Abundance and Community Composition of Ammonia-Oxidizers in Paddy Soil at Different Nitrogen Fertilizer Rates

Journal of Integrative Agriculture 2014, 13(4): 870-880

April 2014

RESEARCH ARTICLE

Abundance and Community Composition of Ammonia-Oxidizers in Paddy Soil at Different Nitrogen Fertilizer Rates SONG Ya-na and LIN Zhi-min Institute of Biological Technology, Fujian Academy of Agricultural Sciences, Fuzhou 350003, P.R.China

Abstract Ammonia oxidation, the first and rate-limiting step of nitrification, is carried out by both ammonia-oxidizing bacteria (AOB) and ammonia-oxidizing archaea (AOA). However, the relative importance of AOB and AOA to nitrification in terrestrial ecosystems is not well understood. The aim of this study was to investigate the effect of the nitrogen input amount on abundance and community composition of AOB and AOA in red paddy soil. Soil samples of 10-20 cm (root layer soil) and 0-5 cm (surface soil) depths were taken from a red paddy. Rice in the paddy was fertilized with different rates of N as urea of N1 (75 kg N ha-1 yr-1), N2 (150 kg N ha-1 yr-1), N3 (225 kg N ha-1 yr-1) and CK (without fertilizers) in 2009, 2010 and 2011. Abundance and community composition of ammonia oxidizers was analyzed by real-time PCR and denaturing gradient gel electrophoresis (DGGE) based on amoA (the unit A of ammonia monooxygenase) gene. Archaeal amoA copies in N3 and N2 were significantly (P<0.05) higher than those in CK and N1 in root layer soil or in surface soil under tillering and heading stages of rice, while the enhancement in bacterial amoA gene copies with increasing of N fertilizer rates only took on in root layer soil. N availability and soil NO3--N content increased but soil NH4+-N content didn’t change with increasing of N fertilizer rates. Otherwise, the copy numbers of archaeal amoA gene were higher (P<0.05) than those of bacterial amoA gene in root lary soil or in surface soil. Redundancy discriminate analysis based on DGGE bands showed that there were no obvious differs in composition of AOA or AOB communities in the field among different N fertilizer rates. Results of this study suggested that the abundance of ammonia-oxidizers had active response to N fertilizer rates and the response of AOA was more obvious than that of AOB. Similarity in the community composition of AOA or AOB among different N fertilizer rates indicate that the community composition of ammonia-oxidizers was relatively stable in the paddy soil at least in short term for three years. Key words: ammonia-oxidizing bacteria, ammonia-oxidizing archaea, nitrogen fertilizer rates, paddy soil

INTRODUCTION It is well known that ammonia oxidation catalyzed by the ammonia monooxygenase (amo) is the first and rate-limiting step of nitrification. For a long time, it is believed that all autotrophic ammonia-oxidizers are bacteria, which belong to γ-proteobacteria and

β-proteobacteria. The former has only been isolated from marine and brackish water (Woese et al. 1985), whereas the later isolated from soils (Stephen et al. 1996). However, recently study showed that some archaea carry amoA genes (Treusch et al. 2005; Schleper et al. 2005), suggesting that ammonia oxidation may be carried out by both ammoniaoxidizing archaea (AOA) and ammonia-oxidizing

Received 12 November, 2012 Accepted 2 April, 2013 Correspondence SONG Ya-na, Mobile: 15980168116, Fax: +86-591-87826470, E-mail: [email protected]

© 2014, CAAS. All rights reserved. Published by Elsevier Ltd. doi: 10.1016/S2095-3119(13)60426-8

Abundance and Community Composition of Ammonia-Oxidizers in Paddy Soil at Different Nitrogen Fertilizer Rates

bacteria (AOB). Ammonia-oxidizing archaea have been found in multiple ecosystems, such as sediments, forest soils, grassland soils and cultivated fields (Francis et al. 2005; Leininger et al. 2006). The quantitative analysis of the amoA genes showed that archaea predominate among ammonia-oxidizing organisms in the ocean (Wuchter et al. 2006) and in soils (Leininger et al. 2006; Nicol et al. 2008; Shen et al. 2008). It indicates that ammonia-oxidizing archaea may play an important role in nitrification. Ammonia oxidizers represent a key functional group that may significantly alter biological and chemical properties in soils (Alvey et al. 2003). Nitrification is thought to be controlled by ammonium concentration, temperature, moisture, and oxygen (Robertson 1982). However, it is unclear how the abundance and community composition of ammonia-oxidizers affect nitrification. Studies showed that management strategies such as tillage, N input, land utilization patterns and long-term fertilization practices affect the function, abundance and community composition of ammonia-oxidizers (Bruns et al. 1999; Phillips et al. 2000; Alvey et al. 2003; He et al. 2007; Ying et al. 2010). Community compisotion or abundance of ammonia-oxidizers responds to a variety of environmental factors such as pH, temperature and ammonia concentration (Prosser and Embley 2002; Avrahami and Conrad 2003; Nicol et al. 2008). Moreover, environmental factors may influence the abundance or communities of AOB and AOA differently, such as the pH in soils. The abundance or activity of ammonia-oxidizing archaea is the highest in acid soils (pH=4.9), whereas that of ammonia-oxidizing bacteria is the highest in soils of pH 6.9 (Nicol et al. 2008). The importance of AOB or AOA for ammonia oxidation may vary. For example, nitrification is driven by bacteria rather than archaea in N-rich grassland soils and agricultural soils with pH about 7.0 (Di et al. 2009; Jia and Conrad 2009), whereas archaea control nitrification in agricultural acidic soils, low-nutrient or sulfide-containing environments (Erguder et al. 2009; Gubry-Rangin et al. 2010). Ammonium is considered as the major nitrogen form in the flooded rice paddies (Wang et al. 1993). It has been suggested that oxygen release from rice

871

root may support aerobic microbial processes such as nitrification (Brune et al. 2000), and it has been shown that rice may absorb nitrate formed by nitrification of ammonium in the rhizosphere of rice (Kronzucker et al. 2000). However, little is known about the abundance and community composition of ammoniaoxidizers in paddy soil. The paddy soil with low pH is very common in southern China. Nitrogen fertilization is a major factor determining rice yields (Cassman et al. 1993). Although studies suggested that ammonia-oxidizing archeae (AOA) is dominant in paddy soil (Chen et al. 2008; Song and Lin 2010), there is little information about the effect of nitrogen fertilizer rates on the abundance and community composition of AOB or AOA and their function for nitrification in a paddy soil with low pH. In this study, the abundance and community composition of AOB and AOA in paddy soil at different rates of nitrogen fertilizer addition were analyzed.

RESULTS Soil chemical properties in paddy soil at different N fertilizer rates Soil pH in the paddy field generally decreased with the growth of rice in all treatments (Table 1). In root layer soil, the control without fertilizers (CK) had the highest pH and N3 had the lowest pH under different rice growth stages of tillering, heading and maturity respectively, while soil pH in N1 and N2 lay between these two extremes (Table 1). There were no significant differences in the surface soil pH between different treatments of N fertilizer input amount under growth stages of tillering, heading and maturity, respectively (Table 1). Available N in root layer soil was significantly (P<0.05) higher in N3 than that in N2, N1 or CK under tillering stage of rice. Available N in root layer soil took on a significant (P<0.05) tendency as N3>N2, N1>CK under heading stage of rice, and the available N of root layer soil in CK was significantly (P<0.05) lower than that in N1, N2 or N3 under maturity stage of rice (Table 1). The surface soil of N2 and N3 had markedly (P<0.05) higher available N than that of N1

© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.

SONG Ya-na et al.

872

Table 1 Chemical properties in the paddy soil under different levels of N fertilizer treatments Growth stage

Treatments1)

Tillering

CK N1 N2 N3 CK N1 N2 N3 CK N1 N2 N3

Heading

Maturity

pH (H2O) Root layer soil 6.39±0.43 a 6.05±0.12 ab 5.92±0.07 bc 5.77±0.10 cd 5.83±0.05 bc 5.53±0.11 de 5.59±0.10 cde 5.41±0.10 e 5.83±0.12 bc 5.73±0.15 cd 5.71±0.07 cd 5.53±0.15 de

Surface soil 6.43±0.21 a 6.27±0.15 ab 6.17±0.41 abc 6.17±0.44 abc 5.86±0.22 bcd 5.90±0.23 bcd 5.85±0.21 cd 5.65±0.17 cd 5.88±0.07 cd 5.79±0.10 d 5.59±0.15 d 5.75±0.13 d

Available P Available K Organic C Available N (Olsen-P, mg kg-1) (NH4OAc-K, mg kg-1) (g kg-1) (alkali-hydrolyzable N, mg kg-1) Root layer soil Surface soil Root layer soil Surface soil Root layer soil Surface soil Root layer soil Surface soil 71.2±5.4 ef 72.2±5.5 d 11.7±2.9 a 12.5±3.4 a 46.9±5.3 a 45.4±5.3 a 10.7±2.1 a 10.3±1.7 a 76.6±6.3 def 81.1±3.4 cd 11.1±3.3 a 14.5±1.0 a 44.7±6.0 a 48.9±3.6 a 10.3±1.1 a 10.1±1.4 a 77.4±3.8 de 96.0±11.8 ab 11.1±1.4 a 11.5±2.9 a 48.1±9.0 a 47.3±8.0 a 10.7±1.4 a 11.4±1.0 a 93.2±9.0 ab 98.1±4.2 a 10.3±1.7 a 14.7±3.3 a 41.2±8.6 a 47.3±2.1 a 10.5±0.7 a 10.6±1.4 a 69.7±4.8 f 78.6±10.8 cd 11.3±4.9 a 10.8±2.9 a 41.3±4.1 a 41.3±6.3 a 11.7±2.0 a 11.9±2.4 a 82.3±2.9 bcd 79.1±6.8 cd 11.4±1.3 a 12.2±1.2 a 41.2±3.8 a 40.0±8.9 a 11.4±1.6 a 10.6±1.3 a 82.7±5.1 bcd 86.5±5.5 bc 11.2±1.2 a 10.6±3.4 a 42.3±3.4 a 49.0±8.4 a 10.7±1.5 a 11.2±2.3 a 95.2±6.4 a 100.0±3.5 a 11.3±1.2 a 13.3±2.4 a 45.0±2.9 a 49.8±9.6 a 11.3±1.1 a 11.6±2.6 a 72.9±3.6 ef 68.5±9.1 d 10.6±2.7 a 10.1±2.7 a 39.7±8.4 a 43.4±3.7 a 11.8±2.5 a 12.0±2.2a 81.3±4.5 cd 75.7±13.1 cd 11.1±1.4 a 11.0±3.1 a 46.1±4.7 a 41.6±6.1 a 10.8±1.7 a 12.3±2.4 a 81.8±4.2 cd 76.1±11.4 cd 10.9±1.7 a 14.3±3.3 a 44.6±3.5 a 44.0±4.5 a 11.3±1.1 a 11.7±1.3 a 87.8±5.8 abc 83.6±11.1 bc 11.0±1.3 a 14.3±2.6 a 42.4±3.7 a 44.7±5.9 a 11.0±2.1 a 12.1±2.5 a

1) CK, control without fertilizers; N1, 75 kg N ha-1 yr-1; N2, 150 kg N ha-1 yr-1; N3, 225 kg N ha-1 yr-1. Values are mean±SD (n=3). Values in the same column followed by different letters are significantly different (P<0.05).

Abundance of ammonia-oxidizers in paddy soil at different N fertilizer rates The archaeal amoA gene copy numbers ranged from 3.30×107 to 1.73×108 g-1 dry soil. The amoA gene copy numbers of archaea in root layer soil of N3 always were the highest and significantly (P<0.05) higher than those in CK or N1 during the growth

A

20 CK

NO3--N content in root layer (mg kg-1 dry soil)

18

N1

N2

N3

16 14 10 8 6

a

a

12 b

a

ab

a

b

b

b

b

c c

4 2 0

B

Tillering

20

Heading

a

16 14

b

12

ab

a

b

10 8

Maturity

a

18 NO3--N content in surface soil (mg kg-1 dry soil)

and CK under tillering stage of rice. Available N in surface soil was markedly (P<0.05) higher in N3 than that in N2, N1 or CK under heading stage of rice, and the available N of surface soil in N3 was markedly (P<0.05) higher than that in CK under maturity stage of rice (Table 1). At the same time, the NO3--N content in root layer soil or surface soil was markedly (P<0.05) higher in N3 than that in CK under tillering, heading and maturity stages of rice (Fig. 1). The NO3--N content in root layer soil or surface soil was also higher in N2 or N1 than that in CK under tillering and heading stages of rice (Fig. 1). The differences in the NO3--N content in root layer soil or surface soil among treatments of N2, N1 and CK reduced under maturity stage of rice (Fig. 1). There was no difference in NH4+-N content in the paddy soil among different treatments of N input among under tillering, heading and maturity stages of rice (Fig. 2). Otherwise, no significant difference in organic C, available P or available K in root layer soil or in surface soil was found among different treatments under the growth stages of rice (Table 1).

b

c

ab

ab a

c

6 4 2 0

Tillering

Heading

Maturity

Growth stages

Fig. 1 NO3--N content in root layer soil (A) and in surface soil (B) at different levels of N fertilizer treatments during growth stages of rice. CK, control without fertilizers; N1, 75 kg N ha-1 yr-1; N2, 150 kg N ha-1 yr-1; N3, 225 kg N ha-1 yr-1. Values in a given growth stage of rice followed by different letters are significantly different (P<0.05). Vertical bars represent means±SE. The same as below.

stages of rice (Fig. 3). In root layer soil the archaeal amoA gene copies in N3 were also significantly (P<0.05) higher than those in N2 under heading and maturity stages of rice (Fig. 3). At the same time,

© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.

Abundance and Community Composition of Ammonia-Oxidizers in Paddy Soil at Different Nitrogen Fertilizer Rates

A

CK

NH4+-N content in root layer soil (mg kg-1 dry soil)

8

NH4+-N content in surface soil (mg kg-1 dry soil)

a

7

N2 a

6 5

a

a

a

a

N3

a a

a

4

a

a

a

3 2 1 0

B

N1

Tillering

Heading

8

a

7 6

a a

5

a

a

a

a

Maturity

a

a a

a

a

4 3 2 1 0

Tillering

Heading Growth stages

Maturity

Fig. 2 NH4+-N content in root layer soil (A) and in surface soil (B) at different levels of N fertilizer treatments during growth stages of rice.

Abundance of archaeal amoA gene in root layer soil (copies g-1 dry soil)

A CK

2.40E+08

N1

N2

N3

a

2.00E+08 1.60E+08 1.20E+08 8.00E+07 4.00E+07 0.00E+00

b

a ab c

c c

c

Tillering

b b b

Heading

a

Maturity

Abundance of archaeal amoA gene in surface soil (copies g-1 dry soil)

B 2.40E+08 2.00E+08 1.60E+08 1.20E+08 b

8.00E+07 4.00E+07 0.00E+00

a

a c c

Tillering

c c

b

Heading

a a a a

Maturity

Growth stages

Fig. 3 Abundance of ammonia-oxidizing archaea in root layer soil (A) and in surface soil (B) at different levels of N fertilizer treatments based on real-time PCR of amoA gene during growth stages of rice.

873

under tillering and heading stages of rice the amoA gene copy numbers of archaea in root layer soil in CK or N1 were significantly (P<0.05) lower than those in N2 (Fig. 3). In surface soil, the amoA gene copy numbers of archaea took on a significant (P<0.05) tendency as CK, N1
© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.

SONG Ya-na et al.

874

A Abundance of bacterial amoA gene in root layer soil (copies g-1 dry soil)

Composition of ammonia-oxidizers communities in paddy soil at different N fertilizer rates The redundancy discriminate analysis showed that there were no obvious differences in composition of ammonia-oxidizing archaea or bacteria communities in root layer or surface soil among different treatments under growth stages of tillering, heading and maturity, respectively (data not shown). In root layer soil the composition of ammonia-oxidizing archaea communities significantly (P=0.032) correlated with the soil pH under maturity stage of rice, and the composition of ammonia-oxidizing bacteria communities significantly (P=0.002) correlated with the soil pH under heading stage of rice.

CK

1.00E+08

DISCUSSION In the third year of the field experiment when the study was conducted, N availability and rice yield were increased by N fertilizer addition. Compared to CK, rice yield was increased by 14, 44 and 53% in N1, N2 and N3 respectively and rice yield in N2 and N3 were significantly (P<0.05) higher than that in N1. These results showed that the increase in amount of

N3

a ab

6.00E+07

c

4.00E+07

c c ab

2.00E+07 0.00E+00

d

a

a a a a

Tillering

Heading

Maturity

a a

a a a a

a a a a

Heading

Maturity

1.00E+08 8.00E+07 6.00E+07 4.00E+07 2.00E+07 a

0.00E+00

a

Tillering

Growth stages

Ammonia-oxidizers phylogeny The dominant DGGE bands in the paddy soil were cloned and sequenced (Fig. 5). Phylogenetic analysis in the neighbour-joining tree of archaeal amoA gene showed that all sequences were distributed in soil and sediment clusters of Group 1.1a and Group 1.1b (Fig. 6). Bands in DGGE gel of bacterial amoA gene in the paddy soil had no differences among different N fertilizer treatments (Fig. 5-B). Phylogenetic analysis showed that only one DGGE band sequence of band 6 was appeared to be the genus Nitrosomonaslike species. The other band sequences all grouped within Nitrosospira-like species in the paddy soil (Fig. 7), and five DGGE bands of band 1, 4, 5, 7, 9 were affiliated with the cluster 12, band 3, 8, 2 fell in cluster 9, cluster 11 &10 and cluster 13, respectively (Fig. 7).

N2

8.00E+07

B Abundance of bacterial amoA gene in surface soil (copies g-1 dry soil)

N1

Fig. 4 Abundance of ammonia-oxidizing bacteria in root layer soil (A) and in surface soil (B) at different levels of N fertilizer treatments based on real-time PCR of amoA gene during growth stages of rice.

A

CK

N1

N2

B

CK

N3

N1

N2

N3

Band 1 Band 2 Band 3 Band 4

Band 1 Band 2

Band 5

Band 3 Band 4

Band 6

Band 5 Band 6

Band 7

Band 7 Band 8

Band 8 Band 9

Band 9

Fig. 5 Denaturing gradient gel electrophoresis (DGGE) analysis of the predominant PCR-amplified partial DNA-targeted amoA of AOA (A) and AOB (B) obtained from the paddy soil at different N fertilizer treatments. Respective 9 major AOA and AOB DGGE bands that showed unique positions in the gels were observed and excised.

N fertilizer input significantly enhanced soil nitrogen availability, and thus promoted the increase in yields

© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.

Abundance and Community Composition of Ammonia-Oxidizers in Paddy Soil at Different Nitrogen Fertilizer Rates

of rice. N fertilizer addition also increased soil NO3-N content but had no effect on NH4+-N content in soil, and the NH4+-N content in the paddy soil was low and was only about 5 mg kg-1. The effect of N fertilizer input on the pH or the available N in root layer soil was similar to the effect of N input on the pH or the available N in surface soil, and there was no markedly difference in the pH or the available N between root layer soil and surface soil under the growth season of rice. The NO3--N content of N1, N2 or N3 in surface soil under tillering stage of rice was significantly (P<0.05) higher than that in root layer soil, which may be due to the topdress of N fertilizers at tillering stage. In agreement with the results of Chen et al. (2008), both AOB and AOA were highly abundant in the paddy soil. The amoA gene copy numbers of archaea or bacteria ranged from 3.30×107 to 1.73×108 or 2.46×10 6 to 6.74×10 7 g -1 dry soil. The archaea amoA gene copy numbers were more than those of bacteria and the ratio of archaea to bacteria ranged from 1.41 to 33.05, which also indicated that AOA dominates among ammonia-oxidizing organisms in soils (Leininger et al. 2006; Nicol et al. 2008; Shen

et al. 2008). The changes in abundance of AOA were more distinct than those in abundance of AOB. The amoA gene copy numbers of archaea in root layer soil and in surface soil all increased significantly (P<0.05) in N2 and N3 treatments under tillering and heading stages, while these changes of bacteria only took on in root layer soil. Recent study suggested that nitrification activity was significantly stimulated by urea fertilization and coupled well with abundance changes in archaeal amoA genes in acid soils (Lu et al. 2012). In our study, urea is used as chemical fertilizers, and the paddy soil pH is low (pH<6.5), the result of abundance changes in AOA were more distinct, which is similar to the study of of Lu et al. (2012). In root layer soil, the highest abundances of AOB and AOA for each treatment were always observed at the heading stage. The microbial in root layer soil were associated with the rice root, which can enhance the growth of ammonia oxidizers possibly by supplying oxygen, CO2 or organic substrates (root exudates) at the heading stage of rice. Otherwise, the effects in abundance of ammonia-oxidizers in root layer soil and in surface soil caused by increasing of N fertilizer input

Band 3 HQ594473 70 Uncultured crenarchaeote MAR AOA 15 EU667887 84 Band 7 HQ594477 94 Band 6 HQ594476 98 Band 8 HQ594478 98

Band 9 HQ594479 Uncultured crenarchaeote QY-A40 EF207216

52

875

Group 1.1a

Sediment clone ES HI 15 DQ148783 Hot spring Nitrosopumilus maritimus EU239959

95 100

100

Marine sediment clone MX 67 DQ148608 100 100

Hot spring clone NyCr.F07 EU239978 Hot spring Nitrosocaldus yellowstonii EU239961

Hot spring clone HL4.G09 EU239971 Band 5 HQ594475

96

71

ThAOA

Uncultured archaeon AOAd-138 GQ142176 Soil uncultured crenarchaeote genomic fragment 54d9 AJ627422

73

Group 1.1b

Soil uncultured archaeon clone CAT-39 GQ481086

59 99

Soil uncultured archaeon clone FE2WH1B_34 HM131580 Forest soil uncultured crenarchaeote clone B 10-3 AB545943 Band 2 HQ594472

Group 1.1b

98 Band 1 HQ594471 54 Band 4 HQ594474 27 Uncultured crenarchaeote DGGE band A1 FJ483773 0.02

Fig. 6 Phylogenetic analysis of DNA-targeted archaeal amoA recovered from DGGE bands of the paddy soil at different N fertilizer treatments. Bootstrap values (>50%) are indicated at branch points. The scale bar represents 2% estimated sequence divergence. The same as below.

© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.

SONG Ya-na et al.

876

20 42 54 100 41

Band 1 HQ594480 Band 7 HQ594488 Uncultured bacterium DGGE band AB286840 Uncultured bacterium clone amoA EU790800

63

Band 5 HQ594486

Cluster 12

Band 9 HQ594493

Uncultured bacterium AOB-T3 FJ517382 Band 4 HQ594483 Uncultured bacterium clone 3 amoA FJ890544

44

Uncultured proteobacterium AJ388582

62 99

38 44 100

Uncultured bacterium BXA-118 EU624926

Nitrosopira sp. AF AJ298689

53

Cluster 9

Band 3 HQ594482

99

Cluster 11&10

Band 8 HQ594491 Nitrosopira sp. A16 AJ298688 Band 2 HQ594481 100 Uncultured bacterium mRNA for amoA FM866450

Cluster 13

Uncultured bacterium Z97840 98 Nitrosomonas europaea L08050 Nitrosomonas sp. Nm103 AF272411Nm103 AF272411 Uncultured bacterium clone E247 EU315022

Cluster 7

100 Band 6 HQ594487 86 Uncultured bacterium clone F2 amoA EU275265 0.02

Fig. 7 Phylogenetic analysis of DNA-targeted bacterial amoA recovered from DGGE bands of the paddy soil at different N fertilizer treatments.

all weakened under maturity stage of rice. It may be attributed to the senescence of rice plant and root. Despite changes in the abundance of AOA and AOB, the communities’ composition of AOA or AOB did not differ among N fertilizer rates. Under different growth stages of rice, there were no obvious shifts in communities’ composition of AOA or AOB among treatments of CK, N1, N2 and N3. The composition of AOA or AOB communities only had significantly correlation with soil pH. Therefore, N fertilizer input had no effects on the communities’ composition of ammonia-oxidizers in the experiment field at least in short term for three years. Otherwise, phylogenetic analysis in the present study based on bacterial amoA gene identified that Nitrosopira-like species dominated in the red paddy soil, which was in agreement with previous studies in paddy soil (Bowatte et al. 2006; Chen et al. 2008). However, one Nitrosomonas-like sequence also was detected in paddy soil of the present study. The phylogenetic tree also revealed that most of the AOB detected here in the paddy soil belong to the cluster 12. Previous studies had demonstrated that AOB were dominated by cluster 13 in a paddy field in Zhejiang Province, China (Chen et al. 2008). At the

same time, all archaeal amoA gene sequences in the present paddy belonged to soil and sediment clusters. The results showed that the predominate kinds of AOB or AOA were limited to the paddy soil in this study. The discovery of AOA raised questions about the traditional assumption of the dominant role of AOB in nitrification. Although it is confirmed that AOA predominate among ammonia-oxidizing organisms in ocean and soils, the relative roles of AOB and AOA in nitrification are controversial. Studies showed that AOB rather than AOA dominate microbial ammonia oxidation in agricultural soil with high pH (pH>6.9) (Shen et al. 2008; Jia and Conrad 2009), or in grassland soils with high ammonia concentrations (Di et al. 2009, 2010). Other studies suggested that AOA rather than AOB controled nitrification in acidic soils (pH<6) (Gubry-Rangin et al. 2010), or in environments with low concentrations of ammonia or sulfide (Erguder et al. 2009; Di et al. 2010). From the present study, with an acidic soil of pH<6.5, AOA dominated among ammonia-oxidizers and the abundance of AOA markedly responsed to the increase in amount of N fertilizer input. It was suggested that AOA was more active than AOB on nitrification in

© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.

Abundance and Community Composition of Ammonia-Oxidizers in Paddy Soil at Different Nitrogen Fertilizer Rates

the present paddy soil. However, the abundance of AOB in root layer soil had a significant response to the increase in amount of N fertilizer input, which implied that AOB may also affect the nitrification. Therefore, it is necessary to assess the relative role of AOA and AOB for nitrification by detecting the amoA gene expression at the RNA level.

CONCLUSION Results of the study demonstrated that the abundance of ammonia-oxidizers had active response to N fertilizer rates in the paddy soil, and the changes in abundance of AOA was more obvious than that of AOB. At the same time, the community composition of AOA or AOB was similar among different N fertilizer rates in the paddy soil, respectively. So the ammonia-oxidizers’ community composition is relatively stable at least in short term in the paddy soil, and the abundance of ammonia-oxidizers is more easily affected by N fertilizer than the community composition of AOB or AOA.

MATERIALS AND METHODS Experimental design In 2009, an experimental field site was established by Institute of Biological Technology, Fujian Academy of Agricultural Sciences, at Qianyang (26°11´N, 119°16´E) located in the Fujian Province, southeastern China. There were three rates of N fertilizer addition in the field experiment, and the rates of N input was based on the commonly used N fertilizer level of 180 kg N ha -1 yr -1, including low, middle and high N levels of 75 kg N ha-1 yr-1 (N1), 150 kg N ha-1 yr-1 (N2) and 225 kg N ha-1 yr-1 (N3) as urea, and a control treatment without fertilizers (CK). The soil is sandy soil with organic C 16.87 g kg-1, pH 5.78, total N 1.29 g kg-1, total P 0.28 g kg-1, total K 19.39 g kg-1, alkali-hydrolyzable N 150.63 mg kg-1, available P (Olsen-P) 15.97 mg kg-1 and available K (NH4OAc-K) 78.73 mg kg-1. The soil was planted with rice (Oryza sativa L. cv. Tianyou 3301). The three N fertilizer treatments received 60 kg P2O5 ha-1 yr-1 as calcium triple superphosphate and 150 kg K2O ha-1 yr-1 as potassium chloride, which are common rates in the area. All P and K fertilizers and two-thirds N fertilizers were used as base fertilizers, and one-third of the N fertilizers were topdressed at tillering stage. Each treatment was replicated three times with 300 plants in one plot of

877

16 m 2 randomly distributed in the field. The same soil preparation, plot arranges, fertilization and irrigation, and harvesting procedures were used in 2009, 2010 and 2011. Rice was sown, transplanted and harvested in May, June, and October in three years, respectively. After harvest, the residues of the previous crops were ploughed into the soil, and new crops were sown in the plot of N treatment same to the before year in the next year.

Soil sampling For this study, the treatments were sampled in 2011 (the third year of the experiment) at tillering, heading and maturity stages (60, 90 and 120 d after rice seeds were sown) respectively. In each field replicate of the four treatments, five random sites about at 0-5 cm depth soil (surface soil) were collected and pooled as one sample, and five plants were excavated randomly, and the soil adhering to the root at about 10-20 cm depth (root layer soil) were collected from each of the five plants and pooled to give one sample per field plot. The soil samples were immediately placed in a cooler at 4°C. After storage for 2 h at 4°C, visible root pieces remaining in the sample soil were removed. The sample soil was then divided into several sub-samples. Some soils were stored at -20 or 4°C for microbial analyses or nitrification potential analyses respectively, and others were air dried at room temperature for the analyses of soil chemical properties.

Soil chemical properties Air-dried soils sieved to 0.2 mm were analyzed for organic C, pH (soil/solution ratio, 1:2.5 H2O), alkali-hydrolyzable N, Olsen-P, NH4OAc-K, NO3--N and NH4+-N by standard procedures (Bao 2007).

DNA extraction DNA was extracted from 0.5 g sample soil (stored at -20°C until analysis) using the FastDNA® SPIN Kit for Soil (MP Biomedicals, USA) according to the manufacturer’s instructions.

Quantification of ammonia-oxidizers abundance Real-time PCR was performed on a PRISM7500 Real-Time PCR System (ABI, USA). The quantification was based on the fluorescent dye SYBR-Green I which bind to doublestranded DNA during PCR amplification. Each reaction was performed in a 25-µL volume containing 2 µL 10- fold diluted DNA, 12.5 µL SYBR Premix Ex TaqTM (Takara, Japan), 0.5 µL ROX reference dye II (TaKaRa, Japan), 1 mL each primer (5 pmol µL-1, Invitrogen, China ) and 8 mL

© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.

SONG Ya-na et al.

878

Table 2 Primers and PCR conditions used for the study Target group Ammoniaoxidizing bacteria Ammoniaoxidizing archaea

1)

Primer (5´

3´)

amoA1F: GGGGTTTCTACTGGTGGT amoA1FGC1) amoA2R: CCCCTCKGSAAAGCCTTCTTC ArchAF: STAATGGTCTGGCTTAGACG ArchAFGC1) ArchAR: GCGGCCATCCATCTGTATGT

Length of Thermal profile for PCR-DGGE amplification (bp) 491 5 min at 95°C, followed by 35 cycles of 30 s at 94°C, 45 s at 58°C, 45 s at 72°C and 72°C 10 min 635 5 min at 95°C, followed by 35 cycles of 30 s at 95°C, 1 min at 53°C, 1 min at 72°C and 72°C 10 min

Thermal profile for real-time PCR 30 s at 95°C, followed by 40 cycles of 30 s at 94°C, 45 s at 58°C, 45 s at 72°C 30 s at 95°C, followed by 40 cycles of 30 s at 94°C, 1 min at 53°C, 1 min at 72°C

Reference Rotthauwe et al. (1997) Francis et al. (2005)

GC clamp 5´-CCGCCGCGCGGCGGGCGGGGCGGGGGCACGGGG-3´ (Muyzer et al. 1993) was attached to the 5´ end of primers amoA1F and ArchAF.

ultrapure water. Primers and thermal profiles for the realtime PCR were listed in Table 2. Standard curves for realtime PCR assays were set up based on the method described in He et al. (2007). Briefly, the bacterial and archaeal amoA genes were PCR-amplified from extracted DNA with the primers amoA1F/amoA2R and ArchAF/ArchAR, respectively (Table 2), and PCR products were cloned into the pMD18-T Vector (TaKaRa, Japan). Plasmids were extracted from the correct insert clones of each target gene used as standards for quantitative analyses. The plasmid DNA concentration was measured on a Nanodrop® ND1000 UV-Vis spectrophotometer (NanoDrop Technologies, USA). The copy numbers of gene were calculated directly from the concentration of the extracted plasmid DNA. Tenfold serial dilutions of a known copy number of the plasmid DNA were subjected to real-time PCR assay in triplicate to generate standard curves over six orders of magnitude (7.34×103 to 7.34×108 copies µL-1 for bacterial amoA gene, 3.81×104 to 3.81×109 copies µL-1 for archaeal amoA gene). The standard curve of bacterial amoA gene with R2 value 0.99, slope -3.26 and amplification efficiency 1.02, and that of archaeal amoA gene with R2 value 0.99, slope -3.33 and amplification efficiency 0.99.

Ammonia-oxidizers community composition Bacterial and archaeal amoA genes were amplified using the primers amoA1FGC/amoA2R and ArchAFGC/ArchAR, respectively, and thermal profiles of PCR for DGGE are listed in Table 2. A guanine-cytosine (GC) clamp was attached to the forward primer to prevent complete separation of the double strands in the DGGE. For PCR, 2 µL of 10-fold diluted DNA extract was added to 48 µL PCR reaction mix composed of 1 μL Taq DNA polymerase (2.5 U µL -1 , TANGEN, China), 5 μL deoxynucleotide triphosphates (dNTPs; 2 mmol L-1 each; Sangon, China), 5 μL 10× PCR buffer (Tangen, China), 4 μL of each primer (5 pmol μL-1; Sangon, China), and 29 μL ultrapure water. The reaction mixtures were amplified in a thermocycler (Mastercycler, Eppendorf, Germany). Successful amplification was verified by electrophoresis in 1.5% (w/v) agarose gels with ethidium bromide staining. 40 µL PCR product was used for DGGE, which was carried out with 8% (w/v) acrylamide gels containing a linear chemical

gradient ranging from 35 to 55% for ammonia-oxidizing bacteria and from 20 to 50% for ammonia-oxidizing archaea (100% denaturant contains 7 mol L-1 urea and 40% (v/v) formamide) in 1× Tris-acetate-EDTA (TAE) buffer at 60°C at a constant voltage of 150 V for 5 h (BIO-RAD DCode System, USA). The 12 samples (three replicates of four treatments) in root layer soil or in surface soil under growth stages of tillering, heading and maturity stages were placed randomly on one DGGE gels, respectively. After electrophoresis, the gels were stained for 45 min with SYBR green I nucleic acid stain (10 000-fold diluted in 1× TAE; Sigma, USA) and photographed under UV light of a video imaging system. The banding patterns were digitized with Quantity One (BIO-RAD, USA). The band intensity (peak height in the digitized banding patterns) indicated the relative abundance of the species or group of species under these PCR conditions.

Sequencing and phylogenetic analysis Numbered bands in the DGGE gel of the paddy soil (1020 cm depth) in different N fertilizer treatments in April 2011 were excised for clone and sequencing analysis. The dominant bands in the DGGE gel were excised and suspended in 30 mL ultrapure water over night, and reamplified with the primers amoA1F/amoA2R and ArchAF/ArchAR. The purified reamplified PCR products were ligated into the pMD18-T vector (TaKaRa, Japan) and the resulting ligation mix transformed into Escherichia coli DH5α competent cells following the instructions of the manufacturer. The positive clones were selected for sequencing. The sequences were aligned with BLAST search program and similarity analysis was performed with DNAMAN ver. 4.0. Phylogenetic analyses were conducted using MEGA ver. 4.0, and the neighbour-joining tree was constructed using Bootstrap Test.

Statistical analysis Statistical significance of differences among treatments of N levels of fertilizers was assessed by the analysis of variance (ANOVA) and the least significant difference (LSD) using SPSS, ver. 13.0. Community composition based on relative band intensity

© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.

Abundance and Community Composition of Ammonia-Oxidizers in Paddy Soil at Different Nitrogen Fertilizer Rates

and position was analyzed by redundancy discriminate analysis (RDA) with Monte Carlo permutation tests (CANOCO 4.0, Microcomputer Power, Ithaca, NY, USA) (Marschner et al. 2002; Alvey et al. 2003). The rates of N fertilizers input and soil properties such as organic C, pH, availability of N, P and K were used as environmental data in the redundancy discriminate analysis (RDA).

Sequence accession numbers All amoA gene sequences have been deposited in the GenBank nucleotide sequence database under accession no. of HQ594471-HQ594479 for AOA, and HQ594480HQ594483, HQ594486-HQ594488, HQ594491 and HQ594493 for AOB.

Acknowledgements The study was supported by the National Natural Science Foundation of China (40801097) and the Natural Science Foundation of Fujian Province, China (2012J01107).

References Alvey S, Yang C H, Bürkert A, Crowley D E. 2003. Cereal/legume rotation effects on rhizosphere bacterial community structure in West African soils. Biology and Fertility of Soils, 37, 73-82. Avrahami S, Conrad R. 2003. Patterns of community change among ammonia oxidizers in meadow soils upon longterm incubation at different temperatures. Applied and Environmental Microbiology, 69, 6152-6164. Bao S D. 2007. Soil Analysis in Agricultural Chemistry. China Agricultural Press, Beijing. pp. 30-34, 56-58, 8183, 106-108. (in Chinese) Bowatte S, Jia Z, Ishihara R, Nakajima Y, Asakawa S, Kimura M. 2006. Molecular analysis of the ammoniaoxidizing bacterial community in the surface soil layer of a Japanese paddy field. Soil Science and Plant Nutrition, 52, 427-431. Brune A, Frenzel P, Cypionka H. 2000. Life at the oxicanoxic interface: Microbial activities and adaptations. FEMS Microbiology Reviews, 24, 691-710. Bruns M A, Stephen J R, Kowalchuk G A, Prosser J I, Paul E A. 1999. Comparative diversity of ammonia oxidizer 16S rRNA gene sequences in native, tilled, and successional soils. Applied and Environmental Microbiology, 65, 2994-3000. Cassman K G, Kropff M J, Gaunt J, Peng S. 1993. Nitrogen use efficiency of rice reconsidered: What are the key constraints? Plant and Soil, 155/156, 359-362. Chen X P, Zhu Y G, Xia Y, Shen J P, He J Z. 2008. Ammonia-oxidizing archeae: Important players in paddy rhizosphere soil? Environmental Microbiology, 10, 1978-1987. Di H J, Cameron K C, Shen J P, Winefield C S, O’Callaghan M, Bowatte S, He J Z. 2009. Nitrification driven by

879

bacteria and not archaea in nitrogen-rich grassland soils. Nature Geoscience, 2, 621-624. Di H J, Cameron K C, Shen J P, Winefield C S, O’Callaghan M, Bowatte S, He J Z. 2010. Ammonia-oxidizing bacteria and archaea grow under contrasting soil nitrogen conditions. FEMS Microbiology Ecology, 72, 386-394. Erguder T H, Boon N, Wittebolle L, Marzorati M, Verstraete W. 2009. Environmental factors shaping the ecological niches of ammonia-oxidizing archaea. FEMS Microbiology Reviews, 33, 855-869. Francis C A, Roberts K J, Beman J M, Santoro A E, Oakley B B. 2005. Ubiquity and diversity of ammonia-oxidizing archaea in water columns and sediments of the ocean. Proceedings of the National Academy of Sciences of the United States of America, 102, 14683-14688. Gubry-Rangin C, Nicol G W, Posser J I. 2010. Archaea rather than bacteria control nitrification in two agricultural acidic soils. FEMS Microbiology Ecology, 74, 566-574. He J Z, Shen J P, Zhang L M, Zhu Y G, Zheng Y M, Xu M G, Di H J. 2007. Quantitative analyses of the abundance and composition of ammonia-oxidizing bacteria and ammonia-oxidizing archaea of a Chinses upland red soil under long-term fertilization practices. Environmental Microbiology, 9, 2364-2374. Jia Z J, Conrad R. 2009. Bacteria rather than archeae dominate microbial ammonia oxidation in an agricultural soil. Environmental Microbiology, 11, 1685-1671. Kronzucker H J, Siddiqi M Y, Glass M A D, Kirk G J D. 2000. Comparative kinetic analysis of ammonium and nitrate acquisition by tropical lowland rice: Implications for rice cultivation and yield potential. New Phytologist, 145, 471-476. Leininger S, Urich T, Schloter M, Schwark L, Qi J, Nicol G W, Prosser J I, Schuster S C, Schleper C. 2006. Archaea predominate among ammonia-oxidizing prokaryotes in soil. Nature, 442, 806-809. Lu L, Han W Y, Zhang J B, Wu Y C, Wang B Z, Lin X G, Zhu J G, Cai Z C, Jia Z J. 2012. Nitrification of archaeal ammonia oxidizers in acid soils is supported by hydrolysis of urea. The International Society for Microbial Ecology Journal, 6, 1978-1984. Marschner P, Neumann G, Kania A, Weiskopf L, Lieberei R. 2002. Spatial and temporal dynamics of the microbial community structure in the rhizosphere of cluster roots of white lupin (Lupinus albus L.). Plant and Soil, 246, 167-174. Muyzer G, Waal de E C, Uitterlinden A G. 1993. Profiling of complex microbial population by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Applied and Environmental Microbiology, 59, 695-700. Nicol G W, Leininger S, Schleper C, Prosser J I. 2008. The influence of soil pH on the diversity, abundance and transcriptional activity of ammonia oxidizing archaea and bacteria. Environmental Microbiology, 10, 2966-

© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.

880

2978. Phillips C J, Harris D, Dollhopf S L, Gross K L, Prosser J I, Paul E A. 2000. Effects of agronomic treatments on structure and function of ammonia-oxidizing communities. Applied and Environmental Microbiology, 66, 5410-5418. Prosser J I, Embley T M. 2002. Cultivation-based and molecular approaches to characterisation of terrestrial and aquatic nitrifiers. Antonie van Leeuwenhoek, 81, 165-179. Robertson G P. 1982. Factors regulating nitrification in primary and secondary succession. Ecology, 63, 15611573. Rotthauwe J H, Witzel K P, Liesack W. 1997. The ammonia monooxygenase structural gene amoA as a functional marker: molecular fine-scale analysis of natural ammonia-oxidizing populations. Applied and Environmental Microbiology, 63, 4704-4712. Schleper C, Jurgens G, onuscheit M. 2005. Genomic studies of uncultivated archaea. Nature Reviews Microbiology, 3, 479-488. Shen J P, Zhang L M, Zhu Y G, Zhang J B, He J Z. 2008. Abundance and composition of ammonia-oxidizing bacteria and ammonia-oxidizing archaea communities of an alkaline sandy loam. Environmental Microbiology, 10, 1601-1611. Song Y N, Lin Z M. 2010. Changes in community structures of ammonia-oxidizers and potential nitrification rates in paddy soilat different growth stages of rice. Acta

SONG Ya-na et al.

Pedologica Sinica, 47, 168-175. (in Chinese) Stephen J R, McCaig A E, Smith Z, Prosser J I, Embley T M. 1996. Molecular diversity of soil and marine 16S rRNA gene sequences related to beta-subgroup ammonia-oxidizing bacteria. Applied and Environmental Microbiology, 62, 4147-4154. Treusch A H, Leininger S, Kletzin A, Schuster S C, Klenk H P, Schleper C. 2005. Novel genes for nitrite reductase and amo-related proteins indicate a role of uncultivated mesophilic crenarchaeota in nitrogen cycling. Environmental Microbiology, 7, 1985-1995. Wang M Y, Siddiqi M Y, Ruth T J, Glass A D M. 1993. Ammonium uptake by rice roots. I. Fluxes and subcellular distribution of 13NH4+. Plant Physiology, 103, 1249-1258. Woese C R, Weisburg W G, Hahn C M, Paster B J, Zablen L B, Lewis B J, Mackie T J, Ludwig W, Stackebrandt E. 1985. The phylogeny of the purple bacteria: The gamma subdivision. Systematic and Applied Microbiology, 6, 25-33. Wuchter C, Abbas B, Coolen M J L, Herfort L, Bleijswijk van J, Timmers P, Strous M, Teira E, Herndl G J, Middelburg J J, et al. 2006. Archaeal nitrification in the ocean. Proceedings of the National Academy of Sciences of the United States of America, 103, 12317-12322. Ying J Y, Zhang L M, He J Z. 2010. Putative ammoniaoxidizing bacteria and archaea in an acid red soil with different land utilization patterns. Environmental Microbiology Reports, 2, 302-312. (Managing editor SUN Lu-juan)

© 2014, CAAS. All rights reserved. Published by Elsevier Ltd.