Accumulation and biosynthesis of hydroxyl-α-sanshool in varieties of Zanthoxylum bungeanum Maxim. by HPLC-fingerprint and transcriptome analyses

Industrial Crops & Products xxx (xxxx) xxxx

Contents lists available at ScienceDirect

Industrial Crops & Products journal homepage: www.elsevier.com/locate/indcrop

Accumulation and biosynthesis of hydroxyl-α-sanshool in varieties of Zanthoxylum bungeanum Maxim. by HPLC-fingerprint and transcriptome analyses Zhaochen Wu1, Wei Wang1, Leiwen Sun, Anzhi Wei, Dongmei Wang* College of Forestry, Northwest A&F University, Yangling, Shaanxi, 712100, People’s Republic of China

ARTICLE INFO

ABSTRACT

Keywords: Z. bungeanum Alkylamide compounds Metabolome analysis Transcriptome analysis Biosynthesis Differentially expressed genes (DEGs)

Zanthoxylum bungeanum Maxim. (Z. bungeanum) is well known for its pharmaceutical properties and pungent taste due to its alkylamide compounds, among which hydroxyl-α-sanshool has the highest content. The differences in the hydroxyl-α-sanshool profiles among 12 varieties of Z. bungeanum collected from a common garden were evaluated by RP-HPLC (reversed-phase high-performance liquid chromatography), HPLC fingerprint and chemometric analyses. The results showed that the peel of You Huajiao (S12) exhibited the highest content (46.936 ± 0.122 mg/g) and Fugu Huajiao (S2) exhibited the lowest content (2.235 ± 0.077 mg/g). The twelve varieties were divided into four groups, and their scores of similarity were between 0.424 and 1. Moreover, hydroxyl-α-sanshool was further proven to be the key compound in Z. bungeanum. To explore the molecular mechanisms of hydroxyl-α-sanshool causing these differences, 6656 differentially expressed genes (DEGs) were identified from three varieties(S2, S3 Fengxian Dahongpao and S12)and showed a significant difference in hydroxyl-α-sanshool expression, as determined by transcriptome analysis, including 10 DEGs related to the biosynthesis of unsaturated fatty acids and 9 DEGs related to valine biosynthesis, which were probably involved in hydroxyl-α-sanshool biosynthesis. The results of qRT–PCR (quantitative real-time–polymerase chain reaction) analysis for 6 DEGs selected after functional annotation were equivalent to those detected by transcriptome sequencing, implying that these DEGs may be the key genes involved in hydroxyl-α-sanshool biosynthesis. The present comprehensive analysis provides, for the first time, insight into the directional biosynthesis of alkylamide compounds, the selection of key functional genes and quality breeding in Z. bungeanum for further study.

1. Introduction Z. bungeanum, a traditional cash crop belonging to the Zanthoxylum genus of the family Rutaceae, is a species of great interest because of its pharmaceutical properties and pungent taste and because it accumulates several compounds with beneficial effects on human health (He et al., 2016). The active constituents in Z. bungeanum include amides, essential oils, lignans, flavonoids, and alkaloids, which are responsible for the high medicinal value of the antioxidant, anti-inflammatory, antimicrobial, bacteriostatic, anticancer, analgesic, anesthetic, and antiviral activities shown in pharmacological studies (Zhang et al., 2014a; You et al., 2015). In our previous work on Z. bungeanum leaves, nine flavonoids were first extracted, and quercitrin, hyperoside, rutin and afzelin showed increased bioactivity (Zhang et al., 2014a, b). Quercitrin and afzelin were the vital compounds used to evaluate the quality of Z.

bungeanum via analysis of the flavonoid composition and bioactivity based on thirteen varieties from a common garden (Chen et al., 2019). However, quality evaluation of germplasm resources to screen for fine varieties of Z. bungeanum based on alkylamide compounds has not been performed to date. Many studies have focused on the extraction, separation, purification, and identification of alkylamide compounds that consider the major flavored and medicinal ingredients in Z. bungeanum. Twentyseven alkylamide compounds have been identified in Z. bungeanum as the primary pungent substances in Z. bungeanum due to their mediation to cinnamaldehyde-activated or capsaicin-activated receptors (Rong et al., 2016; Li et al., 2012; Caterina et al., 1997; Sugai et al., 2005; Story et al., 2003; Jordt et al., 2004; Riera et al., 2009). Hydroxy-εsanshool, hydroxy-α-sanshool, hydroxy-β-sanshool, hydroxy-γ-sanshool, bungeanool, and isobungeanool were verified as major

Corresponding author. E-mail address: [email protected] (D. Wang). 1 Zhaochen Wu and Wei Wang contributed equally to this work. ⁎

https://doi.org/10.1016/j.indcrop.2019.111998 Received 10 September 2019; Received in revised form 18 November 2019; Accepted 19 November 2019 0926-6690/ © 2019 Elsevier B.V. All rights reserved.

Please cite this article as: Zhaochen Wu, et al., Industrial Crops & Products, https://doi.org/10.1016/j.indcrop.2019.111998

Industrial Crops & Products xxx (xxxx) xxxx

Z. Wu, et al.

alkylamide compounds, and hydroxy-sanshool was found to determine the pungency intensity in Z. bungeanum (Koo et al., 2007; Zhang et al., 2019; Zhao et al., 2013). These compounds showed extensive biological functions such as inhibition of cell subsistence through a mitochondrion-dependent pathway to exert anti-cancer activity (You et al., 2015). They are also responsible for the anesthetic action and amelioration of glucose or lipid metabolism by targeting Aδ mechanosensory nociceptors or activating the adenosine monophosphate-activated protein kinase (AMPK) pathway to inhibit excitability in diabetes, respectively (Makoto et al., 2013; Bhatt et al., 2017; Ren et al., 2017). Hydroxy-sanshool not only can reduce the appearance of skin wrinkles but also benefits memory and learning because of its ability to facilitate the neuronal terminals in the brain (Tomonori et al., 2006; Artaria et al., 2011). The biosynthesis pathway, pivotal precursors and key related genes of alkylamide compounds in Z. bungeanum have not been clarified. Previous studies have speculated that alkylamides are a conjugation of unsaturated fatty acids and valine or phenylalanine, and are considered the precursors of isobutyl and phenylethylamide (Greger, 1984; CortezEspinosa et al., 2011). To preliminarily explore the biosynthesis mechanism of alkylamide compounds, metabolomic analysis was used to identify hydroxy-α-sanshool as an alkylamide among different varieties of Z. bungeanum and set up a quality evaluation of germplasm resources. Next, transcriptome analysis for the varieties selected from the preceding step was performed to identify DEGs related to the hydroxy-αsanshool pathway and directionally produce the target compounds in Z. bungeanum. All of the studies were based on common garden experiments, which were used to eliminate the influence of the natural environment and investigate gene function (Nord-Larsen and Pretzsch, 2017). This study will provide insight into the directional biosynthesis of alkylamide compounds and select the key functional genes and quality breeding preliminarily in Z. bungeanum for further study.

Shizitou, S10 Wudu Dahongpao, S11 Xinong stingless and S12 You Huajiao, Supporting Information Fig. 1) were collected in 2018 from a common garden (State Forestry Administration, in Fengxian County, Shaanxi Province, China, latitude 33°59′61″N, longitude 106°39′28″E, at an altitude of 1027 m). For metabolome samples, the leaves and peel of the 12 varieties of Z. bungeanum without disease collected in April to September (the peel was only collected in the last month limited by its growing period) were air-dried in the dark at room temperature and were stored at -20℃ after crushing them into powder using a grinder. For transcriptome samples, the young leaves of S2, S3 and S6 were stored at −80 °C following temporarily freezing in liquid nitrogen. All of the kits were obtained from Beijing ComWin Biotech Co., Ltd. (Beijing, China). Methanol, petroleum ether, ethanol and sulfuric acid purchased from Chengdu Cologne Co., Ltd. (Chengdu, China) and chloroform, acetone, iodine and sodium carboxymethylcellulose purchased from Tianjin Bodi Co., Ltd. (Tianjin, China) were all of analytical grade. HPLC-grade methanol and acetonitrile were purchased from TEDIA Chemical Co., Ltd. (Fairfield, Ohio, USA). All of the solutions were prepared using deionized water (18 MΩ cm). 2.2. Preparation of hydroxyl-α-sanshool Because of the difficulty to obtain hydroxyl-α-sanshool standards due to the instability of this compound and complexity of the isolated process, a Soxhlet instrument coupled with thin-layer chromatography (TLC) was used to prepare hydroxyl-α-sanshool from Z. bungeanum in this study (Huang et al., 1993; Navarrete and Hong, 1996; Subramaniana et al., 2016; Wang et al., 2011). Next, 20 g of powder from the peel of S12 (You Huajiao) was extracted twice with methanol solution at a ratio of 1:20 in a 50 °C water bath. The crude extracts filtered from the supernatant were mixed with silica gel GF254 at a ratio of 1:3. The dry powder in filter paper was placed into a Soxhlet extractor with petroleum ether. The silica gel powder was allowed to dry at room temperature and was dissolved in methanol, while the solvent extraction was colorless. The filtered solution was then concentrated to a brown sticky oil using a rotary evaporator. Next, 18.6 g samples of crude product dissolved in a modicum of chloroform were spotted at 1.5 cm from the bottom of a silica gel thin layer chromatography plate (GF254 and 0.5 % CMC). The development of the chromatograms was carried out using chloroform/acetone solution (7.5:1, v/v). Thereafter, a silica gel band with Rf 0.26 at a

2. Materials and methods 2.1. Plant material The leaves and peel of 12 varieties of Z. bungeanum (S1 Hancheng Dangcun stingless, S2 Fugu Huajiao, S3 Fengxian Dahongpao, S4 Hancheng Gelao stingless, S5 Hancheng Dahongpao, S6 Hancheng stingless, S7 Maoxian Dahongpao, S8 Qinan Yihao, S9 Hancheng

Fig. 1. Difference analysis of hydroxyl-α-sanshool in varieties of Z. bungeanum peel. a) HPLC-fingerprint of different varieties of Z. bungeanum peel (Peak 9 was identified as hydroxyl-α-sanshool at retention times: 20.554 min). b) Chemometric analysis of different varieties of Z. bungeanum peel:(1) heatmap of HCA for 12 varieties of Z. bungeanum peel; (2)3-D loading plot of PCA for 12 varieties of Z. bungeanum peel; (3)2-D scores plot of PCA for 12 varieties of Z. bungeanum peel; (4) DA plots of HPLC chromatograms for 12 varieties of Z. bungeanum peel. 2

Industrial Crops & Products xxx (xxxx) xxxx

Z. Wu, et al.

wavelength of 254 nm was sufficiently extracted with chloroform and the subsequent filtrate was concentrated to a yellow oil. The oil, which was purified by freeze crystallization, was dissolved in petroleum ether at 50℃ and was frozen to obtain 1.56 g of a pale-yellow crystal called Compound 1. 2.3. Identification of hydroxyl-α-sanshool by 1H-NMR and

COG/eggNOG, Swiss-Prot, KEGG (Kyoto Encyclopedia of Genes and Genomes) and GO (Gene Ontology). Genes in any pairwise comparison among three groups (G0: S3 vs S12, G1: S2 vs S12 and G2: S2 vs S3) were screened as significantly differentially expressed genes (DEGs) by DESeq with a fold change (FC) ≥ 4 and a false-discovery rate (FDR) ≤ 0.01. The identified DEGs were then subjected to enrichment analysis of GO functions and KEGG pathway analysis (Minoru, 2008; Mao and Cai, 2005).

13

C-NMR

Compound 1 (1 g) was dissolved in 0.8 mL of CDCl3 and then was filtered using a 0.22-μm filter. Bruker AVANCE III 500 MHz NMR spectrometers were used in this study: TMS was used as the frequency lock, the measurement frequency was 500 MHz, and TD = 65536, DW =48.4 μs, NS = 16, DS = 2, SW = 20.6557, DE =6.50 μs, and O1P = 6.175 mg/L were used as the 1HNMR and 13C-NMR measurement conditions. The filtrate (0.5 mL) added to the NMR tube, followed by a certain amount of the internal reference standard for 1H-NMR and 13C-NMR measurement.

2.7. Quantitative real-time RT–PCR (qRT–PCR) validation The extracted RNA was reverse transcribed using the Revert Aid First Strand cDNA Synthesis kit, and the first-strand cDNA was used as a template. The gene primers were designed using Primer Premier 5.0 software, and qRT-PCR was performed using the versatile plant tissue RNA extraction kit in a Step RT-PCR reaction system according to the manufacturer’s instructions. The following amplification program was used for reaction volumes containing 2 μL of cDNA, 2 μL of each primer, and 25 μL of 5× UltraSYBR Mixture: predenaturation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 10 s, renaturation at 57 °C for 30 s and extension at 72 °C for 32 s. β-Actin was selected as a reference gene, and the 2−ΔΔCt method was used to calculate the relative expression levels. All of the samples used for qRT-PCR analysis were carried out in triplicate.

2.4. Quantification of hydroxyl-α-sanshool by HPLC Two hundred fifty milligrams each of peel and leaf powder from the 12 varieties of Z. bungeanum was dipped into 5 mL of chromatographic methanol, and the samples were subjected to ultrasound extraction for 1 h. Next, 200 μL of extract was diluted to 1000 μL and was filtered by using a 0.22-μm membrane filter before injection. The contents of hydroxyl-α-sanshool were quantified by Agilent Technologies 1260 series HPLC and a variable wavelength detector. The quantification was performed with a flow rate of 0.8 mL/min on a SB-C18 reversed-phase column (4.6 × 25 mm, 5 μm) at ambient temperature. The components of the mobile phase were water (solvent A) and acetonitrile (solvent B). The first 20-min gradient from 75 % water to 55 % acetonitrile and the later 20-min gradient from 45 % water to 90 % acetonitrile following a 5-min 90 % acetonitrile were used to separate the different compounds. The injection volume was 20 μL at a wavelength of 254 nm. Hydroxyl-α-sanshool was identified by referring to the retention time and spectral characteristics peaks of the hydroxylα-sanshool prepared in 2.2. The contents of hydroxyl-α-sanshool showed good linear regression in the range from 7.8125 to 1000 μg/mL: y = - 44.986 + 86.249x (R2 = 0.9998) and expressed in terms of micromoles of hydroxyl-α-sanshool per gram of sample powder. The precision of the method was calculated through testing the same sample six times. The repeatability was determined by analyzing six replicates of the sample. The stability of the sample was evaluated under the same conditions at 0, 2, 4, 6, 8, 10, 12 and 24 h after preparation. The recovery rate was calculated by adding a known amount of standard solution, followed by continuous injection 6 times using the established HPLC method.

2.8. Statistical analysis Similarity analysis (SA) was performed using Chromatographic Fingerprint of Traditional Chinese Medicine (Version 2004A) (SES software). Z. bungeanum was grouped using SPSS (SPSS for Windows 20.0; SPSS Inc., USA) and Morpheus with between-group linkage and squared Euclidean distance in hierarchical clustering analysis (HCA). Principal component analysis (PCA) and discriminant analysis (DA) were performed using SPSS software (SPSS for Windows 20.0; SPSS Inc., USA) to obtain 2-D score plots, 3-D loading plots and discriminant functions. All of the measurements were performed with three replicates and were expressed as means ± standard deviation (SD) (p < 0.05). 3. Results and discussion 3.1. Separation, purification and identification of hydroxyl-α-sanshool from Z. bungeanum The results of 1H-NMR and 13C-NMR obtained in these experiments are shown in Supporting Information Fig. 2. Compound 1 was assigned to signals of 1H-NMR (500 MHz, CDCl3) δ 6.85 (1H, dt, J = 14.2, 6.7 Hz, H-3), 6.32 (1H, t, J = 11.3 Hz, NH), 6.22 – 6.02 (4H, m, H-7-10), 5.86 (1H, d, J =15.2 Hz, H-2), 5.73 (1H, dq, J = 13.9, 6.9 Hz, H-11), 5.36 (1H, q, J =7.9 Hz, H-6), 3.32 (2H, d, J =5.9 Hz, H-1′), 2.35 (2H, d, J =7.5 Hz, H-4), 2.29 (2H, dd, J = 17.3, 10.4 Hz, H-5), 1.78 (3H, d, H-12), 1.23 (6H, s, H-3′, H-4′) and 13C-NMR (126 MHz, CDCl3) δ 167.04 (C-1), 144.31 (C-3), 133.53 (C-9), 131.79 (C-10), 130.21 (C-11), 129.67 (C-7), 129.52 (C-6), 125.24 (C-8), 123.78 (C-2), 71.01 (C-2′,), 50.47 (C1′,), 32.10 (C-4), 27.31 (C-3′, C-4′,), 26.49 (C-5), 18.34 (C-12). By comparing the 1H NMR and 13C NMR results of Compound 1 based on the structure elucidation and configuration reported on the alkylamides, this compound was identified as hydroxyl-α-sanshool (Ichiro et al., 1982; Mizutani et al., 1988; Devkota et al., 2013).

2.5. RNA extraction and transcriptome analysis Total RNA was extracted from three varieties of Z. bungeanum leaves, which were selected by HPLC fingerprinting coupled with chemometric analysis, followed by purification using the versatile plant tissue RNA extraction kit following the manufacturer’s instructions. The RNA samples were resolved by agarose gel electrophoresis and the NanoDrop 2000 system (Thermo Scientific, Pittsburgh, PA, USA) and were used as templates for cDNA synthesis by reverse transcription. De novo transcriptome sequencing and data analysis were analyzed by Biomarker Technologies Co., Ltd. (Beijing, China) using an Illumina HiSeq 2500 platform in triplicate, followed by assembly using the Trinity system (Grabherr et al., 2011).

3.2. Validation of the HPLC method

2.6. Functional unigene annotation and classification

The precision, repeatability and recovery rate of hydroxy-α-sanshool by HPLC were 81,584 ± 1294 mAU*min, 72,166 ± 872 mAU*min, and 100.73 ± 1.04 % (within 97 %–103 %), respectively,

All gene functions were analyzed using the following databases: NR (NCBI nonredundant protein sequences), Pfam (Protein family), KOG/ 3

Industrial Crops & Products xxx (xxxx) xxxx

Z. Wu, et al.

Fig. 2. GO classification of DEGs for three groups (G0, G1 and G2).

and the RSDs were 1.587 %, 1.209 % and 1.034 %, respectively, indicating that the HPLC conditions were accurate, repeatable and effective. The test on the stability of hydroxy-α-sanshool showed that the

contents of the extract gradually decreased after 4 h at room temperature and was only 65 % of the original after 12 h, indicating that the extracts should be used within 4 h or stored at -20℃. 4

Industrial Crops & Products xxx (xxxx) xxxx

Z. Wu, et al.

phenological period. The contents of hydroxyl-α-sanshool in the leaves were low in April and significantly accumulated until the maximum level during the fastgrowing period (May-June) in most varieties except S3, S12 (highest in July) and S4 (highest in August), earlier than in the peel by one or two months. In summary, among the 12 tested varieties, the peel of S1, S4, S7, S9 and S10 is suitable for harvesting in July, that of the other varieties is suitable in early August, except for S2, which is appropriate in September. Regarding the leaves harvested as vegetables, waiting for the ripening of the peel for collection was unnecessary. To obtain the leaves with the best flavor, S12 should be collected in July as the most suitable edible leaves, followed by S8 and S10 collected in June and S3 collected in July. S2 is not suitable for harvesting as a spice because of its extremely low content.

Table 1 The contents of hydroxyl-α-sanshool in 12 varieties of Z. bungeanum peel and leaves. Samples

Contents(mg/g)

S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 S11 S12

Peel

Leaves

34.587 ± 0.676 2.235 ± 0.077 32.920 ± 0.142 35.887 ± 0.608 27.146 ± 0.645 33.737 ± 0.179 24.342 ± 0.679 35.270 ± 0.852 39.095 ± 0.540 39.627 ± 0.671 30.588 ± 0.265 46.936 ± 0.122

0.468 ± 0.017 0.048 ± 0.003 1.344 ± 0.073 0.692 ± 0.017 0.056 ± 0.002 0.521 ± 0.010 0.587 ± 0.008 1.604 ± 0.022 0.600 ± 0.012 1.487 ± 0.031 0.361 ± 0.019 2.450 ± 0.067

3.5. HPLC fingerprint and chemometric analyses

Values are mean ± SD (n = 3).

3.4. Dynamics of the synthesis and accumulation of hydroxyl-α-sanshool

3.5.1. Similarity analysis (SA) of HPLC fingerprinting Twelve common peaks of the 12 varieties of Z. bungeanum peel were detected, and the correlation coefficients among the 12 varieties were within a range of 0.424–1 (Table 4), implying a difference in internal qualities. The value of S2 was 0.424, but the correlation coefficients between S2 and other varieties were low; particularly, the value between S2 and S8 was the lowest (0.404), revealing that S2 showed clear differentiation from the others. By contrast, the correlation coefficients of S1, S4, S6, S9 and S11 to R were 0.999, indicating that the five species had the highest genetic relationship and can be classified into one group with the same origination of these five varieties (Hancheng, Shaanxi). Moreover, the similarities of the four Dahongpao varieties (S3, S5, S7 and S10) and S8 to R ranged from 0.992 to 0.998, and they were classified into another category. The similarity of S12, which has the largest common peak area, to R was 0.965, and S12 should be classified into one category. The results of SA showed the differential profiles of alkylamide in varieties of Z. bungeanum preliminarily.

The biosynthetic accumulation dynamics of hydroxyl-α-sanshool in the 12 varieties of Z. bungeanum peel (June to August) and leaves (April to September) showed a significant difference (Tables 2 and 3). The results revealed that the accumulation of hydroxyl-α-sanshool in the peel was similar to that in the leaves. The peel content of all varieties presented a similar trend of rapidly increasing in June and then increasing slowly, even slightly decreasing, until September because of the instability of hydroxyl-α-sanshool. The S1, S4, S7, S9, and S10 at the early phenological period showed the highest hydroxyl-α-sanshool content in June, whereas the other 7 varieties showed the highest content in August. Particularly, the accumulation of hydroxyl-α-sanshool in S2 did not stop in September because of its characteristic late

3.5.2. Hierarchical clustering analysis (HCA) The peak area of the 12 common characteristic peaks of the 12 varieties of Z. bungeanum formed a data matrix of 12 × 12, and the squared Euclidean distance was 4. The cluster heat map was shown four groups, containing G1 (S3, S5, S7, S8, and S10), G2 (S1, S4, S6, S9, and S11), G3 (S12) and G4 (S2) in Fig. 1b (1). However, S2 was the farthest from other varieties, as indicated by the Euclidean distance from the other 11 varieties, reaching a square value of 25 and indicating the extreme differential. Additionally, the 12 common peaks can be grouped into three groups: P2 and P9 (hydroxyl-α-sanshool) are each classified into one group, and the remaining 10 common peaks are classified into one

3.3. Differences in hydroxyl-α-sanshool among the varieties of Z. bungeanum The contents of hydroxyl-α-sanshool in the peel and leaves from 12 different varieties of Z. bungeanum in July were determined by HPLC (Table 1 and Fig. 1a). The contents of hydroxyl-α-sanshool in the peel from 12 varieties of Z. bungeanum ranged from 2.235 ± 0.077 mg/g to 46.936 ± 0.122 mg/g, with S12 showing the highest and S2 showing the lowest. The contents of hydroxyl-α-sanshool in the leaves, ranging from 0.0484 ± 0.003 mg/g to 2.450 ± 0.067 mg/g, showed the same trend with the peel of Z. bungeanum but accounted for only 0.17%–11.94% of the content in the peel. Thus, the contents of hydroxyl-α-sanshool in the peel were chosen for HPLC fingerprint and chemometric analyses.

Table 2 Dynamic accumulation of hydroxy-α-sanshool in leaves of Z. bungeanum. Samples

April

May

June

July

August

September

S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 S11 S12

0.074 ± 0.004 -a 0.266 ± 0.007 0.070 ± 0.001 0.039 ± 0.001 0.044 ± 0.002 0.163 ± 0.009 0.205 ± 0.003 0.052 ± 0.003 0.220 ± 0.007 0.027 ± 0.001 –

0.662 ± 0.014 0.046 ± 0.002 0.859 ± 0.007 0.376 ± 0.004 0.105 ± 0.004 0.767 ± 0.007 0.949 ± 0.033 1.433 ± 0.055 1.194 ± 0.010 1.408 ± 0.035 0.833 ± 0.039 –

0.561 ± 0.024 0.064 ± 0.002 1.157 ± 0.013 0.541 ± 0.022 0.538 ± 0.008 0.755 ± 0.027 0.589 ± 0.027 1.991 ± 0.027 0.856 ± 0.040 1.625 ± 0.049 0.377 ± 0.007 2.379 ± 0.052

0.468 ± 0.017 0.048 ± 0.003 1.344 ± 0.073 0.692 ± 0.017 0.056 ± 0.002 0.521 ± 0.010 0.587 ± 0.008 1.604 ± 0.022 0.600 ± 0.012 1.487 ± 0.031 0.361 ± 0.019i 2.450 ± 0.067

0.465 ± 0.017 0.028 ± 0.002 1.163 ± 0.005 1.012 ± 0.003 0.063 ± 0.001 0.388 ± 0.012 0.558 ± 0.005 0.864 ± 0.020 0.550 ± 0.009 1.114 ± 0.042 0.358 ± 0.008 1.923 ± 0.017

0.294 ± 0.013 0.029 ± 0.000 0.644 ± 0.029 0.447 ± 0.020 0.046 ± 0.003 0.372 ± 0.022 0.449 ± 0.002 0.309 ± 0.011 0.452 ± 0.013 0.456 ± 0.016 0.365 ± 0.014 1.529 ± 0.038

Values are mean ± SD (n = 3). a indicated no content. 5

Industrial Crops & Products xxx (xxxx) xxxx

Z. Wu, et al.

Table 3 Dynamic accumulation of hydroxy-α-sanshool in peel of Z. bungeanum. Samples

May a

S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 S11 S12

– 2.153 ± 0.178 – – – – – – – – –

June

July

August

September

12.464 ± 0.119 0.339 ± 0.012 28.212 ± 0.583 10.569 ± 0.220 14.696 ± 0.206 12.972 ± 0.185 17.808 ± 0.314 26.950 ± 0.466 16.880 ± 0.119 13.612 ± 0.733 4.599 ± 0.158 24.457 ± 0.843

34.587 ± 0.676 2.235 ± 0.077 32.920 ± 0.142 35.887 ± 0.608 27.146 ± 0.465 33.737 ± 0.179 24.342 ± 0.679 35.270 ± 0.852 39.095 ± 0.540 39.627 ± 0.671 30.588 ± 0.265 46.936 ± 1.122

33.456 ± 0.210 6.653 ± 0.258 36.688 ± 0.853 35.879 ± 0.061 35.825 ± 0.834 45.237 ± 1.454 – 36.635 ± 1.125 34.843 ± 0.972 38.036 ± 0.360 36.808 ± 0.662 54.362 ± 0.253

– 9.530 ± 0.613 – – 34.108 ± 0.453 – – – – – 43.006 ± 0.390 –

Values are mean ± SD (n = 3). a indicated no content. Table 4 Similarity analysis of HPLC fingerprints of 12 varieties of Z. bungeanum peel.

S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 S11 S12 R

S1

S2

S3

S4

S5

S6

S7

S8

S9

S10

S11

S12

1 0.434 0.995 0.999 0.992 0.999 0.994 0.993 0.999 0.996 0.999 0.963 0.999

1 0.407 0.434 0.519 0.435 0.405 0.404 0.437 0.407 0.436 0.408 0.424

1 0.995 0.987 0.995 0.999 0.999 0.995 0.999 0.995 0.978 0.997

1 0.993 0.999 0.994 0.993 0.999 0.995 1 0.963 0.999

1 0.992 0.985 0.985 0.993 0.987 0.992 0.952 0.992

1 0.994 0.993 0.999 0.996 0.999 0.963 0.999

1 0.999 0.994 0.999 0.993 0.979 0.997

1 0.993 0.999 0.993 0.981 0.996

1 0.995 0.999 0.963 0.999

1 0.995 0.976 0.998

1 0.961 0.999

1 0.965

total variance of the data could be explained by these PCs. A threedimensional (3-D) loading plot of PCA, as shown in Fig. 1b (2), displayed the 12 common peaks contributing to the three principal components, showing that peaks 1, 3, 4, 9 (hydroxyl-α-sanshool), 10 and 11 were far from the origin of coordinates. Thus, these variables could be used to distinguish among different varieties as characteristic chemical peaks and may be the key compounds in quality evaluation (Yudthavorasit et al., 2014). As shown in Fig. 2b (3), the 12 varieties of Z. bungeanum were also classified into four groups and the grouping results were completely consistent with cluster analysis and SA. Meanwhile, the five varieties belonging to G2 were in the first quadrant in the PC score map showing a high overall quality and had higher contents of hydroxyl-α-sanshool and the samples in the third quadrant were of poor quality (Han et al., 2015), consistent with the analysis using the comprehensive score of PCs.

Table 5 Principal component analysis composite scores. Samples

PC1

PC2

PC3

F

S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 S11 S12

0.4960 −0.8026 −0.4374 0.2849 −0.3034 0.3795 −0.5289 −0.5495 0.3457 −0.0053 0.4487 0.6723

0.1647 0.1889 −0.1336 0.1224 0.0513 0.1669 −0.0660 −0.2041 0.1337 −0.1038 0.2219 −0.5422

−0.1174 0.0798 −0.0910 0.1407 0.1794 −0.1145 −0.1298 0.0001 0.2333 −0.1233 −0.1294 0.0720

0.5433 −0.5339 −0.6619 0.5479 −0.0727 0.4318 −0.7248 −0.7535 0.7127 −0.2324 0.5413 0.2021

group. Moreover, the large Euclidean distance between P9 (hydroxyl-αsanshool) and the remaining 11 common peaks indicated that the difference in the content of hydroxyl-α-sanshool was significantly higher in the cluster analysis than other peaks; thus, P9 was considered a vital chemical index to evaluate the germplasm resources of Z. bungeanum peel. Through cluster analysis, the results were consistent with SA, further revealing the similarity in the chemical composition of the peel in the same group and close relationship between the different varieties of Z. bungeanum (Kaškonienė et al., 2015).

3.5.4. Discriminant analysis (DA) Discriminant analysis (DA) discerned the optimal discrimination among the groups of Z. bungeanum through linear combinations of the predictor variables (Liu et al., 2016). By adopting the most contributory variable, the DA plots of HPLC chromatograms, as shown in Fig. 2b (4), and DA would establish discriminant functions as follows: Canonical discrimination functions: Function 1: 0.00894X8 - 0.00038X9 + 0.01147X11 + 0.00513X12 1.408 Function 2: 0.00382X8 + 0.00043X9 - 0.01508X11 - 0.00357X12 6.240 Fisher’s discrimination functions: G1 = 0.02277X8 + 0.00176X9 + 0.08347X11 - 0.01308X12 34.296 G2 = 0.10240X8 - 0.00029X9 + 0.18589X11 + 0.02040X12 71.055

3.5.3. Principal component analysis (PCA) PCA used the relative peak areas (RPAs) of common peaks to show the discrimination capacity of the common constituents of Z. bungeanum (Bajoub et al., 2017; Lin et al., 2011). The first three principal components (PCs) deduced from Table 5 were considered significant, revealing that approximately 50.030 %, 22.238 % and 13.548 % of the 6

Industrial Crops & Products xxx (xxxx) xxxx

Z. Wu, et al.

Fig. 3. Statistics of KEGG pathway enrichment.

7

Industrial Crops & Products xxx (xxxx) xxxx

Z. Wu, et al.

Fig. 4. Heatmaps of 19 key DEGs selected by transcriptome analysis. Table 6 The DEGs in the KEGG pathway of unsaturated fatty acids biosynthesis. Gene_ID

c100784.graph_c0 c102796.graph_c0 c32498.graph_c0 c94362.graph_c0 c94392.graph_c0 c96500.graph_c0 c99494.graph_c0 c99750.graph_c0 c99857.graph_c0 c99857.graph_c1

Log2FCa

FPKM T01

T02

T03

T04

T05

T06

T07

T08

T09

G0

G1

G2

67.52 8.11 4.72 2.39 17.37 3.14 83.52 5.20 4.10 14.58

61.15 9.85 1.72 6.9 33.46 2.79 92.24 8.25 4.16 13.01

56.63 7.29 1.35 4.31 37.59 3.90 108.2 3.11 2.24 12.63

6.82 11.26 1.67 6.2 6.75 1.20 31.65 0.97 2.09 10.2

8.11 16.38 2.99 10.54 3.51 1.10 34.83 1.88 0.44 10.73

5.54 16.57 4.83 17.91 13.16 1.51 48.87 2.13 1.55 12.58

108.06 117.62 25.27 94.47 2.66 7.88 187.98 2.10 14.52 38.24

121.48 176.1 30.84 98.36 1.61 4.86 235.52 0.93 18.41 45.29

115.46 192.47 41.63 120.13 1.38 4.51 232.1 0.31 20.66 49.4

3.07310 −0.84301 -b −1.41868 1.79172 1.16074 1.10331 1.70914 – 0.22963

−0.85092 −4.14851 −3.31039 −4.44474 3.85251 −0.98369 −1.01544 2.46918 −3.14104 −1.79350

−3.93976 −3.32047 −3.05753 −3.03817 2.04817 −2.1591 −2.1333 0.74845 −4.1301 −2.0393

For this KEGG enrichment analysis, genes were considered to be differential at an FDR = 0.01 significance threshold. a indicated the fold changes at the transcriptomic level. b indicated no difference.

G3 = 0.04637X8 - 0.00028X9 + 0.37597X11 + 0.01327X12 118.278 G4 = 0.09507X8 - 0.00544X9 + 0.36667X11 + 0.06974X12 59.325 Where X8, X9, X11 and X14 denote the peak areas of peak 8, peak 9 (hydroxy-α- sanshool), peak 11 and peak 14, respectively, and G1, G2, G3 and G4 represent the unknown samples from Groups 1, 2, 3 and 4, respectively. According to Fisher’s discrimination functions, four equations were obtained from the four independent variables. All of the varieties were appropriately divided except S12 by comparison of the G1, G2, G3 and

G4 values, and cross-validation showed that the veracity of Fisher’s discrimination functions was 91.67 %. These results showed that DA provided an effective and credible prediction model to analyze unknown samples of Z. bungeanum. Collectively, significant differences in the phytochemicals and varieties were noted from the results of HPLC fingerprinting, SA, HCA, PCA and DA based on common garden experiments. Additionally, S2, S3 and S12, which showed a significant difference in alkylamide compounds, were selected for subsequent investigation through transcriptome analysis.

8

Industrial Crops & Products xxx (xxxx) xxxx

Z. Wu, et al.

Table 7 The DEGs in the KEGG pathway of valine biosynthesis. Gene ID

c104175.graph_c2 c106250.graph_c0 c79136.graph_c1 c83320.graph_c0 c86477.graph_c0 c95767.graph_c0 c97344.graph_c0 c99298.graph_c0 c99969.graph_c1

Log2FCa

FPKM T01

T02

T03

T04

T05

T06

T07

T08

T09

G0

G1

G2

10.13 27.97 0.12 0.51 2.94 13.84 3.91 24.59 1.40

13.35 27.65 0 0 4.61 13.50 6.29 20.05 1.31

11.58 28.25 0 1.83 3.74 20.62 6.33 19.72 1.64

14.96 94.49 0 0 28.92 52.74 9.11 32.68 0.20

13.95 93.64 0 0 39.33 37.25 7.85 26.54 0.74

19.37 98.87 0 0 33.72 44.12 12.9 22.61 0.73

4.33 22.78 2.08 6.12 3.49 1.93 11.57 4.66 8.33

0.85 18.4 6.49 4.33 1.37 1.08 5.15 4.24 20.07

0.84 21.87 4.27 9.99 0.68 0.98 7.80 4.93 19.01

−0.51685 −1.86451 -b – −2.56535 −1.50414 −2.20764 −0.36650 1.51098

2.68663 0.59161 −6.2529 −2.9069 1.18188 3.74640 −0.37090 2.40287 −2.98650

3.18965 2.44079 – – 3.73511 5.23598 1.82177 2.75208 −4.51155

For this KEGG enrichment analysis, genes were considered to be differential at an FDR = 0.01 significance threshold. a indicated the fold changes at the transcriptomic level. b indicated no difference.

7, 19 differentially expressed genes related to the synthesis of hydroxylα-sanshool were subjected to KEGG enrichment analysis, including 10 genes related to the biosynthesis of unsaturated fatty acids and 9 related to valine biosynthesis.

3.6. Transcriptome analysis 3.6.1. Transcriptome sequencing, assembly and functional annotation RNA sequencing of the 3 varieties of Z. bungeanum (S2, S3, and S12) with a significant difference in the content of hydroxyl-α-sanshool (Table 1) was carried out using the Illumina HiSeq 2500 system. Based on the differential expression analysis (fold change > 4, FDR < 0.01), 83,522 unigenes were obtained by de novo assembly and were highly matched to Citrus sinensis and Citrus clementina, which belong to Rutaceae, identical to Z. bungeanum. The number of unigenes identified in different functional databases were as follows: 15,198 in COG, 21,525 in GO, 14,020 in KEGG, 20,756 in KOG, 22,153 in Pfam, 22,080 in Swiss-Prot, 35,903 in eggNOG, and 39,056 in NR.

3.6.4. Identification and analysis of DEGs In total, 6656 DEGs in three varieties were obtained (Fig. 5), and the 19 key aforementioned DEGs were mapped to the heatmaps shown in Figure 13 and clustered into the three categories (I, II, and III) through similarity of expression. The DEGs in class (I) have higher expression levels, especially in S2, and the differential genes c106250.graph_c0 and c99494.graph_c0 have high levels of expression in all of the tested samples. Additionally, the 6 DEGs belonging to class (I) were mainly related to the dehydrogenation and desaturation of fatty acids. The DEGs in class (II) were higher in the leaves of S6 and S3 than in S2 except for c94392.graph_c0, which were annotated to biosynthetic pathways of valine, leucine, and isoleucine. The 7 DEGs belonging to class (III) were expressed at the mid-lower level and the fold change among the three differential comparison groups were relatively close. Furthermore, the 6 screened DEGs (c100784.graph_c0, c102796.graph_c0, c99494.graph_c0, c106250.graph_c0, c95767.graph_c0, and c99298.graph_c0), which were mainly annotated to the desaturation of fatty acids and amino transfer of the branched chain amino acids, were identified as the key genes potentially responsible for the differentiation of hydroxyl-α-sanshool biosynthesis among different varieties of Z. bungeanum and will be further tested.

3.6.2. GO analysis As shown in Fig. 3, 15,607 genes were annotated to three main GO categories: “biological process”, “cellular component”, and “molecular function”, which corresponded to unigenes and terms. The unigenes related to "metabolic process", "cellular process" and "catalytic activity" in secondary functions numbered 14865, 12,583 and 11566, respectively. The leaves of S2, S3, and S12 revealed 415 (50.06 %), 1763 (56.04 %), and 2021 (55.45 %) DEGs by GO annotation, and most of them were abundantly annotated to “metabolic processes”, “cell processes”, “single biological processes”, “cells”, “catalytic activity” and “binding” among the three differential groups. The quantity and annotation rate of DEGs in groups G1 and G2 were significantly higher than those of G0, indicating that the leaves of S2 had more DEGs than the other two varieties by correlation analysis.

3.6.5. Expression of DEGs using qRT-PCR To evaluate the validity of the transcriptome data and assess the transcriptional differences among S2, S3 and S12, the relative expression profiles of six key DEGs selected previously were verified by qRTPCR (The primers are shown in Table 8). The results of qRT-PCR showed that the relative expression of the DEGs (2−ΔΔCt) was consistent with the results of RNA-seq (FPKM) except c102796.graph_c0 (Fig. 6), indicating that the results of the RNA-seq method were accurate and reliable and these DEGs were probably key genes for the biosynthesis of hydroxyl-α-sanshool.

3.6.3. KEGG enrichment analysis In combination with the KEGG enrichment results for up- and downregulated genes, we used Fig. 4 to determine the significant DEGs in hydroxyl-α-sanshool metabolic pathways. In total, 123 unigenes were related to the biosynthesis of hydroxyl-α-sanshool including 71 unigene of the biosynthesis of unsaturated fatty acids and 52 of valine, leucine or isoleucine biosynthesis. Additionally, 241 (29.07 %), 969 (30.80 %) and 1165 (31.96 %) DEGs in the three tested groups were revealed by KEGG annotations and were annotated into 77, 108 and 114 metabolic pathways, respectively. Many DEGs were significantly enriched in 50 pathways, which were mainly related to metabolic and synthetic pathways of plant hormone signal transduction, amino acids, carbohydrates, and fatty acids. Moreover, G2 lacks much genetic information in metabolic pathways compared with G0 and G1. Particularly, DEGs were annotated to the metabolic pathways of fatty acid elongation, glycine, serine, threonine, glycerophospholipids, mRNA monitoring and phagosomes. The DEGs annotated to the “fatty acid elongation” pathway were not found in G0, but 9 differential genes were annotated to the pathway in G1 and G2. As shown in Tables 6 and

4. Conclusion Z. bungeanum is not only a traditional spice but also possesses pharmaceutical bioactives. Although its alkylamide compounds were considered the major active constituents in Z. bungeanum, their biosynthetic pathways remain to be clarified. In this study, 12 varieties of Z. bungeanum (from a common garden) were classified into the G1, G2, G3 and G4 groups, and three varieties, S2 (Fugu Huajiao), S3 (Fengxian Dahongpao), and S12 (You Huajiao), with significant differences in hydroxyl-α-sanshool content, were selected to represent alkylamide 9

Industrial Crops & Products xxx (xxxx) xxxx

Z. Wu, et al.

Fig. 5. qRT-PCR validations of 6 key DEGs (c100784.graph_c0, c102796.graph_c0, c99494.graph_c0, c106250.graph_c0, c95767.graph_c0 and c99298. graph_c0).

compounds. Additionally, hydroxyl-α-sanshool was further proven to be a key compound in Z. bungeanum. The harvesting time for the peel of S1, S4, S7, S9 and S10 was July and that of other varieties was August, except for S2, which is harvested in September. Regarding the leaves, S12 should be collected in July to obtain the most suitable edible

leaves, followed by S8 and S10 collected in June and S3 collected in July; S2 is not suitable for harvesting for flavor. We then analyzed the transcriptomes of these three varieties, and 6656 differentially expressed genes (DEGs) were identified, including 10 DEGs related to the biosynthesis of unsaturated fatty acids and 9 DEGs related to valine 10

Industrial Crops & Products xxx (xxxx) xxxx

Z. Wu, et al.

Table 8 Primers used for DEGs verification by qRT-PCR. Unigene ID

Forward (5′-3′)

Revise (5′-3′)

c100784.graph_c0 c102796.graph_c0 c99494.graph_c0 c106250.graph_c0 c95767.graph_c0 c99298.graph_c0 β-actin

CTGAGGGTCTGTTGTT TTTTCGTAATGTGGTTGG TCCTCCACTCATTCCT ACAGTTGGGATGGAAATA ACAGTTGGGATGGAAATA AGGGCTGGACTGTTGAGA GTGCTGGATTCTGGTGATGG

ATTTCGTGTGTTGCGT ATAATGCGGGATTTGAGG GCCTGCCTGATACATT CACCGTAATGAAGGGATAG CACCGTAATGAAGGGATAG TAAAGGTAAATGGGTGGG ATTTCCCGTTCGGCTGTG

NF1-Defective tumor cell line growth. J. Nat. Prod. 76, 59–63. https://doi.org/10. 1021/np300696g. Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I., Adiconis, X., Fan, L., Raychowdhury, R., Zeng, Q., Chen, Z., Mauceli, E., Hacohen, N., Gnirke, A., Rhind, N., Di Palma, F., Birren, B.W., Nusbaum, C., Lindblad-Toh, K., Friedman, N., Regev, A., 2011. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 29, 644–652. https://doi.org/10.1038/nbt.1883. Greger, H., 1984. Alkamides: structural relationships, distribution and biological activity. Planta Med. 50, 366–441. https://doi.org/10.1055/s-2007-969741. Han, Y., Wen, J., Zhou, T.T., Fan, G.R., 2015. Chemical fingerprinting of Gardenia jasminoides Ellis by HPLC–DAD–ESI-MS combined with chemometrics methods. Food Chem. 188, 648–657. https://doi.org/10.1016/j.foodchem.2015.05.039. He, F.Y., Li, D.W., Wang, D.M., Deng, M., 2016. Extraction and purification of Quercitrin, hyperoside, Rutin, and afzelin from Zanthoxylum bungeanum maxim leaves using an aqueous two-phase system. J. Food Sci. 81, 1593–1602. https://doi.org/10.1111/ 1750-3841.13331. Huang, X., Kakiuchi, N., Che, Q., Huang, S., Hattori, M., Namba, T., 1993. Effects of extracts of Zanthoxylum fruit and their constituents on spontaneous beating rate of myocardial cell sheets in culture. Phytother. Res. 7, 41–48. https://doi.org/10.1002/ ptr.2650070111. Ichiro, Y., Koichi, T., Hideji, I., 1982. Distribution of unsaturated aliphatic acid amides in Japanese Zanthoxylum species. Phytochemistry. 21, 1295–1298. https://doi.org/10. 1016/0031-9422(82)80128-3. Jordt, S.E., Bautista, D.M., Chuang, H.H., McKemy, D.D., Zygmunt, P.M., Hogestatt, E.D., 2004. Mustard oils and cannabinoids excite sensory nerve fibres through the TRP channel ANKTM1. Nature. 427, 260–265. https://doi.org/10.1038/nature02282. Kaškonienė, V., Stankevičius, M., Drevinskas, T., Akuneca, I., Kaškonas, P., BimbiraitėSurvilienė, K., 2015. Evaluation of phytochemical composition of fresh and dried raw material of introduced Chamerion angustifolium L. Using chromatographic, spectrophotometric and chemometric techniques. Phytochemistry 115, 184–193. https:// doi.org/10.1016/j.phytochem.2015.02.005. Koo, J.Y., Jang, Y., Cho, H., Lee, C.H., Jang, K.H., Chang, Y.H., 2007. Hydroxy-alphasanshool activates TRPV1 and TRPA1 in sensory neurons. Eur. J. Neurosci. 26, 1139–1147. https://doi.org/10.1111/j.1460-9568.2007.05743.x. Lin, C.Y., Chen, Y.J., Cheng, S.S., Chang, S.T., 2011. Rapid differentiation of three Chamaecyparis species (Cupressaceae) grown in taiwan using solid-phase microextraction-gas chromatography/ mass spectrometry, cluster analysis, and principal component analysis. J. Agric. Food Chem. 59, 10854–10859. https://doi.org/10. 1021/jf203286j. Liu, W., Wang, D.M., Liu, J.J., Li, D.W., Yin, D.X., 2016. Quality evaluation of Potentilla fruticosa L. By high performance liquid chromatography fingerprinting associated with chemometric methods. PLoS One 11, e0149197. https://doi.org/10.1371/ journal.pone.0149197. Makoto, T., Richard, C.L., Daniel, V., Samata, K., Cheryl, L.S., Diana, M.B., 2013. A ‘toothache tree’ alkylamide inhibits Aδ mechanonociceptors to alleviate mechanical pain. J. Physiol. (Lond.) 591, 3325–3340. https://doi.org/10.1113/jphysiol.2013. 252106. Mao, X., Cai, T., 2005. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics. 21, 3787–3793. https://doi.org/10.1093/bioinformatics/bti430. Minoru, K., 2008. The KEGG database. “In Silico” Simulation of Biological Processes: Novartis Foundation Symposium 247. pp. 91–103. Mizutani, K., Fukunaga, Y., Tanaka, O., Takasugi, N., Saruwatari, Y., Fuwa, T., Yamauchi, T., Wang, J., Jia, M.R., Li, F.Y., Ling, Y.K., 1988. Amides from huajiao, pericarps of Zanthoxylum bungeanum maxim. Chem. Pharm. Bull. 36, 2362–2365. Navarrete, A., Hong, E., 1996. Anthelmintic Properties of α-Sanshool from Zanthoxylum liebmannianum. Planta Med. 62, 250–251. https://doi.org/10.1055/s-2006-957870. Nord-Larsen, T., Pretzsch, H., 2017. Biomass production dynamics for common forest tree species in Denmark – evaluation of a common garden experiment after 50 yrs of measurements. Eur. J. Neurosci. 400, 645–654. Ren, T.Y., Zhu, Y.P., Kan, J.Q., 2017. Zanthoxylum alkylamides activate phosphorylated AMPK and ameliorate glycolipid metabolism in the streptozotocin-induced diabetic rats. Clin. Exp. Hypertens. 39, 330–338. https://doi.org/10.1080/10641963.2016. 1259332. Riera, C.E., Menozzi-Smarrito, C., Affolter, M., Michlig, S., Munari, C., Robert, F., Vogel, H., Simon, S.A., Le-Coutre, J., 2009. Compounds from Sichuan and Melegueta peppers activate, covalently and non-covalently, TRPA1 and TRPV1 channels. Br. J. Pharmacol. 157, 1398–1409. https://doi.org/10.1111/j.1476-5381.2009.00307.x. Rong, R., Cui, M.Y., Zhang, Q.L., Zhang, M.Y., Yu, Y.M., Zhou, X.Y., Yu, Z.G., Zhao, Y.L., 2016. Anesthetic constituents of Zanthoxylum bungeanum Maxim. Pharmacokinetic study. J. Sep. Sci. 39, 2728–2735. https://doi.org/10.1002/jssc.201600295. Story, G.M., Peier, A.M., Reeve, A.J., Eid, S.R., Mosbacher, J., Hricik, T.R., 2003. ANKTM1, a TRP-like channel expressed in nociceptive neurons, is activated by cold temperatures. Cell. 112, 819–829. https://doi.org/10.1016/S0092-8674(03) 00158-2. Subramaniana, R., Subbramaniyanb, P., Noorul, A.J., Raja, V., 2016. Double bypasses soxhlet apparatus for extraction of piperine from Piper nigrum. Arabian J. Chem. 9, 537–540. https://doi.org/10.1016/j.arabjc.2011.06.022. Sugai, E., Morimitsu, Y., Iwasaki, Y., Morita, A., Watanabe, T., Kubota, K., 2005. Pungent qualities of sanshool-related compounds evaluated by a sensory test and activation of rat TRPV1. Biosci. Biotechnol. Biochem. 69, 1951–1957. https://doi.org/10.1271/ bbb.69.1951. Tomonori, N., Nobuko, K., Issei, I., Koichi, U., Fumio, I., Kageyoshi, O., Shingo, Y., 2006. Memory and learning-enhancing effect of Daikenchuto, a traditional Japanese herbal medicine, in mice. J. Nat. Med. 60, 64–67. https://doi.org/10.1007/s11418-0050012-4.

biosynthesis. Six DEGs (c100784.graph_c0, c102796.graph_c0, c99494.graph_c0, c106250.graph_c0, c95767.graph_c0, c99298. graph_c0) were verified by qRT-PCR and were the key genes involved in hydroxyl-α-sanshool biosynthesis. The present comprehensive analysis provided insight into the directional biosynthesis of hydroxyl-α-sanshool in Z. bungeanum for further study. More specific research in our study about the identification and characterization of these genes, such as gene prokaryotic expression, overexpression or silencing, might help the elucidation of the pathway and directed biosynthesis of alkylamides in Z. bungeanum. Author contributions Zhaochen Wu and Wei Wang designed the study, finished the experiment, and drafted the manuscript; Leiwen Sun helped improve the research plan; and Dongmei Wang and Anzhi Wei helped improve the research plan, guided the experiment and revised the manuscript. Declaration of Competing Interest The authors declare no competing financial interest. Acknowledgement This study was supported by the National Key Research and Development Program of China (SQ2019YFD100019) andNational Natural Science Foundation of China (No. 31872706). Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.indcrop.2019.111998. References Artaria, C., Maramaldi, G., Bonfigli, A., Rigano, L., Appendino, G., 2011. Lifting properties of the alkamide fraction from the fruit husks of Zanthoxylum bungeanum. Int. J. Cosmet. Sci. 33, 328–333. https://doi.org/10.1111/j.1468-2494.2010.00629.x. Bajoub, A., Medina-Rodríguez, S., Gómez-Romero, M., Ajal, E.A., Bagur-González, M.G., Fernández-Gutiérrez, A., Carrasco-Pancorbo, A., 2017. Assessing the varietal origin of extra-virgin olive oil using liquid chromatography fingerprints of phenolic compound, data fusion and chemometrics. Food Chem. 215, 245–255. https://doi.org/ 10.1016/j.foodchem.2016.07.140. Bhatt, V., Sharma, S., Kumar, N., Sharma, U., Singh, B., 2017. Simultaneous quantification and identification of flavonoids, lignans, coumarin and amides in leaves of Zanthoxylum armatum using UPLC-DAD-ESI-QTOF-MS/MS. J. Pharm. Biomed. Anal. 132, 46–55. https://doi.org/10.1016/j.jpba.2016.09.035. Caterina, M.J., Schumacher, M.A., Tominaga, M., Rosen, T.A., Levine, J.D., Julius, D., 1997. The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature 389, 816–824. https://doi.org/10.1038/39807. Chen, X.Q., Wang, W., Wang, C., Liu, Z.J., Sun, Q., Wang, D.M., 2019. Quality evaluation and chemometric discrimination of Zanthoxylum bungeanum Maxim leaves based on flavonoids profiles, bioactivity and HPLC-fingerprint in a common garden experiment. Ind. Crops Prod. 134, 225–233. https://doi.org/10.1016/j.indcrop.2019.04. 017. Cortez-Espinosa, N., Aviña-Verduzco, J.A., Ramírez-Chávez, E., Molina-Torres, J., RíosChávez, P., 2011. Valine and phenylalanine as precursors in the biosynthesis of alkamides in Acmella radicans. Nat. Prod. Commun. 6, 857–861. Devkota, K.P., Wilson, J., Henrich, C.J., McMahon, J.B., Reilly, K.M., Beutler, J.A., 2013. Isobutylhydroxyamides from the pericarp of nepalese Zanthoxylum armatum inhibit

11

Industrial Crops & Products xxx (xxxx) xxxx

Z. Wu, et al. Li, Y., Wei, A.Z., Yang, T.X., Jiang, X., Wang, C.F., 2012. Nondestructive detection of volatile oil content in Zanthoxylum bungeagum Maxim by near infrared spectroscopy. Food Ind. 33, 122–125. Wang, S., Xie, J.C., Yang, W., Sun, B.G., 2011. Preparative separation and purification of alkylamides from Zanthoxylum bungeanum Maxim by high-speed counter-current chromatography. J. Liq. Chromatogr. Related Technol. 34, 2640–2652. Yudthavorasit, S., Wongravee, K., Leepipatpiboon, N., 2014. Characteristic fingerprint based on gingerol derivative analysis for discrimination of ginger (Zingiber officinale) according to geographical origin using HPLC-DAD combined with chemometrics. Food Chem. 158, 101–111. https://doi.org/10.1016/j.foodchem.2014.02.086. You, Y., Zhou, M., Lu, H., Shirima, G.G., Cheng, Y., Liu, X., 2015. Sanshool from Zanthoxylum l. Induces apoptosis in human hepatocarcinoma HepG2 cells. Food Sci. Biotechnol. 24, 2169–2175. https://doi.org/10.1007/s10068-015-0289-3. Zhang, L.L., Zhao, L., Wang, H.Y., Shi, B.L., Liu, L.Y., Chen, Z.H., 2019. The relationship between alkylamide compound content and pungency intensity of Zanthoxylum

bungeanum based on sensory evaluation and ultra‐performance liquid chromatography‐mass spectrometry/ mass spectrometry (UPLC‐MS/MS) analysis. J. Sci. Food Agric. 99, 1475–1483. https://doi.org/10.1002/jsfa.9319. Zhang, Y.J., Luo, Z.W., Wang, D.M., He, F.Y., Li, D.W., 2014b. Phytochemical profiles and antioxidant and antimicrobial activities of the leaves of Zanthoxylum bungeanum. Transfus. Apher. Sci. 2014, 181072. https://doi.org/10.1155/2014/181072. Zhang, Y.J., Wang, D.M., Yang, L.N., Zhou, D., Zhang, J.F., 2014a. Purification and characterization of flavonoids from the leaves of Zanthoxylum bungeanum and correlation between their structure and antioxidant activity. PLoS One 9, e105725. https://doi.org/10.1371/journal.pone.0105725. 5. Zhao, Z.F., Zhu, R.X., Zhong, K., He, Q., Luo, A.M., Gao, H., 2013. Characterization and Comparison of the Pungent Components in CommercialZanthoxylum bungeanum Oil and Zanthoxylum schinifolium Oil. J. Food Sci. 78, 1516–1522. https://doi.org/10. 1111/1750-3841.12236.

12