- Email: [email protected]
Activation of a cryptic splice-site in intron 24 leads to the formation of apolipoprotein B-27.6
Atherosclerosis 133 (1997) 163 – 170
Activation of a cryptic splice-site in intron 24 leads to the formation of apolipoprotein B-27.6 Attilla Nemeth-Slany a, Phillipa Talmud b, Scott M. Grundy a,c,d, Shailendra B. Patel a,c,* a
Center for Human Nutrition, UT Southwestern Medical Center, Y3.208, 5323 Harry Hines Boule6ard, Dallas, TX 75235 -9052, USA b Di6ision of Cardio6ascular Genetics, Department of Medicine, UCL Medical School, The Rayne Institute, 5, Uni6ersity Street, London WC1E 6JJ, UK c Department of Internal Medicine, UT Southwestern Medical Center, Y3.208, 5323 Harry Hines Boule6ard, Dallas, TX 75235 -9052, USA d Department of Clinical Nutrition, UT Southwestern Medical Center, Y3.208, 5323 Harry Hines Boule6ard, Dallas, TX 75235 -9052, USA Received 3 December 1996; received in revised form 15 February 1997; accepted 9 April 1997
Abstract Apo B expression is confined to the intestine and liver, and its secretion from these tissues is dependent on the expression of a lipid transfer protein, microsomal triglyceride transfer protein (MTP). Previously, we reported a model system for the study of apolipoprotein (apo B) biogenesis using heterologous expression in COS cells (Patel SB, Grundy SM. J. Lipid Res. 1995;36:2090– 2103). We now report the characterization of the effects of a T C transition in the splice-site at + 2 of intron 24 previously reported by Talmud et al. (J. Lipid Res. 1994;35:468–77). Using our heterologous expression system, we show that the mutation led to aberrant processing of intron 24, but normal processing of intron 25. The resultant translation of this mutant mRNA produced a truncated apo B protein of the size of apo B-27.6. Reverse transcription, polymerase chain reaction and sequencing of the amplified products were used to show that a cryptic donor splice-site within intron 24 was utilized, resulting in the generation of a novel hydrophilic 29 amino acid carboxyl-terminal tail. Co-expression of apo B-27.6 with microsomal triglyceride transfer protein (MTP) showed that this protein could bind MTP and resulted in the secretion of a lipoprotein particle with a buoyant density in the range 1.16–1.25 g/ml. These results indicate that this splice-site mutation leads to an activation of a downstream cryptic splice-site within intron 24, causing an insertion of 40 bases of intron 24 sequences into the mature RNA. This leads to a frame-shift of translation resulting in addition of 29 new amino acids at the carboxyl-terminus, before an in-frame stop translation codon is encountered, truncating the apo B at B-27.6. © 1997 Elsevier Science Ireland Ltd. Keywords: Hypobetalipoproteinemia; Splicing; Microsomal triglyceride transfer protein
1. Introduction The biogenesis of apolipoprotein B (apo B) is a complex process [1 – 3]. This large apolipoprotein is synthesized in a constitutive manner in the liver and the intestine. In tissue culture cells, a large proportion of newly synthesized apo B is degraded so that only a
* Corresponding author. Tel.: +1 214 6488734; fax: + 1 214 6484837; e-mail [email protected]
fraction of newly synthesized apo B is secreted. Furthermore, the secretion of apo B is absolutely dependent on the co-expression of another gene product, microsomal triglyceride transfer protein (MTP). In the autosomal recessive condition of abetalipoproteinemia, caused by mutations in the MTP gene, apo B is synthesized but not secreted. Indeed, expression of apo B truncates in cells that do not express MTP leads to their retention in the ER and degradation [4,5]. The factors involved in the biogenesis of apo B-containing lipoproteins are not fully characterized, al-
0021-9150/97/$17.00 © 1997 Elsevier Science Ireland Ltd. All rights reserved. PII S 0 0 2 1 - 9 1 5 0 ( 9 7 ) 0 0 1 0 5 - 6
164
A. Nemeth-Slany et al. / Atherosclerosis 133 (1997) 163–170
though factors such as oleate supplementation [6–8] and the activity of MTP can affect the amount of newly synthesized apo B that is secreted from hepatoma cell lines [9]. To help dissect out the factors involved in the biogenesis of apo B-containing lipoproteins, we have developed a heterologous expression system to study these processes [5]. This model can also be applied to investigate mutations causing familial hypobetalipoproteinemia. Familial hypobetalipoproteinemia is an autosomal dominant disorder caused by mutations in the apo B gene that interfere with proper synthesis. A few of these mutations prevent correct splicing of the mature apo B-100 mRNA (reviewed in [18]). The centile system is used to define the sizes of the apo B; the full length is apo B-100 (550 kDa) [10]. Since the expression of apo B is confined to the intestine and the liver, the effects of mutations affecting splice-sites can only be predicted. To obviate the need for either liver or intestinal tissue from affected individuals, or to perform studies in hepatoma cell lines, we report here an alternative method to facilitate investigation of mutations causing hypobetalipoproteinemia. As an example, we have utilized a recently reported mutation affecting RNA processing and leading to the production of apo B-27.6 [11], which is also the smallest naturally-occurring truncation of apo B that has been shown to be associated with lipids. This mutation is due to a T C transition at position + 2 of intron 24. The authors suggested three possible mechanisms by which the mutation interferes with RNA processing: (a) no splicing occurs for intron 24 so translation proceeds into intronic sequences, (b) a cryptic site within intron 24 is activated resulting in a premature stop translation signal or (c) exon skipping occurs, such that exon 23 is spliced to exon 25, again leading to a frame change and premature translational stop [11]. The predicted translational products in each of these cases resulted in the generation of short carboxyl-terminal tails enriched in hydrophobic amino acids. The authors further speculated that perhaps this feature may be responsible for this particular apo B truncation being associated with lipids, as it was found to have a buoyant density between low and high density lipoproteins. In this paper, we expressed a mini-gene construct bearing the mutated intronic site and a normal downstream intron. Expression of the mutant minigene led to the synthesis, but little secretion of a protein the size of apo B-27.6. In the presence of MTP, this protein was secreted and contained sufficient lipid to form a rudimentary lipoprotein particle. Analysis of the mRNA showed that a cryptic splice-site within intron 24 was utilized, resulting in the addition of a novel 29 amino acid – carboxyl-terminal tail.
2. Methods
2.1. DNA constructs The parent construct bearing apo B 41 cDNA in the expression vector pSV7D has been reported previously [5,12]. Introduction of introns 24 and 25 was performed as follows; a BamHI–XhoI fragment from pSV7D-B-41 was cloned into pBluescript (Stratagene, La Jolla, CA), and partially digested with SacI (to retain the upstream SacI site) and completely with Xhol. Intron 24 from a normal individual or from the homozygous proband, CD [11] was amplified using oligonucleotides described below, digested with SacI and XhoI and cloned into the partially digested pBluescript construct. Colonies were screened for the presence of the inserted intron 24, and the presence of both SacI sites, thus maintaining genetic contiguity. Representative clones were sequenced for confirmation. The BamHI– XhoI fragments bearing the normal or mutated introns were recloned into the BamHI–XhoI site in pSV7D-B-41 construct (pSV7DB-41i24 and pSV7D-B-41i24HMZ respectively). A normal intron 25 was introduced into these clones by amplification of normal genomic DNA across the XhoI–XbaI site, and cloned into the XhoI–XbaI site of the pSV7D-B-41i24 and pSV7D-B-41i24HMZ, resulting in the respective minigene constructs, B-41 and HMZ (Fig. 1). The constructs were sequenced to ensure that no mutations had been introduced by the amplification process. We noted that both the normal and affected clones differed from the GenBank database sequence in the following manner; at position + 11 of intron 24 the database contains a G which is missing from both our normal and homozygous constructs. This finding has been noted previously [11]. We sequenced five independent normal and homozygous clones to verify that this was not a result of PCR generated mutation. The MTP
Fig. 1. Apo B minigene constructs used for expression in COS cells. Introns 24 and 25 were introduced into the apo B-41 minigene as described in Section 2. The construct B-41 contains two normal introns, whereas the construct HMZ contains a normal intron 25, but the T C transition mutation at position + 2 intron 24, indicated by the lollipop symbol. The position of the oligonucleotides A, B and C used for RT-PCR are as shown.
A. Nemeth-Slany et al. / Atherosclerosis 133 (1997) 163–170
expression cDNA construct has been described previously [4].
2.2. Cell culture, transfection and pulse-chase analysis COS cell culture, transfection and pulse-chase analyses were performed as previously described [5]. Briefly, COS cells were transfected with plasmid DNA by electroporation, and analyzed 48 h later. Cells were pulselabeled with a [35S]methionine – cysteine mixture for 10 min and chased for various times as indicated. Cell lysates were prepared and apo B immunoprecipitated and analyzed by SDS-PAGE and quantitated by phosphorimaging (Molecular Dynamics, Sunnyvale, CA). For oleate supplementation experiments, transfected cells were split into two equal portions 48 h after transfection, and one portion incubated with 0.8 mM oleate–dextrin complexes for 30 min prior to pulse-labeling and analyzed as previously described. Since cotransfection is involved, results from one experiment can not be compared statistically to another, due to unknown differences in the relative expression of the apo B or MTP cDNAs after each transfection. However, all experiments were performed at least four times to ensure reproducibility of the pattern of expression.
2.3. Oligonucleotides The numbering of the oligonucleotides is based on the apo B GenBank sequence X04506. All oligonucleotides are located in exonic sequences. The following oligonucleotides were used for amplification of intron 25: forward primer 5%GTCTGTGGGATTCCATCTGCC, position 4099–4120; backward primer 5%GAGCCCATCATGTCATTTGAGAG, position 5339 – 5362 Intron 24 was amplified as previously described [11]. For reverse transcription and PCR, the following oligonucleotides were synthesized: A. Forward primer 5%ACCTCMTAGCCTGAAGGAG position 3888– 3908 B. Backward primer 5%GGGACTTGGMCTCTCGAGATG position 4119 – 4141 C. Backward primer 5%MTCTAGAAATTTGTGGCGT position 4406 – 4416.
2.4. cDNA synthesis, RT-PCR, cloning and sequencing Total RNA was isolated from transfected cells using TriZol (Gibco-BRL, Gaithersberg, MD) treated with DN’ase 1 and cDNA synthesis and PCR was carried out as previously described [13], except that the priming oligonucleotide for cDNA synthesis was C, and PCR was performed with either the A/C or A/B combination. PCR products were analyzed by agarose gel electrophoresis, and the products cloned into pBluescript
165
using the TA cloning method [14]. Positive clones were identified by T-tracking and sequenced by the di-deoxy method of Sanger using the Sequenase II kit (USB, Cleveland, OH). Sequence analysis was performed using the DNA software MacVector (Eastman Kodak, New Haven).
2.5. Cesium chloride density gradient centrifugation Conditioned medium from HMZ and MTP co-transfected cells was cleared of cellular debris, subjected to cesium chloride density gradient centrifugation and fractionated as previously described [5]. Samples were immunoprecipitated directly from the fractions with sheep anti-apo B antiserum (Boehringer Mannheim, Evanston, IN), separated by SDS-PAGE, western blotted and the presence of apo B detected by using the mouse monoclonal antibody C1.4 [15]. This antibody has a binding site in the first 400 amino acids from the N-terminus of apo B.
3. Results
3.1. Expression of splice-site mutation in COS cells Apo B mini-genes bearing normal or mutant splicesites (Fig. 1) were transfected into COS cells and the cells and media were examined for the presence of apo B expression. The cells were radiolabeled for 10 min using [35S]methionine, chased for various time intervals and apo B was immunoprecipitated from the cells or the media (Fig. 2). Expression of the control B-41 construct led to the production of apo B-41 (lanes 1 and 2), but expression of the mutant HMZ construct led to the production of a much smaller protein (lanes 3 and 4, Fig. 2A). No apo B-41 was secreted during a chase period of 2 h, although a very small amount of the truncated apo B-27.6 was detected (i.e. lanes 6 and 8, Fig. 2A). An unknown band ( 80 kDa) also co-precipitated from the cells that were transfected with the HMZ minigene, but not the B-41 minigene (asterisk). In western blotting experiments performed with antiapo B antibody, a major band at the position where apo B-27.6 migrates was noted (Fig. 2B). In addition, faint immunoreactive bands were detected on longer exposure of the Western blot, but did not correspond to the size of the asterisk band. These bands were much lower in abundance and are likely to represent intracellular degradation products. Immunofluorescence staining of COS cells transfected with B-41 or HMZ both showed a predominantly ER staining pattern (data not shown). Furthermore, more than 95% of the intracellular apo B (both apo B-41 and apo B-27.6) remained sensitive to endoglycosidase H digestion (data not shown), supporting the conclusion that heterologously
166
A. Nemeth-Slany et al. / Atherosclerosis 133 (1997) 163–170
Fig. 2. Pulse-chase analysis of apo B from B-41 and HMZ transfected COS cells. COS cells were transfected with B-41 or HMZ, labeled for 10 min and chased for the times indicated below the panel. Apo B was immunoprecipitated and analyzed by SDS-PAGE as described in Section 2 (panel A). Expression of B-41 results in the synthesis of an expected apo B-41 sized protein (tracks 1 and 2, panel A) which was not secreted from the cells during a 2 h chase period (track 6). In contrast, cells transfected with the HMZ construct resulted in the synthesis of a shorter protein (tracks 3 and 4), which was poorly secreted in a 2 h chase (track 8). An unidentified protein, marked by *, co-precipitated from cells transfected with the HMZ construct. To further show that this unidentified band was not a shorter apo B fragment, HMZ transfected cells were lysed, immunoprecipitated with apo B antibodies, Western blotted and probed with a monoclonal anti-apo B, C1.4, specific for the N-terminus (panel B). Whilst B-27.4 was readily detectable, the unidentified band was not observed, suggesting it may be a co-associated endogenous protein (see text for details).
the absence of reverse transcription (lanes 5 and 6). To define the spliced products better, the PCR products from B-41 and HMZ transfected cells were purified, cloned and sequenced. At least twenty independent clones from B-41 and HMZ were analyzed and fully sequenced. A representative analysis for HMZ products is shown in Fig. 4, panel A. For clones derived from the normal B-41 transfected cells, all of these showed a correct use of both splice-sites, eliminating introns 24 and 25 from the mature message. However, for all of the clones derived from HMZ transfected cells, a site at + 40 within intron 24 was used as the donor splice-site. Intron 25 was correctly spliced out in all of the clones examined. This leads to the insertion of 40 bases of intron 24 sequence at the end of exon 24 followed by exon 25 (Fig. 4, panel B), altering the translation frame. Translation of mRNA from this sequence information predicts the addition of 29 new amino acids at the carboxyl-terminal tail (shown in italics, panel A, Fig. 4), before an in-frame stop-translation signal is encountered in exon 25 (not shown). The position of the TC transition at position + 2 of intron 24 is indicated by
expressed apo B is retained and degraded within the ER as previously reported [5].
3.2. Characterization of cryptic splice-site To characterize the RNA processing steps leading to the production of the truncated apo B from the mutant splice-site, RNA was extracted from COS cells transfected with either B-41 or HMZ and RT-PCR was performed. The amplified products were analyzed by agarose gel electrophoresis (Fig. 3). When PCR was performed with oligonucleotides A and B, which amplify across intron 24 (Fig. 1), a product of the expected size (250 bp) was obtained for RNA from B-41 transfected cells (lane 2, Fig. 3), but a slightly larger product (310 bp) was obtained for RNA from HMZ transfected cells (lane 1). When oligonucleotide pair A and C were used, the DNA products were larger, as expected since the amplified fragments include introns 24 and 25 (Fig. 1). However, the PCR products from the HMZ transfected cells remain slightly larger than the control products (lanes 3 and 4, Fig. 3). This would suggest that splicing of intron 25 is normal for both B-41 and HMZ RNAs. Since the splicing of intron 24 leads to a larger product, this suggests that cryptic sites within intron 24 were utilized. No DNA contamination in our RNA preparations was noted by the absence of products in
Fig. 3. RT-PCR analysis of RNA from HMZ and B-41 transfected cells. RNA from cells transfected with HMZ or B-41 was reverse transcribed with oligonucleotide C (tracks 1 – 4) and an aliquot of the cDNA amplified by PCR using oligonucleotides A and B (tracks 1, 2, 5 and 6) or with oligonucleotides A and C (tracks 3 and 4). Tracks 1, 3 and 5 contain RNA from HMZ transfected cells, and tracks 2, 4 and 6 from B-41 transfected cells. Reverse transcription was omitted from samples in tracks 5 and 6 to detect the presence of contaminating genomic DNA. For B-41, an expected product of the size of 250 bp (track 2) and 530 bp (track 4) was obtained. However, for HMZ a slightly larger product was seen (tracks 1 and 3). These products appeared to larger by approximately 60 bp. No genomic contamination was detected when the reverse transcriptase was omitted (tracks 5 and 6).
A. Nemeth-Slany et al. / Atherosclerosis 133 (1997) 163–170
167
Fig. 4. Sequence analysis of cloned RT-PCR products from HMZ transfected cells, and prediction of translated products. PCR products described in Fig. 3 were cloned into pBluescript as described in Section 2. Positive clones were initially screened for the presence of inserts by T-tracking and sequenced. The data for HMZ are shown. A representative clone, sequenced across the aberrant splicing site, is shown. All clones derived from HMZ show an inclusion of intronic sequences (indicated by lower case, panel A). This inclusion leads to the in-frame translation of 29 new amino acids (indicated by the lower line, single alphabet code, italicized) before an in-frame stop translation codon is reached in exon 25 (not shown). The splice-site mutation T C is indicated by *. Panel B shows the effects of normal splicing and that from the cryptic splice-site activation RNA. Under normal circumstances the excision of intron 24 at its correct position leads to maintenance of the frame and allows the full length apo B to be translated. However, the activation of the cryptic splice-site leads to the insertion of some intron 24 sequences which changes the frame. This results in a stop-codon after the addition of 29 new amino acids, truncating apo B at B-27.6.
168
A. Nemeth-Slany et al. / Atherosclerosis 133 (1997) 163–170
Fig. 5. Effect of MTP co-expression on apo B-27.6 secretion kinetics. COS cells were transfected with HMZ in the absence of MTP (——) or the presence of MTP (- - -) and analyzed by pulse-chase as described in Section 2. The data shown is representative of 4 experiments. In the absence of MTP, 7.5% of apo B-27.6 was secreted into the medium at 5 h (), but in the presence of MTP ( ) about 20% was secreted at 5 h. Although intracellular apo B-27.6 appeared to degrade at a more rapid rate in the presence of MTP ( ) compared its absence (), this was not a reproducible finding. Note that even in the presence of MTP, about 50% of apo B-27.6 was degraded intracellularly.
Fig. 6. Effect of oleate supplementation on apo B-27.6 secretion. The effect of oleate supplementation on the secretion of apo B-27.6 was examined in COS cells co-transfected with HMZ and MTP, as described in Section 2. The data shown is representative of 2 separate experiments. The open symbols represent apo B present in the medium and the closed symbols the apo B present within the cells. Oleate supplementation (- - -) had no effect on the amount of apo B-27.6 secreted in 5 h compared to control (——) and neither was the intracellular rate of apo B-27.6 affected.
the asterisk. Kyte-Doolittle analysis [16] of this new peptide shows that it is not particularly hydrophobic in nature (data not shown).
Once a form of hypobetalipoproteinemia has been identified, the size of the truncation is determined by a combination of SDS-PAGE, Coomassie-staining and
4. Discussion
3.3. Truncated Apo B 27.6 can be secreted as a lipoprotein To examine whether apo B-27.6 could be secreted as a lipoprotein particle, HMZ was co-expressed with MTP. We have previously shown that apo B truncations larger than B26 require co-expression with MTP in COS cells for secretion. When apo B-27.6 was expressed in the absence of MTP, pulse-chase analysis showed that only about 59 2% (n = 2) of apo B-27.6 was secreted from COS cells. In the presence of MTP, secretion was increased to about 2695% (n = 2) (Fig. 5). Although in the experiment shown, it would appear that the rate of intracellular degradation of apo B-27.6 is prolonged in the absence of MTP, this was not a consistent finding. Oleate supplementation of the cells co-transfected with MTP and HMZ did not lead to a significant increase in apo B-27.6 secretion (Fig. 6). To examine the buoyant density of apo B-27.6, secreted in the presence of MTP, conditioned medium was subjected to cesium chloride density centrifugation, fractionated and the analyzed for the presence of apo B as described in Section 2. Apo B-27.6 was found to attain a buoyant density between 1.16–1.25 g/ml (Fig. 7).
Fig. 7. Buoyant density of the secreted apo B-27.6. Conditioned medium from COS cells transfected with HMZ and MTP was subjected to CsCI density gradient centrifugation, fractionated and apo B-27.6 immunoprecipitated and detected by Western blotting as described in Section 2. The bottom panel shows the density profile and the top panel the results of Western blotting. The majority of apo B-27.6 (indicated by the arrowhead) is found at a buoyant density of 1.16 – 1.25 g/ml. Although there is a tail of apo B into the lighter fractions, densitometric analysis showed less than 1% of the secreted apo B was present in this range.
A. Nemeth-Slany et al. / Atherosclerosis 133 (1997) 163–170
by Western blotting of the lipoprotein fractions for the presence of a truncated apo B. From these size determinations, the likely area of mutation of the apo B gene can be estimated and these regions are amplified from genomic DNA and sequenced for the presence of the causative mutation. These steps are necessary because the gene for apo B spans over 43 kb and contains 29 exons, one of which is 7572 bp in size [17]. Some of these mutations affect the coding region within the exons, and hence the characterization of the carboxyl-terminal ends of the apo B is greatly simplified. All of this information can be obtained by sampling blood of affected individuals and their family members. In contrast, mutations involving RNA processing, either by affecting splicing, or in one case by a novel RNA polymerase stuttering process, can not be easily characterized (reviewed in [18]). In these cases analysis is complicated because the direct examination of mRNA in affected individuals is not possible; apo B mRNA is expressed in the liver and the intestine, both of these tissues are not as readily available as a sample of blood is. In addition, apo B mRNA in the intestine is subjected to RNA editing [19], and this could also complicate analysis. We report here characterization of a mutation affecting RNA processing [11]. Apo B-27.6 is the smallest known truncation to be associated with lipids in familial hypobetalipoproteinemia cases, and the genetic mutation has been identified as one that disrupts normal splicing involving intron 24. However, the exact RNA processing that could result from such a mutation had not been determined. COS cells have previously been shown to be useful in studying the effects of mutations on splicing [20,21]. Using heterologous expression, when an apo B-41 minigene, bearing either the normal intron or the mutated intron was expressed in COS cells, the presence of the mutated intron led to the production of a truncated apo B the size of apo B-27.6. Analysis of the mRNA from these cells allowed us to determine that a cryptic splice-site was activated within intron 24. This led to the insertion of 40 bases of intron 24 sequences between exons 24 and 25. One consequence of this is that the protein translation frame is shifted, and leads to the addition of 29 new amino acids at the carboxyl-terminal tail, before an in-frame stop translation signal is encountered, terminating the apo B prematurely. Apo B-27.6 is unusual in that it has been shown to form a relatively buoyant lipoprotein [11], in contrast to many other truncated apo Bs of this size range [25,26]. One hypothesis advanced for this behavior is that the novel 29 amino acids added at the carboxyl-terminal tail may be responsible in part for this biological activity [11]. However, this tail is not likely to be responsible for the ability of apo B-27.6 to form lipoproteins; our previous studies have
169
shown that the size of apo B is the major determinant of the ability to form a lipoprotein particle [22]. Apo B truncates larger than apo B-26 are secreted as lipoproteins, whereas truncates shorter than this are secreted with minimal or no lipid [22]. When apo B truncates larger than apo B-26 are expressed in COS cells, these proteins are retained and degraded within the ER [5,23]. Expression of apo B in HeLa cells also resulted in a similar localization [4]. Co-expression of such truncates with MTP allows for secretion and depending upon their size, the secretion rates can be affected by oleate supplementation [4,22,23]. We demonstrate here that coexpression of apo B-27.6 with MTP led to augmentation of secretion, but this secretion was not further increased by oleate supplementation. Oleate supplementation, under normal circumstances, leads to an increase in apo B-100 secretion from cultured hepatocytes [24]. Heterologously expressed apo B truncates also show a size dependent responsiveness to oleate supplementation; secretion of apo Bs smaller than apo B-29 is not augmented by oleate supplementation, but truncations larger than apo B-29 show a progressive response [22]. However, secretion of apo B-27.6 is not increased by oleate supplementation, a feature it has in common with other apo Bs of this size range. Furthermore, the size of apo B is an important factor in determining its buoyant density. Truncated apo Bs expressed in hepatoma cell lines show a linear response between the size of lipoprotein particle (and hence its lipid content) and the size of the apo B truncation, for apo Bs larger than apo B-26 [25,26]. The use of standard molecular biology techniques, together with the ability to co-express MTP and apo B mini-genes by heterologous expression, can thus allow for rapid assessment of mutations whose effects may be complex, such as the splice-site mutation responsible for the production of apo B-27.6 described here. Co-expression with MTP allows for secretion of any truncates larger than apo B-26, hence the ability of such proteins to form lipoproteins and their resultant buoyant densities can also be rapidly established. Such information can be correlated with the study of the lipoproteins from the blood of the probands or affected individuals, thus allowing a more complete characterization.
Acknowledgements We gratefully acknowledge the gifts of monoclonal antibody C1.4 from Dr Gustav Schonfeld, to Dr Reca Infante for supplying the DNA for HMZ originally, to Loyce Rutledge for technical assistance and to Dr
A. Nemeth-Slany et al. / Atherosclerosis 133 (1997) 163–170
170
Helen Hobbs for critical reading of this manuscript. ANS was funded by a scholarship from the Szechenyi Istvan Foundation of Hungary. PJT is supported by the British Heart Foundation (RG 95-007). This work was supported by unrestricted grants from Merck, West Point, PA; Bristol Myers Squibb, New Brunswick, NJ; the Southwestern Medical Foundation, Dallas, TX and the Moss Heart Foundation, Dallas TX and by NIH Grant HL-29252.
References [1] Vance JE, Vance DE. Lipoprotein assembly and secretion by hepatocytes (Review). Ann Rev Nutr 1990;10:337. [2] Gibbons GF. Assembly and secretion of hepatic very-low-density lipoprotein (Review). Biochem J 1990;268:1. [3] Schumaker VN, Phillips ML, Chatterton JE. Apolipoprotein B and low-density lipoprotein structure: implications for biosynthesis of triglyceride-rich lipoproteins (Review). Adv Prot Chem 1994;45:205. [4] Gordon DA, Jamil H, Sharp D, et al. Secretion of apolipoprotein B containing lipoproteins from HeLa cells is dependent on expression of the microsomal triglyceride transfer protein and is regulated by lipid availability. Proc Natl Acad Sci USA 1994;91:7628. [5] Patel SB, Grundy SM. Heterologous expression of apolipoprotein B carboxyl-terminal truncates: a model for the study of lipoprotein biogenesis. J Lipid Res 1995;36:2090. [6] Pullinger CR, North JD, Teng BB, Rifici VA, Ronhild de Brito AE, Scott J. The apolipoprotein B gene is constitutively expressed in HepG2 cells: regulation of secretion by oleic acid, albumin, and insulin, and measurement of the mRNA half-life. J Lipid Res 1989;30:1065. [7] Adeli K, Sinkevitch C. Secretion of apolipoprotein B in serumfree cultures of human hepatoma cell line, HepG2. FEBS Lett 1990;263:345. [8] Dixon JL, Furukawa S, Ginsberg HN. Oleate stimulates secretion of apolipoprotein B-containing lipoproteins from Hep G2 cells by inhibiting early intracellular degradation of apolipoprotein B. J Biol Chem 1991;266:5080. [9] Jamil H, Chu C-H, Chen Y. et al., Microsomal triglyceride transfer protein is limiting in the assembly and secretion of apoB containing lipoproteins in HepG2 and McArdle RH-7777 cell lines (Abstract). Circulation 1995;92:1717. [10] Kane JP, Hardman DA, Paulus HE. Heterogeneity of apolipoprotein B: isolation of a new species from human chylomicrons. Proc Natl Acad Sci USA 1980;77:2465.
.
[11] Talmud PJ, Krul ES, Pessah M, et al. Donor splice mutation generates a lipid-associated apolipoprotein B-27.6 in a patient with homozygous hypobetalipoproteinemia. J Lipid Res 1994;35:468. [12] Graham DL, Knott TJ, Jones TC, Pease RJ, Pullinger CR, Scott J. Carboxyl-terminal truncation of apolipoprotein B results in gradual loss of the ability to form buoyant lipoproteins in cultured human and rat liver cell lines. Biochemistry 1991;30:5616. [13] Patel S, Pessah M, Beucler I, Navarro J, Infante R. Chylomicron retention disease: exclusion of apolipoprotein B gene defects and detection of mRNA editing in an affected family. Atherosclerosis 1994;108:201. [14] Clark JM. Novel non-templated nucleotide addition reactions catalyzed by procaryotic and eucaryotic DNA polymerases. Nucleic Acids Res 1988;16:9677. [15] Krul ES, Parhofer KG, Barrett PH, Wagner RD, Schonfeld G. ApoB-75, a truncation of apolipoprotein B associated with familial hypobetalipoproteinemia: genetic and kinetic studies. J Lipid Res 1992;33:1037. [16] Kyte J, Doolittle RF. A simple method for displaying the hydropathic character of a protein. J Mol Biol 1982;157:105. [17] Blackhart BD, Ludwig EM, Pierotti VR, et al. Structure of the human apolipoprotein B gene. J Biol Chem 1986;261:15364. [18] Linton MF, Farese R Jr., Young SG. Familial hypobetalipoproteinemia (Review). J Lipid Res 1993;34:521. [19] Chan L. RNA editing: exploring one mode with apolipoprotein B mRNA (Review). Bioessays 1993;15:33. [20] Tee MK, Lin D ugaw, Sugawara T, et al. T A transversion 11 bp from a splice acceptor site in the human gene for steroidogenic acute regulatory protein causes congenial lipoid adrenal hyperplasia. Hum Mol Genet 1995;4:2299. [21] Horowitz M, Cepko CL, Sharp PA. Expression of chimeric genes in the early region of SV40. J Mol Appl Genet 1983;2:147. [22] Patel SB, Grundy SM. Interactions between microsomal triglyceride transfer protein and apolipoprotein B within the endoplasmic reticulum in a heterologous expression system. J Biol Chem 1996;271:18686. [23] Leiper JM, Bayliss JD, Pease RJ, Brett DJ, Scott J, Shoulders CC. Microsomal triglyceride transfer protein, the abetalipoproteinemia gene product, mediates the secretion of apolipoprotein B-containing lipoproteins from heterologous cells. J Biol Chem 1994;269:21951. [24] Dixon JL, Ginsberg HN. Regulation of hepatic secretion of apolipoprotein B-containing lipoproteins: information obtained from cultured liver cells. (Review). J Lipid Res 1993;34:167. [25] Spring DJ, Chen-Liu LW, Chatterton JE, Elovson J, Schumaker VN. Lipoprotein assembly. Apolipoprotein B size determines lipoprotein core circumference. J Biol Chem 1992;267:14839. [26] McLeod RS, Zhao Y, Selby SL, Westerlund J, Yao Z. Carboxylterminal truncation impairs lipid recruitment by apolipoprotein B100 but does not affect secretion of the truncated apolipoprotein B-containing lipoproteins. J Biol Chem 1994;269:2852.
.
Activation of a cryptic splice-site in intron 24 leads to the formation of apolipoprotein B-27.6 Attilla Nemeth-Slany a, Phillipa Talmud b, Scott M. Grundy a,c,d, Shailendra B. Patel a,c,* a
Center for Human Nutrition, UT Southwestern Medical Center, Y3.208, 5323 Harry Hines Boule6ard, Dallas, TX 75235 -9052, USA b Di6ision of Cardio6ascular Genetics, Department of Medicine, UCL Medical School, The Rayne Institute, 5, Uni6ersity Street, London WC1E 6JJ, UK c Department of Internal Medicine, UT Southwestern Medical Center, Y3.208, 5323 Harry Hines Boule6ard, Dallas, TX 75235 -9052, USA d Department of Clinical Nutrition, UT Southwestern Medical Center, Y3.208, 5323 Harry Hines Boule6ard, Dallas, TX 75235 -9052, USA Received 3 December 1996; received in revised form 15 February 1997; accepted 9 April 1997
Abstract Apo B expression is confined to the intestine and liver, and its secretion from these tissues is dependent on the expression of a lipid transfer protein, microsomal triglyceride transfer protein (MTP). Previously, we reported a model system for the study of apolipoprotein (apo B) biogenesis using heterologous expression in COS cells (Patel SB, Grundy SM. J. Lipid Res. 1995;36:2090– 2103). We now report the characterization of the effects of a T C transition in the splice-site at + 2 of intron 24 previously reported by Talmud et al. (J. Lipid Res. 1994;35:468–77). Using our heterologous expression system, we show that the mutation led to aberrant processing of intron 24, but normal processing of intron 25. The resultant translation of this mutant mRNA produced a truncated apo B protein of the size of apo B-27.6. Reverse transcription, polymerase chain reaction and sequencing of the amplified products were used to show that a cryptic donor splice-site within intron 24 was utilized, resulting in the generation of a novel hydrophilic 29 amino acid carboxyl-terminal tail. Co-expression of apo B-27.6 with microsomal triglyceride transfer protein (MTP) showed that this protein could bind MTP and resulted in the secretion of a lipoprotein particle with a buoyant density in the range 1.16–1.25 g/ml. These results indicate that this splice-site mutation leads to an activation of a downstream cryptic splice-site within intron 24, causing an insertion of 40 bases of intron 24 sequences into the mature RNA. This leads to a frame-shift of translation resulting in addition of 29 new amino acids at the carboxyl-terminus, before an in-frame stop translation codon is encountered, truncating the apo B at B-27.6. © 1997 Elsevier Science Ireland Ltd. Keywords: Hypobetalipoproteinemia; Splicing; Microsomal triglyceride transfer protein
1. Introduction The biogenesis of apolipoprotein B (apo B) is a complex process [1 – 3]. This large apolipoprotein is synthesized in a constitutive manner in the liver and the intestine. In tissue culture cells, a large proportion of newly synthesized apo B is degraded so that only a
* Corresponding author. Tel.: +1 214 6488734; fax: + 1 214 6484837; e-mail [email protected]
fraction of newly synthesized apo B is secreted. Furthermore, the secretion of apo B is absolutely dependent on the co-expression of another gene product, microsomal triglyceride transfer protein (MTP). In the autosomal recessive condition of abetalipoproteinemia, caused by mutations in the MTP gene, apo B is synthesized but not secreted. Indeed, expression of apo B truncates in cells that do not express MTP leads to their retention in the ER and degradation [4,5]. The factors involved in the biogenesis of apo B-containing lipoproteins are not fully characterized, al-
0021-9150/97/$17.00 © 1997 Elsevier Science Ireland Ltd. All rights reserved. PII S 0 0 2 1 - 9 1 5 0 ( 9 7 ) 0 0 1 0 5 - 6
164
A. Nemeth-Slany et al. / Atherosclerosis 133 (1997) 163–170
though factors such as oleate supplementation [6–8] and the activity of MTP can affect the amount of newly synthesized apo B that is secreted from hepatoma cell lines [9]. To help dissect out the factors involved in the biogenesis of apo B-containing lipoproteins, we have developed a heterologous expression system to study these processes [5]. This model can also be applied to investigate mutations causing familial hypobetalipoproteinemia. Familial hypobetalipoproteinemia is an autosomal dominant disorder caused by mutations in the apo B gene that interfere with proper synthesis. A few of these mutations prevent correct splicing of the mature apo B-100 mRNA (reviewed in [18]). The centile system is used to define the sizes of the apo B; the full length is apo B-100 (550 kDa) [10]. Since the expression of apo B is confined to the intestine and the liver, the effects of mutations affecting splice-sites can only be predicted. To obviate the need for either liver or intestinal tissue from affected individuals, or to perform studies in hepatoma cell lines, we report here an alternative method to facilitate investigation of mutations causing hypobetalipoproteinemia. As an example, we have utilized a recently reported mutation affecting RNA processing and leading to the production of apo B-27.6 [11], which is also the smallest naturally-occurring truncation of apo B that has been shown to be associated with lipids. This mutation is due to a T C transition at position + 2 of intron 24. The authors suggested three possible mechanisms by which the mutation interferes with RNA processing: (a) no splicing occurs for intron 24 so translation proceeds into intronic sequences, (b) a cryptic site within intron 24 is activated resulting in a premature stop translation signal or (c) exon skipping occurs, such that exon 23 is spliced to exon 25, again leading to a frame change and premature translational stop [11]. The predicted translational products in each of these cases resulted in the generation of short carboxyl-terminal tails enriched in hydrophobic amino acids. The authors further speculated that perhaps this feature may be responsible for this particular apo B truncation being associated with lipids, as it was found to have a buoyant density between low and high density lipoproteins. In this paper, we expressed a mini-gene construct bearing the mutated intronic site and a normal downstream intron. Expression of the mutant minigene led to the synthesis, but little secretion of a protein the size of apo B-27.6. In the presence of MTP, this protein was secreted and contained sufficient lipid to form a rudimentary lipoprotein particle. Analysis of the mRNA showed that a cryptic splice-site within intron 24 was utilized, resulting in the addition of a novel 29 amino acid – carboxyl-terminal tail.
2. Methods
2.1. DNA constructs The parent construct bearing apo B 41 cDNA in the expression vector pSV7D has been reported previously [5,12]. Introduction of introns 24 and 25 was performed as follows; a BamHI–XhoI fragment from pSV7D-B-41 was cloned into pBluescript (Stratagene, La Jolla, CA), and partially digested with SacI (to retain the upstream SacI site) and completely with Xhol. Intron 24 from a normal individual or from the homozygous proband, CD [11] was amplified using oligonucleotides described below, digested with SacI and XhoI and cloned into the partially digested pBluescript construct. Colonies were screened for the presence of the inserted intron 24, and the presence of both SacI sites, thus maintaining genetic contiguity. Representative clones were sequenced for confirmation. The BamHI– XhoI fragments bearing the normal or mutated introns were recloned into the BamHI–XhoI site in pSV7D-B-41 construct (pSV7DB-41i24 and pSV7D-B-41i24HMZ respectively). A normal intron 25 was introduced into these clones by amplification of normal genomic DNA across the XhoI–XbaI site, and cloned into the XhoI–XbaI site of the pSV7D-B-41i24 and pSV7D-B-41i24HMZ, resulting in the respective minigene constructs, B-41 and HMZ (Fig. 1). The constructs were sequenced to ensure that no mutations had been introduced by the amplification process. We noted that both the normal and affected clones differed from the GenBank database sequence in the following manner; at position + 11 of intron 24 the database contains a G which is missing from both our normal and homozygous constructs. This finding has been noted previously [11]. We sequenced five independent normal and homozygous clones to verify that this was not a result of PCR generated mutation. The MTP
Fig. 1. Apo B minigene constructs used for expression in COS cells. Introns 24 and 25 were introduced into the apo B-41 minigene as described in Section 2. The construct B-41 contains two normal introns, whereas the construct HMZ contains a normal intron 25, but the T C transition mutation at position + 2 intron 24, indicated by the lollipop symbol. The position of the oligonucleotides A, B and C used for RT-PCR are as shown.
A. Nemeth-Slany et al. / Atherosclerosis 133 (1997) 163–170
expression cDNA construct has been described previously [4].
2.2. Cell culture, transfection and pulse-chase analysis COS cell culture, transfection and pulse-chase analyses were performed as previously described [5]. Briefly, COS cells were transfected with plasmid DNA by electroporation, and analyzed 48 h later. Cells were pulselabeled with a [35S]methionine – cysteine mixture for 10 min and chased for various times as indicated. Cell lysates were prepared and apo B immunoprecipitated and analyzed by SDS-PAGE and quantitated by phosphorimaging (Molecular Dynamics, Sunnyvale, CA). For oleate supplementation experiments, transfected cells were split into two equal portions 48 h after transfection, and one portion incubated with 0.8 mM oleate–dextrin complexes for 30 min prior to pulse-labeling and analyzed as previously described. Since cotransfection is involved, results from one experiment can not be compared statistically to another, due to unknown differences in the relative expression of the apo B or MTP cDNAs after each transfection. However, all experiments were performed at least four times to ensure reproducibility of the pattern of expression.
2.3. Oligonucleotides The numbering of the oligonucleotides is based on the apo B GenBank sequence X04506. All oligonucleotides are located in exonic sequences. The following oligonucleotides were used for amplification of intron 25: forward primer 5%GTCTGTGGGATTCCATCTGCC, position 4099–4120; backward primer 5%GAGCCCATCATGTCATTTGAGAG, position 5339 – 5362 Intron 24 was amplified as previously described [11]. For reverse transcription and PCR, the following oligonucleotides were synthesized: A. Forward primer 5%ACCTCMTAGCCTGAAGGAG position 3888– 3908 B. Backward primer 5%GGGACTTGGMCTCTCGAGATG position 4119 – 4141 C. Backward primer 5%MTCTAGAAATTTGTGGCGT position 4406 – 4416.
2.4. cDNA synthesis, RT-PCR, cloning and sequencing Total RNA was isolated from transfected cells using TriZol (Gibco-BRL, Gaithersberg, MD) treated with DN’ase 1 and cDNA synthesis and PCR was carried out as previously described [13], except that the priming oligonucleotide for cDNA synthesis was C, and PCR was performed with either the A/C or A/B combination. PCR products were analyzed by agarose gel electrophoresis, and the products cloned into pBluescript
165
using the TA cloning method [14]. Positive clones were identified by T-tracking and sequenced by the di-deoxy method of Sanger using the Sequenase II kit (USB, Cleveland, OH). Sequence analysis was performed using the DNA software MacVector (Eastman Kodak, New Haven).
2.5. Cesium chloride density gradient centrifugation Conditioned medium from HMZ and MTP co-transfected cells was cleared of cellular debris, subjected to cesium chloride density gradient centrifugation and fractionated as previously described [5]. Samples were immunoprecipitated directly from the fractions with sheep anti-apo B antiserum (Boehringer Mannheim, Evanston, IN), separated by SDS-PAGE, western blotted and the presence of apo B detected by using the mouse monoclonal antibody C1.4 [15]. This antibody has a binding site in the first 400 amino acids from the N-terminus of apo B.
3. Results
3.1. Expression of splice-site mutation in COS cells Apo B mini-genes bearing normal or mutant splicesites (Fig. 1) were transfected into COS cells and the cells and media were examined for the presence of apo B expression. The cells were radiolabeled for 10 min using [35S]methionine, chased for various time intervals and apo B was immunoprecipitated from the cells or the media (Fig. 2). Expression of the control B-41 construct led to the production of apo B-41 (lanes 1 and 2), but expression of the mutant HMZ construct led to the production of a much smaller protein (lanes 3 and 4, Fig. 2A). No apo B-41 was secreted during a chase period of 2 h, although a very small amount of the truncated apo B-27.6 was detected (i.e. lanes 6 and 8, Fig. 2A). An unknown band ( 80 kDa) also co-precipitated from the cells that were transfected with the HMZ minigene, but not the B-41 minigene (asterisk). In western blotting experiments performed with antiapo B antibody, a major band at the position where apo B-27.6 migrates was noted (Fig. 2B). In addition, faint immunoreactive bands were detected on longer exposure of the Western blot, but did not correspond to the size of the asterisk band. These bands were much lower in abundance and are likely to represent intracellular degradation products. Immunofluorescence staining of COS cells transfected with B-41 or HMZ both showed a predominantly ER staining pattern (data not shown). Furthermore, more than 95% of the intracellular apo B (both apo B-41 and apo B-27.6) remained sensitive to endoglycosidase H digestion (data not shown), supporting the conclusion that heterologously
166
A. Nemeth-Slany et al. / Atherosclerosis 133 (1997) 163–170
Fig. 2. Pulse-chase analysis of apo B from B-41 and HMZ transfected COS cells. COS cells were transfected with B-41 or HMZ, labeled for 10 min and chased for the times indicated below the panel. Apo B was immunoprecipitated and analyzed by SDS-PAGE as described in Section 2 (panel A). Expression of B-41 results in the synthesis of an expected apo B-41 sized protein (tracks 1 and 2, panel A) which was not secreted from the cells during a 2 h chase period (track 6). In contrast, cells transfected with the HMZ construct resulted in the synthesis of a shorter protein (tracks 3 and 4), which was poorly secreted in a 2 h chase (track 8). An unidentified protein, marked by *, co-precipitated from cells transfected with the HMZ construct. To further show that this unidentified band was not a shorter apo B fragment, HMZ transfected cells were lysed, immunoprecipitated with apo B antibodies, Western blotted and probed with a monoclonal anti-apo B, C1.4, specific for the N-terminus (panel B). Whilst B-27.4 was readily detectable, the unidentified band was not observed, suggesting it may be a co-associated endogenous protein (see text for details).
the absence of reverse transcription (lanes 5 and 6). To define the spliced products better, the PCR products from B-41 and HMZ transfected cells were purified, cloned and sequenced. At least twenty independent clones from B-41 and HMZ were analyzed and fully sequenced. A representative analysis for HMZ products is shown in Fig. 4, panel A. For clones derived from the normal B-41 transfected cells, all of these showed a correct use of both splice-sites, eliminating introns 24 and 25 from the mature message. However, for all of the clones derived from HMZ transfected cells, a site at + 40 within intron 24 was used as the donor splice-site. Intron 25 was correctly spliced out in all of the clones examined. This leads to the insertion of 40 bases of intron 24 sequence at the end of exon 24 followed by exon 25 (Fig. 4, panel B), altering the translation frame. Translation of mRNA from this sequence information predicts the addition of 29 new amino acids at the carboxyl-terminal tail (shown in italics, panel A, Fig. 4), before an in-frame stop-translation signal is encountered in exon 25 (not shown). The position of the TC transition at position + 2 of intron 24 is indicated by
expressed apo B is retained and degraded within the ER as previously reported [5].
3.2. Characterization of cryptic splice-site To characterize the RNA processing steps leading to the production of the truncated apo B from the mutant splice-site, RNA was extracted from COS cells transfected with either B-41 or HMZ and RT-PCR was performed. The amplified products were analyzed by agarose gel electrophoresis (Fig. 3). When PCR was performed with oligonucleotides A and B, which amplify across intron 24 (Fig. 1), a product of the expected size (250 bp) was obtained for RNA from B-41 transfected cells (lane 2, Fig. 3), but a slightly larger product (310 bp) was obtained for RNA from HMZ transfected cells (lane 1). When oligonucleotide pair A and C were used, the DNA products were larger, as expected since the amplified fragments include introns 24 and 25 (Fig. 1). However, the PCR products from the HMZ transfected cells remain slightly larger than the control products (lanes 3 and 4, Fig. 3). This would suggest that splicing of intron 25 is normal for both B-41 and HMZ RNAs. Since the splicing of intron 24 leads to a larger product, this suggests that cryptic sites within intron 24 were utilized. No DNA contamination in our RNA preparations was noted by the absence of products in
Fig. 3. RT-PCR analysis of RNA from HMZ and B-41 transfected cells. RNA from cells transfected with HMZ or B-41 was reverse transcribed with oligonucleotide C (tracks 1 – 4) and an aliquot of the cDNA amplified by PCR using oligonucleotides A and B (tracks 1, 2, 5 and 6) or with oligonucleotides A and C (tracks 3 and 4). Tracks 1, 3 and 5 contain RNA from HMZ transfected cells, and tracks 2, 4 and 6 from B-41 transfected cells. Reverse transcription was omitted from samples in tracks 5 and 6 to detect the presence of contaminating genomic DNA. For B-41, an expected product of the size of 250 bp (track 2) and 530 bp (track 4) was obtained. However, for HMZ a slightly larger product was seen (tracks 1 and 3). These products appeared to larger by approximately 60 bp. No genomic contamination was detected when the reverse transcriptase was omitted (tracks 5 and 6).
A. Nemeth-Slany et al. / Atherosclerosis 133 (1997) 163–170
167
Fig. 4. Sequence analysis of cloned RT-PCR products from HMZ transfected cells, and prediction of translated products. PCR products described in Fig. 3 were cloned into pBluescript as described in Section 2. Positive clones were initially screened for the presence of inserts by T-tracking and sequenced. The data for HMZ are shown. A representative clone, sequenced across the aberrant splicing site, is shown. All clones derived from HMZ show an inclusion of intronic sequences (indicated by lower case, panel A). This inclusion leads to the in-frame translation of 29 new amino acids (indicated by the lower line, single alphabet code, italicized) before an in-frame stop translation codon is reached in exon 25 (not shown). The splice-site mutation T C is indicated by *. Panel B shows the effects of normal splicing and that from the cryptic splice-site activation RNA. Under normal circumstances the excision of intron 24 at its correct position leads to maintenance of the frame and allows the full length apo B to be translated. However, the activation of the cryptic splice-site leads to the insertion of some intron 24 sequences which changes the frame. This results in a stop-codon after the addition of 29 new amino acids, truncating apo B at B-27.6.
168
A. Nemeth-Slany et al. / Atherosclerosis 133 (1997) 163–170
Fig. 5. Effect of MTP co-expression on apo B-27.6 secretion kinetics. COS cells were transfected with HMZ in the absence of MTP (——) or the presence of MTP (- - -) and analyzed by pulse-chase as described in Section 2. The data shown is representative of 4 experiments. In the absence of MTP, 7.5% of apo B-27.6 was secreted into the medium at 5 h (), but in the presence of MTP ( ) about 20% was secreted at 5 h. Although intracellular apo B-27.6 appeared to degrade at a more rapid rate in the presence of MTP ( ) compared its absence (), this was not a reproducible finding. Note that even in the presence of MTP, about 50% of apo B-27.6 was degraded intracellularly.
Fig. 6. Effect of oleate supplementation on apo B-27.6 secretion. The effect of oleate supplementation on the secretion of apo B-27.6 was examined in COS cells co-transfected with HMZ and MTP, as described in Section 2. The data shown is representative of 2 separate experiments. The open symbols represent apo B present in the medium and the closed symbols the apo B present within the cells. Oleate supplementation (- - -) had no effect on the amount of apo B-27.6 secreted in 5 h compared to control (——) and neither was the intracellular rate of apo B-27.6 affected.
the asterisk. Kyte-Doolittle analysis [16] of this new peptide shows that it is not particularly hydrophobic in nature (data not shown).
Once a form of hypobetalipoproteinemia has been identified, the size of the truncation is determined by a combination of SDS-PAGE, Coomassie-staining and
4. Discussion
3.3. Truncated Apo B 27.6 can be secreted as a lipoprotein To examine whether apo B-27.6 could be secreted as a lipoprotein particle, HMZ was co-expressed with MTP. We have previously shown that apo B truncations larger than B26 require co-expression with MTP in COS cells for secretion. When apo B-27.6 was expressed in the absence of MTP, pulse-chase analysis showed that only about 59 2% (n = 2) of apo B-27.6 was secreted from COS cells. In the presence of MTP, secretion was increased to about 2695% (n = 2) (Fig. 5). Although in the experiment shown, it would appear that the rate of intracellular degradation of apo B-27.6 is prolonged in the absence of MTP, this was not a consistent finding. Oleate supplementation of the cells co-transfected with MTP and HMZ did not lead to a significant increase in apo B-27.6 secretion (Fig. 6). To examine the buoyant density of apo B-27.6, secreted in the presence of MTP, conditioned medium was subjected to cesium chloride density centrifugation, fractionated and the analyzed for the presence of apo B as described in Section 2. Apo B-27.6 was found to attain a buoyant density between 1.16–1.25 g/ml (Fig. 7).
Fig. 7. Buoyant density of the secreted apo B-27.6. Conditioned medium from COS cells transfected with HMZ and MTP was subjected to CsCI density gradient centrifugation, fractionated and apo B-27.6 immunoprecipitated and detected by Western blotting as described in Section 2. The bottom panel shows the density profile and the top panel the results of Western blotting. The majority of apo B-27.6 (indicated by the arrowhead) is found at a buoyant density of 1.16 – 1.25 g/ml. Although there is a tail of apo B into the lighter fractions, densitometric analysis showed less than 1% of the secreted apo B was present in this range.
A. Nemeth-Slany et al. / Atherosclerosis 133 (1997) 163–170
by Western blotting of the lipoprotein fractions for the presence of a truncated apo B. From these size determinations, the likely area of mutation of the apo B gene can be estimated and these regions are amplified from genomic DNA and sequenced for the presence of the causative mutation. These steps are necessary because the gene for apo B spans over 43 kb and contains 29 exons, one of which is 7572 bp in size [17]. Some of these mutations affect the coding region within the exons, and hence the characterization of the carboxyl-terminal ends of the apo B is greatly simplified. All of this information can be obtained by sampling blood of affected individuals and their family members. In contrast, mutations involving RNA processing, either by affecting splicing, or in one case by a novel RNA polymerase stuttering process, can not be easily characterized (reviewed in [18]). In these cases analysis is complicated because the direct examination of mRNA in affected individuals is not possible; apo B mRNA is expressed in the liver and the intestine, both of these tissues are not as readily available as a sample of blood is. In addition, apo B mRNA in the intestine is subjected to RNA editing [19], and this could also complicate analysis. We report here characterization of a mutation affecting RNA processing [11]. Apo B-27.6 is the smallest known truncation to be associated with lipids in familial hypobetalipoproteinemia cases, and the genetic mutation has been identified as one that disrupts normal splicing involving intron 24. However, the exact RNA processing that could result from such a mutation had not been determined. COS cells have previously been shown to be useful in studying the effects of mutations on splicing [20,21]. Using heterologous expression, when an apo B-41 minigene, bearing either the normal intron or the mutated intron was expressed in COS cells, the presence of the mutated intron led to the production of a truncated apo B the size of apo B-27.6. Analysis of the mRNA from these cells allowed us to determine that a cryptic splice-site was activated within intron 24. This led to the insertion of 40 bases of intron 24 sequences between exons 24 and 25. One consequence of this is that the protein translation frame is shifted, and leads to the addition of 29 new amino acids at the carboxyl-terminal tail, before an in-frame stop translation signal is encountered, terminating the apo B prematurely. Apo B-27.6 is unusual in that it has been shown to form a relatively buoyant lipoprotein [11], in contrast to many other truncated apo Bs of this size range [25,26]. One hypothesis advanced for this behavior is that the novel 29 amino acids added at the carboxyl-terminal tail may be responsible in part for this biological activity [11]. However, this tail is not likely to be responsible for the ability of apo B-27.6 to form lipoproteins; our previous studies have
169
shown that the size of apo B is the major determinant of the ability to form a lipoprotein particle [22]. Apo B truncates larger than apo B-26 are secreted as lipoproteins, whereas truncates shorter than this are secreted with minimal or no lipid [22]. When apo B truncates larger than apo B-26 are expressed in COS cells, these proteins are retained and degraded within the ER [5,23]. Expression of apo B in HeLa cells also resulted in a similar localization [4]. Co-expression of such truncates with MTP allows for secretion and depending upon their size, the secretion rates can be affected by oleate supplementation [4,22,23]. We demonstrate here that coexpression of apo B-27.6 with MTP led to augmentation of secretion, but this secretion was not further increased by oleate supplementation. Oleate supplementation, under normal circumstances, leads to an increase in apo B-100 secretion from cultured hepatocytes [24]. Heterologously expressed apo B truncates also show a size dependent responsiveness to oleate supplementation; secretion of apo Bs smaller than apo B-29 is not augmented by oleate supplementation, but truncations larger than apo B-29 show a progressive response [22]. However, secretion of apo B-27.6 is not increased by oleate supplementation, a feature it has in common with other apo Bs of this size range. Furthermore, the size of apo B is an important factor in determining its buoyant density. Truncated apo Bs expressed in hepatoma cell lines show a linear response between the size of lipoprotein particle (and hence its lipid content) and the size of the apo B truncation, for apo Bs larger than apo B-26 [25,26]. The use of standard molecular biology techniques, together with the ability to co-express MTP and apo B mini-genes by heterologous expression, can thus allow for rapid assessment of mutations whose effects may be complex, such as the splice-site mutation responsible for the production of apo B-27.6 described here. Co-expression with MTP allows for secretion of any truncates larger than apo B-26, hence the ability of such proteins to form lipoproteins and their resultant buoyant densities can also be rapidly established. Such information can be correlated with the study of the lipoproteins from the blood of the probands or affected individuals, thus allowing a more complete characterization.
Acknowledgements We gratefully acknowledge the gifts of monoclonal antibody C1.4 from Dr Gustav Schonfeld, to Dr Reca Infante for supplying the DNA for HMZ originally, to Loyce Rutledge for technical assistance and to Dr
A. Nemeth-Slany et al. / Atherosclerosis 133 (1997) 163–170
170
Helen Hobbs for critical reading of this manuscript. ANS was funded by a scholarship from the Szechenyi Istvan Foundation of Hungary. PJT is supported by the British Heart Foundation (RG 95-007). This work was supported by unrestricted grants from Merck, West Point, PA; Bristol Myers Squibb, New Brunswick, NJ; the Southwestern Medical Foundation, Dallas, TX and the Moss Heart Foundation, Dallas TX and by NIH Grant HL-29252.
References [1] Vance JE, Vance DE. Lipoprotein assembly and secretion by hepatocytes (Review). Ann Rev Nutr 1990;10:337. [2] Gibbons GF. Assembly and secretion of hepatic very-low-density lipoprotein (Review). Biochem J 1990;268:1. [3] Schumaker VN, Phillips ML, Chatterton JE. Apolipoprotein B and low-density lipoprotein structure: implications for biosynthesis of triglyceride-rich lipoproteins (Review). Adv Prot Chem 1994;45:205. [4] Gordon DA, Jamil H, Sharp D, et al. Secretion of apolipoprotein B containing lipoproteins from HeLa cells is dependent on expression of the microsomal triglyceride transfer protein and is regulated by lipid availability. Proc Natl Acad Sci USA 1994;91:7628. [5] Patel SB, Grundy SM. Heterologous expression of apolipoprotein B carboxyl-terminal truncates: a model for the study of lipoprotein biogenesis. J Lipid Res 1995;36:2090. [6] Pullinger CR, North JD, Teng BB, Rifici VA, Ronhild de Brito AE, Scott J. The apolipoprotein B gene is constitutively expressed in HepG2 cells: regulation of secretion by oleic acid, albumin, and insulin, and measurement of the mRNA half-life. J Lipid Res 1989;30:1065. [7] Adeli K, Sinkevitch C. Secretion of apolipoprotein B in serumfree cultures of human hepatoma cell line, HepG2. FEBS Lett 1990;263:345. [8] Dixon JL, Furukawa S, Ginsberg HN. Oleate stimulates secretion of apolipoprotein B-containing lipoproteins from Hep G2 cells by inhibiting early intracellular degradation of apolipoprotein B. J Biol Chem 1991;266:5080. [9] Jamil H, Chu C-H, Chen Y. et al., Microsomal triglyceride transfer protein is limiting in the assembly and secretion of apoB containing lipoproteins in HepG2 and McArdle RH-7777 cell lines (Abstract). Circulation 1995;92:1717. [10] Kane JP, Hardman DA, Paulus HE. Heterogeneity of apolipoprotein B: isolation of a new species from human chylomicrons. Proc Natl Acad Sci USA 1980;77:2465.
.
[11] Talmud PJ, Krul ES, Pessah M, et al. Donor splice mutation generates a lipid-associated apolipoprotein B-27.6 in a patient with homozygous hypobetalipoproteinemia. J Lipid Res 1994;35:468. [12] Graham DL, Knott TJ, Jones TC, Pease RJ, Pullinger CR, Scott J. Carboxyl-terminal truncation of apolipoprotein B results in gradual loss of the ability to form buoyant lipoproteins in cultured human and rat liver cell lines. Biochemistry 1991;30:5616. [13] Patel S, Pessah M, Beucler I, Navarro J, Infante R. Chylomicron retention disease: exclusion of apolipoprotein B gene defects and detection of mRNA editing in an affected family. Atherosclerosis 1994;108:201. [14] Clark JM. Novel non-templated nucleotide addition reactions catalyzed by procaryotic and eucaryotic DNA polymerases. Nucleic Acids Res 1988;16:9677. [15] Krul ES, Parhofer KG, Barrett PH, Wagner RD, Schonfeld G. ApoB-75, a truncation of apolipoprotein B associated with familial hypobetalipoproteinemia: genetic and kinetic studies. J Lipid Res 1992;33:1037. [16] Kyte J, Doolittle RF. A simple method for displaying the hydropathic character of a protein. J Mol Biol 1982;157:105. [17] Blackhart BD, Ludwig EM, Pierotti VR, et al. Structure of the human apolipoprotein B gene. J Biol Chem 1986;261:15364. [18] Linton MF, Farese R Jr., Young SG. Familial hypobetalipoproteinemia (Review). J Lipid Res 1993;34:521. [19] Chan L. RNA editing: exploring one mode with apolipoprotein B mRNA (Review). Bioessays 1993;15:33. [20] Tee MK, Lin D ugaw, Sugawara T, et al. T A transversion 11 bp from a splice acceptor site in the human gene for steroidogenic acute regulatory protein causes congenial lipoid adrenal hyperplasia. Hum Mol Genet 1995;4:2299. [21] Horowitz M, Cepko CL, Sharp PA. Expression of chimeric genes in the early region of SV40. J Mol Appl Genet 1983;2:147. [22] Patel SB, Grundy SM. Interactions between microsomal triglyceride transfer protein and apolipoprotein B within the endoplasmic reticulum in a heterologous expression system. J Biol Chem 1996;271:18686. [23] Leiper JM, Bayliss JD, Pease RJ, Brett DJ, Scott J, Shoulders CC. Microsomal triglyceride transfer protein, the abetalipoproteinemia gene product, mediates the secretion of apolipoprotein B-containing lipoproteins from heterologous cells. J Biol Chem 1994;269:21951. [24] Dixon JL, Ginsberg HN. Regulation of hepatic secretion of apolipoprotein B-containing lipoproteins: information obtained from cultured liver cells. (Review). J Lipid Res 1993;34:167. [25] Spring DJ, Chen-Liu LW, Chatterton JE, Elovson J, Schumaker VN. Lipoprotein assembly. Apolipoprotein B size determines lipoprotein core circumference. J Biol Chem 1992;267:14839. [26] McLeod RS, Zhao Y, Selby SL, Westerlund J, Yao Z. Carboxylterminal truncation impairs lipid recruitment by apolipoprotein B100 but does not affect secretion of the truncated apolipoprotein B-containing lipoproteins. J Biol Chem 1994;269:2852.
.