- Email: [email protected]
Actinomyces israelii in radicular cysts: a molecular study
Vol. 123 No. 5 May 2017
Actinomyces israelii in radicular cysts: a molecular study Nathália Rodrigues Gomes, DDS,a Marina Gonçalves Diniz, BSc, PhD,a Thais dos Santos Fontes Pereira, DDS, MSc,a Carlos Estrela, DDS, PhD,b Luiz de Macedo Farias, DDS, PhD,c Bruno Augusto Benevenuto de Andrade, DDS, PhD,d Carolina Cavaliéri Gomes, DDS, PhD,e and Ricardo Santiago Gomez, DDS, PhDa Universidade Federal University de Minas Gerais, Belo Horizonte, Brazil
Objective. To investigate whether the microscopic filamentous aggregates observed in radicular cysts are associated with the molecular identification of Actinomyces israelii. Moreover, to verify whether this bacterium can be detected in radicular cyst specimens not presenting aggregates. Study Design. Microscopic colonies suggestive of Actinomyces were found in 8 out of 279 radicular cyst samples (case group). The case and control groups (n ¼ 12; samples without filamentous colonies) were submitted to the semi-nested polymerase chain reaction to test the presence of A israelii. DNA sequencing was performed to validate polymerase chain reaction results. Results. Two and 3 samples in the case and control groups, respectively, did not present a functional genomic DNA template and were excluded from the study. A israelii was identified in all samples of the case group and in 3 out of 9 samples of the control group. Conclusions. Although A israelii is more commonly identified in radicular cysts presenting filamentous aggregates, it also appears to be detected in radicular cysts without this microscopic finding. (Oral Surg Oral Med Oral Pathol Oral Radiol 2017;123:586-590)
The genus Actinomyces consists of a heterogeneous group of gram-positive facultative anaerobic bacteria, usually found in symbiosis with the human microbiota, especially in dental plaque.1 In the event of disruption of the mucosa barrier, these microorganisms can cause infection in almost any anatomic site, most commonly affecting the cervicofacial, thoracic, abdominopelvic, and cerebral regions.2 Cervicofacial actinomycosis comprises about 55% of all cases3-5 and includes, among others, intraoral and periapical forms.6 A large number of Actinomyces species has been described, and Actinomyces israelii is considered the major causative agent of human actinomycosis.7 In any of its forms, the diagnosis of actinomycosis is based on clinical manifestations together with microbiologic exams and histopathology. Histopathologic examination of actinomycosis may reveal the presence of masses of branching gram-positive filament aggregates surrounded by neutrophils, known as the Splendore-Hoeppli phenomenon.8 However, direct The authors declare no conflict of interest related to this study. a Department of Oral Surgery and Pathology, School of Dentistry, Universidade Federal University de Minas Gerais, Belo Horizonte, Brazil. b Department of Stomatologic Sciences, School of Dentistry, Universidade Federal de Goiás, Goiânia, Brazil. c Department of Microbiology, Biological Science Institute, Universidade Federal de Minas Gerais, Belo Horizonte, Brazil. d Department of Oral Pathology and Diagnosis, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil. e Department of Pathology, Biological Science Institute, Universidade Federal de Minas Gerais, Belo Horizonte, Brazil. Received for publication Oct 31, 2016; returned for revision Jan 30, 2017; accepted for publication Feb 7, 2017. Ó 2017 Elsevier Inc. All rights reserved. 2212-4403/$ - see front matter http://dx.doi.org/10.1016/j.oooo.2017.02.006
586
identification and/or isolation of the infecting organism from a clinical specimen are necessary for a definitive diagnosis. The identification of Actinomyces species must be performed by culture, which requires ideal growth conditions and is not always a reliable and efficient method.9 The most sensitive technique for bacteria identification is the 16S rRNA gene sequencing.10 However, this is not without limitations, such as the difficulty of extraction of viable DNA and with elevated costs.3 A israelii represents commensal bacteria of the oral cavity isolated in the tonsils, dental plaque, periodontal pockets, and carious lesions.11 Infection of A israelii was reported in periapical inflammatory lesions12-17 and exemplifies a representative extraradicular infection, given the ability of the A israelii to sustain inflammation even after orthograde root canal treatment.11 Radicular cysts are the most common periapical cyst of the jaws and arise from a long-standing inflammatory process surrounding the root apex, originating from the epithelial cell rests of Malassez proliferation.18 The Splendore-Hoeppli phenomenon was observed in histologic exams of periapical lesions, including radicular cysts,2 and has been diagnosed as periapical
Statement of Clinical Relevance Because molecular methods may detect Actinomyces israelii in radicular cysts without the histopathologic Splendore-Hoeppli phenomenon, the results from both techniques should be critically evaluated before the diagnosis of periapical actinomycosis is made.
OOOO Volume 123, Number 5
ORIGINAL ARTICLE Gomes et al. 587
actinomycosis when associated with an inflammatory reaction.19 This study verified whether the microscopic filamentous aggregates observed in radicular cysts are related to the molecular identification of A israelii. In addition, we determine whether this bacterium can also be detected in specimens of radicular cysts not presenting aggregates.
METHODS AND MATERIALS Histopathological analysis and sample selection Hematoxylin and eosin stained slides of all radicular cysts diagnosed between 2008 and 2014 at the Oral Pathology Service (School of Dentistry of Federal University de Minas Gerais, Brazil) were retrieved and reviewed. Figure 1 shows a schematic diagram outlining the experimental protocol. From 279 cases examined, 8 had the characteristic Splendore-Hoeppli phenomenon suggestive of Actinomyces. (Figure 2). Twelve samples of radicular cysts with no histopathologic signs of bacterial deposits were randomly selected and composed the control group. The 20 selected samples were from both male and female patients between 8 and 63 years of age (mean [SD], 36 16.8 years). The local ethics committee approved this study, and the authors have followed the guidelines of the Declaration of Helsinki. DNA extraction Formalin-fixed paraffin-embedded samples were microdissected in a series of 10-mm-thick paraffinembedded tissue sections and digested with proteinase K. Genomic DNA was isolated using a QIAamp DNA formalin-fixed paraffin-embedded tissue kit (QIAGEN, Hilden, Germany) according to the manufacturer’s protocol and were quantified in a NanoDrop 2000 (Thermo Fisher, Wilmington, DE). A positive control was carried out by polymerase chain reaction (PCR) amplification of the endogenous human gene, ß-globin, after a protocol described elsewhere.20 After the PCR reaction, the products were analyzed by electrophoresis in a 6.5% polyacrylamide gel. Samples that did not show ß-globin amplification were excluded from the study to avoid false negative results.
1.5 mL of 10X PCR buffer, 0.6 U of Taq DNA polymerase (Invitrogen, Life Technologies, Inc., Carlsbad, CA), 3 pM of each primer, and 100 ng of template DNA. Thermocycling steps for the first PCR round were as follows: preheating at 94 C for 10 min, 40 cycles of sequential incubations at 94 C for 30 s, 55 C for 30 s and 72 C for 1 min, and a final extension period at 72 C for 5 min. For the second PCR reaction, the number of cycles was reduced to 30 and the primer annealing temperature was set to 66 C. The final PCR products were subjected to electrophoresis in a 6.5% polyacrylamide gel and visualized after silver staining.
Semi-nested PCR Semi-nested PCR was performed using 2 primer sets previously described by Hansen et al.21 (Table I). The first-round primers spanned a specific DNA sequence for A israelii identification; after that, a second PCR reaction was carried out using the same reverse (R) primer, but a different forward (F) primer, to amplify a smaller target within the first PCR product. In both reactions, the PCR mixture yielded a final volume of 15 mL, containing 2.5 mM of DNTP, 2.5 mM of MgCl2,
DNA sequencing (Sanger) The semi-nested PCR products were purified using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, Amersham, UK) and then sequenced. The PCR product band was cut out from a 1.5% agarose gel with GelRed Nucleic Acid Stain (Biotium, Hayward, CA) immediately after staining of the electrophoresis. The purified product was sequenced with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) using 10 pM of
Fig. 1. Schematic diagram outlining the experimental protocol.
ORAL AND MAXILLOFACIAL PATHOLOGY 588 Gomes et al.
OOOO May 2017
Fig. 2. Histopathology of radicular cyst, corresponding to case #3 showing the Splendore-Hoeppli phenomenon characterized by basophilic areas with club-shaped filaments forming a radiating rosette surrounded by neutrophils (hematoxylin and eosin staining, original magnification 100 and 400). This case was positive in the semi-nested polymerase chain reaction and the DNA sequencing analysis, which confirmed the presence of A israelii.
Table I. Primer sets used in the experiments Primer
Forward
Reverse
Amplicon size
A israelii 1st round 2nd round B- globin
50 AAGTCGAACGGGTCTGCCTTG30 50 TAACCT’GCCCCTCACTTCTGG30 50 CAACTTCATCCACGTTCACC30
50 TCAAAGCCTTGGCAGGCCATC30 50 TCAAAGCCTTGGCAGGCCATC30 50 GAAGAGCCAAGGACAGGTAC30
237 bp 170 bp 268 bp
bp, base pairs.
the F primer (of the second round reaction). Reactions were done in an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems). The sequencing electropherograms were analyzed with the Sequence Scanner Software 2 (Applied Biosystems) and the sequence of the gene 16S rRNA of A israelii from the GenBank (access number: X82450.1) was used as a reference. The Sanger sequencing was performed only on the positive samples of the semi-nested PCR.
RESULTS All radicular cysts with filamentous aggregates suggestive of Actinomyces reported proximity with inflammatory infiltrates. Two samples of radicular cyst of the case group and 3 of the control group did not present a functional genomic DNA template based on the results of the ß-globin PCR test and were excluded from the molecular study. The semi-nested PCR and Sanger sequencing results are shown in Table II. All of the 6 non-excluded samples with filamentous aggregates (case group) in the hematoxylin and eosin stain revealed a positive result for A israelii using the semi-nested PCR (Figure 3). Direct sequencing of 4 samples (cases 3, 4, 5, and 6) was consistent with the results of the semi-nested PCR identification of A israelii (Figure 4). The other 2 samples (cases 1 and 2) were of low yield after purification of the PCR product from the agarose gel and could not be successfully
sequenced. Three out of 9 samples (cases 8, 12, and 13) from the control group were also positive for A israelii using the semi-nested PCR. One PCR product sample (case 12) was successfully sequenced, and the result was confirmed. The PCR products of the remaining 2 samples (cases 8 and 13) were of low yield after purification of the gel band.
DISCUSSION Actinomycosis is a chronic infection caused by bacteria of the genus Actinomyces, with the most common causative species being A israelii.7 Actinomyces colonies have been reported in periapical lesions submitted for histologic examination.2 Most of the studies use culture or microscopic examination to detect Actinomyces. Nevertheless, molecular techniques such as PCR and DNA hybridization have been used to identify bacterial species more successfully.1,3,12,21,22 The semi-nested PCR strategy increases the specificity of the reaction and is more sensitive and advantageous when only small amounts of the microorganism’s DNA are available.12 Additionally, the semi-nested PCR was found to be suitable to detect A israelii in samples from paraffinembedded tissues.21 Although the PCR technique does not distinguish secondary contaminations from the targeted infection, it has been widely used to support the diagnosis of various infectious diseases.
OOOO Volume 123, Number 5
ORIGINAL ARTICLE Gomes et al. 589
Table II. PCR and DNA sequencing results from each sample Semi-nested PCR Case Group 1 2 3 4 5 6 Control group 7 8 9 10 11 12 13 14 15
Result
Sanger
þ þ þ þ þ þ
NA NA þ þ þ þ
e þ e e e þ þ e e
*
NA * * *
þ NA *
Result verified A A A A A A
israelii israelii israelii israelii israelii israelii
Negative A israelii Negative Negative Negative A israelii A israelii Negative Negative
NA, not available due to low concentration of the PCR product purified from the agarose gel. *The Sanger sequencing was performed only on the positive samples of the semi-nested PCR.
Fig. 3. Polyacrylamide gel electrophoresis of purified polymerase chain reaction (PCR) products from semi-nested PCR. Lane 1: 100 bp ladder DNA marker. Lane 2: sample #6. Lane 3: sample #3. Lane 4: sample #4. Lane 5: negative control (DNA omission). The 3 positive cases reported a clear 170 bp amplicon.
In the present study, the histopathologic analysis of 279 cases of radicular cysts revealed 8 samples with unequivocal evidence of typical Actinomyces colonies, indicating a prevalence of 2.8%. This result is in line with previous findings in the literature, where actinomycetes aggregates were found in <5% of all periapical lesions analyzed.2,11,23,24 All cases with SplendoreHoeppli phenomenon that were investigated by molecular methods confirmed the presence of A israelii. In the retrospective analysis of the clinical records available, no evidence of suppuration, abscess formation, or draining sinus tracts were found. Interestingly, we also found the presence of A israelii in 3 out of 9 radicular cysts without histologic evidence of the Splendore-Hoeppli phenomenon. A previous study reported that 56% of 129 root canals and abscesses were infected by Actinomyces.16 Only 1 study investigated the presence of Actinomyces in a radicular cyst using the PCR method. The authors investigated several oral inflammatory lesions, and only 1 radicular cyst reported the presence of Actinomyces naeslundii.3 In our study, we performed a molecular investigation for A israelii only. Although this species is the most common cause of actinomycotic infection, other Actinomyces species are also sporadically related to the disease. Although radicular cysts infected by A israelii are not associated with a specific clinical presentation, this finding raises the question of whether there might be a risk of infection of the surrounding tissues, propagation, and development of cervical actinomycosis.2 The association between Actinomyces and the progression and persistence of periapical lesions has been
explored in the literature. Many studies report that Actinomyces are mostly found in persistent infections and extraradicular lesions compared with early stages of periapical infections.12,15,16,22,25 It has been reported that bacteria from this genus have the ability to adhere to intracanal surfaces and create a foundation for secondary colonizers.26 Periapical actinomycosis has a more indolent clinical presentation, and there is no consensus about the clinical meaning of filamentous aggregates of bacteria in the histopathologic exam.19 According to Kaplan et al.,19 true actinomycosis can only be diagnosed when colonies generate an inflammatory response and/or fibrosis in their immediate proximity. In our results, we observed an increased prevalence of A israelii in radicular cysts presenting filamentous aggregates, but some cysts without this histopathologic finding also presented this microorganism. One might speculate that the presence of bacteria forming colonies with or without inflammatory reaction may not have substantial clinical significance when no signs or symptoms of infection are observed. However, there are no consistent data showing that this diagnosis should be excluded in asymptomatic patients with radicular cyst without the Splendore-Hoeppli phenomenon who are positive for Actinomyces at molecular investigation. Although the molecular identification of the bacterium does not show the role, if any, of the microorganism in the context of the lesion, further studies are necessary to confirm which of these possibilities is true. An important limitation of the present study relates to its retrospective nature. Because of the incomplete
*
ORAL AND MAXILLOFACIAL PATHOLOGY 590 Gomes et al.
OOOO May 2017
Fig. 4. Electropherogram showing DNA analysis of Sanger sequencing from sample 3. The peaks represent each base pair corresponding to the 16S ribosomal RNA gene sequence of A israelii.
clinical information and evolution data of each patient included in the analysis, the results should be interpreted with caution. In summary, although A israelii is more commonly identified in radicular cysts presenting filamentous aggregates at the microscopic exam, it can also be detected in radicular cysts not presenting this feature. This work was supported by grants from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)/Brazil, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)/Brazil, and Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG)/Brazil. RSG, MGD, CE, and CCG are research fellows at CNPq.
REFERENCES 1. Ruby JD, Li Y, Luo Y, Caufield PW. Genetic characterization of the oral. Actinomyces Arch Oral Biol. 2002;47:457-463. 2. Hirshberg A, Tsesis I, Metzger Z, Kaplan I. Periapical actinomycosis: a clinicopathologic study. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2003;95:614-620. 3. Kuyama K, Fukui K, Ochiai E, et al. Identification of the actinomycete 16S ribosomal RNA gene by polymerase chain reaction in oral inflammatory lesions. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2013;116:485-491. 4. Miller M, Haddad AJ. Cervicofacial actinomycosis. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 1998;85:496-508. 5. Zitsch RP 3rd, Bothwell M. Actinomycosis: a potential complication of head and neck surgery. Am J Otolaryngol. 1999;20:260-262. 6. Baliga S, Shenoy S, Wilson G, Katara V. An unusual case of actinomycosis. Ear Nose Throat J. 2002;81:44-45. 7. Fazili T, Blair D, Riddell S, Kiska D, Nagra S. Actinomyces meyeri infection: case report and review of the literature. J Infect. 2012;65:357-361. 8. Valour F, Sénéchal A, Dupieux C, et al. Actinomycosis: etiology, clinical features, diagnosis, treatment, and management. Infect Drug Resist. 2014;7:183-197. 9. Reichenbach J, Lopatin U, Mahlaoui N, et al. Actinomyces in chronic granulomatous disease: an emerging and unanticipated pathogen. Clin Infect Dis. 2009;49:1703-1710. 10. Könönen E, Wadec WG. Actinomyces and related organisms in human infections. Clin Microbiol Rev. 2015;28:419-442. 11. Nair PNR. Biology and pathology of apical periodontitis. In: Estrela C, ed. Endodontic Science. 2nd ed. São Paulo-SP, Brasil: Artes Médicas; 2009:285-347. 12. Nair PNR, Schroeder HE. Periapical actinomycosis. J Endod. 1984;10:567-570. 13. Siqueira JF Jr, Rôças IN, Souto R, de Uzeda M, Colombo AP. Actinomyces species, streptococci, and Enterococcus faecalis in primary root canal infections. J Endod. 2002;28:168-172.
14. Sundqvist G, Reuterving CO. Isolation of Actinomyces israelii from periapical lesion. J Endod. 1980;6:602-606. 15. Tronstad L, Barnett F, Cervone F. Periapical bacterial plaque in teeth refractory to endodontic treatment. Endod Dent Traumatol. 1990;6:73-77. 16. Sunde PT, Olsen I, Debelian GJ, Tronstad L. Microbiota of periapical lesions refractory to endodontic therapy. J Endod. 2002;28:304-310. 17. Xia T, Baumgartner JC. Occurrence of Actinomyces in infections of endodontic origin. J Endod. 2003;29:549-552. 18. Scholl RJ, Kellett HM, Neumann DP, Lurie AG. Cysts and cystic lesions of the mandible: clinical and radiologic-histopathologic review. Radiographics. 1999;19:1107-1124. 19. Kaplan I, Anavi K, Anavi Y, et al. The clinical spectrum of Actinomyces-associated lesions of the oral mucosa and jawbones: correlations with histomorphometric analysis. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2009;108:738-746. 20. Gall-Troselj K, Mravak-Stipetic M, Jurak I, Ragland WL, Pavelic J. Helicobacter pylori colonization of tongue mucosa e increased incidence in atrophic glossitis and burning mouth syndrome (BMS). J Oral Pathol Med. 2001;30:560-563. 21. Hansen T, Kunkel M, Kirkpatrick CJ, Weber A. Actinomyces in infected osteoradionecrosisdunderestimated? Hum Pathol. 2006;37:61-67. 22. Siqueira JF, Rôças IN. Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2003;96:215-222. 23. Happonen RP. Periapical actinomycosis: a follow-up study of 16 surgically treated cases. Endod Dent Traumatol. 1986;2:205-209. 24. Byström A, Happonen RP, Sjögren U, Sundqvist G. Healing of periapical lesions of pulpless teeth after endodontic treatment with controlled asepsis. Endod Dent Traumatol. 1987;3:58-63. 25. Signoretti FG, Endo MS, Gomes BP, Montagner F, Tosello FB, Jacinto RC. Persistent extraradicular infection in root-filled asymptomatic human tooth: scanning electron microscopic analysis and microbial investigation after apical microsurgery. J Endod. 2011;37:1696-1700. 26. Peters LB, Wesselink PR, Van Winkelhoff AJ. Combinations of bacterial species in endodontic infections. Int Endod J. 2002;35: 698-702. Reprint requests: Ricardo S. Gomez, DDS, PhD Department of Oral Surgery and Pathology School of Dentistry Universidade Federal de Minas Gerais Av. Antônio Carlos, 6627 Belo Horizonte Minas Gerais 31270-901 Brazil [email protected]
Actinomyces israelii in radicular cysts: a molecular study Nathália Rodrigues Gomes, DDS,a Marina Gonçalves Diniz, BSc, PhD,a Thais dos Santos Fontes Pereira, DDS, MSc,a Carlos Estrela, DDS, PhD,b Luiz de Macedo Farias, DDS, PhD,c Bruno Augusto Benevenuto de Andrade, DDS, PhD,d Carolina Cavaliéri Gomes, DDS, PhD,e and Ricardo Santiago Gomez, DDS, PhDa Universidade Federal University de Minas Gerais, Belo Horizonte, Brazil
Objective. To investigate whether the microscopic filamentous aggregates observed in radicular cysts are associated with the molecular identification of Actinomyces israelii. Moreover, to verify whether this bacterium can be detected in radicular cyst specimens not presenting aggregates. Study Design. Microscopic colonies suggestive of Actinomyces were found in 8 out of 279 radicular cyst samples (case group). The case and control groups (n ¼ 12; samples without filamentous colonies) were submitted to the semi-nested polymerase chain reaction to test the presence of A israelii. DNA sequencing was performed to validate polymerase chain reaction results. Results. Two and 3 samples in the case and control groups, respectively, did not present a functional genomic DNA template and were excluded from the study. A israelii was identified in all samples of the case group and in 3 out of 9 samples of the control group. Conclusions. Although A israelii is more commonly identified in radicular cysts presenting filamentous aggregates, it also appears to be detected in radicular cysts without this microscopic finding. (Oral Surg Oral Med Oral Pathol Oral Radiol 2017;123:586-590)
The genus Actinomyces consists of a heterogeneous group of gram-positive facultative anaerobic bacteria, usually found in symbiosis with the human microbiota, especially in dental plaque.1 In the event of disruption of the mucosa barrier, these microorganisms can cause infection in almost any anatomic site, most commonly affecting the cervicofacial, thoracic, abdominopelvic, and cerebral regions.2 Cervicofacial actinomycosis comprises about 55% of all cases3-5 and includes, among others, intraoral and periapical forms.6 A large number of Actinomyces species has been described, and Actinomyces israelii is considered the major causative agent of human actinomycosis.7 In any of its forms, the diagnosis of actinomycosis is based on clinical manifestations together with microbiologic exams and histopathology. Histopathologic examination of actinomycosis may reveal the presence of masses of branching gram-positive filament aggregates surrounded by neutrophils, known as the Splendore-Hoeppli phenomenon.8 However, direct The authors declare no conflict of interest related to this study. a Department of Oral Surgery and Pathology, School of Dentistry, Universidade Federal University de Minas Gerais, Belo Horizonte, Brazil. b Department of Stomatologic Sciences, School of Dentistry, Universidade Federal de Goiás, Goiânia, Brazil. c Department of Microbiology, Biological Science Institute, Universidade Federal de Minas Gerais, Belo Horizonte, Brazil. d Department of Oral Pathology and Diagnosis, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil. e Department of Pathology, Biological Science Institute, Universidade Federal de Minas Gerais, Belo Horizonte, Brazil. Received for publication Oct 31, 2016; returned for revision Jan 30, 2017; accepted for publication Feb 7, 2017. Ó 2017 Elsevier Inc. All rights reserved. 2212-4403/$ - see front matter http://dx.doi.org/10.1016/j.oooo.2017.02.006
586
identification and/or isolation of the infecting organism from a clinical specimen are necessary for a definitive diagnosis. The identification of Actinomyces species must be performed by culture, which requires ideal growth conditions and is not always a reliable and efficient method.9 The most sensitive technique for bacteria identification is the 16S rRNA gene sequencing.10 However, this is not without limitations, such as the difficulty of extraction of viable DNA and with elevated costs.3 A israelii represents commensal bacteria of the oral cavity isolated in the tonsils, dental plaque, periodontal pockets, and carious lesions.11 Infection of A israelii was reported in periapical inflammatory lesions12-17 and exemplifies a representative extraradicular infection, given the ability of the A israelii to sustain inflammation even after orthograde root canal treatment.11 Radicular cysts are the most common periapical cyst of the jaws and arise from a long-standing inflammatory process surrounding the root apex, originating from the epithelial cell rests of Malassez proliferation.18 The Splendore-Hoeppli phenomenon was observed in histologic exams of periapical lesions, including radicular cysts,2 and has been diagnosed as periapical
Statement of Clinical Relevance Because molecular methods may detect Actinomyces israelii in radicular cysts without the histopathologic Splendore-Hoeppli phenomenon, the results from both techniques should be critically evaluated before the diagnosis of periapical actinomycosis is made.
OOOO Volume 123, Number 5
ORIGINAL ARTICLE Gomes et al. 587
actinomycosis when associated with an inflammatory reaction.19 This study verified whether the microscopic filamentous aggregates observed in radicular cysts are related to the molecular identification of A israelii. In addition, we determine whether this bacterium can also be detected in specimens of radicular cysts not presenting aggregates.
METHODS AND MATERIALS Histopathological analysis and sample selection Hematoxylin and eosin stained slides of all radicular cysts diagnosed between 2008 and 2014 at the Oral Pathology Service (School of Dentistry of Federal University de Minas Gerais, Brazil) were retrieved and reviewed. Figure 1 shows a schematic diagram outlining the experimental protocol. From 279 cases examined, 8 had the characteristic Splendore-Hoeppli phenomenon suggestive of Actinomyces. (Figure 2). Twelve samples of radicular cysts with no histopathologic signs of bacterial deposits were randomly selected and composed the control group. The 20 selected samples were from both male and female patients between 8 and 63 years of age (mean [SD], 36 16.8 years). The local ethics committee approved this study, and the authors have followed the guidelines of the Declaration of Helsinki. DNA extraction Formalin-fixed paraffin-embedded samples were microdissected in a series of 10-mm-thick paraffinembedded tissue sections and digested with proteinase K. Genomic DNA was isolated using a QIAamp DNA formalin-fixed paraffin-embedded tissue kit (QIAGEN, Hilden, Germany) according to the manufacturer’s protocol and were quantified in a NanoDrop 2000 (Thermo Fisher, Wilmington, DE). A positive control was carried out by polymerase chain reaction (PCR) amplification of the endogenous human gene, ß-globin, after a protocol described elsewhere.20 After the PCR reaction, the products were analyzed by electrophoresis in a 6.5% polyacrylamide gel. Samples that did not show ß-globin amplification were excluded from the study to avoid false negative results.
1.5 mL of 10X PCR buffer, 0.6 U of Taq DNA polymerase (Invitrogen, Life Technologies, Inc., Carlsbad, CA), 3 pM of each primer, and 100 ng of template DNA. Thermocycling steps for the first PCR round were as follows: preheating at 94 C for 10 min, 40 cycles of sequential incubations at 94 C for 30 s, 55 C for 30 s and 72 C for 1 min, and a final extension period at 72 C for 5 min. For the second PCR reaction, the number of cycles was reduced to 30 and the primer annealing temperature was set to 66 C. The final PCR products were subjected to electrophoresis in a 6.5% polyacrylamide gel and visualized after silver staining.
Semi-nested PCR Semi-nested PCR was performed using 2 primer sets previously described by Hansen et al.21 (Table I). The first-round primers spanned a specific DNA sequence for A israelii identification; after that, a second PCR reaction was carried out using the same reverse (R) primer, but a different forward (F) primer, to amplify a smaller target within the first PCR product. In both reactions, the PCR mixture yielded a final volume of 15 mL, containing 2.5 mM of DNTP, 2.5 mM of MgCl2,
DNA sequencing (Sanger) The semi-nested PCR products were purified using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, Amersham, UK) and then sequenced. The PCR product band was cut out from a 1.5% agarose gel with GelRed Nucleic Acid Stain (Biotium, Hayward, CA) immediately after staining of the electrophoresis. The purified product was sequenced with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) using 10 pM of
Fig. 1. Schematic diagram outlining the experimental protocol.
ORAL AND MAXILLOFACIAL PATHOLOGY 588 Gomes et al.
OOOO May 2017
Fig. 2. Histopathology of radicular cyst, corresponding to case #3 showing the Splendore-Hoeppli phenomenon characterized by basophilic areas with club-shaped filaments forming a radiating rosette surrounded by neutrophils (hematoxylin and eosin staining, original magnification 100 and 400). This case was positive in the semi-nested polymerase chain reaction and the DNA sequencing analysis, which confirmed the presence of A israelii.
Table I. Primer sets used in the experiments Primer
Forward
Reverse
Amplicon size
A israelii 1st round 2nd round B- globin
50 AAGTCGAACGGGTCTGCCTTG30 50 TAACCT’GCCCCTCACTTCTGG30 50 CAACTTCATCCACGTTCACC30
50 TCAAAGCCTTGGCAGGCCATC30 50 TCAAAGCCTTGGCAGGCCATC30 50 GAAGAGCCAAGGACAGGTAC30
237 bp 170 bp 268 bp
bp, base pairs.
the F primer (of the second round reaction). Reactions were done in an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems). The sequencing electropherograms were analyzed with the Sequence Scanner Software 2 (Applied Biosystems) and the sequence of the gene 16S rRNA of A israelii from the GenBank (access number: X82450.1) was used as a reference. The Sanger sequencing was performed only on the positive samples of the semi-nested PCR.
RESULTS All radicular cysts with filamentous aggregates suggestive of Actinomyces reported proximity with inflammatory infiltrates. Two samples of radicular cyst of the case group and 3 of the control group did not present a functional genomic DNA template based on the results of the ß-globin PCR test and were excluded from the molecular study. The semi-nested PCR and Sanger sequencing results are shown in Table II. All of the 6 non-excluded samples with filamentous aggregates (case group) in the hematoxylin and eosin stain revealed a positive result for A israelii using the semi-nested PCR (Figure 3). Direct sequencing of 4 samples (cases 3, 4, 5, and 6) was consistent with the results of the semi-nested PCR identification of A israelii (Figure 4). The other 2 samples (cases 1 and 2) were of low yield after purification of the PCR product from the agarose gel and could not be successfully
sequenced. Three out of 9 samples (cases 8, 12, and 13) from the control group were also positive for A israelii using the semi-nested PCR. One PCR product sample (case 12) was successfully sequenced, and the result was confirmed. The PCR products of the remaining 2 samples (cases 8 and 13) were of low yield after purification of the gel band.
DISCUSSION Actinomycosis is a chronic infection caused by bacteria of the genus Actinomyces, with the most common causative species being A israelii.7 Actinomyces colonies have been reported in periapical lesions submitted for histologic examination.2 Most of the studies use culture or microscopic examination to detect Actinomyces. Nevertheless, molecular techniques such as PCR and DNA hybridization have been used to identify bacterial species more successfully.1,3,12,21,22 The semi-nested PCR strategy increases the specificity of the reaction and is more sensitive and advantageous when only small amounts of the microorganism’s DNA are available.12 Additionally, the semi-nested PCR was found to be suitable to detect A israelii in samples from paraffinembedded tissues.21 Although the PCR technique does not distinguish secondary contaminations from the targeted infection, it has been widely used to support the diagnosis of various infectious diseases.
OOOO Volume 123, Number 5
ORIGINAL ARTICLE Gomes et al. 589
Table II. PCR and DNA sequencing results from each sample Semi-nested PCR Case Group 1 2 3 4 5 6 Control group 7 8 9 10 11 12 13 14 15
Result
Sanger
þ þ þ þ þ þ
NA NA þ þ þ þ
e þ e e e þ þ e e
*
NA * * *
þ NA *
Result verified A A A A A A
israelii israelii israelii israelii israelii israelii
Negative A israelii Negative Negative Negative A israelii A israelii Negative Negative
NA, not available due to low concentration of the PCR product purified from the agarose gel. *The Sanger sequencing was performed only on the positive samples of the semi-nested PCR.
Fig. 3. Polyacrylamide gel electrophoresis of purified polymerase chain reaction (PCR) products from semi-nested PCR. Lane 1: 100 bp ladder DNA marker. Lane 2: sample #6. Lane 3: sample #3. Lane 4: sample #4. Lane 5: negative control (DNA omission). The 3 positive cases reported a clear 170 bp amplicon.
In the present study, the histopathologic analysis of 279 cases of radicular cysts revealed 8 samples with unequivocal evidence of typical Actinomyces colonies, indicating a prevalence of 2.8%. This result is in line with previous findings in the literature, where actinomycetes aggregates were found in <5% of all periapical lesions analyzed.2,11,23,24 All cases with SplendoreHoeppli phenomenon that were investigated by molecular methods confirmed the presence of A israelii. In the retrospective analysis of the clinical records available, no evidence of suppuration, abscess formation, or draining sinus tracts were found. Interestingly, we also found the presence of A israelii in 3 out of 9 radicular cysts without histologic evidence of the Splendore-Hoeppli phenomenon. A previous study reported that 56% of 129 root canals and abscesses were infected by Actinomyces.16 Only 1 study investigated the presence of Actinomyces in a radicular cyst using the PCR method. The authors investigated several oral inflammatory lesions, and only 1 radicular cyst reported the presence of Actinomyces naeslundii.3 In our study, we performed a molecular investigation for A israelii only. Although this species is the most common cause of actinomycotic infection, other Actinomyces species are also sporadically related to the disease. Although radicular cysts infected by A israelii are not associated with a specific clinical presentation, this finding raises the question of whether there might be a risk of infection of the surrounding tissues, propagation, and development of cervical actinomycosis.2 The association between Actinomyces and the progression and persistence of periapical lesions has been
explored in the literature. Many studies report that Actinomyces are mostly found in persistent infections and extraradicular lesions compared with early stages of periapical infections.12,15,16,22,25 It has been reported that bacteria from this genus have the ability to adhere to intracanal surfaces and create a foundation for secondary colonizers.26 Periapical actinomycosis has a more indolent clinical presentation, and there is no consensus about the clinical meaning of filamentous aggregates of bacteria in the histopathologic exam.19 According to Kaplan et al.,19 true actinomycosis can only be diagnosed when colonies generate an inflammatory response and/or fibrosis in their immediate proximity. In our results, we observed an increased prevalence of A israelii in radicular cysts presenting filamentous aggregates, but some cysts without this histopathologic finding also presented this microorganism. One might speculate that the presence of bacteria forming colonies with or without inflammatory reaction may not have substantial clinical significance when no signs or symptoms of infection are observed. However, there are no consistent data showing that this diagnosis should be excluded in asymptomatic patients with radicular cyst without the Splendore-Hoeppli phenomenon who are positive for Actinomyces at molecular investigation. Although the molecular identification of the bacterium does not show the role, if any, of the microorganism in the context of the lesion, further studies are necessary to confirm which of these possibilities is true. An important limitation of the present study relates to its retrospective nature. Because of the incomplete
*
ORAL AND MAXILLOFACIAL PATHOLOGY 590 Gomes et al.
OOOO May 2017
Fig. 4. Electropherogram showing DNA analysis of Sanger sequencing from sample 3. The peaks represent each base pair corresponding to the 16S ribosomal RNA gene sequence of A israelii.
clinical information and evolution data of each patient included in the analysis, the results should be interpreted with caution. In summary, although A israelii is more commonly identified in radicular cysts presenting filamentous aggregates at the microscopic exam, it can also be detected in radicular cysts not presenting this feature. This work was supported by grants from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)/Brazil, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)/Brazil, and Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG)/Brazil. RSG, MGD, CE, and CCG are research fellows at CNPq.
REFERENCES 1. Ruby JD, Li Y, Luo Y, Caufield PW. Genetic characterization of the oral. Actinomyces Arch Oral Biol. 2002;47:457-463. 2. Hirshberg A, Tsesis I, Metzger Z, Kaplan I. Periapical actinomycosis: a clinicopathologic study. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2003;95:614-620. 3. Kuyama K, Fukui K, Ochiai E, et al. Identification of the actinomycete 16S ribosomal RNA gene by polymerase chain reaction in oral inflammatory lesions. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2013;116:485-491. 4. Miller M, Haddad AJ. Cervicofacial actinomycosis. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 1998;85:496-508. 5. Zitsch RP 3rd, Bothwell M. Actinomycosis: a potential complication of head and neck surgery. Am J Otolaryngol. 1999;20:260-262. 6. Baliga S, Shenoy S, Wilson G, Katara V. An unusual case of actinomycosis. Ear Nose Throat J. 2002;81:44-45. 7. Fazili T, Blair D, Riddell S, Kiska D, Nagra S. Actinomyces meyeri infection: case report and review of the literature. J Infect. 2012;65:357-361. 8. Valour F, Sénéchal A, Dupieux C, et al. Actinomycosis: etiology, clinical features, diagnosis, treatment, and management. Infect Drug Resist. 2014;7:183-197. 9. Reichenbach J, Lopatin U, Mahlaoui N, et al. Actinomyces in chronic granulomatous disease: an emerging and unanticipated pathogen. Clin Infect Dis. 2009;49:1703-1710. 10. Könönen E, Wadec WG. Actinomyces and related organisms in human infections. Clin Microbiol Rev. 2015;28:419-442. 11. Nair PNR. Biology and pathology of apical periodontitis. In: Estrela C, ed. Endodontic Science. 2nd ed. São Paulo-SP, Brasil: Artes Médicas; 2009:285-347. 12. Nair PNR, Schroeder HE. Periapical actinomycosis. J Endod. 1984;10:567-570. 13. Siqueira JF Jr, Rôças IN, Souto R, de Uzeda M, Colombo AP. Actinomyces species, streptococci, and Enterococcus faecalis in primary root canal infections. J Endod. 2002;28:168-172.
14. Sundqvist G, Reuterving CO. Isolation of Actinomyces israelii from periapical lesion. J Endod. 1980;6:602-606. 15. Tronstad L, Barnett F, Cervone F. Periapical bacterial plaque in teeth refractory to endodontic treatment. Endod Dent Traumatol. 1990;6:73-77. 16. Sunde PT, Olsen I, Debelian GJ, Tronstad L. Microbiota of periapical lesions refractory to endodontic therapy. J Endod. 2002;28:304-310. 17. Xia T, Baumgartner JC. Occurrence of Actinomyces in infections of endodontic origin. J Endod. 2003;29:549-552. 18. Scholl RJ, Kellett HM, Neumann DP, Lurie AG. Cysts and cystic lesions of the mandible: clinical and radiologic-histopathologic review. Radiographics. 1999;19:1107-1124. 19. Kaplan I, Anavi K, Anavi Y, et al. The clinical spectrum of Actinomyces-associated lesions of the oral mucosa and jawbones: correlations with histomorphometric analysis. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2009;108:738-746. 20. Gall-Troselj K, Mravak-Stipetic M, Jurak I, Ragland WL, Pavelic J. Helicobacter pylori colonization of tongue mucosa e increased incidence in atrophic glossitis and burning mouth syndrome (BMS). J Oral Pathol Med. 2001;30:560-563. 21. Hansen T, Kunkel M, Kirkpatrick CJ, Weber A. Actinomyces in infected osteoradionecrosisdunderestimated? Hum Pathol. 2006;37:61-67. 22. Siqueira JF, Rôças IN. Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2003;96:215-222. 23. Happonen RP. Periapical actinomycosis: a follow-up study of 16 surgically treated cases. Endod Dent Traumatol. 1986;2:205-209. 24. Byström A, Happonen RP, Sjögren U, Sundqvist G. Healing of periapical lesions of pulpless teeth after endodontic treatment with controlled asepsis. Endod Dent Traumatol. 1987;3:58-63. 25. Signoretti FG, Endo MS, Gomes BP, Montagner F, Tosello FB, Jacinto RC. Persistent extraradicular infection in root-filled asymptomatic human tooth: scanning electron microscopic analysis and microbial investigation after apical microsurgery. J Endod. 2011;37:1696-1700. 26. Peters LB, Wesselink PR, Van Winkelhoff AJ. Combinations of bacterial species in endodontic infections. Int Endod J. 2002;35: 698-702. Reprint requests: Ricardo S. Gomez, DDS, PhD Department of Oral Surgery and Pathology School of Dentistry Universidade Federal de Minas Gerais Av. Antônio Carlos, 6627 Belo Horizonte Minas Gerais 31270-901 Brazil [email protected]