Acidosis differently modulates the inflammatory program in monocytes and macrophages

Biochimica et Biophysica Acta 1862 (2016) 72–81

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbadis

Acidosis differently modulates the inflammatory program in monocytes and macrophages Anne Riemann a,⁎, Hanna Wußling a, Harald Loppnow b, Hang Fu b, Sarah Reime a, Oliver Thews a a b

Julius-Bernstein-Institute of Physiology, University Halle-Wittenberg, Germany Dept. of Internal Medicine III, University Halle-Wittenberg, Germany

a r t i c l e

i n f o

Article history: Received 22 July 2015 Received in revised form 15 October 2015 Accepted 20 October 2015 Available online 22 October 2015 Keywords: Acidosis Inflammation Immune cell function Macrophages Phagocytosis

a b s t r a c t Inflammation, ischemia or the microenvironment of solid tumors is often accompanied by a reduction of extracellular pH (acidosis) that stresses the cells and acts on cellular signaling and transcription. The effect of acidosis on the expression of various inflammatory markers, on functional parameters (migration, phagocytic activity) and on signaling pathways involved was studied in monocytic cells and macrophages. In monocytic cell lines acidosis led to a reduction in expression of most of the inflammatory mediators, namely IL-1ß, IL-6, TNF-α, MCP-1, COX-2 and osteopontin. In primary human monocytes MCP-1 and TNF-α were reduced but COX-2 and IL-6 were increased. In RAW264.7 macrophage cell line IL-1ß, COX-2 and iNOS expression was increased, whereas MCP-1 was reduced similar to the effect in monocytic cells. For primary human monocyte-derived macrophages the regulation of inflammatory markers by acidosis depended on activation state, except for the acidosis-induced downregulation of MCP-1 and TNF-α. Acidosis affected functional immune cell behavior when looking at phagocytic activity which was increased in a time-dependent manner, but cellular motility was not changed. Neither ERK1/2 nor CREB signaling was stimulated by the reduction of extracellular pH. However, p38 was activated by acidosis in RAW264.7 cells and this activation was critical for the induction of IL-1ß, COX-2 and iNOS expression. In conclusion, acidosis may impede the recruitment of immune cells, but fosters inflammation when macrophages are present by increasing the level of COX-2 and iNOS and by functionally forcing up the phagocytic activity. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Different pathological conditions like inflammation, ischemia or solid tumors are accompanied by a reduction of the extracellular pH. This is caused by hypoxia, glycolytic cell metabolism or a hampered removal of acidic metabolic byproducts due to impaired blood perfusion [1]. Typical values for interstitial tissue pH found in inflammatory disease [2] or in solid growing tumors [3] are in the range of pH 6.0 and pH 7.0. Since acidosis can regulate cellular responses by affecting enzyme activity, ion transport, protein and DNA synthesis as well as the level of cAMP and calcium, an acidic microenvironment can impair immune cell function. The effect of reduced pH on polymorphonuclear leukocyte and lymphocyte function seems mainly inhibitory, but concerning acidosis and macrophages there are only very few studies (overview see [4]). Since not only macrophages, but also their precursors are exposed to the acidic microenvironment, we analyzed the impact of a reduced extracellular pH on immune cell function and the expression of different inflammatory mediators in monocytes (THP-1, ⁎ Corresponding author at: Julius Bernstein Institute of Physiology, University Halle-Wittenberg, Magdeburger Straße 6, 06112 Halle (Saale), Germany. E-mail address: [email protected] (A. Riemann).

http://dx.doi.org/10.1016/j.bbadis.2015.10.017 0925-4439/© 2015 Elsevier B.V. All rights reserved.

Mono Mac 6, primary human blood monocytes) and macrophages (PMA-differentiated THP-1, RAW264.7, primary human monocytederived macrophages). The set of inflammatory markers tested comprises interleukin-1ß (IL-1ß), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), monocyte chemoattractant protein-1 (MCP-1/ CCL2), cyclooxygenase-2 (COX-2/PTGS2), inducible isoform of nitric oxide synthase (iNOS/NOS2), and osteopontin (SPP1). IL-1ß is mainly produced by monocytes and macrophages and plays a critical role in inflammation by influencing both innate and adaptive immune response (overview see [5]). IL-1ß is involved in the response to tissue damage and cell death, which is often the result of extracellular acidosis. It leads to the activation of NF-κB and MAPK signaling. IL-6 is promptly produced in response to tissue injuries and infections and has pro- or anti-inflammatory activity depending on the microenvironmental conditions [6]. It can switch the balance between tissue repair and carcinogenesis [7], and it affects immunity for instance by acting on monocytic migration [8] and by regulating the differentiation of B-cells and subsets of T-cells [9]. One of the most important pro-inflammatory cytokines is TNF-α, which is mainly produced by macrophages and T-cells and which contributes to inflammation, cell proliferation, differentiation, leukocyte adhesion and apoptosis [10,11]. TNF-α can act through MAPK signaling, transcription factors or caspases and induces the

A. Riemann et al. / Biochimica et Biophysica Acta 1862 (2016) 72–81

expression of various signaling molecules and reactive oxygen species (ROS) [11]. MCP-1 is expressed by various cell types either constitutively or after induction by growth factors, cytokines or oxidative stress [12]. It is involved in the activation and recruitment of leukocytes. Induction of COX-2 and iNOS promotes inflammation by the production of prostaglandins and reactive nitrogen species, respectively [13,14]. Osteopontin is a secreted matricellular protein that regulates the recruitment of monocytes/macrophages and the secretion of cytokines by leukocytes [15]. It modulates tissue repair and inflammation and might therefore be regulated itself by the pH of the microenvironment [16]. The aim of the present study was to analyze whether extracellular acidosis affects the expression of these inflammatory markers in monocytic or macrophagic cell lines. For comparison all measurements were also performed in primary human monocytes and macrophages (including macrophages which were polarized to M1 or M2 cells). Additionally, the impact of acidosis on functional parameters such as cell migration or phagocytic activity was studied. Finally, the underlying signaling pathways responsible for changes in cytokine expression were investigated. 2. Material and methods 2.1. Cell culture Experiments were performed on monocytic cell lines (Mono Mac 6, THP-1) and on macrophages (RAW264.7, PMA-differentiated THP-1). RAW264.7 murine macrophages (ATCC TIB-71) were grown in DMEM medium supplemented with 10% fetal calf serum (FCS), THP-1 [17] and Mono Mac 6 [18] monocytic cells in RPMI with 10% FCS. All cells were grown at 37 °C under a humidified 5% CO2 atmosphere and sub-cultivated once per week. For a further direct comparison of monocytic cells and macrophages, THP-1 cells were differentiated to a phagocytic phenotype by incubation with phorbol 12-myristate 13acetate (PMA). Differentiation of 1 × 105 THP-1 cells/ml was induced with 5 ng/ml PMA over 48 h according to the protocol of Park et al. [19] and was monitored by changes in cell morphology as well as an increase in cell adhesion and phagocytosis of coated latex beads (Suppl. Fig. 1). 2.2. Primary human cells Human monocytes were isolated from peripheral blood as described previously [20–22]. Briefly, heparinized buffy coats of human male donors were obtained from the transfusion center of the University Hospital. Written consent of the donors was obtained. The use of the blood was permitted by the local ethical committee. The buffy coat was diluted with the same volume of Hank's balanced salt solution (Biochrom AG, Berlin, Germany) and the mononuclear cells (MNC) were obtained after density gradient centrifugation (400 × g, 30 min, 20 °C) using Biocoll™ (Biochrom, Berlin, Germany). The MNC were washed twice (200 ×g, 10 min), transferred into MACS® buffer and monocytes were prepared using CD14-beads and a LS-column (MACS®-system; Miltenyi Biotec, Bergisch Gladbach, Germany) according to the manufacturer's instructions. These monocytes were used either for direct measurements after exposing them to an extracellular acidosis (see below, except: incubation time without FCS supplementation was reduced to 3 h) or were differentiated to macrophages by plating the cells for 24 h in 6-well plates in RPMI/10% FCS leading to unpolarized M0 macrophages [23]. Polarization of the macrophages to M1 or M2 cell was performed as described previously [24]. In brief, cells were either incubated for 24 h with LPS (50 ng/ml) and IFNγ (20 ng/ml) resulting in M1 macrophages or with IL-4 and IL-10 (20 ng/ml each) leading to M2 macrophages [24]. After polarizing the cells, macrophages were kept for another 24 in RPMI without FCS supplementation after which the cells were incubated in an acidic or a control environment (see below).

73

2.3. Experimental setup (acidosis challenge) The cells were transferred to medium without additional FCS supplementation for 24 h prior to the measurements and were incubated afterwards for 3 h (mRNA and signaling measurements) or up to 24 h (protein expression) in Ringer solutions, respectively. Control cells were exposed to bicarbonate HEPES-buffered Ringer solution adjusted to pH 7.4 (NaHCO3 24.0 mM, Na2HPO4 0.8 mM, NaH2PO4 0.2 mM, NaCl 86.5 mM, KCl 5.4 mM, CaCl2 1.2 mM, MgCl2 0.8 mM, HEPES 20 mM; pH adjustment with 1 N NaOH). Extracellular acidosis (pH 6.6) was applied using isoosmotic bicarbonate MES-buffered Ringer solution (NaHCO3 4.5 mM, Na2HPO4 0.8 mM, NaH2PO4 0.2 mM, NaCl 106 mM, KCl 5.4 mM, CaCl2 1.2 mM, MgCl2 0.8 mM, MES (morpholinoethanesulfonic acid) 20 mM; pH adjustment to 6.6 with 1 N NaOH). For incubation periods longer than 6 h (COX-2 and IL-1ß protein expression measurements) DMEM medium with 1,5 g/l NaHCO3 was used and adjusted to pH 7.4 or pH 6.6 with 1 M HCl. Extracellular pH (pHe) was checked with a blood gas analyzer (ABL5, Radiometer, Copenhagen, Denmark) and only minor pH changes of Ringer solutions and DMEM medium were observed after the incubation periods. For experiments on the role of MAP kinase p38 10 μM of the p38 inhibitor SB203580 or DMSO (control) was added during the incubation period. 2.4. Quantitative PCR Total RNA was isolated using the InviTrap Spin Tissue RNA Mini kit (Invitek, Berlin, Germany). 1 μg RNA was subjected to reverse transcription with SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) and analyzed by qPCR using the Platinum SYBR Green qPCR Supermix (Invitrogen, Carlsbad, CA, USA); each step according to the manufacturer's instructions. The obtained data was normalized against Rn18S. The obtained data was normalized against Rn18S and related to the respective control (pH 7.4) [25]. The obtained ΔΔCq values for each experiment were averaged and subjected to statistical analysis. The following primers were used: Target-murine-

Forward primer

Reverse primer

Ptgs2/COX2 Il1b Il6 Nos2/iNos Ccl2/MCP1 SPP1/osteopontin Tnf

AGGACTCTGCTCACGAAGGA CCTGCTGGTGTGTGACGTTCCC CCGGAGAGGAGACTTCACAG ACTGGAGGTGGGTGGCCTCG AGGTCCCTGTCATGCTTCTG ATTTGCTTTTGCCTGTTTGG CACACTCAGATCATCTTCTCAAAA

TCATACATTCCCCACGGTTT CAGGGTGGGTGTGCCGTCTT TTCTGCAAGTGCATCATCGT CTCCACGGGCCCGGTACTCA TCTGGACCCATTCCTTCTTG TGGCTATAGGATCTGGGTGC GTAGACAAGGTACAACCCATCG

Target-humanPTGS2/COX2 IL1B IL6 NOS2/INOS CCL2/MCP1 Spp1/osteopontin TNF Rn18s

Forward primer CTTACAATGCTGACTATGGCTAC ACGCTCCGGGACTCACAGCA CCTCGACGGCATCTCAGCCC ACAAGCCTACCCCTCCAGAT GTCTCTGCCGCCCTTCTGTGC AGCAGAATCTCCTAGCCCCA AGTTGTGTCTGTAATCGCCCTAC CTG AGA AAC GGC TAC CAC ATC

Reverse primer AAACTGATGCGTGAAGTGCTG TGAGGCCCAAGGCCACAGGT TGTGGTTGGGTCAGGGGTGGT TCCCGTCAGTTGGTAGGTTC AACAGCAGGTGACTGGGGCA CTGGATGTCAGGTCTGCGAA CTAAGCAAACTTTATTTCTCGCC CCC AAG ATC CAA CTA CGA GC

2.5. IL-1ß ELISA and nitrate/nitrite production Secretion of IL-1ß was analyzed by mouse IL-1 beta ELISA ReadySET-Go (eBioscience, San Diego, CA, USA), while nitrite and nitrate production was studied using nitrate/nitrite fluorometric assay kit (Cayman Chemical, Ann Arbor, MI, USA). Prior to both measurements cell supernatant was centrifugated briefly to remove any cells. Respective media and Ringer's solutions without cells were used as references. Measurements were made according to the manufacturer's instruction and the obtained data was normalized to overall protein content in μg before calculating relative acidosis-induced effects. The secreted IL-1ß concentration measured in the assay was within 0–5 pg/ml.

74

A. Riemann et al. / Biochimica et Biophysica Acta 1862 (2016) 72–81

2.6. Western blot

3.1. Changes in the expression of inflammatory markers by acidosis

Western blotting was performed according to standard protocols. Cells were lysed (0.5 M Tris–HCl pH 6.8; 10% SDS; 10% 2Mercaptoethanol; 20% Glycerol; 0.01% Bromphenol blue), separated by SDS-PAGE and transferred to a nitrocellulose membrane. Subsequently, membranes were incubated with antibodies specific for ERK1/2, p38, CREB, phospho-ERK1/2, phospho-p38, phospho-CREB (Cell Signaling Technology, Danvers, MA, USA) and COX-2 (ab52237, Abcam, Cambridge, UK). The bound primary antibody was visualized using horseradish peroxidase (HRP)-conjugated secondary antibodies and Serva chemoluminescence reagent for HRP (Serva, Heidelberg, Germany) with the Molecular Imager ChemiDoc XRS System (Biorad, Munich, Germany). Quantitative analysis was performed with Quantity One software (Biorad, Munich, Germany). Phosphorylated ERK1/2, p38 and CREB were normalized against total ERK1/2, p38 or CREB, respectively, while COX-2 was normalized to Hsp90 or GAPDH (Cell Signaling Technology, Danvers, MA, USA).

The impact of extracellular pH on the inflammatory program of immune cells was analyzed after 3 h at a pH of 7.4 (control) or 6.6 (acidosis), respectively. Fig. 1 shows the expression of various inflammatory markers on mRNA level in the different cell types. All values shown are normalized to the control conditions (3 h pH 7.4). When analyzing acidosis-induced expression of inflammatory markers, profound differences between monocytic cells (Fig. 1A + C) and macrophages (Fig. 1B + D) became apparent. Both monocytic cell lines display a diminished expression of inflammatory markers upon acidosis with a reduction of COX-2, IL-6, MCP-1, SPP1 and TNF-α mRNA. In Mono Mac 6 cells IL-1ß was reduced also (Fig. 1A), while iNOS was elevated in THP-1 cells (Fig. 1C). In macrophages the expression was increased (COX-2, IL-1ß and iNOS in RAW264.7 cells, Fig. 1C) or essentially unaffected in PMA-differentiated THP-1 cells except for IL-1ß (Fig. 1D) by acidosis. However, MCP-1 mRNA was decreased under acidotic conditions in monocytic cells as well as in RAW264.7 macrophages, possibly pointing to a general role of acidosis in regulating MCP-1 expression that is independent of the differentiation state or cell type. IL-6 was not detectable in RAW264.7 cells in this study probably due to our experimental setting (incubation without FCS for 24 h), although it is known to be expressed [26]. When RAW264.7 cells were not serumstarved for 24 h, IL-6 expression reappeared (data not shown). Expression of iNOS in Mono Mac 6 cells was also not detectable, which is in accordance with the literature [27]. Comparable measurements were performed in primary monocytes, unpolarized macrophages (M0) as well as in M1 or M2 polarized cells (Fig. 2). In primary monocytes the expression of COX-2 and IL-6 was significantly increased by a factor of 3 to 4, whereas the expression of MCP1 and TNF-α was reduced (Fig. 2A). In M0 and M2 macrophages the acidosis-induced changes in cytokine expression were similar to the data obtained in the RAW264.7 cell line (Fig. 2B + D). IL-1ß, MCP-1, SPP1 and TNF-α mRNA were decreased while iNOS and COX-2 (p = 0.06) showed a trend of increased expression in unstimulated macrophages. Expression of iNOS was not detected in 3 out of 5 human samples therefore statistical analysis was not possible. Low iNOS expression might be the result of variability between different patients or inhomogeneous expression in only a small subset of macrophages as described in [28]. Acidosis increased COX-2 and reduced MCP-1 and TNF-α expression in M2 polarized macrophages (Fig. 2D). In M1 polarized macrophages also a significant decrease in MCP-1 and TNF-α was seen, as well as a reduction of IL-1ß and COX-2 mRNA (Fig. 2C). Since mRNA levels of COX-2, IL-1ß and iNOS were increased by extracellular acidosis in RAW264.7 cells, the effect on protein content of these inflammatory markers was studied. COX-2 protein (Fig. 3A, Suppl. Fig. 2) and IL-1ß secretion (Fig. 3B) were elevated after 6 h of acidic treatment. The production of nitrate and nitrite, which is a functional measure of reactive nitrogen species production by iNOS, was increased in an acidic environment after 3 h and 6 h (Fig. 3C).

2.7. Migratory speed and phagocytosis Migration was assayed by time lapse photography. Cells were grown in 35 mm-Petri dishes, serum-starved, incubated with the above mentioned bicarbonate solutions and transferred to an incubation chamber (stage Top Incubator INU-KI-F1; Tokai Hit, Shizuoka, Japan) of a Keyence BZ-8100E fluorescence microscope (Keyence Corporation, Neu-Isenburg, Germany). Pictures were taken every 1–5 min (overall time interval: 60–100 min). The migratory speed of single cells (in μm/min) was calculated using BZ analyzer (Keyence Corporation) and ImageJ. Phagocytosis of IgG FITC-coated latex beads was analyzed according to the instructions of the phagocytosis assay kit (Cayman Chemical, Ann Arbor, MI, USA). Briefly, 5 × 105 cells/ml were grown in 24-well plates, serum-starved and incubated at pH 7.4 or pH 6.6 (see Experimental setup). Cells were harvested and washed in assay buffer and FITC-labeled cells analyzed by flow cytometry (LSRFortessa, BD Biosciences, San Jose, CA, USA).

2.8. Materials If not stated otherwise, chemicals were purchased from SigmaAldrich, Munich, Germany.

2.9. Data analysis Data are presented as mean ± SEM. For all other experiments, n equals the number of cell passages used to perform the measurements (performance of duplicates or triplicates is indicated separately in the text) and three different passages were performed at least. Statistical significance was determined by unpaired Student's t-test or ANOVA, as appropriate. Differences were considered statistically significant when p b 0.05. 3. Results All experiments were performed in monocytic cell lines (Mono Mac 6, THP-1) or primary monocytes as well as in macrophage cell lines (RAW264.7, differentiated THP-1) or primary monocyte-derived macrophages. In order to differentiate the monocytic cell line THP-1 to macrophages, cells were incubated with PMA for 48 h. During this procedure cells changed their morphology, became adherent and spindle-shaped (Suppl. Fig. 1A) and the phagocytotic activity was significantly increased (Suppl. Fig. 1B) both indicating a cellular differentiation to a macrophagic phenotype.

3.2. Activation of immune cell function by extracellular acidosis Different studies have focused on the role of extracellular pH on immune cell activity particularly on cell migration and on phagocytosis. The effect of extracellular acidosis on random movement of monocytic cells (Mono Mac 6 and THP-1) and RAW264.7 macrophages was analyzed by time lapse photography. Acidosis did not affect the migratory behavior of the immune cells studied (Fig. 4). However, when studying phagocytosis of macrophages (PMA-differentiated THP-1 and RAW264.7) acidosis led to an increased phagocytic activity after 24 h (Fig. 5). Differentiated THP-1 even displayed increased phagocytosis already after 3 h in an acidic environment (Fig. 5A). Therefore, extracellular acidosis affects immune cell function in concern of phagocytosis, but does not influence cellular motility.

A. Riemann et al. / Biochimica et Biophysica Acta 1862 (2016) 72–81

75

Fig. 1. Acidosis-induced modulation of the expression of inflammatory markers in monocytes (A + C) and macrophages (B + D). Changes in mRNA expression of COX-2, IL-1ß, IL-6, iNOS, MCP-1, osteopontin (SPP1) and TNF-α in Mono Mac 6 (A), THP-1 (C), RAW264.7 (B) and PMA-differentiated THP-1 cells (D). Fold regulation and ΔΔCq values of pH 6.6 compared to pH 7.4 after an incubation period of 3 h are shown, n = 6–12 (triplicates each). (*) p b 0.05, (**) p b 0.01 vs. pH 7.4, (n.d.) not detectable.

3.3. Changes in cellular signaling Whether an acidic environment impacts on cellular signaling was determined by semi-quantitative analysis of phosphorylation of ERK1/2, p38 and CREB (Fig. 6, Suppl. Fig. 3). Overall protein amount of

ERK1/2, p38 and CREB was not affected at pH 6.6 after 3 h, except in Mono Mac 6 cells where total ERK1/2 protein was increased slightly (+32 ± 14%, n = 6, p = 0.045). Phosphorylation of ERK1/2 and CREB was unaffected by acidosis in monocytic cell lines (Fig. 6A + C) as well as in macrophages (Fig. 6B + D). Phosphorylation of p38 was

Fig. 2. Acidosis-induced modulation of the expression of inflammatory markers in (A) primary human monocytes, (B) unpolarized primary macrophages and (C) M1 or (D) M2 polarized cells. Fold regulation and ΔΔCq values of pH 6.6 compared to pH 7.4 after an incubation period of 3 h are shown, n = 4–5 (except for iNOS: n = 2; triplicates each). (*) p b 0.05, (**) p b 0.01 vs. pH 7.4, (n.d.) not detectable.

76

A. Riemann et al. / Biochimica et Biophysica Acta 1862 (2016) 72–81

Fig. 3. Acidosis increases protein expression of inflammatory markers. Time course of relative acidosis-induced changes (compared to respective pH 7.4 controls) in the expression of (A) COX-2 protein and (B) IL-1ß protein as well as (C) nitrate−/nitrite production as an indicator of increased functional iNOS expression in RAW264.7 macrophages is shown, n = 3–7 (duplicates each). (*) p b 0.05 vs. pH 7.4.

unaffected by extracellular acidosis in Mono Mac 6 and increased in undifferentiated THP-1 cells. In RAW264.7 macrophages p38 phosphorylation increased significantly under acidic conditions by 38 ± 10% (n = 6; p b 0.05 vs. pH 7.4). When normalized to the total amount of p38 the increase in RAW264.7 cells was 30 ± 13% (Fig. 6B; p = 0.045). This acidosis-induced activation of p38 was specific, since phosphorylation of ERK1/2, another member of MAP kinase family, was not affected by acidosis in RAW264.7 macrophages. In primary cells acidosis also affected the activation signaling cascades. CREB was statistically significantly activated neither in monocytes nor in any of the macrophage cell types (Fig. 7). There was a trend towards increased phosphorylation of p38 in unpolarized and M1 macrophages but statistical significantly repressed p38 phosphorylation in M2 cells. Also a trend in elevated ERK1/2 phosphorylation in monocytes was found, while in M1 and M2 macrophages phosphorylation was reduced (Fig. 7C + D). Altogether, the evaluation of the regulation in cell signaling of freshly isolated monocytes/macrophages was difficult due to large variation between the different monocyte preparations and due to low protein amounts resulting in weak signals in Western blots (Suppl. Fig. 4). Since p38 is known to play a critical role in regulating the expression of different inflammatory markers, further experiments were performed in RAW264.7 cells to elucidate its role in acidosis-induced gene regulation. In these experiments p38 activity was blocked by 10 μM SB203580 and the effect on the expression of COX-2, IL-1ß, iNOS and MCP-1 was studied (Fig. 8). At first it was analyzed whether the expression was p38-dependent even under normal pH. When inhibiting p38 at pH 7.4 the expression of IL-1ß was significantly reduced but that of MCP-1 was more than doubled (Fig. 8A) indicating

that p38 is involved in controlling the expression of these cytokines. In the literature a regulation of MCP-1 by p38 in RAW264.7 cells was shown, although the results seem to depend on the experimental setting, since up-, down- and no regulation were described [29–31]. Under acidic conditions, where the expression of IL-1ß, COX-2 and iNOS mRNA was increased (Fig. 1B), inhibition of p38 blocked the expression (Fig. 8B). With SB203580 the expression of these mediators reached approximately the level at pH 7.4 indicating that the acidosisinduced increase is mediated by p38. Taken together, our results show an acidosis-induced activation of p38 signaling in RAW264.7 macrophages which leads to an increase in the expression of inflammatory markers COX-2, IL-1ß and iNOS. 4. Discussion Local acidosis is often found in different pathological conditions like acute or chronic inflammation, ischemia as well as in the tumor microenvironment. In this study we show that acidosis impacts on monocytic cells and macrophages in dependency of their differentiation. Monocytic cells (Mono Mac 6, THP-1) display a diminished expression of inflammatory markers when extracellular pH is lowered. COX-2, IL-6, MCP-1, SPP1 and TNF-α were reduced significantly in both cell lines. An acidic microenvironment hence impedes the production of prostaglandins, the recruitment of subsequent immune cells and the secretion of proinflammatory cytokines. Therefore acidosis seems to diminish the inflammatory response in the monocytic cell lines. The data of these immortalized cell lines were only partially confirmed in primary human monocytes. In primary cells only MCP-1 and TNF-α were significantly reduced whereas the expression of COX-2 and IL-6 increased. These

Fig. 4. Migration is not affected by extracellular acidosis. Motility in μm/min is shown for Mono Mac 6 (A), THP-1 (B) and RAW264.7 cells (C) in bicarbonate-buffered solution pH 7.4 or pH 6.6, n = 4–5 (minimum 10 cells per cell passage).

A. Riemann et al. / Biochimica et Biophysica Acta 1862 (2016) 72–81

Fig. 5. Acidosis enhances phagocytic activity of macrophages. The time course of relative changes in phagocytosis comparing pH 6.6 to pH 7.4 is shown for PMA-differentiated THP-1 (A) and RAW264.7 cells (B), “0” meaning no change and “+/−x” resembles relative changes induced by acidic incubation. n = 4–7; (*) p b 0.05 vs. pH 7.4.

results illustrate that data, obtained in immortalized cell lines with a leukemic background, potentially cannot be transferred to the human situation. However, the down regulation of MCP-1 and TNF-α by acidosis in all cells indicate a fundamental mechanism resulting in a reduced recruitment of inflammatory cells in an acidic tissue. In macrophages the response to acidosis was fundamentally different. In RAW264.7 cells the expression of COX-2, IL-1ß and iNOS was significantly increased on the mRNA level (Fig. 1B) but also on the level of functional protein (Fig. 3). Obviously, the inflammatory behavior of RAW264.7 macrophages is activated by extracellular acidosis, which is also reflected by the increased phagocytic activity under these

77

conditions (Fig. 5B). The results of the RAW264.7 cell line were confirmed in primary human unpolarized and M2 macrophages (Fig. 2B + D). In these cells also COX-2 and iNOS were increased whereas MCP-1 was markedly reduced. Only IL-1ß expression was not increased in M0 macrophages. For acidosis-induced IL-1ß regulation, differing results were obtained from the group of Jancic et al. [32]. They demonstrated that GM-CSF pre-differentiated macrophages showed no regulation of IL-1ß, while monocytes exhibited an increase in IL-1ß and no regulation of IL-6 and TNF-α. However, experimental setups varied fundamentally, since we applied no pre-differentiation step, but activated the macrophages with LPS/IFNγ or IL-4/IL-10. Additionally, results were obtained in the absence of FBS, since it is known to affect cytokine production [33]. Obviously, RAW264.7 cells seem to be a suitable model for unpolarized macrophages. LPS−/IFNγ-induced M1 macrophages showed a reduced expression in most of the cytokines indicating a repression of inflammation by an acidic environment. Obviously, the impact of acidosis depends not only on cell differentiation but also on the polarization state of the macrophages. In contrast to RAW264.7 cells the expression of inflammatory markers in PMA-differentiated THP-1 was almost independent from the extracellular pH. This might be a result of the stimulation with PMA. Since PMA is known to regulate different cytokines in a dose dependent manner [19,34,35], it might be that the pH-depending changes of mediator expression are opposed by the prior PMA incubation. Only IL-1ß was upregulated by acidosis, which is consistent with the results of Torres et al. that showed enhanced expression and secretion of IL1ß in differentiated THP-1 by a pH of 6.7 [36]. In RAW264.7 but also in M0 primary macrophages the expression of COX-2 and iNOS was increased under acidic conditions. This change of the inflammatory profile could have an effect on the immune response

Fig. 6. Impact of acidosis on ERK1/2, p38 and CREB phosphorylation in different monocytic and macrophagic cell lines. Semi-quantitative analysis of Western blots showing relative effects of 3 h acidosis (control: 3 h pH 7.4) on phosphorylated protein normalized to total ERK1/2, p38 or CREB protein respectively, n = 6–9. (*) p b 0.05 vs. pH 7.4.

78

A. Riemann et al. / Biochimica et Biophysica Acta 1862 (2016) 72–81

Fig. 7. Impact of acidosis on ERK1/2, p38 and CREB phosphorylation in primary human monocytes, unpolarized macrophages or polarized M1 and M2 cells. Semi-quantitative analysis of Western blots showing relative effects of 3 h acidosis (control: 3 h pH 7.4) on phosphorylated protein normalized to total ERK1/2, p38 or CREB protein respectively, n = 5. (*) p b 0.05 vs. pH 7.4.

in tumors and by this on the prognosis of tumor patients. In the present study acidosis was able to activate phagocytic activity of macrophages significantly (Fig. 5). An increase in phagocytic activity by acidosis was also described in murine macrophages [37,38]. Therefore, acidosis may lead to an enhanced formation of NO and fostered phagocytosis. An increased COX-2 expression in tumor-associated macrophages has been discussed with a poor prognosis of tumor patients [39], which might also explain that NSAID reduce the recurrence of breast cancer [40]. Prostaglandin E2 can play a role in the mesenchymal stem cell– macrophage interaction leading to tumor progression [41]. In addition, several studies indicate that increased levels of inflammatory mediators such as IL-1ß (which expression was elevated in RAW264.7 macrophages) could also promote tumorigenesis and switch to a stem celllike phenotype [41,42]. Since IL-1ß as well as COX-2 expression was strongly increased (Figs. 1B + 2D + 3) it has to be discussed whether the acidotic environment of the tumor can promote tumor progression indirectly by activation tumor associated macrophages. In the present study, MCP-1 was markedly down-regulated in RAW264.7 and primary macrophages by acidosis (Figs. 1 + 2). With respect to the tumor-promoting effect of this cytokine [43–45], the reduced expression could be beneficial for tumor control. However, since the migration of mononuclear immune cells is directly correlated with the MCP-1 production [12,46], a reduced expression under acidic conditions could hinder the chemoattraction of immune cells and by this, could have a long-term anti-inflammatory effect. Finally, TNF-α has been linked to tumorigenesis including cellular transformation, proliferation, survival, angiogenesis, invasion and metastasis [47,48]. TNF-α was down-regulated in unstimulated as well as M1 or M2 activated macrophages by acidosis, which is in good accordance with the results of primary murine macrophages and human monocytes [49,50] and

could facilitate a repression of inflammation by an acidic environment. Likewise an acidosis-induced reduction in TNF-α synthesis at the protein, but not mRNA level has been shown in RAW246.7 cells [51]. Taking these results together, the impact of an extracellular acidosis is somehow Janus-faced. On the one hand acidosis has a proinflammatory effect (mediator secretion, phagocytic activity) which could enhance the immune response. On the other hand it can repress the activation and recruitment of leukocytes via MCP-1 and TNF-α reduction and indirectly promote tumor progression by secretion of pro-tumorigenic cytokines by macrophages. At present, the net effect of acidosis on the immune response and tumor control cannot be predicted. Here, further experiments in co-culture (tumor cells, macrophages, fibroblasts) as well as in vivo experiments are necessary. In order to analyze the underlying signaling pathways responsible for the acidosis-induced change in inflammatory mediator expression, the phosphorylation of MAP kinases and CREB were studied. In RAW264.7 and in tendency in primary M0 and M1 macrophages the phosphorylation of p38 but not of ERK1/2 or CREB was significantly increased. These results are in good accordance to similar measurements in several tumor cell lines [52] and normal tissue fibroblasts [53]. In all tumor cell lines as well as in fibroblasts p38 was significantly activated by acidosis. Hence the activation of the p38 MAPK signaling pathway seems to be a uniform response of various cells to low pH. Interestingly, M2 macrophages showed a decrease in p38 and ERK1/2 phosphorylation which might reflect the immune repressive action of acidosis on tumorassociated macrophages. However, it might also be the result of the pretreatment with IL-4 and IL-10 for polarization since both interleukins have been shown to strongly activate for instance p38 [54,55]. Therefore, it may be possible that the pre-treatment already activated this signaling cascade so that acidosis cannot further increase phosphorylation.

A. Riemann et al. / Biochimica et Biophysica Acta 1862 (2016) 72–81

Fig. 8. Dependency of the expression of inflammatory markers on p38 signaling in RAW264.7 macrophages during (A) control conditions (pH 7.4) and (B) extracellular acidosis (pH 6.6). Effects of p38 inhibitor SB203580 on expression of COX-2, IL-1ß, iNOS and MCP-1 after an incubation period of 3 h is shown. In panel (A) fold regulation as well as ΔΔCq compared to cells at pH 7.4 incubated with vehicle (DMSO) are shown (* p b 0.05 and ** p b 0.01 vs. w/o SB203580). In panel (B) fold regulation and ΔΔCq of acidic conditions compared to pH 7.4 with or without SB203580, respectively, are shown (# p b 0.05 and ## p b 0.01 pH 6.6 vs. pH 7.4 with or w/o SB203580, respectively), n = 7–12 (triplicates each).

79

specific way via cAMP/PKA signaling [49]. Whether a similar mechanism exists in human macrophages must be clarified in future studies. A third possible way to sense acidosis is by the change of intracellular pH (pHi) since proteins sensitive to protonation can act as intracellular pH sensors [64]. An acidosis-induced drop in pHi was shown for many tumor and non-tumor cell lines [52] including human blood monocytes [32]. In the latter work, acidosis affected IL-1ß expression in dependency of changes in pHi and intracellular free calcium. Further experiments are needed to investigate which mechanisms are critical for the observed acidosis-induced regulation of inflammatory markers in monocytic/macrophage cell lines and human primary cells. In conclusion, the present study demonstrates that moderate extracellular acidosis which is a common finding in different pathological conditions such as inflammation, ischemia or in solid growing tumors affects the functional behavior of monocytes and macrophages and can therefore modulate the immune response. These results are in line with the literature suggesting that acidic microenvironment can activate neutrophils and dendritic cells and regulate the function of NK and T cells [4,32]. However, the impact of acidosis on monocytes and on macrophages differs. In monocytes low pH leads to a repression of several inflammatory mediators and is therefore probably antiinflammatory. In macrophages (Fig. 9) the expression of COX-2, iNOS and partly IL-6 is functionally increased as well as the phagocytic activity, leading to an increase in inflammation. However, MCP-1 and TNF-α decreased and may, therefore, repress inflammation. Specifically in tumors, where some of the cytokines can have a tumor-promoting effect, this change could force tumor progression.

Disclosure statement The authors declare that they have no conflict of interest.

In principle, phosphorylation of MAP kinases or the transcription factor CREB can affect expression of inflammatory mediators. It is known that p38 can stabilize inflammatory response protein mRNA and promote their translation through adenylate-uridylate-rich elements in the 3'untranslated region of the mRNAs [56]. This stabilization has been shown in detail for COX-2 [57], furthermore it is known that iNOS is p38-dependent [58,59]. Fig. 8 indicates that in RAW264.7 macrophages the expression of COX-2, IL-1ß, iNOS and MCP-1 is p38-dependent. Basal expression (pH 7.4) of COX-2 and iNOS was independent of p38 activity, while IL-1ß and MCP-1 were strongly p38dependent (Fig. 8A). The acidosis-induced increase in the expression of COX-2, IL-1ß, iNOS was prevented by blocking p38 (Fig. 8B), which clearly shows that the increased expression at low pH is p38-induced. Similar results have been found in normal tissue fibroblasts [53], indicating that this is a universal regulation of inflammatory mediators by acidosis. MCP-1 expression was significantly reduced at acidic pH, but during p38 inhibition the expression further decreased, indicating that the regulation of MCP-1 by p38 is not direct, but comprises different signaling molecules under control (pH 7.4) and under acidic conditions (pH 6.6). In fibroblasts MCP-1 expression was independent on p38 signaling [53], therefore control of MCP-1 expression is cell line specific. There are different ways of how immune cells sense and transmit changes of extracellular pH that could lead to the regulation of MAPK activity and cytokine expression. One possibility is acid-sensing ion channels (ASICs) that are H+-gated sodium channels activated by extracellular protons [60]. Dendritic cells express ASICs and they were critical for acidosis-induced activation of dendritic cells [61]. Additionally, ASIC expression was detected in murine macrophages and contributed to the acidosis-induced promotion of endocytosis and maturation [38]. Another possible way of sensing extracellular acidosis in inflammation is via proton-sensing G protein-coupled receptors (GPCRs) [62,63]. Expression of OGR1 family receptors was found in mouse peritoneal macrophages and acidosis repressed TNF-α and IL-6 expression in a TDAG8-

Transparency document The Transparency document associated with this article can be found, in online version.

Fig. 9. Impact of extracellular acidosis on macrophage activity in inflammation. Acidosis modulates the expression of inflammatory markers and phagocytic activity possibly mediated by acid sensitive ion channels (ASICs), proton-sensing G protein-coupled receptors (GCPRs) or changes in intracellular pH (pHi). IL-1ß, IL-6 and SPP1 regulation (in gray) depended on activation state and species.

80

A. Riemann et al. / Biochimica et Biophysica Acta 1862 (2016) 72–81

Acknowledgements & funding This study was supported by Deutsche Krebshilfe (Grants 106774/ 106906).

[24]

[25]

Appendix A. Supplementary data [26]

Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.bbadis.2015.10.017. [27]

References [1] M. Stubbs, P.M. McSheehy, J.R. Griffiths, C.L. Bashford, Causes and consequences of tumour acidity and implications for treatment, Mol. Med. Today 6 (2000) 15–19. [2] L. Dong, Z. Li, N.R. Leffler, A.S. Asch, J.T. Chi, L.V. Yang, Acidosis activation of the proton-sensing GPR4 receptor stimulates vascular endothelial cell inflammatory responses revealed by transcriptome analysis, PLoS One 8 (2013)http://dx.doi.org/10. 1371/journal.pone.0061991. [3] P. Vaupel, F. Kallinowski, P. Okunieff, Blood flow, oxygen and nutrient supply, and metabolic microenvironment of human tumors: a review, Cancer Res. 49 (1989) 6449–6465. [4] A. Lardner, The effects of extracellular pH on immune function, J. Leukoc. Biol. 69 (2001) 522–530. [5] J.E. Sims, D.E. Smith, The IL-1 family: regulators of immunity, Nat. Rev. Immunol. 10 (2010) 89–102, http://dx.doi.org/10.1038/nri2691. [6] D. Kamimura, K. Ishihara, T. Hirano, IL-6 signal transduction and its physiological roles: the signal orchestration model, Rev. Physiol. Biochem. Pharmacol. 149 (2003) 1–38, http://dx.doi.org/10.1007/s10254-003-0012-2. [7] Y. Zhang, W. Yan, M. a. Collins, F. Bednar, S. Rakshit, B.R. Zetter, et al., Interleukin-6 is required for pancreatic cancer progression by promoting MAPK signaling activation and oxidative stress resistance, Cancer Res. 73 (2013) 6359–6374, http://dx.doi.org/ 10.1158/0008-5472.CAN-13-1558-T. [8] T. Clahsen, F. Schaper, Interleukin-6 acts in the fashion of a classical chemokine on monocytic cells by inducing integrin activation, cell adhesion, actin polymerization, chemotaxis, and transmigration, J. Leukoc. Biol. 84 (2008) 1521–1529, http://dx.doi. org/10.1189/jlb.0308178. [9] T. Tanaka, M. Narazaki, T. Kishimoto, IL-6 in inflammation, immunity, and disease, Cold Spring Harb. Perspect. Biol. 6 (2014)http://dx.doi.org/10.1101/cshperspect. a016295 (a016295–a016295). [10] J.R. Bradley, TNF-mediated inflammatory disease, J. Pathol. 214 (2008) 149–160, http://dx.doi.org/10.1002/path.2287. [11] H. Zelová, J. Hošek, TNF-α signalling and inflammation: interactions between old acquaintances, Inflamm. Res. 62 (2013) 641–651, http://dx.doi.org/10.1007/ s00011-013-0633-0. [12] S.L. Deshmane, S. Kremlev, S. Amini, B.E. Sawaya, Monocyte chemoattractant protein-1 (MCP-1): an overview, J. Interf. Cytokine Res. 29 (2009) 313–326, http://dx.doi.org/10.1089/jir.2008.0027. [13] F. Aktan, INOS-mediated nitric oxide production and its regulation, Life Sci. 75 (2004) 639–653, http://dx.doi.org/10.1016/j.lfs.2003.10.042. [14] D.L. Simmons, R.M. Botting, T. Hla, Cyclooxygenase isozymes: the biology of prostaglandin synthesis and inhibition, Pharmacol. Rev. 56 (2004) 387–437, http://dx.doi. org/10.1124/pr.56.3.3. [15] F. Kahles, H.M. Findeisen, D. Bruemmer, Osteopontin: a novel regulator at the cross roads of inflammation, obesity and diabetes, Mol. Metab. 3 (2014) 384–393, http:// dx.doi.org/10.1016/j.molmet.2014.03.004. [16] P.H. Anborgh, J.C. Mutrie, A.B. Tuck, A.F. Chambers, Role of the metastasis-promoting protein osteopontin in the tumour microenvironment, J. Cell. Mol. Med. 14 (2010) 2037–2044, http://dx.doi.org/10.1111/j.1582-4934.2010.01115.x. [17] S. Tsuchiya, M. Yamabe, Y. Yamaguchi, Y. Kobayashi, T. Konno, K. Tada, Establishment and characterization of a human acute monocytic leukemia cell line (THP1), Int. J. Cancer 26 (1980) 171–176, http://dx.doi.org/10.1002/ijc.2910260208. [18] H.W. Ziegler-Heitbrock, E. Thiel, A. Fütterer, V. Herzog, A. Wirtz, G. Riethmüller, Establishment of a human cell line (mono Mac 6) with characteristics of mature monocytes, Int. J. Cancer 41 (1988) 456–461. [19] E.K. Park, H.S. Jung, H.I. Yang, M.C. Yoo, C. Kim, K.S. Kim, Optimized THP-1 differentiation is required for the detection of responses to weak stimuli, Inflamm. Res. 56 (2007) 45–50, http://dx.doi.org/10.1007/s00011-007-6115-5. [20] H. Loppnow, H. Brade, I. Dürrbaum, C.A. Dinarello, S. Kusumoto, E.T. Rietschel, et al., IL-1 induction-capacity of defined lipopolysaccharide partial structures, J. Immunol. 142 (1989) 3229–3238 http://www.ncbi.nlm.nih.gov/pubmed/2651523 (accessed October 6, 2015). [21] L. Chen, A. Frister, S. Wang, A. Ludwig, H. Behr, S. Pippig, et al., Interaction of vascular smooth muscle cells and monocytes by soluble factors synergistically enhances IL-6 and MCP-1 production, Am. J. Physiol. Heart Circ. Physiol. 296 (2009) H987–H996, http://dx.doi.org/10.1152/ajpheart.01158.2008. [22] H. Fu, F. Spieler, J. Großmann, D. Riemann, M. Larisch, B. Hiebl, et al., Interleukin-1 potently contributes to 25-hydroxycholesterol-induced synergistic cytokine production in smooth muscle cell–monocyte interactions, Atherosclerosis 237 (2014) 443–452, http://dx.doi.org/10.1016/j.atherosclerosis.2014.10.002. [23] M.G. Netea, C.A. Nold-Petry, M.F. Nold, L.A.B. Joosten, B. Opitz, J.H.M. van der Meer, et al., Differential requirement for the activation of the inflammasome for processing

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

and release of IL-1beta in monocytes and macrophages, Blood 113 (2009) 2324–2335, http://dx.doi.org/10.1182/blood-2008-03-146720. S. Mia, A. Warnecke, X.M. Zhang, V. Malmström, R. a. Harris, an optimized protocol for human M2 macrophages using M-CSF and IL-4/IL-10/TGF-β yields a dominant immunosuppressive phenotype, Scand. J. Immunol. 79 (2014) 305–314, http://dx. doi.org/10.1111/sji.12162. K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method, Methods 25 (2001) 402–408, http://dx. doi.org/10.1006/meth.2001.1262. W. Wang, L. Ye, L. Ye, B. Li, B. Gao, Y. Zeng, et al., Up-regulation of IL-6 and TNF-alpha induced by SARS-coronavirus spike protein in murine macrophages via NF-kappaB pathway, Virus Res. 128 (2007) 1–8, http://dx.doi.org/10.1016/j.virusres.2007.02. 007. T.N.Q. Pham, B.L. Brown, P.R.M. Dobson, V.J. Richardson, Protein kinase C-eta (PKCeta) is required for the development of inducible nitric oxide synthase (iNOS) positive phenotype in human monocytic cells, Nitric Oxide 9 (2003) 123–134, http://dx.doi.org/10.1016/j.niox.2003.09.006. M. Guilliams, L. van de Laar, A hitchhiker's guide to myeloid cell subsets: practical implementation of a novel mononuclear phagocyte classification system, Front. Immunol. 6 (2015) 1–12, http://dx.doi.org/10.3389/fimmu.2015.00406. L. Moreno-Fierros, A.L. García-Hernández, D. Ilhuicatzi-Alvarado, L. Rivera-Santiago, M. Torres-Martínez, N. Rubio-Infante, et al., Cry1Ac protoxin from Bacillus thuringiensis promotes macrophage activation by upregulating CD80 and CD86 and by inducing IL-6, MCP-1 and TNF-α cytokines, Int. Immunopharmacol. 17 (2013) 1051–1066, http://dx.doi.org/10.1016/j.intimp.2013.10.005. Y.Q. Xiao, K. Malcolm, G.S. Worthen, S. Gardai, W.P. Schiemann, V.A. Fadok, et al., Cross-talk between ERK and p38 MAPK mediates selective suppression of proinflammatory cytokines by transforming growth factor-beta, J. Biol. Chem. 277 (2002) 14884–14893, http://dx.doi.org/10.1074/jbc.M111718200. H. Tang, U. Amara, D. Tang, M.A. Barnes, C. McDonald, L.E. Nagy, Synergistic interaction between C5a and NOD2 signaling in the regulation of chemokine expression in RAW 264.7 macrophages, Adv. Biosci. Biotechnol. 4 (2013) 30–37, http://dx.doi.org/ 10.4236/abb.2013.48A3004. C.C. Jancic, M. Cabrini, M.L. Gabelloni, C. Rodríguez Rodrigues, G. Salamone, A.S. Trevani, et al., Low extracellular pH stimulates the production of IL-1β by human monocytes, Cytokine 57 (2012) 258–268, http://dx.doi.org/10.1016/j.cyto.2011.11. 013. F. Rey-Giraud, M. Hafner, C.H. Ries, In vitro generation of monocyte-derived macrophages under serum-free conditions improves their tumor promoting functions, PLoS One 7 (2012)http://dx.doi.org/10.1371/journal.pone.0042656. H. Schwende, E. Fitzke, P. Ambs, P. Dieter, Differences in the state of differentiation of THP-1 cells induced by phorbol ester and 1,25-dihydroxyvitamin D3, J. Leukoc. Biol. 59 (1996) 555–561. K.G. Steube, C. Meyer, H.G. Drexler, Constitutive protein expression of monocyte chemotactic protein-1 (MCP-1) by myelomonocytic cell lines and regulation of the secretion by anti- and proinflammatory stimuli, Leuk. Res. 23 (1999) 843–849. I.M. Torres, Y.R. Patankar, T.B. Shabaneh, E. Dolben, D. a. Hogan, D. a. Leib, et al., Acidosis potentiates the host proinflammatory interleukin-1 response to Pseudomonas aeruginosa infection, Infect. Immun. 82 (2014) 4689–4697, http://dx.doi.org/ 10.1128/IAI.02024-14. S.-Y. Park, D.-J. Bae, M.-J. Kim, M.L. Piao, I.-S. Kim, Extracellular low pH modulates phosphatidylserine-dependent phagocytosis in macrophages by increasing stabilin-1 expression, J. Biol. Chem. 287 (2012) 11261–11271, http://dx.doi.org/10. 1074/jbc.M111.310953. X. Kong, X. Tang, W. Du, J. Tong, Y. Yan, F. Zheng, et al., Extracellular acidosis modulates the endocytosis and maturation of macrophages, Cell. Immunol. 281 (2013) 44–50, http://dx.doi.org/10.1016/j.cellimm.2012.12.009. H. Li, B. Yang, J. Huang, Y. Lin, T. Xiang, J. Wan, et al., Cyclooxygenase-2 in tumorassociated macrophages promotes breast cancer cell survival by triggering a positive-feedback loop between macrophages and cancer cells, Oncotarget (2015) http://www.ncbi.nlm.nih.gov/pubmed/26359357 (accessed October 12, 2015). L.W. Bowers, I.X.F. Maximo, A.J. Brenner, M. Beeram, S.D. Hursting, R.S. Price, et al., NSAID use reduces breast cancer recurrence in overweight and obese women: role of prostaglandin-aromatase interactions, Cancer Res. 74 (2014) 4446–4457, http://dx.doi.org/10.1158/0008-5472.CAN-13-3603. H.-J. Li, F. Reinhardt, H.R. Herschman, R.A. Weinberg, Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling, Cancer Discov. 2 (2012) 840–855, http://dx.doi.org/10.1158/2159-8290.CD-12-0101. L. Wang, L.-F. Zhang, J. Wu, S.-J. Xu, Y.-Y. Xu, D. Li, et al., IL-1β-mediated repression of microRNA-101 is crucial for inflammation-promoted lung tumorigenesis, Cancer Res. 74 (2014) 4720–4730, http://dx.doi.org/10.1158/0008-5472.CAN-14-0960. C. Katanov, S. Lerrer, Y. Liubomirski, L. Leider-Trejo, T. Meshel, J. Bar, et al., Regulation of the inflammatory profile of stromal cells in human breast cancer: prominent roles for TNF-α and the NF-κB pathway, Stem Cell Res. Ther. 6 (2015) 87, http://dx. doi.org/10.1186/s13287-015-0080-7. S.L. Hembruff, I. Jokar, L. Yang, N. Cheng, Loss of transforming growth factor-beta signaling in mammary fibroblasts enhances CCL2 secretion to promote mammary tumor progression through macrophage-dependent and -independent mechanisms, Neoplasia 12 (2010) 425–433. R.M. Dwyer, S.M. Potter-Beirne, K.A. Harrington, A.J. Lowery, E. Hennessy, J.M. Murphy, et al., Monocyte chemotactic protein-1 secreted by primary breast tumors stimulates migration of mesenchymal stem cells, Clin. Cancer Res. 13 (2007) 5020–5027, http://dx.doi.org/10.1158/1078-0432.CCR-07-0731. M. Baay, A. Brouwer, P. Pauwels, M. Peeters, F. Lardon, Tumor cells and tumorassociated macrophages: secreted proteins as potential targets for therapy, Clin. Dev. Immunol. 2011 (2011) 565187, http://dx.doi.org/10.1155/2011/565187.

A. Riemann et al. / Biochimica et Biophysica Acta 1862 (2016) 72–81 [47] F. Balkwill, Tumour necrosis factor and cancer, Nat. Rev. Cancer 9 (2009) 361–371, http://dx.doi.org/10.1038/nrc2628. [48] R. Singh, B.S. Shankar, K.B. Sainis, TGF–β1–ROS–ATM–CREB signaling axis in macrophage mediated migration of human breast cancer MCF7 cells, Cell. Signal. 26 (2014) 1604–1615, http://dx.doi.org/10.1016/j.cellsig.2014.03.028. [49] C. Mogi, M. Tobo, H. Tomura, N. Murata, X. He, K. Sato, et al., Involvement of protonsensing TDAG8 in extracellular acidification-induced inhibition of proinflammatory cytokine production in peritoneal macrophages, J. Immunol. 182 (2009) 3243–3251, http://dx.doi.org/10.4049/jimmunol.0803466. [50] K. Dietl, K. Renner, K. Dettmer, B. Timischl, K. Eberhart, C. Dorn, et al., Lactic acid and acidification inhibit TNF secretion and glycolysis of human monocytes, J. Immunol. 184 (2010) 1200–1209, http://dx.doi.org/10.4049/jimmunol.0902584. [51] T.a. Heming, D.M. Tuazon, S.K. Davé, a.K. Chopra, J.W. Peterson, a. Bidani, Posttranscriptional effects of extracellular pH on tumour necrosis factor-alpha production in RAW 246.7 and J774 A.1 cells, Clin. Sci. (Lond.) 100 (2001) 259–266, http://dx.doi.org/10.1042/CS20000192. [52] A. Riemann, B. Schneider, A. Ihling, M. Nowak, C. Sauvant, O. Thews, et al., Acidic environment leads to ROS-Induced MAPK signaling in cancer cells, PLoS One 6 (2011)http://dx.doi.org/10.1371/journal.pone.0022445. [53] A. Riemann, A. Ihling, J. Thomas, B. Schneider, O. Thews, M. Gekle, Acidic environment activates inflammatory programs in fibroblasts via a cAMP-MAPK pathway, Biochim. Biophys. Acta 1853 (2015) 299–307, http://dx.doi.org/10.1016/j.bbamcr. 2014.11.022. [54] L. Jiménez-Garcia, S. Herránz, A. Luque, S. Hortelano, Critical role of p38 MAPK in IL4-induced alternative activation of peritoneal macrophages, Eur. J. Immunol. 45 (2015) 273–286, http://dx.doi.org/10.1002/eji.201444806. [55] B. Deng, M. Wehling-Henricks, S.A. Villalta, Y. Wang, J.G. Tidball, IL-10 triggers changes in macrophage phenotype that promote muscle growth and regeneration, J. Immunol. 189 (2012) 3669–3680, http://dx.doi.org/10.4049/jimmunol.1103180.

81

[56] J. Saklatvala, The p38 MAP kinase pathway as a therapeutic target in inflammatory disease, Curr. Opin. Pharmacol. 4 (2004) 372–377, http://dx.doi.org/10.1016/j. coph.2004.03.009. [57] J.L. Dean, M. Brook, A.R. Clark, J. Saklatvala, p38 mitogen-activated protein kinase regulates cyclooxygenase-2 mRNA stability and transcription in lipopolysaccharidetreated human monocytes, J. Biol. Chem. 274 (1999) 264–269. [58] G.J. Feng, H.S. Goodridge, M.M. Harnett, X.Q. Wei, A. V Nikolaev, A.P. Higson, et al., Extracellular signal-related kinase (ERK) and p38 mitogen-activated protein (MAP) kinases differentially regulate the lipopolysaccharide-mediated induction of inducible nitric oxide synthase and IL-12 in macrophages: leishmania phosphoglycans subvert macr, J. Immunol. 163 (1999) 6403–6412. [59] J.F. Schindler, J.B. Monahan, W.G. Smith, P38 pathway kinases as anti-inflammatory drug targets, J. Dent. Res. 86 (2007) 800–811, http://dx.doi.org/10.1177/ 154405910708600902. [60] J.A. Wemmie, M.P. Price, M.J. Welsh, Acid-sensing ion channels: advances, questions and therapeutic opportunities, Trends Neurosci. 29 (2006) 578–586, http://dx.doi. org/10.1016/j.tins.2006.06.014. [61] J. Tong, W.-N. Wu, X. Kong, P.-F. Wu, L. Tian, W. Du, et al., Acid-sensing ion channels contribute to the effect of acidosis on the function of dendritic cells, J. Immunol. 186 (2011) 3686–3692, http://dx.doi.org/10.4049/jimmunol.1001346. [62] F. Okajima, Regulation of inflammation by extracellular acidification and protonsensing GPCRs, Cell. Signal. 25 (2013) 2263–2271, http://dx.doi.org/10.1016/j. cellsig.2013.07.022. [63] C.R. Justus, L. Dong, L.V. Yang, Acidic tumor microenvironment and pH-sensing G protein-coupled receptors, Front. Physiol. 4 (2013) 1–9, http://dx.doi.org/10.3389/ fphys.2013.00354 (DEC). [64] J. Srivastava, D.L. Barber, M.P. Jacobson, Intracellular pH sensors: design principles and functional significance, Physiology (Bethesda) 22 (2007) 30–39, http://dx.doi. org/10.1152/physiol.00035.2006.