enhancer binding protein β at K39 in mediating gene transcription

Molecular and Cellular Endocrinology 289 (2008) 94–101

Contents lists available at ScienceDirect

Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce

Acetylation and deacetylation regulate CCAAT/enhancer binding protein ␤ at K39 in mediating gene transcription夽 ˜ a , Tracy X. Cui b , Lalitha Subramanian c , Christina T. Fulton b , Teresa I. Cesena ˜ Jorge A. Iniguez-Lluh´ ı c , Roland P.S. Kwok d , Jessica Schwartz a,b,∗ a

Cellular & Molecular Biology Program, University of Michigan, Ann Arbor, MI, United States Department of Molecular & Integrative Physiology, University of Michigan, Ann Arbor, MI, United States Department of Pharmacology, University of Michigan, Ann Arbor, MI, United States d Departments of Ob/Gyn and Biological Chemistry, University of Michigan, Ann Arbor, MI, United States b c

a r t i c l e

i n f o

Article history: Received 15 January 2008 Received in revised form 5 March 2008 Accepted 19 March 2008 Keywords: C/EBP␤ Acetylation Deacetylation Transcription p300 HDAC1 PPAR␥ C/EBP␣ c-fos Glut4 Leptin

a b s t r a c t The transcription factor CCAAT/enhancer binding protein ␤ (C/EBP␤) contains multiple acetylation sites, including lysine (K) 39. Mutation of C/EBP␤ at K39, an acetylation site in the transcriptional activation domain, impairs transcription of C/EBP␤ target genes in a dominant-negative fashion. Further, K39 of C/EBP␤ can be deacetylated by HDAC1, and HDAC1 may decrease C/EBP␤-mediated transcription, suggesting that acetylation of C/EBP␤ at K39 is dynamically regulated in mediating gene transcription. Acetylation of endogenous C/EBP␤ at K39 is detected in adipose tissue, and also occurs in 3T3-L1 cells undergoing adipocyte conversion. In addition, mutation of K39 in C/EBP␤ impairs activation of its target genes encoding C/EBP␣ and PPAR␥, essential mediators of adipogenesis, as well as adipocyte genes for leptin and Glut4. These findings suggest that acetylation of C/EBP␤ at K39 is an important and dynamic regulatory event that contributes to its ability to transactivate target genes, including those associated with adipogenesis and adipocyte function. © 2008 Elsevier Ireland Ltd. All rights reserved.

1. Introduction CCAAT/enhancer binding protein (C/EBP) ␤ is a bZIP transcription factor that is expressed in adipose, hepatic, and immune cells as well as in a variety of other cell types (Descombes et al., 1990; Poli et al., 1990; Akira et al., 1990; Chang et al., 1990; Cao et al., 1991; Lekstrom-Himes and Xanthopoulos, 1998). C/EBP␤ plays

夽 This work was supported by National Institutes of Health (NIH) Grant (DK46072) and NSF Grant (IBN00-80193) (to J.S.), by the Michigan Diabetes Research and Training Center (DK20572) (to R.K.), and NIH Grant (DK061656) (to J.A.I.-L.). TIC was supported by the Cellular and Molecular Biology Training Grant (NIHT32-GM07315), a Predoctoral Fellowship from the Center for Organogenesis (NIHT32-HD07505), an NSF/Rackham Merit Fellowship from the University of Michigan and an NIH/NRSA Predoctoral Fellowship (F31 DK074377-01). CTF was supported by a summer research fellowship from The Endocrine Society. ∗ Corresponding author at: Department of Molecular & Integrative Physiology, University of Michigan, 6815 Medical Science II, 1137 Catherine Street, Ann Arbor, MI 48109-5622, United States. Tel.: +1 734 647 2124; fax: +1 734 647 9523. E-mail address: [email protected] (J. Schwartz). 0303-7207/$ – see front matter © 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mce.2008.03.009

a significant role in adipogenesis (Rosen and Spiegelman, 2000; MacDougald and Lane, 1995), as well as in the gluconeogenic pathway (Croniger et al., 1997), liver regeneration (Diehl, 1998), and hematopoiesis (Scott et al., 1992). Transcriptional activation by C/EBP␤ appears to involve the recruitment of coregulatory complexes harboring acetyl transferase activity. C/EBP␤ interacts with the acetyltransferases p300 (Mink et al., 1997), CREB binding protein (CBP) (Kovacs et al., 2003), and GCN5 (Wiper-Bergeron et al., 2007). p300 and CBP bind C/EBP␤ through their E1A pocket regions (Mink et al., 1997; Kovacs et al., 2003) and serve as coactivators to enhance transcription of C/EBP␤ target genes (Mink et al., 1997; Kovacs et al., 2003; Cui et al., 2005). The activity of C/EBP␤ is often regulated via post-translational modifications (Roesler, 2001). Consequences of phosphorylation of C/EBP␤ at multiple residues have been related to its transcriptional activity, adipogenesis, and hepatocyte function (Ramji and Foka, 2002). Recently, we (Cesena et al., 2007) and others (WiperBergeron et al., 2007; Xu et al., 2003), have demonstrated that C/EBP␤ is acetylated at multiple residues, including lysine (K) 39 in its transcription activation domain (Cesena et al., 2007). Notably,

T.I. Cese˜ na et al. / Molecular and Cellular Endocrinology 289 (2008) 94–101

acetylation of C/EBP␤ at K39 appears to be critical for its ability to activate transcription of target genes such as c-fos and C/EBP␣ (Cesena et al., 2007). Alanine and arginine substitutions at K39 severely compromise the ability of C/EBP␤ to activate these promoters (Cesena et al., 2007), whereas replacement by glutamine, which can mimic acetylated lysine, is well tolerated. This suggests that acetylation of C/EBP␤ at K39 contributes to activation of these genes. In addition to K39, C/EBP␤ is acetylated at other residues, where it also appears to serve a role in transactivation (Cesena et al., 2007). For C/EBP␤, while several acetyltransferases are reported to catalyze acetylation, the role of deacetylases remains unclear, although a role for histone deacetylase (HDAC) 1 has been proposed (Xu et al., 2003). Here, we investigate the role of acetylation and deacetylation of C/EBP␤ at K39 in activation of target genes, and report that these modifications modulate its ability to activate transcription, particularly of genes associated with adipogenesis and adipocyte function. 2. Materials and methods 2.1. Plasmids and antibodies The numbering used to designate residues in C/EBP␤ is based on the mouse C/EBP␤ sequence (accession# NM009883). The plasmid HA-C/EBP␤, kindly provided by Dr. J. Cardinaux (University of Lausanne, Switzerland), encodes C/EBP␤ (residues 22–296, also known as LAP2) tagged with HA at the Nterminus (Kovacs et al., 2003). Mutations were introduced into C/EBP␤ at indicated residues using Stratagene QuikChange XL Site Directed Mutagenesis Kit as described previously (Cesena et al., 2007). All mutations were confirmed by sequencing. The mutated forms of C/EBP␤ are referred to as: K39R, K39A, K39Q, K117R, K98R, and K215/216R. To generate C-terminally HIS tagged expression vectors, the mouse cDNA sequence (residues 23 to C-terminus) from both the WT and K39R C/EBP␤ was amplified by PCR using the forward 5 CCGAGGATCCGGCACCATGG-AAGTGGCCAACTTCTACTACGAGCC 3 and reverse 5 GGTCAAGCTTCTAATG-ATGATGGTGGTGATGGTCGACCGCGCAGTGGCCCGCCGA 3 primers, and inserted as a BamHI and HindIII fragments into the same sites of pcDNA3 p42 HIS (Subramanian et al., 2003). Plasmids for full-length, N-terminally Flag-tagged p300 (p300) were prepared, expressed and purified as previously described (Kashanchi et al., 1998; Lu et al., 2003). Plasmids for WT and mutant H1441A HDAC1 were C-terminally Flag-tagged. Mutation of H144 to A (Canettieri et al., 2003) was introduced into HDAC1 using Stratagene QuikChange XL Site Directed Mutagenesis Kit as described previously (Cesena et al., 2007). The plasmid for c-fos/luciferase (c-fos-luc), which contains the mouse c-fos promoter (−379 to +1) upstream of luciferase, was a gift from Dr. Wharton (University of S. Florida) and Dr. Cochran (Tufts University) (Harvat and Wharton, 1995). The plasmids for C/EBP␣-luciferase (C/EBP␣-luc) (Tang et al., 1997), PPAR␥-luciferase (PPAR␥-luc) (Dowell et al., 2003), leptin-luciferase (leptinluc) (Kennell et al., 2003), and glucose transporter (Glut)-4-luciferase (Glut4-luc) (Liu et al., 1992) were gifts from Dr. O. MacDougald (University of Michigan) and Dr. M.D. Lane (Johns Hopkins University). pODLO2(CAAT)4 -Luc contains four consensus C/EBP sites upstream of a minimal TATA box and the firefly luciferase coding sequence (Subramanian et al., 2003). The plasmid for RSV-␤-galactosidase (␤gal) was provided by Dr. M. Uhler (University of Michigan). Plasmid vector pcDNA3 was purchased from Clontech, pBR322 was a gift from Dr. M. Lomax (University of Michigan), and Rc/RSV was a gift from Dr. J. Lunblad (Oregon Health Sciences University, Portland, OR). The following antibodies were used: anti-p300 (Santa Cruz), anti-Flag (Sigma), and anti-C/EBP␤ (specific for the C-terminus of C/EBP␤, Santa Cruz) were used at dilutions of 1:100 for immunoprecipitations and 1:1000 for immunoblotting. Anti-acetyl-lysine (anti-Ac-K, monoclonal antibody 4G12 which detects acetylated lysines on histones and p53, Upstate, cat #05-515) was used at a dilution of 1:500 for immunoblotting. An antibody against the C-terminus of PPAR␥ (anti-PPAR␥), an antibody against the C-terminus of C/EBP␣ (anti-C/EBP␣), anti-HDAC1, and antitubulin (all from Santa Cruz), and anti-HA (Covance), were used at a dilution of 1:1000 for immunoblotting. Equivalent amounts of normal rabbit IgG (Santa Cruz) were used as controls for immunoprecipitations.

95

reached confluence (day 0), they were incubated with DMEM supplemented with 10% fetal bovine serum (FBS), dexamethasone (0.25 ␮M), isomethylbutylxanthine (0.5 mM), and insulin (10 ␮g/ml). On day 2, cells were incubated with DMEM supplemented with 10% FBS and insulin. Two days later (day 4), and every other day after that, cells were incubated with DMEM supplemented only with 10% FBS. Chinese Hamster Ovary cells expressing rat growth hormone receptor containing the N-terminal half of the cytoplasmic domain (referred to as CHO-GHR cells) were provided by Dr. G. Norstedt (Karolinska Institute, Stockholm, Sweden) and Dr. N. Billestrup (Steno Diabetes Center, Copenhagen, Denmark) (Moller et al., 1992). They were maintained in Ham’s F12 Medium (Gibco/Invitrogen) containing 8% FBS and 0.5 mg/ml geneticin (Gibco/Invitrogen) in 5%CO2 /95% air at 37 ◦ C. Prior to experiments, CHO-GHR cells were incubated overnight in medium containing 1% bovine serum albumin (BSA, CRG7; Serological Corp.) instead of serum. All media were supplemented with 1 mM l-glutamine, 100 units/ml penicillin, 100 ␮g/ml streptomycin, and 0.25 ␮g/ml amphotericin. Calcium phosphate transfections were performed as previously described (Chen and Okayama, 1987), except 50 mM HEPES-buffered saline was used instead of BES-buffered saline. 2.3. Immunoblotting mmmmmmmmol293T cells were lysed using Lysis buffer (420 mM NaCl, 20 mM Hepes (pH 7.9), 1 mM EDTA, 1 mM EGTA, 20% glycerol), supplemented with Inhibitor Cocktail (150 mM sodium pyrophosphate, 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, 10 ␮g/ml aprotinin and leupeptin, 1 ␮M trichostatin A (TSA), 50 nM nicotinamide (NAM)). Samples were homogenized (50×) using a dounce homogenizer with a tight pestle, centrifuged at 9447 × g for 10 min at 4 ◦ C, and supernatants were collected. 3T3-L1 cells were lysed in SDS Lysis buffer (50 mM Tris–HCl, 1% SDS, 10 mM EDTA, 1 mM EGTA, 0.2% Triton X-100), supplemented with Inhibitor Cocktail. An aliquot of lysate was reserved for immunoblotting. For 3T3L1 cells, the remaining lysates were diluted and precleared using protein A agarose beads (A beads, RepliGen). Endogenous C/EBP␤ was immunoprecipitated using antiC/EBP␤ antibody overnight at 4 ◦ C, and immunoprecipitates were collected on beads for 1 h. Beads were washed three times in Acetylase buffer (10 mM Tris, pH 7.6, 150 mM NaCl, 1 mM EDTA, and 5% glycerol, 22 mg/ml sodium butyrate (Sigma), 3 mg/ml dithiothreitol (Invitrogen), 1 ␮M TSA, 50 nM NAM). SDS protein dye (50 mM Tris, 1% SDS, 0.001% bromophenol blue, 10% glycerol, 10% ␤-mercapto-ethanol) was then added and samples were boiled, separated by SDS-PAGE, and immunoblotted as previously described (Hodge et al., 1998). Bands on immunoblots were visualized and quantified using IRDye 700-coupled anti-mouse IgG (1:10,000) or IRDye 800coupled anti-rabbit IgG (1:10,000) on an Odyssey infrared scanning system (LI-COR Inc., Lincoln, NE) as previously described (Cui et al., 2005). Molecular weight was estimated using Kaleidoscope protein molecular weight standard (Biorad) or Magic Mark XP Western Standard (Invitrogen). For analysis of deacetylation, 293T cells (100 mm plates) were transfected with plasmids for WT HA-C/EBP␤ or K39R HA-C/EBP␤ (4 ␮g), p300 (2 ␮g), and the indicated HDAC1 (8 ␮g) or vector. Lysates were collected for immunoblotting as described, separated by SDS-PAGE, and immunoblotted with anti-Ac-K, antiC/EBP␤, anti-p300, or anti-HDAC1. To analyze the interaction of C/EBP␤ with p300, plasmids for WT or mutated C/EBP␤ were expressed with p300-Flag or control pBR322 DNA. 293T cells were lysed using RIPA buffer (50 mM Tris–HCl (pH 7.5), 150 mM NaCl, 2 mM EGTA, 0.5% SDS), supplemented with Inhibitor Cocktail. p300 was immunoprecipitated using anti-p300 or normal rabbit IgG as control. Samples were separated by SDS-PAGE and immunoblotted with anti-p300 or anti-C/EBP␤. To analyze the interaction of C/EBP␤ with HDAC1, plasmids for C/EBP␤ were expressed with HDAC1-Flag or Rc/RSV vector. 293T cells were lysed using RIPA buffer, supplemented with 150 mM sodium pyrophosphate, 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, and 10 ␮g/ml aprotinin and leupeptin. HDAC1 was immunoprecipitated using anti-Flag or IgG as control. Immunoprecipitates were separated by SDS-PAGE and immunoblotted with anti-Flag (HDAC1) or anti-C/EBP␤. For in vivo examination of endogenous C/EBP␤, liver and adipose tissue from 9week-old female and male mixed background WT mice (kindly provided by L. LopezDiaz and Dr. L. Samuelson, and by D. Morris and Dr. L. Rui, University of Michigan) was homogenized (100×) using a dounce homogenizer with a tight pestle. Lysis buffer for adipose tissue contained 10 mM Tris–HCl pH 7.5, 5 mM EDTA, 150 mM NaCl, 10% glycerol, and 0.5%NP-40. Lysis buffers were supplemented with Inhibitor Cocktail. Lysates were centrifuged at 9447 × g for 20 min at 4 ◦ C, and supernatants were collected for immunoprecipitation using anti-C/EBP␤, or normal rabbit IgG as control. Immunoprecipitates were separated by SDS-PAGE and immunoblotted with anti-Ac-K or anti-C/EBP␤ as described. 2.4. Transcription assays

2.2. Cell culture 293T cells were provided by Dr. M. Lazar (University of Pennsylvania), and were maintained in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) containing 8% calf serum (Invitrogen) in an environment of 5%CO2 /95% air at 37 ◦ C. 3T3LI cells, provided by Dr. O. MacDougald, were maintained in an environment of 10%CO2 /90% air at 37 ◦ C, and were differentiated into adipocytes as previously described (MacDougald et al., 1994; Student et al., 1980). Briefly, 2 days after cells

Plasmids for WT HA-C/EBP␤ or HA-C/EBP␤ mutated at various residues (each 400 ng/35 mm well, unless indicated otherwise) were coexpressed with reporter plasmids c-fos-luc, C/EBP␣-luc, PPAR␥-luc, leptin-luc, or Glut4-luc as indicated (each 400 ng/well) in CHO-GHR cells, a reliable system to assess reporter gene activation. The RSV-␤-galactosidase (␤gal) plasmid (50 ng/well) was included to normalize for transfection efficiency. pcDNA3, pBR322, and Rc/RSV DNA were used to normalize the total amount of C/EBP␤, p300, or HDAC1, respectively. 24 h after transfection,

96

T.I. Cese˜ na et al. / Molecular and Cellular Endocrinology 289 (2008) 94–101

Fig. 1. Expression of the acetylation site mutant K39R C/EBP␤ impairs the transcriptional activity of WT C/EBP␤. (A) 293T cells were cotransfected with plasmids (CAAT)4 -luc (30 ng), ␤gal (10 ng), and the indicated amounts of expression vector for K39R C/EBP␤-HIS, in the absence (open circle) or presence (closed circles) of plasmid encoding WT C/EBP␤ HIS (10 ng). WT C/EBP␤ driven activity was 5.16 ± 0.86 RLU. Data represent the mean (±S.E.M.) of three independent experiments performed in triplicate or quadruplicate and are expressed as % of the normalized luciferase activity for WT alone. (B) Plasmids for WT HA-C/EBP␤, with increasing amounts of K39R HA-C/EBP␤ (closed circles), or pcDNA3 vector (open circle) were cotransfected with C/EBP␣-luc in CHO-GHR cells. Expression of WT and K39R C/EBP␤ in CHO-GHR cells is shown in the anti-HA immunoblot in the lower panel.

cells were deprived of serum overnight and lysed to assess luciferase and ␤gal expression, as previously described (Kwok et al., 1994). Luciferase activity was determined using an Opticomp Luminometer. Transcriptional activity is expressed as the ratio of luciferase to ␤-galactosidase activities (normalized luciferase activity designated as relative luciferase units, RLU). Coactivation by p300 was assessed in cells transfected with plasmids for c-fos-luc, WT HA-C/EBP␤ or HA-C/EBP␤ mutated at indicated residues (10 ng/35 mm well), in the absence or presence of p300 (0.5 ␮g). To assess the effect of HDAC1 on C/EBP␤-mediated transcription, increasing amounts of plasmid encoding HDAC1 (50, 100, or 200 ng/well) were cotransfected with c-fos-luc and C/EBP␤ expression constructs. The data in Fig. 1A were obtained by transfection and assay of 293T cells in a 96-well format exactly as described (Subramanian et al., 2003) except that the total amount of transfected DNA was 160 ng. Each condition was analyzed in triplicate for each experiment. Statistical analysis of results from replicate, independent experiments was performed using 1-way (promoter activation) or 2-way (coactivation) ANOVA and Bonferroni’s Multiple Comparison Test (Prism Version 3). Statistical significance is indicated in figures by asterisks and brackets. Expression of C/EBP␤ in lysates used for luciferase assays was assessed by immunoblotting.

3. Results 3.1. The acetylation state of C/EBPˇ is regulated by both p300 and HDAC1 C/EBP␤ is acetylated at K39, and mutation of K39 to arginine (K39R) severely compromises C/EBP␤-mediated transcription of target genes (Cesena et al., 2007). To investigate the mecha-

nism by which the K39R substitution prevents C/EBP␤-mediated gene expression, we first examined whether co-expression of this mutant can antagonize WT C/EBP␤-driven transcription. Interestingly, the K39R mutant exerts a dominant-negative effect, since coexpression of increasing amounts of the K39R mutant together with a fixed amount of WT C/EBP␤ leads to a dose-dependent inhibition of activity from either a reporter bearing consensus C/EBP sites (Fig. 1A) or from the C/EBP␣ promoter (Fig. 1B). To understand how the K39R mutant antagonizes the WT activity of C/EBP␤, we explored several scenarios. One possibility is that this mutation of C/EBP␤ leads to its mislocalization and exclusion from the nucleus. WT C/EBP␤ might then be mislocalized through heterodimerization with the mutant protein. Cellular fractionation studies revealed however, that mutations at K39 do not alter the nuclear/cytoplasmic distribution of C/EBP␤ (data not shown). The possibility that the K39R mutation renders C/EBP␤ incapable of occupying its target sites is also unlikely, since in cells in which the mutant is expressed, we can readily detect protein/DNA complexes through in vitro electrophoretic mobility shift assays using a consensus C/EBP site sequence as probe, as well as at the endogenous c-fos promoter by chromatin immunoprecipitation (data not shown). These data therefore suggest some defect downstream of DNA binding that could involve alterations in coactivator function. Cofactors such as p300, which has been shown to enhance the activity of WT C/EBP␤ (Mink et al., 1997; Cui et al., 2005), may fail to activate the K39R C/EBP␤ mutant. In this view, the K39R mutant may block interaction of p300 with the WT protein, leading to complexes refractory to p300 coactivation. Such coactivation is evident as enhanced c-fos reporter activity driven by WT C/EBP␤ with coexpression of p300 (Fig. 2A). In contrast, p300 fails to increase the c-fos reporter activity in the case of the K39R C/EBP␤ mutant. Notably, this effect is specific to K39 since mutation of other lysines known to be acetylated within C/EBP␤ (K98 and K215/216) yield complexes that can still be coactivated by p300 (Fig. 2A, right). We investigated whether resistance of K39R to p300 coactivation could be due to impairment of their interaction. Coimmunoprecipitation (Fig. 2B) as well as in vitro GST-pulldown assays (data not shown) indicated that p300 interacts with both WT and K39 mutants, including K39R C/EBP␤. Taken together, these data suggest that the integrity of K39 of C/EBP␤ is critical for its transactivation and that disruption of this acetylation site leads to complexes that are resistant to coactivation. The acetylation state of C/EBP␤ at K39 may be regulated by modulating its deacetylation as well as acetylation. We find by coimmunoprecipitation that C/EBP␤ interacts with HDAC1 (Fig. 3A), as reported previously (Wiper-Bergeron et al., 2007). Using a cfos reporter assay, we show that expression of HDAC1, but not its deacetylation-deficient mutant (H141A), represses C/EBP␤mediated c-fos reporter activity (Fig. 3B). By taking advantage of an anti-acetyl-lysine (Ac-K) antibody that recognizes acetylated K39 C/EBP␤ (Cesena et al., 2007), we examined the influence of HDAC1 on K39 C/EBP␤ acetylation. Since a decrease in acetylation of C/EBP␤ was detected by immunoblotting only when K39 was mutated, and not when K98, K117, or K215/216 were mutated (Cesena et al., 2007), this anti-Ac-K antibody most likely detects acetylation of C/EBP␤ at K39. In 293T cells, co-expression of p300 enhances C/EBP␤ acetylation at K39 (Fig. 3C lanes 2 vs. 1, top panel), as observed previously (Cesena et al., 2007). Notably, additional co-expression of HDAC1 almost completely prevented K39 C/EBP␤ acetylation (Fig. 3C, lane 3), while co-expression of its deacetylation-deficient mutant did not block C/EBP␤ acetylation (lane 4). Other HDACs (Akira et al., 1990; Chang et al., 1990; Cao et al., 1991; Rosen and Spiegelman, 2000) did not reverse the acetylation of C/EBP␤ at K39 (data not shown). These results suggest that HDAC1 decreases C/EBP␤-mediated tran-

T.I. Cese˜ na et al. / Molecular and Cellular Endocrinology 289 (2008) 94–101

Fig. 2. Transcriptional enhancement of C/EBP␤ by p300 is impaired by mutations at K39. (A) Plasmids for WT C/EBP␤ or C/EBP␤ mutated at the indicated lysines and for c-fos-luc were transfected into CHO-GHR cells in the absence (−) or presence (+) of an expression vector for p300. Bars represent mean ± S.E.M., and transcriptional activity is expressed relative to control, which was set to 1 (n = 3 independent experiments). Asterisks represent significant changes for the indicated comparisons (*p < 0.05; **p < 0.01). (B) Plasmids for WT or mutated HA-C/EBP␤, or pcDNA3 vector (V) were cotransfected with (+) or without (−) p300-Flag in 293T cells. Samples were immunoprecipitated with anti-p300 (top panels) and probed by immunoblotting with anti-p300 (upper panel) or anti-HA (second panel) antibodies. Lysates (bottom panels) were immunoblotted with anti-p300 (upper) or anti-C/EBP␤ (lower) antibodies. In the absence of exogenous p300 (lane 1), WT C/EBP␤ was not detectable in p300 immunoprecipitates. Neither p300 nor C/EBP␤ was detected when IgG was used instead of anti-p300 for immunoprecipitation (lane 7). Similar results were obtained in two other experiments.

scriptional activation, even in a context where C/EBP␤ is only one of potentially many HDAC1 targets that may alter transcription. These data further demonstrate that acetylation of C/EBP␤ at K39 is dynamically regulated by both p300 and HDAC1. 3.2. The acetylation of C/EBPˇ at K39 modulates transcription of adipocyte genes To examine whether endogenous C/EBP␤ is acetylated, we tested whether acetylated C/EBP␤ was detectable in adipose tissue, one of the tissues in which physiological roles of C/EBP␤ are known (MacDougald and Lane, 1995; Buck and Chojkier, 2003). In mouse adipose tissue extracts, we carried out immunoprecipitation using anti-C/EBP␤ and probed with anti-Ac-K. The presence of acetylated K39 C/EBP␤ is detectable in the endogenous C/EBP␤ immunoprecipitated from mouse adipose tissue (Fig. 4A). In adipose tissue, C/EBP␤ plays a critical role in adipogenesis and induces the expression of the key adipogenic factors peroxisome proliferator activator receptor (PPAR) ␥ and C/EBP␣ (MacDougald and Lane, 1995). We therefore investigated whether C/EBP␤ is acetylated during adipogenesis of 3T3-L1 cells, an estab-

97

Fig. 3. HDAC1 deacetylates C/EBP␤ and impairs C/EBP␤-mediated transcription. (A) Plasmids for WT C/EBP␤ or K39R C/EBP␤ were cotransfected with an expression vector for HDAC1-Flag or empty RC/RSV vector (V) in 293T cells. HDAC1 was immunoprecipitated with anti-Flag antibodies and immunoprecipitates (top panels) were analyzed by immunoblotting with anti-Flag (HDAC1) or anti-C/EBP␤ antibodies. Lysates (bottom panels), immunoblotted with anti-HA or anti-HDAC1 indicate expression of C/EBP␤ and HDAC1, respectively. Similar results were obtained in two other experiments. (B) Plasmids for WT C/EBP␤, and either WT or inactive mutant (H141A) HDAC1 (50, 100, or 200 ng/per well), or Rc/RSV vector (V) were co-transfected with c-fos-luc plasmid into CHO-GHR cells, and luciferase activity was measured 48 h later (n = 3 experiments). A significant decrease (*p < 0.05) in C/EBP␤-mediated activation of c-fos-luc was observed with 200 ng of WT HDAC1. No significant change was observed with the mutant HDAC1. (C) Plasmids for WT C/EBP␤ were transfected alone, or with the indicated HDAC1 in the absence (−) or presence (+) of p300 in 293T cells. Lysates were analyzed by immunoblotting with anti-Ac-K (Ac C/EBP␤), anti-p300, anti-HDAC1, or anti-C/EBP␤. Similar results were obtained in two other experiments.

lished model for examining adipocyte differentiation. Acetylation of K39 C/EBP␤ is detected starting at day 2 after adipogenesis induction in 3T3-L1 cells (Fig. 4B, upper panels) (MacDougald and Lane, 1995). The appearance of the acetylation of C/EBP␤ at K39 parallels the expression of C/EBP␤ and briefly precedes the increased expression of C/EBP␣ and PPAR␥ (Fig. 4B, lower panels). Given the important regulatory consequences of K39 acetylation on C/EBP␤, this modification is likely to have substantial influence on C/EBP␤-mediated regulation of PPAR␥ and C/EBP␣ gene expression during adipogenesis. To probe further the role of K39

98

T.I. Cese˜ na et al. / Molecular and Cellular Endocrinology 289 (2008) 94–101

4. Discussion 4.1. Acetylation and deacetylation of C/EBPˇ modulate its ability to mediate transcriptional activation

Fig. 4. Endogenous C/EBP␤ is acetylated at K39 in adipose tissue and in 3T3L1 adipocytes. (A) Mouse adipose tissue was homogenized and nuclear-enriched samples were subjected to immunoprecipitation with anti-C/EBP␤ or IgG. Immunoprecipitates were separated by SDS-PAGE and used for immunoblotting with anti-Ac-K (Ac C/EBP␤, top) or anti-C/EBP␤ (bottom). Similar results were obtained in two other experiments. (B) Confluent 3T3-L1 cells were induced to convert to adipocytes on day 0 and lysates were prepared on the indicated days following. In upper panels, samples were immunoprecipitated (IP) with anti-C/EBP␤, separated by SDS-PAGE and used for immunoblotting with anti-Ac-K (Ac C/EBP␤, top) or antiC/EBP␤ (bottom). Arrows indicate bands that co-migrate with reference C/EBP␤. In the lower panels, lysates were analyzed by immunoblotting using anti-C/EBP␣ (top), anti-PPAR␥ (middle), or anti-tubulin (bottom) antibodies. Similar results were obtained in two other experiments.

C/EBP␤ acetylation in adipogenesis, we compared the ability of WT and mutant forms of C/EBP␤ to activate key adipocyte target genes. We showed previously that C/EBP␣ promoter activity is increased by C/EBP␤, and that K39R C/EBP␤ fails to activate the C/EBP␣ promoter (Cesena et al., 2007). When we extend this analysis to the promoter for PPAR␥ (Fig. 5A), the other key regulator of adipogenesis, we find that arginine or alanine substitutions at position 39 compromise C/EBP␤-mediated activation of the PPAR␥ promoter by 60–70%. In contrast, C/EBP␤ with a glutamine substitution, which can mimic the function of acetyl-lysine (Li et al., 2002), is as effective as WT C/EBP␤. The reduction in basal activity in the presence of the K39R mutant is consistent with the dominant-negative effect of this substitution. Notably, the inhibition is specific for K39, as C/EBP␤ bearing mutations of other reported acetylation sites (K98, K215/216) activate PPAR␥ as effectively as WT C/EBP␤ (Fig. 5A and B). It is of note that C/EBP␣ and PPAR␥ are also target genes of C/EBP␤ in the liver (Buck and Chojkier, 2003). In addition to driving the expression of C/EBP␣ and PPAR␥, C/EBP␤ also contributes to the expression of adipocyte genes such as Glut4 and leptin (MacDougald and Lane, 1995). By testing the function of mutated vs. WT C/EBP␤, we find that acetylation of K39 of C/EBP␤ is an important requirement for its effective activation of the Glut 4 (Fig. 5C) and leptin promoters (Fig. 5D and E). Comparison of the consequences of mutation at K39 with mutations at other lysines reveals that whereas K39 acetylation has major consequences for the regulation of all the genes examined, substitutions at the other C/EBP␤ acetylation sites we have examined is neither consistent nor substantial. Taken together, these results indicate that acetylation at K39 controls the ability of C/EBP␤ to regulate multiple genes central to adipocyte differentiation and function, and implicates this post-translational modification as a potential regulatory point during adipogenesis.

Post-translational modification of C/EBP␤ is an important mechanism for regulating the activity of this transcription factor. We provide evidence that endogenous C/EBP␤ is acetylated at K39 in adipose tissue, and in differentiated 3T3-L1 adipocytes. Further, disruption of C/EBP␤ acetylation at K39 renders it refractory to p300 coactivation and impairs activation of adipocyte genes encoding C/EBP␣, PPAR␥, Glut4, and leptin. The dynamic regulation of the acetylation state of C/EBP␤ at K39 is mediated by both acetyltransferases and deacetylases. These observations are consistent with a model in which alterations in the acetylation state of C/EBP␤ at K39 modulate its ability to mediate activation of target genes, such as those essential for adipose differentiation and function. While the present analysis focuses on acetylation at K39, C/EBP␤ is acetylated at other residues. As in the case of K39, acetylation of C/EBP␤ at K117 contributes to the activation of C/EBP␣ (Cesena et al., 2007) and acetylation at unspecified residues of C/EBP␤ increases Cox-2 expression (Joo et al., 2004). Conversely, deacetylation of C/EBP␤ at K215/216 is reported to mediate activation of the Id-1 gene (Xu et al., 2003). In the context of hormonal regulation, acetylation of C/EBP␤ at K39 is induced by growth hormone (Cesena et al., 2007) and at K98/101/102 by glucocorticoids (Wiper-Bergeron et al., 2007). Recent work indicates that acetylation at K98/101/102 in C/EBP␤ by the acetyltransferase GCN5 prevented HDAC1 dissociation from C/EBP␤ on the C/EBP␣ promoter during adipose differentiation (Wiper-Bergeron et al., 2007). Moreover, mutation of all three residues simultaneously (K98/101/102R) decreased the ability of C/EBP␤ to mediate adipose conversion in NIH-3T3 cells (Wiper-Bergeron et al., 2007). Further studies may address whether acetylation at K39 and K98/101/102 within C/EBP␤ work in concert to regulate the transcriptional activity of C/EBP␤ during adipose conversion. Lysines can be subject to multiple modifications in addition to acetylation, such as SUMOylation, ubiquitination, or methylation (Freiman and Tjian, 2003). Although K39 in C/EBP␤ may be a site for other modifications, our finding that replacement of K39 by glutamine, which can mimic an acetylated lysine, resembles the WT protein supports the idea that the phenotype of the K39R and K39A substitutions is likely due to loss of acetylation. Furthermore, preliminary data suggest that K39 is not a site of SUMOylation and that mutations at K39 do not appear to affect ubiquitination (Subramanian and Piwien-Pilipuk, unpublished data). It is also of interest that the K39R substitution leads to a consistent upward shift in the electrophoretic migration of C/EBP␤ (e.g. Fig. 3A). Loss of K39 acetylation may therefore lead to alterations in other posttranslational modifications such as phosphorylation. Although our previous findings indicate that acetylation at K39 in C/EBP␤ is independent of its phosphorylation at S184 or T188 (Cesena et al., 2007), whether acetylation at K39 alters phosphorylation at other sites remains to be determined. We have observed that treatment of K39 C/EBP␤ with alkaline phosphatase can reduce its slight upward shift in mobility (not shown) suggesting that future exploration of the phosphorylation state of this mutant is likely to be revealing. The post-translational mechanisms that regulate C/EBP␤ function are likely to play important roles in controlling the biological responses dependent on C/EBP␤. In this regard, the mechanisms by which C/EBP␤ contributes to adipogenesis are of particular interest in the context of the increasing incidence of obesity worldwide. C/EBP␤ is induced early in a cascade of transcription factors that drive adipose differentiation. C/EBP␤, in combination with

T.I. Cese˜ na et al. / Molecular and Cellular Endocrinology 289 (2008) 94–101

99

Fig. 5. Acetylatable K39 in C/EBP␤ contributes to activation of multiple adipocyte genes. Plasmids for expression of WT HA-C/EBP␤, the indicated HA-C/EBP␤ lysine mutant, or pcDNA3 vector (V) were transfected into CHO-GHR cells, together with PPAR␥-luc (panels A and B), Glut4-luc (panel C), or leptin-luc (panels D and E) plasmids. Cells were lysed 48 h later and luciferase activity was measured (n = 3 for each panel). For all reporters, transcriptional activation by WT C/EBP␤ is significantly greater than control (p < 0.05 for PPAR␥-luc, p < 0.01 for Glut4-luc and leptin-luc, not shown in figure). The normalized luciferase activity of the C/EBP␤ mutants was compared to WT C/EBP␤, and brackets indicate significant differences (*p < 0.05; **p < 0.01). Activity for WT C/EBP␤ relative to control (V), set to 1.00 was: (A) 2.43 ± 0.39, (B) 1.79 ± 0.06, (C) 2.40 ± 0.14, (D) 4.04 ± 0.09, and (E) 7.14 ± 0.73 RLU. A representative immunoblot of lysates used for luciferase assay, probed with anti-HA, illustrates the relative expression of C/EBP␤ proteins.

C/EBP␦, initiates the expression of additional transcription factors that include C/EBP␣ and PPAR␥ (Hamm et al., 2001). These two factors are considered master regulators of adipogenesis (Rosen and Spiegelman, 2000; MacDougald and Lane, 1995; Mandrup and Lane, 1997) and mediate the adipocyte differentiation program. Mice lacking both C/EBP␤ and C/EBP␦ show a significant decrease in adipose tissue mass, even with normal expression of C/EBP␣ and PPAR␥, and cells from C/EBP␤−/− mice are severely compromised in their ability to undergo adipose differentiation (Tanaka et al., 1997). We propose that acetylation of C/EBP␤ at K39 plays a role in adipose differentiation, particularly through its role activating C/EBP␣ and PPAR␥ expression (MacDougald and Lane, 1995; Wu et al., 1995). 4.2. A dynamic balance between acetylation and deacetylation at K39 in C/EBPˇ The steady-state acetylation of C/EBP␤ at K39 reflects the interplay between acetylase and deacetylase activities. Based on our

data, both p300 and HDAC1 contribute to this balance. Our experiments provide evidence that HDAC1 reduces acetylation of C/EBP␤ at K39 in a manner that requires its deacetylase activity. C/EBP␤ associates with HDAC1, and both HDAC1 and C/EBP␤ have been observed to occupy the c-fos (Cui et al., 2005) (and data not shown) and C/EBP␣ (Wiper-Bergeron et al., 2007) promoters by ChIP analysis. The dissociation of HDAC1 from C/EBP␤ was suggested to facilitate activation of the C/EBP␣ promoter (Wiper-Bergeron et al., 2007). Our data suggest that release of HDAC1 may contribute to activation by permitting the accumulation of K39 acetylation in C/EBP␤. The observations that during adipose conversion of 3T3-L1 and 3T3-F442A cells, p300 levels increase, whereas HDAC levels decrease (Yoo et al., 2006; Wiper-Bergeron et al., 2003), are consistent with the regulatory role played by acetylation in adipogenesis. Other acetylases or deacetylases also interact with and modulate C/EBP␤. For example, the SMRT complex, which contains deacetylase activity, interacts with C/EBP␤ at its N-terminus (Ki et al., 2005).

100

T.I. Cese˜ na et al. / Molecular and Cellular Endocrinology 289 (2008) 94–101

Since C/EBP␤ is an early inducer of adipogenesis, deacetylation of C/EBP␤ at K39 or other residues by HDAC1 may be important for regulation during adipogenesis. 4.3. The acetylation state of K39 modulates C/EBPˇ-mediated transcription The acetylation state of C/EBP␤ at K39 contributes to its role in transactivation of target genes. The strong functional effects of K39 mutation are rather remarkable, since the redundant nature of activation domains of transcription factors makes them relatively tolerant to mutations (Iniguez-Lluhi et al., 1997). C/EBP␤ harbors multiple transcriptional activation functions, and the fact that a single substitution at K39 is sufficient to compromise C/EBP␤ activity severely argues that acetylation at this position is a “gatekeeper” modification required for the function of C/EBP␤. Studies of C/EBP␤ (Kowenz-Leutz et al., 1994) and the related C/EBP␣ (Ross et al., 2004) indicate that their N- and C-terminal regions are in close proximity. One can speculate that K39 acetylation contributes to the opening of an otherwise closed and inactive form of C/EBP␤. Our data indicate that the functional effects of K39 substitutions are not reflected in detectable alterations in the interaction between C/EBP␤ and either p300 or HDAC1. Acetylation of C/EBP␤ may nonetheless alter its association with other coactivators or corepressors, as in the case of c-myb, which shows increased affinity for CBP when acetylated (Sano and Ishii, 2001). Such alterations in coregulator interaction may contribute to the mechanism by which K39R C/EBP␤ exerts its dominant-negative effects. Taken together, these studies indicate that the reciprocal events of acetylation by p300 and deacetylation by HDAC1 at K39 in C/EBP␤ modulate its ability to mediate activation of target genes. The dynamic interplay between these opposing activities appears to be especially pertinent for adipocytes where this modification is readily detected and exerts an important influence on C/EBP␤mediated activation of critical target genes for adipogenesis and adipocyte function. We anticipate that, by serving as a key regulatory modification, acetylation of C/EBP␤ at K39 may also exert important effects in other metabolic and differentiation events regulated by this transcription factor, such as those occurring in the liver and the hematopoietic compartment. Acknowledgements The authors thank Drs. G. Jin, I. Gerin, and L. Argetsinger for technical advice and critical review of this manuscript. References Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T., Kishimoto, T., 1990. A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO J. 9, 1897–1906. Buck, M., Chojkier, M., 2003. Signal transduction in the liver: C/EBP beta modulates cell proliferation and survival. Hepatology 37, 731–738. Canettieri, G., Morantte, I., Guzman, E., Asahara, H., Herzig, S., Anderson, S.D., Yates III, J.R., Montminy, M., 2003. Attenuation of a phosphorylation-dependent activator by an HDAC-PP1 complex. Nat. Struct. Biol. 10, 175–181. Cao, Z., Umek, R.M., McKnight, S.L., 1991. Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev. 5, 1538–1552. Cesena, T.I., Cardinaux, J.R., Kwok, R., Schwartz, J., 2007. CCAAT/enhancer-binding protein (C/EBP) beta is acetylated at multiple lysines: acetylation of C/EBP beta at lysine 39 modulates its ability to activate transcription. J. Biol. Chem. 282, 956–967. Chang, C.J., Chen, T.T., Lei, H.Y., Chen, D.S., Lee, S.C., 1990. Molecular cloning of a transcription factor, AGP/EBP, that belongs to members of the C/EBP family. Mol. Cell. Biol. 10, 6642–6653. Chen, D., Okayama, H., 1987. High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell Biol. 7, 2745–2752. Croniger, C., Trus, M., Lysek-Stupp, K., Cohen, H., Liu, Y., Darlington, G.J., Poli, V., Hanson, R.W., Reshef, L., 1997. Role of the isoforms of CCAAT/enhancer-binding

protein in the initiation of phosphoenolpyruvate carboxykinase (GTP) gene transcription at birth. J. Biol. Chem. 272, 26306–26312. Cui, T.X., Piwien-Pilipuk, G., Huo, J.S., Kaplani, J., Kwok, R., Schwartz, J., 2005. Endogenous CCAAT/enhancer binding protein ␤ and p300 are both regulated by growth hormone to mediate transcriptional activation. Mol. Endocrinol. 19, 2175–2186. Descombes, P., Chojkier, M., Lichtsteiner, S., Falvey, E., Schibler, U., 1990. LAP, a novel member of the C/EBP gene family, encodes a liver-enriched transcriptional activator protein. Genes Dev. 4, 1541–1551. Diehl, A.M., 1998. Roles of CCAAT/enhancer-binding proteins in regulation of liver regenerative growth. J. Biol. Chem. 273, 30843–30846. Dowell, P., Otto, T.C., Adi, S., Lane, M.D., 2003. Convergence of peroxisome proliferator-activated receptor ␥ and Foxo1 signaling pathways. J. Biol. Chem. 278, 45485–45491. Freiman, R.N., Tjian, R., 2003. Regulating the regulators: lysine modifications make their mark. Cell 112, 11–17. Hamm, J.K., Park, B.H., Farmer, S.R., 2001. A role for C/EBP␤ in regulating peroxisome proliferator-activated receptor ␥ activity during adipogenesis in 3T3-L1 preadipocytes. J. Biol. Chem. 276, 18464–18471. Harvat, B.L., Wharton, W., 1995. Serum response element and flanking sequences mediate the synergistic transcriptional activation of c-fos by 12-Otetradecanoylphorbol-13-acetate and cholera toxin in AKR-2B cells. Cell Growth Differ. 6, 955–964. Hodge, C., Liao, J., Stofega, M., Guan, K., Carter-Su, C., Schwartz, J., 1998. Growth hormone stimulates phosphorylation and activation of Elk-1 and expression of c-fos, egr-1, and junB through activation of extracellular signal-regulated kinases 1 and 2. J. Biol. Chem. 273, 31327–31336. Iniguez-Lluhi, J.A., Lou, D.Y., Yamamoto, K.R., 1997. Three amino acid substitutions selectively disrupt the activation but not the repression function of the glucocorticoid receptor N terminus. J. Biol. Chem. 272, 4149–4156. Joo, M., Park, G.Y., Wright, J.G., Blackwell, T.S., Atchison, M.L., Christman, J.W., 2004. Transcriptional regulation of the cyclooxygenase-2 gene in macrophages by PU.1. J. Biol. Chem. 279, 6658–6665. Kashanchi, F., Duvall, J.F., Kwok, R.P., Lundblad, J.R., Goodman, R.H., Brady, J.N., 1998. The coactivator CBP stimulates human T-cell lymphotrophic virus type I Tax transactivation in vitro. J. Biol. Chem. 273, 34646–34652. Kennell, J.A., O’Leary, E.E., Gummow, B.M., Hammer, G.D., MacDougald, O.A., 2003. T-cell factor 4N (TCF-4N), a novel isoform of mouse TCF-4, synergizes with ␤catenin to coactivate C/EBP␣ and steroidogenic factor 1 transcription factors. Mol. Cell Biol. 23, 5366–5375. Ki, S.H., Cho, I.J., Choi, D.W., Kim, S.G., 2005. Glucocorticoid receptor (GR)-associated SMRT binding to C/EBP␤ TAD and Nrf2 Neh4/5, role of SMRT recruited to GR in GSTA2 gene repression. Mol. Cell Biol. 25, 4150–4165. Kovacs, K.A., Steinmann, M., Magistretti, P.J., Halfon, O., Cardinaux, J.R., 2003. CCAAT/enhancer-binding protein family members recruit the coactivator CREB-binding protein and trigger its phosphorylation. J. Biol. Chem. 278, 36959–36965. Kowenz-Leutz, E., Twamley, G., Ansieau, S., Leutz, A., 1994. Novel mechanism of C/EBP␤ (NF-M) transcriptional control: activation through derepression. Genes Dev. 8, 2781–2791. Kwok, R.P., Lundblad, J.R., Chrivia, J.C., Richards, J.P., Bachinger, H.P., Brennan, R.G., Roberts, S.G., Green, M.R., Goodman, R.H., 1994. Nuclear protein CBP is a coactivator for the transcription factor CREB. Nature 370, 223–226. Lekstrom-Himes, J., Xanthopoulos, K.G., 1998. Biological role of the CCAAT/enhancerbinding protein family of transcription factors. J. Biol. Chem. 273, 28545–28548. Li, M., Luo, J., Brooks, C.L., Gu, W., 2002. Acetylation of p53 inhibits its ubiquitination by Mdm2. J. Biol. Chem. 277, 50607–50611. Liu, M.L., Olson, A.L., Moye-Rowley, W.S., Buse, J.B., Bell, G.I., Pessin, J.E., 1992. Expression and regulation of the human GLUT4/muscle-fat facilitative glucose transporter gene in transgenic mice. J. Biol. Chem. 267, 11673–11676. Lu, Q., Hutchins, A.E., Doyle, C.M., Lundblad, J.R., Kwok, R.P., 2003. Acetylation of cAMP-responsive element-binding protein (CREB) by CREB-binding protein enhances CREB-dependent transcription. J. Biol. Chem. 278, 15727–15734. MacDougald, O.A., Lane, M.D., 1995. Transcriptional regulation of gene expression during adipocyte differentiation. Ann. Rev. Biochem. 64, 345–373. MacDougald, O.A., Cornelius, P., Lin, F.-T., Chen, S.S., Lane, M.D., 1994. Glucocorticoids reciprocally regulate expression of the CCAAT/enhancer-binding protein ␣ and ␦ genes in 3T3-L1 adipocytes and white adipose tissue. J. Biol. Chem. 269, 19041–19047. Mandrup, S., Lane, M.D., 1997. Regulating adipogenesis. J. Biol. Chem. 272, 5367–5370. Mink, S., Haenig, B., Klempnauer, K.H., 1997. Interaction and functional collaboration of p300 and C/EBP␤. Mol. Cell Biol. 17, 6609–6617. Moller, C., Hansson, A., Enberg, B., Lobie, P.E., Norstedt, G., 1992. Growth hormone (GH) induction of tyrosine phosphorylation and activation of mitogen-activated protein kinase in cells transfected with rat GH receptor cDNA. J. Biol. Chem. 267, 23403–23408. Poli, V., Mancini, F.P., Cortese, R., 1990. IL-6DBP, a nuclear protein involved in interleukin-6 signal transduction, defines a new family of leucine zipper proteins related to C/EBP. Cell 63, 643–653. Ramji, D.P., Foka, P., 2002. CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem. J. 365, 561–575. Roesler, W.J., 2001. The role of C/EBP in nutrient and hormonal regulation of gene expression. Annu. Rev. Nutr. 21, 141–165. Rosen, E.D., Spiegelman, B.M., 2000. Molecular regulation of adipogenesis. Ann. Rev. Cell Dev. Biol. 16, 145–171.

T.I. Cese˜ na et al. / Molecular and Cellular Endocrinology 289 (2008) 94–101 Ross, S.E., Radomska, H.S., Wu, B., Zhang, P., Winnay, J.N., Bajnok, L., Wright, W.S., Schaufele, F., Tenen, D.G., MacDougald, O.A., 2004. Phosphorylation of C/EBP␣ inhibits granulopoiesis. Mol. Cell Biol. 24, 675–686. Sano, Y., Ishii, S., 2001. Increased affinity of c-Myb for CREB-binding protein (CBP) after CBP-induced acetylation. J. Biol. Chem. 276, 3674–3682. Scott, L.M., Civin, C.I., Rorth, P., Friedman, A.D., 1992. A novel temporal expression pattern of three C/EBP family members in differentiating myelomonocytic cells. Blood 80, 1725–1735. Student, A.K., Hsu, R.Y., Lane, M.D., 1980. Induction of fatty acid synthetase synthesis in differentiating 3T3-L1 preadipocytes. J. Biol. Chem. 255, 4745–4750. Subramanian, L., Benson, M.D., Iniguez-Lluhi, J.A., 2003. A synergy control motif within the attenuator domain of CCAAT/enhancer-binding protein alpha inhibits transcriptional synergy through its PIASy-enhanced modification by SUMO-1 or SUMO-3. J. Biol. Chem. 278, 9134–9141. Tanaka, T., Yoshida, N., Kishimoto, T., Akira, S., 1997. Defective adipocyte differentiation in mice lacking the C/EBP␤ and/or C/EBP␦ gene. EMBO J. 16, 7432– 7443.

101

Tang, Q.Q., Jiang, M.S., Lane, M.D., 1997. Repression of transcription mediated by dual elements in the CCAAT/enhancer binding protein alpha gene. Proc. Natl. Acad. Sci. U.S.A. 94, 13571–13575. Wiper-Bergeron, N., Wu, D., Pope, L., Schild-Poulter, C., Hache, R.J., 2003. Stimulation of preadipocyte differentiation by steroid through targeting of an HDAC1 complex. EMBO J. 22, 2135–2145. Wiper-Bergeron, N., Salem, H.A., Tomlinson, J.J., Wu, D., Hache, R.J., 2007. Glucocorticoid-stimulated preadipocyte differentiation is mediated through acetylation of C/EBP␤ by GCN5. Proc. Natl. Acad. Sci. U.S.A. 104, 2703–2708. Wu, Z., Xie, Y., Bucher, N.L., Farmer, S.R., 1995. Conditional ectopic expression of C/EBP beta in NIH-3T3 cells induces PPAR gamma and stimulates adipogenesis. Genes Dev. 9, 2350–2363. Xu, M., Nie, L., Kim, S.H., Sun, X.H., 2003. STAT5-induced Id-1 transcription involves recruitment of HDAC1 and deacetylation of C/EBP beta. EMBO J. 22, 893–904. Yoo, E.J., Chung, J.J., Choe, S.S., Kim, K.H., Kim, J.B., 2006. Down-regulation of histone deacetylases stimulates adipocyte differentiation. J. Biol. Chem. 281, 6608–6615.