow cytometric analysis of control trophoblast sample (A) and representative trophoblast sample (B). Both scales are a logarithmic display of the fluorescence intensity. Each dot represents one cell. A, A sample from an RhD-positive fetus with an RhD-negative mother9 X and Y axes display the "green" (mouse IgG1 fluorescein isothiocyanate) fluorescence and the "red" (mouse IgG2 phycoerythrin) fluorescence, respectively. B, A sample from an RhD-positive fetus with an RhDnegative mother9 X and Y axes display the "green" (glycophorin A fluorescein isothiocyanate) fluorescence and the "red" (RhD phycoerythrin) fluorescence, respectively9 Three populations are seen, RhD-positive and glycophorin A-positive fetal red blood cells in the upper right quadrant (with another secondary population of erythroid lineage cell to the left of this), RhD-negative and glycophorin A-positive maternal cells in the lower right quadrant, and RhD-negative and glycophorin A-negative trophoblast cells in the lower left quadrant9
trimester, we e x t e n d e d the study into the second a n d third trimesters to confirm that n o expression of RhD existed o n trophoblast at any time d u r i n g pregnancy. Only one article has previously studied the expression of RhD in trophoblast. In 1980 Goto et al., 2 by use of an i m m u n o f l u o r e s c e n t method, showed a specific staining o n the plasma m e m b r a n e a n d cytoplasm of the villous trophoblast, c o n c l u d i n g that RhD was expressed in trophoblast tissue9 T h e same g r o u p 9 previously r e p o r t e d
2 9 8 Benachi et al.
February 1998 AmJ Obstet Gynecol
Fig. 4. A, Light photomicrograph of cytospin of trophoblast tissue collected at 12 weeks, after immunocytochemical labeling. No beads are attached to the external membrane of the trophoblast tissue. Occasional unbound beads can be seen. B, Light photomicrograph of cytospin of a cluster of RhD-positive erythrocytes (palepink cells). The streptavidincoated magnetic beads (brown) are seen bound to indMdual cells. There are also occasional unbound beads seen. (May-Gia3nwald-Giemsa stain.)
that A and B blood g r o u p antigens were n o t present on the surface m e m b r a n e of the trophoblast. In the Goto et al. study, 20 placentas were e x a m i n e d . T h e y u s e d an i m m u n o f l u o r e s c e n c e t e c h n i q u e with a fluorescein-conjugated (fluorescein isothiocyanate) antiRhD a n t i s e r u m . T h e s p e c i m e n s were divided in t h r e e groups. O n e g r o u p was i n c u b a t e d with fluorescein-conjugated anti-RhD and two groups served as controls. O n e control went t h r o u g h the absoqotion test (incubated with the fluorescein isothiocyanate anti-RhD having b e e n previously absorbed with erythrocytes of b l o o d g r o u p RhD) a n d the s e c o n d c o n t r o l was n o t t r e a t e d ( s p o n t a n e o u s fluorescein test). T h e i m m u n o f l u o r e s c e n t staining was present in the trophoblast in all samples of the first g r o u p and n o n e in the first control group. They c o n c l u d e d that RhD antigen was expressed in the trophoblast. However, it is n o t clear w h e t h e r the RhD type of the fetus was con-
firmed. F u r t h e r m o r e , no trophoblast t r o m an RhD- negative fetus was tested as a negative control to confirm that i m m u n o f l u o r e s c e n t staining was specific for RhD. A l t h o u g h the antibodies used had b e e n absorbed, they h a d n o t b e e n tested o n any o t h e r type o f tissue, v a n ' t Veer et al. 1~ r e p o r t e d in c o r r e s p o n d e n c e that they incub a t e d trophoblasts of RhD-positive and RhD-negative fetuses with various conjugates and saw n o d i f f e r e n c e in the i m m u n o f l u o r e s c e n t staining pattern. Unlike Goto et al., their conjugates were n o t absorbed. Van't Veer et al. also u s e d a m o u s e m o n o c l o n a l a n t i b o d y ( L I C R L O N R6a) that reacts with all red cells except Rh-null cells but does n o t discriminate b e t w e e n RhD-posidve a n d RhDnegative cells. They c o n c l u d e d that RhD antigen was only expressed by red cells in the villous vessels and red cells o f the m o t h e r a r o u n d the villi, n o t on trophoblast cells. I m m u n o f l u o r e s c e n t staining with h u m a n anti-RhD con-
Benachi et al.
Volume 178, Number 2 AmJ Obstet Gynecol
j u g a t e m i g h t n o t b e a reliable t e c h n i q u e for d e t e r m i n a tion of the expression of the Rh gene on trophoblast. V a n ' t Veer's study, a l t h o u g h h i g h l i g h t i n g t h e i m p e r f e c tions of G o t o ' s t e c h n i q u e , failed to p r o v i d e a final answer to this question. T h e m o d e r n t e c h n i q u e s u s e d in o u r study are reliable, r e p r o d u c i b l e , a n d highly specific. I n view o f t h e possibility o f c o n t a m i n a t i n g m a t e r n a l D N A ( f r o m d e c i d u a o r b l o o d ) o r t r o p h o b l a s t mosaicism, D N A was isolated f r o m fetal tissue to c o n f i r m t h e t r o p h o b l a s t result. T h e results were t h e same in all 18 cases. T h e negative e x p r e s s i o n o f R h D in o u r samples m i g h t have b e e n t h e result of deg r a d e d RNA, b u t cDNA a n d p o l y m e r a s e c h a i n r e a c t i o n for the RNA was also p e r f o r m e d with p r i m e r s within t h e reduced glyceraldehyde-phosphate dehydrogenase gene as a c o n t r o l h o u s e k e e p i n g gene. T h e r e d u c e d glyceraldehyde p h o s p h a t e d e h y d r o g e n a s e g e n e was f o u n d clearly e x p r e s s e d in all 18 samples, Moreover, this f i n d i n g is supp o r t e d by o u r flow cytometric data: t h e only cells t h a t express RhD coexpress g l y c o p h o r i n A, a m a r k e r of the erythr o i d l i n e a g e . Also by m e a n s o f i m m u n o c y t o c h e m i c a l t e c h n i q u e s we c o u l d n o t d e m o n s t r a t e any R h D a n t i g e n e x p r e s s i o n o n t r o p h o b l a s t tissue. In summary, R h D is n o t e x p r e s s e d by t r o p h o b l a s t cells. Fetal cell s o r t i n g for n o n i n v a s i v e p r e n a t a l diagnosis by t a r g e t i n g t h e R h a n t i g e n in p r e g n a n c i e s in w h i c h t h e
299
m o t h e r is R h D negative a n d t h e fetus is R h D positive will t h e r e f o r e only t a r g e t e r y t h r o i d cells.
REFERENCES
1. Sieff CA. Membrane antigen expression during hematopoietic differentiation. Crit Rev Oncol Hematol 1986;5:1-36. 2. Goto S, Nishi H, Tomoda Y. Blood group Rh-D factor in human trophoblast determined by immunofluorescent method. Am J Obstet Gynecol 1980;137:707-12. 3. Thomas MR, Williamson R, Craft I, Yardani NM, Rodeck CH. Y chromosome sequence DNA amplified from peripheral blood of women in early pregnancy. Lancet 1994;343:411-5. 4. Johansen M, Knight M, Maher EJ, Smith K, Sargent IL. An investigation of methods for enriching trophoblast from maternal blood. AmJ Obstet Gynecol 1995;15:921-31. 5. Durrant L, McDowall K, Holmes R, Liu D. Non-invasive prenatal diagnosis by isolation of both trophoblasts and fetal nucleated red blood cells from the peripheral blood of pregnant women. BrJ Obstet Gynaecol 1996;103:219-22. 6. Bennett PR, Le-Van-Kim C, Colin Y, et al. Prenatal determination of fetal RhD type. N EnglJ Med 1993;329:60%10. 7. Cartron J. Defining the RhD blood group antigens: biochemistry and molecular genetics. Blood Rev 1994;8:199-212. 8. Edwards PA. Monoclonal antibodies that bind to the human erythrocyte membrane glycoproteins glycophorin A and Band 3. Biochem Soc Trans 1980;8:334-5. 9. Goto S, Hoshino M, Tomoda Y, Ishizuka N. Immunoelectron microscopy of the human chorionic villus in search of blood group A and B antigens. Lab Invest 1976;35:350. 10. van't Veer MB, Overbeeke N. AM, Geertzen HGM, van der Lans SMGA [letter]. The expression of Rh-D factor in human trophoflast. 1984;150:1008-9.
Key words: Rhesus D expression, h u m a n trophoblast
The RhD a n t i g e n causes Rh a l l o i m m u n i z a t i o n , an i m p o r t a n t cause of perinatal morbidity and mortality. RhD is abundantly present on cells of the erythroid lineage and has b e e n d o c u m e n t e d from as early as the colony-forming unit-erythrocyte stage, 1 with the antigens persisting t h r o u g h o u t the life of the erythrocyte. Alloimmunization is generally thought to be caused by transfer of fetal erythrocytes into the maternal circulation. Only one study has addressed whether RhD is expressed in other reproductive tissues.2 This showed, by means of immunocytochemistry, that trophoblast also expresses the RhD antigen. Trophoblast expression might explain the p h e n o m e n o n of very early sensitization at gestations when circulating fetal blood volume is too small to be considered capable of initiating an antibody response in the mother. Trophoblasts are one of the three fetal cell types d e m o n s t r a t e d n o r m a l l y to be present in the maternal circulation. Fetal deoxyribonucleic acid (DNA) has been shown to be present in maternal blood from as early as 5 weeks' gestation, too early for nucleated erythrocytes to be the source. 3 This is an imFrom the Royal Postgraduate Medical School, Institute of Obstetrics and Gynaecology, Queen Charlotte's and Chelsea Hospital, a and Institut fiir Transfusionmedizin/Transplantationsimmunologie, Westfiilische Wilhelms Universitdt. b Supported by a NATO Collaborative Research Grant. Received for publication May 27, 1997; revisedJuly 2, 1997; accepted August 5, 1997. Reprints not availablefrom the authors. Copyright 9 1998 by Mosby, Inc. 0002-9378/98 $5.00 + 0 6/1/85195 294
portant clinical issue because alloimmunization could occur in a n e m b r y o n i c molar pregnancies, the trophoblast from which was also shown to express the RhD antigen.2 Although identification of fetal cells in the maternal circulation holds exciting prospects for noninvasive prenatal diagnosis, work in this field has been delayed by the lack of fetally specific antigens to facilitate cell sorting. 4, 5 This applies especially to isolation of trophoblast because most antitrophoblast antibodies are not highly specific. Most cell sorting strategies in this field target nucleated erythrocytes, leukocytes, or trophoblasts. If trophoblast did express the RhD antigen, this would be a truly specific fetal marker for fetal cell sorting in pregnancies in which the mother is RhD negative and the fetus is RhD positive. Sorting with an anti-D monoclonal antibody would thus simultaneously target both nucleated erythrocytes and trophoblasts. The aim of our study was to confirm expression of the RhD gene in trophoblast using sensitive molecular and immunophenotyping techniques. Material and m e t h o d s
Tissue. Trophoblast was collected from 18 pregnancies, either at termination of pregnancy or after cesarean section, together with samples of fetal tissue or umbilical cord blood, respectively. All women gave informed consent in accordance with institutional ethics committee approval and national guidelines on fetal tissue research. Tissue samples were snap frozen in liquid nitrogen immediately after collection and stored at -70 ~ C. A RhDpositive cord blood samp!e was also collected as a positive
Benachi et al.
Volmne 178, Number 2 AmJ Obstet Gynecol
control for RhD expression. Blood samples were stored at 4~ Nucleic acid extraction. Ribonucleic acid (RNA) was extracted for reverse transcriptase-polymerase chain reaction analysis of RhD expression in trophoblast. DNA was isolated from trophoblast to determine the fetal RhD status and from fetal tissue to confirm the trophoblast result. RNA and DNA were extracted using TRIzol reagent (Gibco BRL Life Technologies, Paisley, United Kingdom). One h u n d r e d milligrams of tissue was homogenized in 1 ml of TRIzol and 0.2 ml of chloroform was added, separating the solution into an aqueous and organic phase. RNA was isolated from the aqueous phase after centrifugation by precipitation with isopropanol. RNA was then dissolved in 20 p,1 of 1 m l n o l / L ethylenediaminetetraacetic acid and stored at -70 ~ C. DNA was isolated from the interphase after ethanol precipitation, dissolved in 8 m m o l / L sodium hydroxide, and stored at 4 ~ C. RNA, and DNA concentrations were determined by spectrophotometry. Reverse transcriptase-polymerase chain reaction. Complementary DNA (cDNA) was synthesized from 10 tll of RNA in a 20 [tl reaction mixture consisting of 0.2 m m o l / L deoxynucleotides, triphosphates, 50 U myeloid leukemia virus reverse transcriptase, and 100 ng primers in standard reverse transcriptase (Gibco BRL). cDNA complementary to the RhD gene was synthesized using the D2B primer from exon 10 of the RhD gene (Table I). Random hexanucleotide primers were used to synthesize a total cDNA population. Ten microliters of RNA was denatured at 70 ~ C for 5 minutes, and 10 gl of reaction mix was added and incubated at 37 ~ C for 60 minutes. The reaction was stopped by heating to 95 ~ C for 5 minutes. Heminested polymerase chain reaction analysis was then carried out using three oligonucleotide primers from within the RhD gene (Fig. 1). The first r o u n d of polymerase chain reaction was performed with primers DIB (from exon 7 of the RhD) and D2B; the second with D2B a n d D3B (from exon 7 of the RhD). Each polymerase chain reaction took place in a 50 gl volume consisting of 1.5 m m o l / L magnesium chloride, 100 ng of each primer, 0.2 m m o l / L each of deoxythymidine triphosphate, deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, and 1 U of Taq polymerase. The DNA template for the first round of polymerase chain reaction was 5 gl of cDNA; 5 gl of DNA product from the first reaction was used as template for the second round. Polymerase chain reaction was also carried out using primers within the housekeeping reduced glyceraldehyde-phosphate dehydrogenase gene, as a messenger RNA (mRNA) expression control, in a 25 gl reaction (with reagents essentially as described above) using 2:5 ~tl of the total cDNA population as a template. Polymerase chain reaction for RhD type. A single r o u n d
D1B
D gene
D3B
IN I 1 o i
,,,I~..41AI
Cc Ee gene
ElN
D2B
-Ib,---IP~
Nr r NN I rglNI
295
A2
..II~-~41-, A3
A4
D1 B D3 B
~
7 INNI
"ID'-~91"
A1 A2 A3 primer with full sequence homology primer with partial sequence homology Fig. 1. Diagram showing the annealing sites for each of the primers used for the RhD and RhCcEe gene sequences. Each gene consists of 10 exons with high homology except within exons 7 and 10.
of polymerase chain reaction using two sets of primers corresponding to the RhCcEe and RhD genes, 6, 7 respectively (Table I), was carried out to determine the RhD status of fetal trophoblast and tissue. A 50 gl reaction was performed with reagents as described above and 5 gl of DNA template. For each polymerase chain reaction 30 cycles of polymerase chain reaction were performed with an initial denaturation of 95 ~ C for 5 minutes, and subsequent cycles of 1 minute at 95 ~ C, 1 minute at the appropriate a n n e a l i n g temperature (Table I), and 1 minute at 72 ~ C. Final denaturation was at 72 ~ C for 5 minutes. DNA products were electrophoresed on 3% agarose gels, stained with ethidium bromide, and visualized u n d e r ultraviolet light. The presence of one polymerase chain reaction product of 136 base pairs indicated amplification only from the Rh CcEe gene and therefore an RhD-negative fetus. Two polymerase chain reaction products of 136 base pairs and 186 base pairs indicated amplification from both genes and therefore that the fetus was RhD positive. Flow cytometry. Single cells were isolated from trophoblast samples by mechanical disruption of the sample. A total of 104 to 105 isolated cells was incubated with a biotinylated anti-D monoclonal antibody (gift from Prof. J.E Cartron, INSERM Paris) for 15 minutes at 40 ~ C. After incubation, cells were washed three times (5 minutes, 1200 revolutions/min centrifugation) with 1 ml of phosphate-buffered saline solution. After discarding the phosphate-buffered saline solution, the remaining pellet was incubated for 15 minutes at 40 ~ C with 10 gl of pretitered streptavidin phycoerythrin (Becton/Dickinson, Oxford, United Kingdom; No. 349023) and 10 gl pretitered glycophorin-A fluorescein-conjugated monoclonal antibody (Immunotech, No. 0772), a directly labeled specific antibody for erythroid lineage associated cells. 8 The cells were washed twice after this incubation
296 Benachi et al.
February 1998 AmJ ObstetGynecol
Table I. The sequences of oligonucleotide primers and the annealing temperature for each primer pair Primer
Annealing temperature
Sequence
D1B D2B D3B A1 A2 A3 A4 Reduced glyceraldehyde-phosphate dehydrogenase forward Reduced glyceraldehyde-phosphate dehydrogenase reverse
TGTTGTAACCGAGTGCTGGGGA TTACTGGATGACCACCATCATATAT CAGCTCCATCATGGGCTACAAC TGTGTTGTAACCGAGT ACATGCCATTGCCG TAAGCAAAAGCATCCAA ATGGTGAGATTCTCCT CCACCCATGGCAAATTCCATGGCA
65 48 58
TCTAGACGGCAGGTCAGGTCCACC
Table II. RhD genotype of mothers, fetuses, and trophoblast studied
First trimester Second trimester Third trimester
Maternal RhD
No. of fetal samples
Fetal RAD positive
11 RH+ 3 Rh1 Rh+ 1Rh2 Rh+ 0Rh-
11 3 1 1 2 0
11/11 3/3 1/1
Fetal RhD negative
Trophoblast RhD positive (DNA) 11/11 3/3 1/1
1/1 2/2 --
using phosphate-buffered saline solution. Finally, 300 p.1 of phosphate-buffered saline solution was added to the pellet, Which was gently dissolved. A negative control sample was also prepared using Simultest Control, which conrains murine monoclonal IgG1 and IgG2 andbodies coupled, respectively, to fluorescein-conjugated monoclonal antibody and phycoerythrin. The antibodies are specific for keyhole limpet hemocyanin, an antigen not expressed on h u m a n cells (Becton/Dickinson, No. 340041). Flow cytometric measurements were performed on a Facscan (Becton/Dickinson) using Lysis II software. Only single cells were evaluated and 5000 to 10,000 such events were scrutinized. Immunocytochemistry. Cells were isolated as described and incubated for 15 minutes with the same biofinylated m o n o c l o n a l Rh-D antibody. Cells were washed three times (5 minutes, 1200 revolutions/rain centrifugation) with 1 ml of phosphate-buffered saline solution. After discarding the phosphate-buffered saline solution, the remaining pellet was incubated simultaneously for 15 minutes with 10 gl of pretitered 2.8 gm streptavidincoated magnetic beads (Dynal AS Norway, Dynabeads M280 streptavidin, No. 112.050). Cells were washed once more with phosphate-buffered saline solution a n d cytospinned on a microscopic slide (Shandon Cyto centrifuge, Astmoor, United Kingdom). The slides were air-
Trophoblast TrophoblastRhD RhD messenger negative RNA (DNA) expression
1/1 2/2
None None None None None
dried for 1 hour a n d stained with a May-GrfinwaldGiemsa stain for cytologic evaluation. Results Trophoblast samples from 14 patients in the first trimester (8.5 to 13 weeks), two in the second trimester (17 weeks), a n d two in the third trimester (39 to 40 weeks) were analyzed. Maternal RhD type, which had been previously determined immunologically, was RhD positive in 14 and RhD negative in 4 (Table II). The fetal tissue and trophoblast RhD status was d e t e r m i n e d in each case by polymerase chain reaction amplification of DNA with primers within the RhD a n d CcEe gene. Seventeen fetuses were RhD positive and one was RhD negative for both tissue and trophoblast (Table II). No RhD expression was detected in any trophoblast sample, whereas expression was seen in the RhD-positive cord blood sample (Figure. 2). The presence of RNA was confirmed by reverse transcriptase-polymerase chain reaction analysis with primers from the reduced glyceraldehyde phosphate dehydrogenase gene, expression of which was observed in each sample. Figure. 3 shows the flow cytometric analysis of a representative sample, in this case a sample from a RhD-posifive fetus with an RhD-negative mother. X and Y axes display the "green" (fluorescein isothiocyanate) fluorescence
Benachi et al.
Volume 178, Number 2 AmJ Obstet Gynecol
+ve ~ntrol
RhD positive ~ trophoblast
m
297
'-
~
RT-PCR for RhD mRNA E A
i ~.
RT-PCR for GAPDH mRNA
!.~...i~!~,.:l... i~'!! . .. ,:.~."~,~,:'.':~/I : ......
__"z~ A
i'6~
.....
i~
---),
-ItxFL1-Helght
9
_
.. ",
.
..-'.. ?..
.
9 9
.~.
9 ,t t.*>s'l
Fig. 2. Polymerase chain reaction products showing specific RhD expression in control fetal erythrocytes but not in trophoblast. Reduced glyceraldehyde-phosphate dehydrogenase expression is shown to confirm RNA integrity.
^ N |
"
t I
1';
"
This study clearly d e m o n s t r a t e s that RhD is n o t expressed by h u m a n trophoblast. O u r original aim was to examine trophoblast expression in the first trimester to assess the usefulness of anti-D cell sorting for noninvasive p r e n a t a l diagnosis 9 With negative findings in the first
~. v . . . .
.~.,'.;,,
:
.t
i
~ 9
.
.
.
.
.
.
.
. ...:.'0.",,~:
, .......
: .~:,
I
"
"
9 :
.,
.
]
9 ". :
...':"Z~;/:~.
9
..
B
FLI
-H'~FL
"l'~
l-Heigh~
9 ..,
.:,,.,.~.,..,
.. "1"6~
,,:..'~::,?
"~;
.~!..':'
';."
~:i.~..~,...::..... ~;."
;" ::~ ~::L;.:;
d,~ ......
..
9
. 9
9
.
I|
a n d the "red" (phycoerythrin) fluorescence, respectively. Both scales are a logarithmic display of the fluorescence intensity. Each dot represents one cell. In Fig. 3, A (the negative control sample), all cells can be f o u n d in the lower left quadrant. The sample i n c u b a t e d with the phycoerythrin-labeled RhD antibody a n d glycophorin A-fluorescein isothiocyanate antibody (Fig. 3, B) displays distinct p o p u l a t i o n s of cells in the u p p e r right q u a d r a n t (RhD-positive a n d glycophorin A-positive events), lower left q u a d r a n t (RhD-negative a n d glycophorin A-negative events), a n d lower right q u a d r a n t (RhD-negative a n d glyc o p h o r i n A-positive events). These were considered to c o r r e s p o n d with fetal erythrocytes, trophoblast cells, a n d maternal.erythrocytes, T h e paucity of trophoblast cell n u m b e r in the lower left q u a d r a n t may be attributed to the difficulty disaggregating trophoblast into single cells. Figure. 4 displays the results of the i m m u n o c y t o c h e m i c a l approach. Figure. 4, A, displays a cluster of RhD-positive erythrocytes, with streptavidin-coated m a g n e t i c beads (brown) detected o n the individual cells in contrast to Fig. 4, B, in which n o beads are attached to the external m e m b r a n e s of the trophoblast tissue9
, ".:
";;'~l:.~bN~";':"~lt;.,,,.,,~,,~7[~/, ,, :~,~ ,~':~'".
1~
9
~
---)
Fig. 3. Results of flow cytometric analysis of control trophoblast sample (A) and representative trophoblast sample (B). Both scales are a logarithmic display of the fluorescence intensity. Each dot represents one cell. A, A sample from an RhD-positive fetus with an RhD-negative mother9 X and Y axes display the "green" (mouse IgG1 fluorescein isothiocyanate) fluorescence and the "red" (mouse IgG2 phycoerythrin) fluorescence, respectively. B, A sample from an RhD-positive fetus with an RhDnegative mother9 X and Y axes display the "green" (glycophorin A fluorescein isothiocyanate) fluorescence and the "red" (RhD phycoerythrin) fluorescence, respectively9 Three populations are seen, RhD-positive and glycophorin A-positive fetal red blood cells in the upper right quadrant (with another secondary population of erythroid lineage cell to the left of this), RhD-negative and glycophorin A-positive maternal cells in the lower right quadrant, and RhD-negative and glycophorin A-negative trophoblast cells in the lower left quadrant9
trimester, we e x t e n d e d the study into the second a n d third trimesters to confirm that n o expression of RhD existed o n trophoblast at any time d u r i n g pregnancy. Only one article has previously studied the expression of RhD in trophoblast. In 1980 Goto et al., 2 by use of an i m m u n o f l u o r e s c e n t method, showed a specific staining o n the plasma m e m b r a n e a n d cytoplasm of the villous trophoblast, c o n c l u d i n g that RhD was expressed in trophoblast tissue9 T h e same g r o u p 9 previously r e p o r t e d
2 9 8 Benachi et al.
February 1998 AmJ Obstet Gynecol
Fig. 4. A, Light photomicrograph of cytospin of trophoblast tissue collected at 12 weeks, after immunocytochemical labeling. No beads are attached to the external membrane of the trophoblast tissue. Occasional unbound beads can be seen. B, Light photomicrograph of cytospin of a cluster of RhD-positive erythrocytes (palepink cells). The streptavidincoated magnetic beads (brown) are seen bound to indMdual cells. There are also occasional unbound beads seen. (May-Gia3nwald-Giemsa stain.)
that A and B blood g r o u p antigens were n o t present on the surface m e m b r a n e of the trophoblast. In the Goto et al. study, 20 placentas were e x a m i n e d . T h e y u s e d an i m m u n o f l u o r e s c e n c e t e c h n i q u e with a fluorescein-conjugated (fluorescein isothiocyanate) antiRhD a n t i s e r u m . T h e s p e c i m e n s were divided in t h r e e groups. O n e g r o u p was i n c u b a t e d with fluorescein-conjugated anti-RhD and two groups served as controls. O n e control went t h r o u g h the absoqotion test (incubated with the fluorescein isothiocyanate anti-RhD having b e e n previously absorbed with erythrocytes of b l o o d g r o u p RhD) a n d the s e c o n d c o n t r o l was n o t t r e a t e d ( s p o n t a n e o u s fluorescein test). T h e i m m u n o f l u o r e s c e n t staining was present in the trophoblast in all samples of the first g r o u p and n o n e in the first control group. They c o n c l u d e d that RhD antigen was expressed in the trophoblast. However, it is n o t clear w h e t h e r the RhD type of the fetus was con-
firmed. F u r t h e r m o r e , no trophoblast t r o m an RhD- negative fetus was tested as a negative control to confirm that i m m u n o f l u o r e s c e n t staining was specific for RhD. A l t h o u g h the antibodies used had b e e n absorbed, they h a d n o t b e e n tested o n any o t h e r type o f tissue, v a n ' t Veer et al. 1~ r e p o r t e d in c o r r e s p o n d e n c e that they incub a t e d trophoblasts of RhD-positive and RhD-negative fetuses with various conjugates and saw n o d i f f e r e n c e in the i m m u n o f l u o r e s c e n t staining pattern. Unlike Goto et al., their conjugates were n o t absorbed. Van't Veer et al. also u s e d a m o u s e m o n o c l o n a l a n t i b o d y ( L I C R L O N R6a) that reacts with all red cells except Rh-null cells but does n o t discriminate b e t w e e n RhD-posidve a n d RhDnegative cells. They c o n c l u d e d that RhD antigen was only expressed by red cells in the villous vessels and red cells o f the m o t h e r a r o u n d the villi, n o t on trophoblast cells. I m m u n o f l u o r e s c e n t staining with h u m a n anti-RhD con-
Benachi et al.
Volume 178, Number 2 AmJ Obstet Gynecol
j u g a t e m i g h t n o t b e a reliable t e c h n i q u e for d e t e r m i n a tion of the expression of the Rh gene on trophoblast. V a n ' t Veer's study, a l t h o u g h h i g h l i g h t i n g t h e i m p e r f e c tions of G o t o ' s t e c h n i q u e , failed to p r o v i d e a final answer to this question. T h e m o d e r n t e c h n i q u e s u s e d in o u r study are reliable, r e p r o d u c i b l e , a n d highly specific. I n view o f t h e possibility o f c o n t a m i n a t i n g m a t e r n a l D N A ( f r o m d e c i d u a o r b l o o d ) o r t r o p h o b l a s t mosaicism, D N A was isolated f r o m fetal tissue to c o n f i r m t h e t r o p h o b l a s t result. T h e results were t h e same in all 18 cases. T h e negative e x p r e s s i o n o f R h D in o u r samples m i g h t have b e e n t h e result of deg r a d e d RNA, b u t cDNA a n d p o l y m e r a s e c h a i n r e a c t i o n for the RNA was also p e r f o r m e d with p r i m e r s within t h e reduced glyceraldehyde-phosphate dehydrogenase gene as a c o n t r o l h o u s e k e e p i n g gene. T h e r e d u c e d glyceraldehyde p h o s p h a t e d e h y d r o g e n a s e g e n e was f o u n d clearly e x p r e s s e d in all 18 samples, Moreover, this f i n d i n g is supp o r t e d by o u r flow cytometric data: t h e only cells t h a t express RhD coexpress g l y c o p h o r i n A, a m a r k e r of the erythr o i d l i n e a g e . Also by m e a n s o f i m m u n o c y t o c h e m i c a l t e c h n i q u e s we c o u l d n o t d e m o n s t r a t e any R h D a n t i g e n e x p r e s s i o n o n t r o p h o b l a s t tissue. In summary, R h D is n o t e x p r e s s e d by t r o p h o b l a s t cells. Fetal cell s o r t i n g for n o n i n v a s i v e p r e n a t a l diagnosis by t a r g e t i n g t h e R h a n t i g e n in p r e g n a n c i e s in w h i c h t h e
299
m o t h e r is R h D negative a n d t h e fetus is R h D positive will t h e r e f o r e only t a r g e t e r y t h r o i d cells.
REFERENCES
1. Sieff CA. Membrane antigen expression during hematopoietic differentiation. Crit Rev Oncol Hematol 1986;5:1-36. 2. Goto S, Nishi H, Tomoda Y. Blood group Rh-D factor in human trophoblast determined by immunofluorescent method. Am J Obstet Gynecol 1980;137:707-12. 3. Thomas MR, Williamson R, Craft I, Yardani NM, Rodeck CH. Y chromosome sequence DNA amplified from peripheral blood of women in early pregnancy. Lancet 1994;343:411-5. 4. Johansen M, Knight M, Maher EJ, Smith K, Sargent IL. An investigation of methods for enriching trophoblast from maternal blood. AmJ Obstet Gynecol 1995;15:921-31. 5. Durrant L, McDowall K, Holmes R, Liu D. Non-invasive prenatal diagnosis by isolation of both trophoblasts and fetal nucleated red blood cells from the peripheral blood of pregnant women. BrJ Obstet Gynaecol 1996;103:219-22. 6. Bennett PR, Le-Van-Kim C, Colin Y, et al. Prenatal determination of fetal RhD type. N EnglJ Med 1993;329:60%10. 7. Cartron J. Defining the RhD blood group antigens: biochemistry and molecular genetics. Blood Rev 1994;8:199-212. 8. Edwards PA. Monoclonal antibodies that bind to the human erythrocyte membrane glycoproteins glycophorin A and Band 3. Biochem Soc Trans 1980;8:334-5. 9. Goto S, Hoshino M, Tomoda Y, Ishizuka N. Immunoelectron microscopy of the human chorionic villus in search of blood group A and B antigens. Lab Invest 1976;35:350. 10. van't Veer MB, Overbeeke N. AM, Geertzen HGM, van der Lans SMGA [letter]. The expression of Rh-D factor in human trophoflast. 1984;150:1008-9.