- Email: [email protected]
Activation of astrocytes in the anterior cingulate cortex contributes to the affective component of pain in an inflammatory pain model
Brain Research Bulletin 87 (2012) 60–66
Contents lists available at SciVerse ScienceDirect
Brain Research Bulletin journal homepage: www.elsevier.com/locate/brainresbull
Research report
Activation of astrocytes in the anterior cingulate cortex contributes to the affective component of pain in an inflammatory pain model Feng-Li Chen a,b , Yu-Lin Dong a , Zhi-Jun Zhang a , De-Li Cao a , Jie Xu a , Jie Hui a , Li Zhu a , Yong-Jing Gao a,∗ a b
Institute of Nautical Medicine, Jiangsu Key Laboratory of Neuroregeneration, Nantong University, 19 Qixiu Road, Nantong 226001, China Central Laboratory, The First People’s Hospital of Huai’an, Huai’an 223300, China
a r t i c l e
i n f o
Article history: Received 20 June 2011 Received in revised form 16 September 2011 Accepted 25 September 2011 Available online 8 October 2011 Keywords: Astrocytes The affective component of pain Mechanical allodynia Complete Freund’s Adjuvant Anterior cingulate cortex
a b s t r a c t The anterior cingulate cortex (ACC) has been implicated as a key structure in the affective component of pain (such as unpleasantness or aversion). Recent evidence suggests that activation of spinal astrocytes contributes to the development and maintenance of the sensory component of pain after peripheral inflammation. However, whether the astrocytes in the ACC contribute to the affective component of pain is unknown. In this study, we demonstrated that intraplantar administration of Complete Freund’s Adjuvant (CFA) in rats induced mechanical allodynia and place escape/avoidance behavior, which reflects the aversion of mechanical nociceptive stimuli. A reverse transcriptase-polymerase chain reaction study showed a significant increase in the mRNA level of GFAP, an astrocytic marker in the bilateral ACC at 3 d and 14 d after CFA-induced peripheral inflammation. Similarly, Western blot also revealed enhanced expression of GFAP protein at 3 d and 14 d after CFA injection. Interestingly, intra-ACC injection of Lalpha-aminoadipate (L-␣-AA), an astroglial toxin, inhibited the escape/avoidance behavior, but did not affect the paw withdrawal threshold at 3 d following CFA injection. All together, our results suggest that the astrocytes activation in the ACC may contribute to the affective component of pain. © 2011 Elsevier Inc. All rights reserved.
1. Introduction Pain is considered to include not only a sensory-discriminative but also a motivational-affective component. Chronic pain affects millions of people in the world. Clinical observations are increasingly indicating that in chronic pain patients, pain-related negative affect (such as unpleasantness, aversion and anxiety) is more disabling than pain itself [5]. The underlying mechanisms of the affective component of pain, however, remain unclear. The anterior cingulate cortex (ACC) is a limbic-system structure that has been shown to play a role in the affective component of pain. Clinically, surgical ablation of the ACC and surrounding cortical tissue decreased pain-related unpleasantness without affecting the patient’s ability to discriminate the intensity or localization of the noxious stimulus [6]. Positron emission tomography (PET) studies revealed that pain-induced unpleasantness activated the ACC [24,26,32]. Animal behavioral studies have demonstrated that a lesion of the ACC decreased formalin-induced place avoidance, which reflects the aversive-like negative affect, but not the nociceptive behavior induced by formalin [8,13]. Additionally, ACC lesion in animals with neuropathic pain selectively reduced pain affect
∗ Corresponding author. Tel.: +86 513 85051799; fax: +86 513 85051796. E-mail addresses: [email protected], [email protected] (Y.-J. Gao). 0361-9230/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.brainresbull.2011.09.022
assessed by the place escape/avoidance paradigm without affecting the paw withdrawal threshold in response to a mechanical stimulus [17]. These data clearly suggest that the ACC is involved in the affective component of pain, but little is known about the cellular mechanisms involved. Glial activation is a common feature of many diseases of the central nervous system (CNS) [27]. In the spinal cord, astrocytes are activated following peripheral inflammation or nerve injury and may manifest as increased expression of astrocytic markers, such as glial fibrillary acidic protein (GFAP) [7,33]. Inhibition of astroglial function in the spinal cord has been shown to attenuate nerve injury- or nerve inflammation-induced mechanical allodynia [10,21,23,36]. Although most studies involving astrocytes and pain focus on the spinal cord dorsal horn, astroglial activation also occurs in supraspinal areas, such as the rostral ventramedial medulla after chronic constriction injury of the rat infra-orbital nerve [10,34] and the forebrain after Complete Freund’s Adjuvant (CFA) injection [25]. Results from our laboratory have recently shown that pain-related aversion increased the expression of GFAP mRNA and protein in the ACC [19], suggesting the possible role of astrocytes in the ACC in pain affect. Peripheral injection of CFA is a chronic inflammatory model characterized by spontaneous pain, heat hyperalgesia and mechanical allodynia. Mechanical allodynia persists much longer than thermal hypersensitivity in animals following CFA injection [9]. In 2000, LaBuda and Fuchs developed a place escape/avoidance
F.-L. Chen et al. / Brain Research Bulletin 87 (2012) 60–66
paradigm (PEAP) to measure the aversion of the mechanical nociceptive stimuli in animals with inflammatory pain [16]. In this study, by using the PEAP, combining with RT-PCR and Western Blot, we investigated the expression of GFAP in the ACC following CFA peripheral injection and the involvement of astroglial activation in the sensory and affective component of pain.
61
at respective temperatures for 30 s, extension at 72 ◦ C for 30 s and a final extension at 72 ◦ C for 10 m. The running cycle was 30, 26, and 35 for GFAP, GAPDH and CD14, respectively. After PCR amplification, 5 l of the PCR products were used for electrophoresis on 1.5% agarose gels and stained with ethidium bromide. Gel images were captured with the Eagle Sight system (Stratagene) and analyzed using Image J software (NIH). 2.6. Western blot
2. Materials and methods 2.1. Animals Male adult Sprague–Dawley rats weighing 200–220 g, obtained from the Experimental Animal Center of Nantong University, were used in this study. The animals were maintained on a 12:12 light–dark cycle at a room temperature of 22 ± 1 ◦ C with free access to food and water. Before experimental manipulations, the animals were habituated to the environment and experimental test. Blinded experiments were performed according to the guidelines of the International Association for the Study of Pain, and were approved by the Animal Care and Use Committee of Jiangsu Province. Peripheral inflammation was induced with CFA (purchased from Sigma. Each mL contains 1 mg of heat-killed and dried Mycobacterium tuberculosis, 0.85 ml paraffin oil and 0.15 ml mannide monooleate) into the plantar surface of the left hind paw under brief anesthesia with Isoflurane. The rats serving as the control group were injected with the same volume of saline to the left hind paws. 2.2. Surgery Rats were anesthetized with sodium pentobarbital (50 mg/kg, i.p.) and were then positioned in a stereotaxic frame with blunt-tipped ear bars. A midline incision was made and burr holes were drilled on each side of the rostral ACC area (AP = 2.7, ML = 0.6 from Bregma). To minimize the injury of the ACC, we did not place the cannula. Instead, a 1-l syringe (Hamilton) was directly lowered into the rostral ACC (DV = 2.5). Ten minutes after lowering the syringe to the target coordinates, a volume of 1 l (Saline or L-␣-aminoadipate, purchased from Sigma) was injected over a period of 30 min. The syringe remained in place for 10 min after each injection to prevent the spread of the agent to the surface of the brain. This procedure was then repeated in the opposite hemisphere. After completion of the experiments, Nissle staining of the ACC sections were conducted to check the location of the syringe insertion. The data from the animals with injection sites outside rostral ACC were excluded. 2.3. Mechanical allodynia testing Animals were habituated to the testing environment daily for at least 2 d before baseline testing. The room temperature and humidity remained stable for all experiments. For testing mechanical sensitivity, animals were put under inverted plastic boxes (11 cm × 13 cm × 24 cm) on an elevated mesh floor and allowed 30 min for habituation before the threshold testing. Mechanical allodynia was tested using von Frey hairs. The paw was pressed with one of a series of von Frey hairs with logarithmically incrementing stiffness (0.6, 1, 1.4, 2, 4, 6, 8, 10, 15, and 26 g) (Stoelting, Kiel, WI), presented perpendicular to the plantar surface (3–4 s for each hair). The 50% withdrawal threshold was determined using Dixon’s up–down method [4].
Rats were euthanatized with an overdose of sodium pentobarbital. The ACC from both sides were quickly removed and homogenized in a SDS sample buffer containing a mixture of proteinase and phosphatase inhibitors (Sigma). Protein samples (25 g) were separated on SDS-PAGE gel and transferred to polyvinylidene difluoride blots. The blots were blocked with 5% milk and incubated overnight at 4 ◦ C with the following primary antibodies: mouse anti-GFAP (1:10000, Millipore) and mouse anti--actin (1:10000, Millipore). These blots were further incubated with HRP-conjugated secondary antibody, developed in ECL solution, and exposed onto Hyperfilm (Amersham Biosciences) for 1–10 m. The intensity of the specific bands was captured and analyzed using Image J software (NIH). 2.7. Immunohistochemistry Animals were deeply anesthetized with sodium pentobarbital and perfused through the ascending aorta with normal saline followed by 4% paraformaldehyde in 0.1 M PB. After the perfusion, the brain was removed and postfixed in the same fixative overnight. Coronal sections (30 m) were cut in a cryostat and processed for immunofluorescence staining. Brain sections were first blocked with 2% goat serum for 1 h at room temperature, then incubated overnight at 4 ◦ C with mouse anti-GFAP primary antibody (1:5000, Millipore), followed by incubating with FITC-conjugated secondary antibody (1:400, Jackson ImmunoResearch) for 1 h at room temperature. The stained brain sections were examined with a Leica fluorescence microscope, and images were captured with a CCD Spot camera. 2.8. Histology As described above, the animals were perfused and the brains were removed and cut. Brain sections were then stained with Cresyl Violet to check the location of the syringe insertion. 2.9. Quantification and statistics For behavioral studies, the data were analyzed with Student’s t-test (place escape/avoidance behavior) or one-way ANOVA followed by a Newman–Keuls test for post hoc analysis (paw withdrawal threshold). For the quantification of RT-PCR and Western Blot, the density of specific bands for GFAP, GAPDH or -actin were measured with imaging analysis software (Image J, NIH). The GFAP level was normalized to loading control (expressed as the ratio of density of GFAP to -actin). The data were analyzed with Student’s t-test (saline vs. CFA). All the data were presented as mean ± SEM, and P < 0.05 was considered statistically significant in all cases.
3. Results 2.4. Place escape/avoidance paradigm (PEAP) testing PEAP testing was conducted as described by Labuda and Fuchs [16]. Briefly, two 30 cm × 30 cm × 30 cm Plexiglas chambers were placed parallel on top of a mesh screen. One chamber with opaque ceiling was painted black as a dark area, whereas the other with transparent ceiling was painted white and as a light area. A square door (10 cm per side) was situated between the two chambers. During behavioral testing, animals were allowed free access to the two chambers for the duration of a 30-min test period. The mechanical stimulus (476 mN) was applied to the inflamed paw when the animal was within the preferred dark area of the test chamber and the non-inflamed paw when the animal was within the non-preferred light area of the test chamber at 15 s intervals. Saline control animals were mechanically stimulated in a manner identical to the experimental group. The mean percentage of time spent in each side of the chamber was calculated for the entire test period. 2.5. RT-PCR Rats were euthanatized with an overdose of sodium pentobarbital. The ACC was rapidly removed and immediately stored in Trizol reagent (Invitrogen). Total RNA was extracted and reverse transcription (RT) was performed. RT was performed at 42 ◦ C for 60 m and 70 ◦ C for 15 m. The cDNA was then amplified by PCR using Taq polymerase in a reaction volume of 50 l. The sequences of GFAP primers are (from 5 to 3 ): GFAP, forward: AGGGACAATCTCACACAGG; reverse: GACTCAACCTTCCTCTCCA (155 bp); GAPDH, forward, ACCACAGTCCATGCCATCAC; reverse: TCCACCACCCTGTTGCTGTA (490 bp); CD14, forward: CTTGTTGCTGTTGCCTTTGA; reverse: CGTGTCCACACGCTTTAGAA (214 bp). Amplification was performed in a thermal cycler (Biometia, Germany) with denaturation at 94 ◦ C for 30 s, annealing
3.1. CFA induces mechanical allodynia and place escape/avoidance First, we tested the paw withdrawal threshold after unilateral injection of 150 l CFA or saline. As shown in Fig. 1A, CFA injection induces a significant decrease of the paw withdrawal thresholds (PWTs) on the ipsilateral paw at 4 h, 12 h, 3 d, and 14 d compared to baseline. Similarly, CFA injection also decreases PWTs on the contralateral paw at 4 h, 12 h, 3 d, and 14 d compared to baseline. But saline injection does not change the PWTs at all time points on either ipsilateral or contralateral paw (Fig. 1A). Pain is thought to involve both sensory/discriminative and affective-motivational components. To separate the two components, we used PEAP, which was developed by Labuda and Fuchs [16], to test the affective component of pain at 3 d after CFA injection. As shown in Fig. 1B, within the 30 min, the saline injected animals spent 14.9 ± 1.7% of the time within the light chamber while the CFA injected animals spent 55.7 ± 5.9% of time within the light chamber. There was a significant difference between the two groups (P < 0.001), suggesting that the animals with inflammatory pain had place escape/avoidance behavior.
62
F.-L. Chen et al. / Brain Research Bulletin 87 (2012) 60–66
Fig. 1. CFA peripheral injection induced bilateral mechanical allodynia and aversion to noxious stimuli. (A) The bilateral mechanical withdrawal threshold was decreased after CFA injection. It started from 4 h and maintained for more than 14 d. Saline injection did not induce obvious mechanical allodynia. (B) Percentage of time within the light side of the test chamber was increased after repeated mechanical stimulation in CFA treated animals. The data were presented as mean ± SEM (n = 5 for each group). *P < 0.05, **P < 0.01; ***P < 0.001 compared to BL (baseline).
3.2. The expression of astrocytic marker, GFAP is increased in the ACC after CFA injection To examine if astrocytes in the ACC are activated in CFA-induced inflammatory pain, we checked GFAP expression in the ACC at different times after CFA or saline injection. As unilateral paw injection of CFA caused bilateral mechanical allodynia, we checked GFAP expression on both ipsilateral and contralateral ACC. As shown in Fig. 2, GFAP mRNA in the contralateral ACC did not change at 4 h after CFA injection, but significantly increased at 3 d and 14 d, with higher expression at 3 d than 14 d. The expression pattern of GFAP mRNA in the ipsilateral ACC is similar to the contralateral side. Saline treatment did not change GFAP expression at any time point. To further check the protein level of GFAP expression, we conducted Western Blot on the samples from the same time points. The results showed a basal expression of GFAP in naïve rats. At 12 h after CFA injection, the GFAP expression did not change in either ipsilateral or contralateral ACC (Fig. 3), but GFAP significantly increased at 3 d and further increased at 14 d. The saline control group did not show any change at 12 h, 3 d, and 14 d (Fig. 3).
3.3. L-alpha-aminoadipate (L-˛-AA) injection into bilateral ACC prevents place escape/avoidance, but not mechanical allodynia in rats with inflammatory pain To investigate whether bilateral astrocytes activation in the ACC is involved in CFA-induced sensory or affective component of pain, we injected L-␣-AA into the bilateral ACC. L-␣-AA is a cytotoxin relatively specific for astrocytes [11,15,29,36]. Thirty minutes after L-␣-AA administration, CFA was injected into the paw. The mechanical allodynia was tested 6 h, 1 d, 3 d after CFA injection. The results showed that L-␣-AA, at doses of 10 nmol and 25 nmol did not change the paw withdrawal threshold compared to ACC-saline injection (P > 0.05, Fig. 4A). Then we conducted place escape/avoidance testing at 3 d after CFA injection to examine the effect of L-␣-AA on affective component of pain. The results showed that before L-␣-AA and CFA injection, the animals did not show place escape/avoidance behavior. The percentage of time that animals spent in the light chamber was about 10%. At day 3, the animals in the CFA/saline group spent significantly more time within the light chamber compared to preinjection (60.0 ± 11.3%, P < 0.01), so did the animals injected with 10 nmol L-␣-AA. However, the animals injected with 25 nmol L␣-AA spent a similar amount of time within the light area before and after injection (9.4 ± 0.8% vs. 10.2 ± 0.8%, P > 0.05). Therefore,
L-␣-AA at the doses of 25 nmol blocked the escape/avoidance behavior at day 3 (P < 0.01, compared to saline control, Fig. 4B). As GFAP mRNA and protein in the ACC was not increased at 4 h or 12 h after CFA injection, to check if astroglial activation is involved in the development of the affective pain, we tested the place escape/avoidance behavior at 12 h after CFA injection. As shown in Fig. 4C, at 12 h after CFA injection, both CFA/saline and CFA/L-␣-AA (25 nmol) groups spent more time in the light chamber than before CFA injection (P < 0.01). But there was no significant difference in the percentage of time that animals spent in the light chamber between saline and L-␣-AA groups (Saline group 66.6 ± 3.9%, CFA group 71.4 ± 2.8%, P > 0.05), suggesting that the early-developed pain affect is independent of astroglial activation. After completion of the behavior test, we conducted Nissl staining of the ACC sections. An example showing the location of syringe insertion is shown in Fig. 5.
3.4. L-˛-AA microinjection reduces GFAP mRNA expression and GFAP-positive astrocytes in the ACC To confirm the specific cytotoxic effect of L-␣-AA on astrocytes, we examined GFAP mRNA expression 1d after L-␣-AA intra-ACC injection. The results showed that L-␣-AA at the dose of 25 nmol significantly decreased GFAP mRNA expression (P < 0.001). But the expression of microglial marker CD14 mRNA in the same tissues was not significantly affected (Fig. 6A and B). In addition, L-␣-AA at the dose of 10 nmol had no significant effect on GFAP mRNA expression in the ACC (data not shown). We further undertook immunofluorescence staining of GFAP at 3 d after CFA injection to check the effect of L-␣-AA on the GFAP protein expression. In agreement with previous studies [15,29,36], L-␣-AA (25 nmol) produced a marked reduction of GFAP-positive astrocytes in the vicinity of the injection site (Fig. 6C and D).
4. Discussion In this study, we have two important findings. First, CFA peripheral injection persistently increased GFAP mRNA and protein expression in the bilateral ACC with the time-course closely correlated with the pain behavior. Second, inhibition of the astroglial function by astroglial toxin, L-␣-AA, decreased the place escape/avoidance behavior, but did not affect the paw withdrawal threshold, suggesting the involvement of astroglial activation in the ACC in the affective component of pain. To our knowledge this is
F.-L. Chen et al. / Brain Research Bulletin 87 (2012) 60–66
63
Fig. 2. CFA increased GFAP mRNA expression in the bilateral ACC. (A) The mRNA expression of GFAP and GAPDH in the ipsilateral and contralateral ACC after CFA or saline injection. (B) Intensity of GFAP mRNA bands (normalized to GAPDH). The data were presented as mean ± SEM (n = 3). **P < 0.01, ***P < 0.001 compared to saline group.
Fig. 3. CFA increased GFAP protein expression in the bilateral ACC. (A) The expression of GFAP and -actin in the bilateral ACC after CFA or saline injection. (B) Intensity of GFAP band (normalized to the band of -actin). The data were presented as mean ± SEM (n = 3). ***P < 0.001 compared to saline group.
64
F.-L. Chen et al. / Brain Research Bulletin 87 (2012) 60–66
Fig. 4. Intra-ACC injection of L-␣-AA did not affect CFA-induced mechanical allodynia, but blocked mechanical stimulation-induced aversion behavior on day 3. (A) Intra-ACC injection of L-␣-AA at doses of 10 and 25 nmol did not change paw withdrawal threshold at 6 h, 1 d, and 3 d after CFA injection. (B) L-␣-AA at the dose of 25 nmol decreased the percentage of time within the light chamber at 3 d after CFA injection. (3) L-␣-AA at the dose of 25 nmol did not affect the percentage of time within the light chamber at 12 h after CFA injection. The data were presented as mean ± SEM (n = 5). ***P < 0.001 compared to saline control. ++ P < 0.01, +++ P < 0.001 compared to pre-test.
the first study that specifically addresses the role of ACC astrocytes in pain affect. Previous experiments utilizing the CFA model have shown that CFA induced marked inflammation and inflammatory pain, which is characterized as heat hyperalgesia and mechanical allodynia [9,25]. Of special note, mechanical allodynia is not only more persistent than heat hyperalgesia, but also spread to the contralateral side [9,21]. Our results confirm that the peripheral injection of CFA results in bilateral mechanical allodynia. In addition, CFA-induced inflammatory pain also caused avoidance of the preferred location when the paradigm was combined with the application of a mechanical stimulus to the hyperalgesic paw, reflecting the affective components in animals with chronic pain [16]. Astrocytes in normal CNS are active and carry out various functions, including supporting and nourishing neurons, and regulating the external chemical environment of neurons. It has been demonstrated that astrocytes can be converted to reactive states and participate in the pathogenesis of neurological disorders after injury or under disease conditions [7,27,33]. In the supraspinal areas, astrocytic markers, GFAP and S100B upregulation were observed in the brain stem and forebrain following CFA peripheral injection [25]. It was found that GFAP and S100B were upregulated at 4 d and 14 d, but not 4 h after CFA in the forebrain [25]. Similarly, our results also showed GFAP mRNA and protein upregulation at 3 d and 14 d following CFA in the ACC bilaterally. In addition, no obvious increase of GFAP was found at 4 h. As in most cases, microglial reaction precedes astrocytic reaction [3,25,31], it is possible that microglia and astrocytes are involved in inflammatory pain in different phases.
L-␣-AA is a cytotoxin relatively specific for astrocytes. Ultrastructural evidence suggests that degeneration is confined to astrocytes after the injection of this toxin into the striatum [11,15,29]. Our results further showed L-␣-AA decreased GFAP mRNA, but not CD14 mRNA expression in the ACC. By using a PEAP model combined with an intra-ACC injection of L-␣-AA, we found that inhibition of astrocytes did not affect pain sensation as tested by the mechanical withdrawal threshold or pain affect as tested by the place-avoidance behavior at early phase (12 h) of the inflammatory pain. But L-␣-AA, blocked pain affect at 3 d after CFA injection without effect on pain sensation. These data indicate that astrocytes activation in the ACC may be involved in affective rather than sensory pain. In addition, astrocytes may play a role in the maintenance rather than the development of the pain affect. It has been demonstrated that the neurons in the ACC are involved in the affective component of pain. Peripheral injection of formalin increased the expression of NMDA receptors (NR2A and NR2B) [18], pERK and pCREB in the ACC neurons [2]. Selectively blocking the function of NR2A, NR2B, or the activation of ERK in the ACC abolished the acquisition of formalin-induced place avoidance, without affecting formalin-induced nociceptive behavior [2,18]. In the CNS, astrocytes outnumber neurons and are closely associated with neurons. It is well accepted that neuron-glial interactions participate in normal brain function and further contribute to neurological disorders including chronic pain [27]. Astrocytes activation may enhance neuronal transmission through the release of a variety of substances (e.g., proinflammatory cytokines, chemokines, ATP, excitatory amino acids, nitric oxide, D-serine, etc.). Proinflammatory cytokines, such as IL-1 and TNF-␣ have been especially implicated as important gliato-neuron signals [7,27,33]. Raghavendra et al. have shown that
Fig. 5. Photomicrograph of Nissl-stained coronal section from the rat that microinjected with L-␣-AA in the bilateral ACC (about Bregma 2.7 mm). Scale bar, 1 mm.
F.-L. Chen et al. / Brain Research Bulletin 87 (2012) 60–66
65
Fig. 6. Intra-ACC injection of L-␣-AA (25 nmol) reduced GFAP expression. (A) The mRNA expression of GFAP, GAPDH, and CD14 after intra-ACC injection of L-␣-AA or vehicle. (B) Intensity of GFAP or CD14 band (normalized to the band of GAPDH). The data were presented as mean ± SEM (n = 4–5). ***P < 0.001 compared to vehicle control. (C) Intra-ACC injection 25 nmol L-␣-AA caused a profound loss of GFAP-positive astroctytes in the vicinity of injection at 3 d after CFA injection. (D) The same volume of vehicle did not decrease the GFAP-positive astrocytes in the injection area at 3 d after CFA injection. Scale bar, 100 m.
CFA increased mRNA expression of IL-1, TNF-␣ and IL-6 in the forebrain [25]. Our previous results showed that formalin peripheral injection or pain-related aversion upregulated the expression of IL-1 and TNF-␣ in the ACC [19]. Electrophysiological studies demonstrated that IL-1 or TNF-␣ increased synaptic transmission in the spinal cord, ACC or hippocampal [1,12,14]. Besides proinflammatory cytokines, D-serine may also be released from astrocytes [30,35] and involved in modulating the function of NMDA receptors through the glycine site [20,22]. Ren et al. demonstrated that degradation of endogenous D-serine with D-amino acid oxidase (DAAO) effectively inhibited NMDA-evoked currents in ACC slices. Preadministration of DAAO into the ACC blocked pain-related aversion in the rat [28]. Taken together, these data suggest that the activated astrocytes in the ACC may be involved in the processing of the affective component of pain through the release of chemical mediators by which neuronal function is modulated. In conclusion, the peripheral injection of CFA increased the mRNA and protein expression of the astrocytic marker GFAP in the bilateral ACC. The inhibition of astroglial function by an astroglial toxin blocked the place-avoidance behavior, but not the paw withdrawal threshold, suggesting the involvement of astrocytes in the ACC in the affective component of pain. Modulating the function of astrocytes in the ACC may provide a new strategy for the prevention of chronic pain-induced emotional disturbance. Acknowledgements The authors wish to thank Mr. Ian Haigler for linguistic revision of the manuscript. This study was supported by the National Natural Science Foundation of China (NSFC) 30500153,
31171062, the Natural Science Research Program of Jiangsu Province 05KJB180100, the Program for New Century Excellent Talents NCET-09-0164, the Natural Science Foundation of Jiangsu Province BK2010273 and a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions. References [1] E.C. Beattie, D. Stellwagen, W. Morishita, J.C. Bresnahan, B.K. Ha, M. Von Zastrow, M.S. Beattie, R.C. Malenka, Control of synaptic strength by glial TNFalpha, Science 295 (2002) 2282–2285. [2] H. Cao, Y.J. Gao, W.H. Ren, T.T. Li, K.Z. Duan, Y.H. Cui, X.H. Cao, Z.Q. Zhao, R.R. Ji, Y.Q. Zhang, Activation of extracellular signal-regulated kinase in the anterior cingulate cortex contributes to the induction and expression of affective pain, J. Neurosci. 29 (2009) 3307–3321. [3] C. Cavaliere, G. Cirillo, M. Rosaria Bianco, F. Rossi, V. De Novellis, S. Maione, M. Papa, Gliosis alters expression and uptake of spinal glial amino acid transporters in a mouse neuropathic pain model, Neuron Glia Biol. 3 (2007) 141–153. [4] S.R. Chaplan, F.W. Bach, J.W. Pogrel, J.M. Chung, T.L. Yaksh, Quantitative assessment of tactile allodynia in the rat paw, J. Neurosci. Methods 53 (1994) 55–63. [5] G. Crombez, J.W. Vlaeyen, P.H. Heuts, R. Lysens, Pain-related fear is more disabling than pain itself: evidence on the role of pain-related fear in chronic back pain disability, Pain 80 (1999) 329–339. [6] E.L. Foltz, L.E. White Jr., Pain “relief” by frontal cingulumotomy, J. Neurosurg. 19 (1962) 89–100. [7] Y.J. Gao, R.R. Ji, Targeting astrocyte signaling for chronic pain, Neurotherapeutics 7 (2010) 482–493. [8] Y.J. Gao, W.H. Ren, Y.Q. Zhang, Z.Q. Zhao, Contributions of the anterior cingulate cortex and amygdala to pain- and fear-conditioned place avoidance in rats, Pain 110 (2004) 343–353. [9] Y.J. Gao, Z.Z. Xu, Y.C. Liu, Y.R. Wen, I. Decosterd, R.R. Ji, The c-Jun N-terminal kinase 1 (JNK1) in spinal astrocytes is required for the maintenance of bilateral mechanical allodynia under a persistent inflammatory pain condition, Pain 148 (2010) 309–319. [10] W. Guo, H. Wang, M. Watanabe, K. Shimizu, S. Zou, S.C. LaGraize, F. Wei, R. Dubner, K. Ren, Glial–cytokine–neuronal interactions underlying the mechanisms of persistent pain, J. Neurosci. 27 (2007) 6006–6018.
66
F.-L. Chen et al. / Brain Research Bulletin 87 (2012) 60–66
[11] S. Huck, F. Grass, H. Hortnagl, The glutamate analogue alpha-aminoadipic acid is taken up by astrocytes before exerting its gliotoxic effect in vitro, J. Neurosci. 4 (1984) 2650–2657. [12] D. Jia, G.D. Gao, Y. Liu, S.M. He, X.N. Zhang, Y.F. Zhang, M.G. Zhao, TNF-alpha involves in altered prefrontal synaptic transmission in mice with persistent inflammatory pain, Neurosci. Lett. 415 (2007) 1–5. [13] J.P. Johansen, H.L. Fields, B.H. Manning, The affective component of pain in rodents: direct evidence for a contribution of the anterior cingulate cortex, Proc. Natl. Acad. Sci. U.S.A. 98 (2001) 8077–8082. [14] Y. Kawasaki, L. Zhang, J.K. Cheng, R.R. Ji, Cytokine mechanisms of central sensitization: distinct and overlapping role of interleukin-1beta, interleukin-6, and tumor necrosis factor-alpha in regulating synaptic and neuronal activity in the superficial spinal cord, J. Neurosci. 28 (2008) 5189–5194. [15] M. Khurgel, A.C. Koo, G.O. Ivy, Selective ablation of astrocytes by intracerebral injections of alpha-aminoadipate, Glia 16 (1996) 351–358. [16] C.J. LaBuda, P.N. Fuchs, A behavioral test paradigm to measure the aversive quality of inflammatory and neuropathic pain in rats, Exp. Neurol. 163 (2000) 490–494. [17] S.C. LaGraize, C.J. Labuda, M.A. Rutledge, R.L. Jackson, P.N. Fuchs, Differential effect of anterior cingulate cortex lesion on mechanical hypersensitivity and escape/avoidance behavior in an animal model of neuropathic pain, Exp. Neurol. 188 (2004) 139–148. [18] T.T. Li, W.H. Ren, X. Xiao, J. Nan, L.Z. Cheng, X.H. Zhang, Z.Q. Zhao, Y.Q. Zhang, NMDA NR2A and NR2B receptors in the rostral anterior cingulate cortex contribute to pain-related aversion in male rats, Pain 146 (2009) 183–193. [19] Y. Lu, L. Zhu, Y.J. Gao, Pain-related aversion induces astrocytic reaction and proinflammatory cytokine expression in the anterior cingulate cortex in rats, Brain Res. Bull. 84 (2011) 178–182. [20] T. Matsui, M. Sekiguchi, A. Hashimoto, U. Tomita, T. Nishikawa, K. Wada, Functional comparison of D-serine and glycine in rodents: the effect on cloned NMDA receptors and the extracellular concentration, J. Neurochem. 65 (1995) 454–458. [21] E.D. Milligan, C. Twining, M. Chacur, J. Biedenkapp, K. O‘Connor, S. Poole, K. Tracey, D. Martin, S.F. Maier, L.R. Watkins, Spinal glia and proinflammatory cytokines mediate mirror-image neuropathic pain in rats, J. Neurosci. 23 (2003) 1026–1040. [22] J.P. Mothet, A.T. Parent, H. Wolosker, R.O. Brady Jr., D.J. Linden, C.D. Ferris, M.A. Rogawski, S.H. Snyder, D-serine is an endogenous ligand for the glycine site of the N-methyl-D-aspartate receptor, Proc. Natl. Acad. Sci. U.S.A. 97 (2000) 4926–4931. [23] A. Okada-Ogawa, I. Suzuki, B.J. Sessle, C.Y. Chiang, M.W. Salter, J.O. Dostrovsky, Y. Tsuboi, M. Kondo, J. Kitagawa, A. Kobayashi, N. Noma, Y. Imamura, K. Iwata, Astroglia in medullary dorsal horn (trigeminal spinal subnucleus caudalis) are involved in trigeminal neuropathic pain mechanisms, J. Neurosci. 29 (2009) 11161–11171.
[24] A. Ploghaus, I. Tracey, J.S. Gati, S. Clare, R.S. Menon, P.M. Matthews, J.N. Rawlins, Dissociating pain from its anticipation in the human brain, Science 284 (1999) 1979–1981. [25] V. Raghavendra, F.Y. Tanga, J.A. DeLeo, Complete, Freunds adjuvant-induced peripheral inflammation evokes glial activation and proinflammatory cytokine expression in the CNS, Eur. J. Neurosci. 20 (2004) 467–473. [26] P. Rainville, B. Carrier, R.K. Hofbauer, M.C. Bushnell, G.H. Duncan, Dissociation of sensory and affective dimensions of pain using hypnotic modulation, Pain 82 (1999) 159–171. [27] K. Ren, R. Dubner, Neuron-glia crosstalk gets serious: role in pain hypersensitivity, Curr. Opin. Anaesthesiol. 21 (2008) 570–579. [28] W.H. Ren, J.D. Guo, H. Cao, H. Wang, P.F. Wang, H. Sha, R.R. Ji, Z.Q. Zhao, Y.Q. Zhang, Is endogenous D-serine in the rostral anterior cingulate cortex necessary for pain-related negative affect? J. Neurochem. 96 (2006) 1636–1647. [29] M.J. Rodriguez, M. Martinez-Sanchez, F. Bernal, N. Mahy, Heterogeneity between hippocampal and septal astroglia as a contributing factor to differential in vivo AMPA excitotoxicity, J. Neurosci. Res. 77 (2004) 344–353. [30] M.J. Schell, M.E. Molliver, S.H. Snyder, D-serine, an endogenous synaptic modulator: localization to astrocytes and glutamate-stimulated release, Proc. Natl. Acad. Sci. U.S.A. 92 (1995) 3948–3952. [31] F.Y. Tanga, V. Raghavendra, J.A. DeLeo, Quantitative real-time RT-PCR assessment of spinal microglial and astrocytic activation markers in a rat model of neuropathic pain, Neurochem. Int. 45 (2004) 397–407. [32] T.R. Tolle, T. Kaufmann, T. Siessmeier, S. Lautenbacher, A. Berthele, F. Munz, W. Zieglgansberger, F. Willoch, M. Schwaiger, B. Conrad, P. Bartenstein, Regionspecific encoding of sensory and affective components of pain in the human brain: a positron emission tomography correlation analysis, Ann. Neurol. 45 (1999) 40–47. [33] L.R. Watkins, M.R. Hutchinson, A. Ledeboer, J. Wieseler-Frank, E.D. Milligan, S.F. Maier, Norman Cousins Lecture. Glia as the “bad guys”: implications for improving clinical pain control and the clinical utility of opioids, Brain Behav. Immun. 21 (2007) 131–146. [34] F. Wei, W. Guo, S. Zou, K. Ren, R. Dubner, Supraspinal glial–neuronal interactions contribute to descending pain facilitation, J. Neurosci. 28 (2008) 10482–10495. [35] Y. Yang, W. Ge, Y. Chen, Z. Zhang, W. Shen, C. Wu, M. Poo, S. Duan, Contribution of astrocytes to hippocampal long-term potentiation through release of D-serine, Proc. Natl. Acad. Sci. U.S.A. 100 (2003) 15194–15199. [36] Z.Y. Zhuang, Y.R. Wen, D.R. Zhang, T. Borsello, C. Bonny, G.R. Strichartz, I. Decosterd, R.R. Ji, A peptide c-Jun N-terminal kinase (JNK) inhibitor blocks mechanical allodynia after spinal nerve ligation: respective roles of JNK activation in primary sensory neurons and spinal astrocytes for neuropathic pain development and maintenance, J. Neurosci. 26 (2006) 3551–3560.
Contents lists available at SciVerse ScienceDirect
Brain Research Bulletin journal homepage: www.elsevier.com/locate/brainresbull
Research report
Activation of astrocytes in the anterior cingulate cortex contributes to the affective component of pain in an inflammatory pain model Feng-Li Chen a,b , Yu-Lin Dong a , Zhi-Jun Zhang a , De-Li Cao a , Jie Xu a , Jie Hui a , Li Zhu a , Yong-Jing Gao a,∗ a b
Institute of Nautical Medicine, Jiangsu Key Laboratory of Neuroregeneration, Nantong University, 19 Qixiu Road, Nantong 226001, China Central Laboratory, The First People’s Hospital of Huai’an, Huai’an 223300, China
a r t i c l e
i n f o
Article history: Received 20 June 2011 Received in revised form 16 September 2011 Accepted 25 September 2011 Available online 8 October 2011 Keywords: Astrocytes The affective component of pain Mechanical allodynia Complete Freund’s Adjuvant Anterior cingulate cortex
a b s t r a c t The anterior cingulate cortex (ACC) has been implicated as a key structure in the affective component of pain (such as unpleasantness or aversion). Recent evidence suggests that activation of spinal astrocytes contributes to the development and maintenance of the sensory component of pain after peripheral inflammation. However, whether the astrocytes in the ACC contribute to the affective component of pain is unknown. In this study, we demonstrated that intraplantar administration of Complete Freund’s Adjuvant (CFA) in rats induced mechanical allodynia and place escape/avoidance behavior, which reflects the aversion of mechanical nociceptive stimuli. A reverse transcriptase-polymerase chain reaction study showed a significant increase in the mRNA level of GFAP, an astrocytic marker in the bilateral ACC at 3 d and 14 d after CFA-induced peripheral inflammation. Similarly, Western blot also revealed enhanced expression of GFAP protein at 3 d and 14 d after CFA injection. Interestingly, intra-ACC injection of Lalpha-aminoadipate (L-␣-AA), an astroglial toxin, inhibited the escape/avoidance behavior, but did not affect the paw withdrawal threshold at 3 d following CFA injection. All together, our results suggest that the astrocytes activation in the ACC may contribute to the affective component of pain. © 2011 Elsevier Inc. All rights reserved.
1. Introduction Pain is considered to include not only a sensory-discriminative but also a motivational-affective component. Chronic pain affects millions of people in the world. Clinical observations are increasingly indicating that in chronic pain patients, pain-related negative affect (such as unpleasantness, aversion and anxiety) is more disabling than pain itself [5]. The underlying mechanisms of the affective component of pain, however, remain unclear. The anterior cingulate cortex (ACC) is a limbic-system structure that has been shown to play a role in the affective component of pain. Clinically, surgical ablation of the ACC and surrounding cortical tissue decreased pain-related unpleasantness without affecting the patient’s ability to discriminate the intensity or localization of the noxious stimulus [6]. Positron emission tomography (PET) studies revealed that pain-induced unpleasantness activated the ACC [24,26,32]. Animal behavioral studies have demonstrated that a lesion of the ACC decreased formalin-induced place avoidance, which reflects the aversive-like negative affect, but not the nociceptive behavior induced by formalin [8,13]. Additionally, ACC lesion in animals with neuropathic pain selectively reduced pain affect
∗ Corresponding author. Tel.: +86 513 85051799; fax: +86 513 85051796. E-mail addresses: [email protected], [email protected] (Y.-J. Gao). 0361-9230/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.brainresbull.2011.09.022
assessed by the place escape/avoidance paradigm without affecting the paw withdrawal threshold in response to a mechanical stimulus [17]. These data clearly suggest that the ACC is involved in the affective component of pain, but little is known about the cellular mechanisms involved. Glial activation is a common feature of many diseases of the central nervous system (CNS) [27]. In the spinal cord, astrocytes are activated following peripheral inflammation or nerve injury and may manifest as increased expression of astrocytic markers, such as glial fibrillary acidic protein (GFAP) [7,33]. Inhibition of astroglial function in the spinal cord has been shown to attenuate nerve injury- or nerve inflammation-induced mechanical allodynia [10,21,23,36]. Although most studies involving astrocytes and pain focus on the spinal cord dorsal horn, astroglial activation also occurs in supraspinal areas, such as the rostral ventramedial medulla after chronic constriction injury of the rat infra-orbital nerve [10,34] and the forebrain after Complete Freund’s Adjuvant (CFA) injection [25]. Results from our laboratory have recently shown that pain-related aversion increased the expression of GFAP mRNA and protein in the ACC [19], suggesting the possible role of astrocytes in the ACC in pain affect. Peripheral injection of CFA is a chronic inflammatory model characterized by spontaneous pain, heat hyperalgesia and mechanical allodynia. Mechanical allodynia persists much longer than thermal hypersensitivity in animals following CFA injection [9]. In 2000, LaBuda and Fuchs developed a place escape/avoidance
F.-L. Chen et al. / Brain Research Bulletin 87 (2012) 60–66
paradigm (PEAP) to measure the aversion of the mechanical nociceptive stimuli in animals with inflammatory pain [16]. In this study, by using the PEAP, combining with RT-PCR and Western Blot, we investigated the expression of GFAP in the ACC following CFA peripheral injection and the involvement of astroglial activation in the sensory and affective component of pain.
61
at respective temperatures for 30 s, extension at 72 ◦ C for 30 s and a final extension at 72 ◦ C for 10 m. The running cycle was 30, 26, and 35 for GFAP, GAPDH and CD14, respectively. After PCR amplification, 5 l of the PCR products were used for electrophoresis on 1.5% agarose gels and stained with ethidium bromide. Gel images were captured with the Eagle Sight system (Stratagene) and analyzed using Image J software (NIH). 2.6. Western blot
2. Materials and methods 2.1. Animals Male adult Sprague–Dawley rats weighing 200–220 g, obtained from the Experimental Animal Center of Nantong University, were used in this study. The animals were maintained on a 12:12 light–dark cycle at a room temperature of 22 ± 1 ◦ C with free access to food and water. Before experimental manipulations, the animals were habituated to the environment and experimental test. Blinded experiments were performed according to the guidelines of the International Association for the Study of Pain, and were approved by the Animal Care and Use Committee of Jiangsu Province. Peripheral inflammation was induced with CFA (purchased from Sigma. Each mL contains 1 mg of heat-killed and dried Mycobacterium tuberculosis, 0.85 ml paraffin oil and 0.15 ml mannide monooleate) into the plantar surface of the left hind paw under brief anesthesia with Isoflurane. The rats serving as the control group were injected with the same volume of saline to the left hind paws. 2.2. Surgery Rats were anesthetized with sodium pentobarbital (50 mg/kg, i.p.) and were then positioned in a stereotaxic frame with blunt-tipped ear bars. A midline incision was made and burr holes were drilled on each side of the rostral ACC area (AP = 2.7, ML = 0.6 from Bregma). To minimize the injury of the ACC, we did not place the cannula. Instead, a 1-l syringe (Hamilton) was directly lowered into the rostral ACC (DV = 2.5). Ten minutes after lowering the syringe to the target coordinates, a volume of 1 l (Saline or L-␣-aminoadipate, purchased from Sigma) was injected over a period of 30 min. The syringe remained in place for 10 min after each injection to prevent the spread of the agent to the surface of the brain. This procedure was then repeated in the opposite hemisphere. After completion of the experiments, Nissle staining of the ACC sections were conducted to check the location of the syringe insertion. The data from the animals with injection sites outside rostral ACC were excluded. 2.3. Mechanical allodynia testing Animals were habituated to the testing environment daily for at least 2 d before baseline testing. The room temperature and humidity remained stable for all experiments. For testing mechanical sensitivity, animals were put under inverted plastic boxes (11 cm × 13 cm × 24 cm) on an elevated mesh floor and allowed 30 min for habituation before the threshold testing. Mechanical allodynia was tested using von Frey hairs. The paw was pressed with one of a series of von Frey hairs with logarithmically incrementing stiffness (0.6, 1, 1.4, 2, 4, 6, 8, 10, 15, and 26 g) (Stoelting, Kiel, WI), presented perpendicular to the plantar surface (3–4 s for each hair). The 50% withdrawal threshold was determined using Dixon’s up–down method [4].
Rats were euthanatized with an overdose of sodium pentobarbital. The ACC from both sides were quickly removed and homogenized in a SDS sample buffer containing a mixture of proteinase and phosphatase inhibitors (Sigma). Protein samples (25 g) were separated on SDS-PAGE gel and transferred to polyvinylidene difluoride blots. The blots were blocked with 5% milk and incubated overnight at 4 ◦ C with the following primary antibodies: mouse anti-GFAP (1:10000, Millipore) and mouse anti--actin (1:10000, Millipore). These blots were further incubated with HRP-conjugated secondary antibody, developed in ECL solution, and exposed onto Hyperfilm (Amersham Biosciences) for 1–10 m. The intensity of the specific bands was captured and analyzed using Image J software (NIH). 2.7. Immunohistochemistry Animals were deeply anesthetized with sodium pentobarbital and perfused through the ascending aorta with normal saline followed by 4% paraformaldehyde in 0.1 M PB. After the perfusion, the brain was removed and postfixed in the same fixative overnight. Coronal sections (30 m) were cut in a cryostat and processed for immunofluorescence staining. Brain sections were first blocked with 2% goat serum for 1 h at room temperature, then incubated overnight at 4 ◦ C with mouse anti-GFAP primary antibody (1:5000, Millipore), followed by incubating with FITC-conjugated secondary antibody (1:400, Jackson ImmunoResearch) for 1 h at room temperature. The stained brain sections were examined with a Leica fluorescence microscope, and images were captured with a CCD Spot camera. 2.8. Histology As described above, the animals were perfused and the brains were removed and cut. Brain sections were then stained with Cresyl Violet to check the location of the syringe insertion. 2.9. Quantification and statistics For behavioral studies, the data were analyzed with Student’s t-test (place escape/avoidance behavior) or one-way ANOVA followed by a Newman–Keuls test for post hoc analysis (paw withdrawal threshold). For the quantification of RT-PCR and Western Blot, the density of specific bands for GFAP, GAPDH or -actin were measured with imaging analysis software (Image J, NIH). The GFAP level was normalized to loading control (expressed as the ratio of density of GFAP to -actin). The data were analyzed with Student’s t-test (saline vs. CFA). All the data were presented as mean ± SEM, and P < 0.05 was considered statistically significant in all cases.
3. Results 2.4. Place escape/avoidance paradigm (PEAP) testing PEAP testing was conducted as described by Labuda and Fuchs [16]. Briefly, two 30 cm × 30 cm × 30 cm Plexiglas chambers were placed parallel on top of a mesh screen. One chamber with opaque ceiling was painted black as a dark area, whereas the other with transparent ceiling was painted white and as a light area. A square door (10 cm per side) was situated between the two chambers. During behavioral testing, animals were allowed free access to the two chambers for the duration of a 30-min test period. The mechanical stimulus (476 mN) was applied to the inflamed paw when the animal was within the preferred dark area of the test chamber and the non-inflamed paw when the animal was within the non-preferred light area of the test chamber at 15 s intervals. Saline control animals were mechanically stimulated in a manner identical to the experimental group. The mean percentage of time spent in each side of the chamber was calculated for the entire test period. 2.5. RT-PCR Rats were euthanatized with an overdose of sodium pentobarbital. The ACC was rapidly removed and immediately stored in Trizol reagent (Invitrogen). Total RNA was extracted and reverse transcription (RT) was performed. RT was performed at 42 ◦ C for 60 m and 70 ◦ C for 15 m. The cDNA was then amplified by PCR using Taq polymerase in a reaction volume of 50 l. The sequences of GFAP primers are (from 5 to 3 ): GFAP, forward: AGGGACAATCTCACACAGG; reverse: GACTCAACCTTCCTCTCCA (155 bp); GAPDH, forward, ACCACAGTCCATGCCATCAC; reverse: TCCACCACCCTGTTGCTGTA (490 bp); CD14, forward: CTTGTTGCTGTTGCCTTTGA; reverse: CGTGTCCACACGCTTTAGAA (214 bp). Amplification was performed in a thermal cycler (Biometia, Germany) with denaturation at 94 ◦ C for 30 s, annealing
3.1. CFA induces mechanical allodynia and place escape/avoidance First, we tested the paw withdrawal threshold after unilateral injection of 150 l CFA or saline. As shown in Fig. 1A, CFA injection induces a significant decrease of the paw withdrawal thresholds (PWTs) on the ipsilateral paw at 4 h, 12 h, 3 d, and 14 d compared to baseline. Similarly, CFA injection also decreases PWTs on the contralateral paw at 4 h, 12 h, 3 d, and 14 d compared to baseline. But saline injection does not change the PWTs at all time points on either ipsilateral or contralateral paw (Fig. 1A). Pain is thought to involve both sensory/discriminative and affective-motivational components. To separate the two components, we used PEAP, which was developed by Labuda and Fuchs [16], to test the affective component of pain at 3 d after CFA injection. As shown in Fig. 1B, within the 30 min, the saline injected animals spent 14.9 ± 1.7% of the time within the light chamber while the CFA injected animals spent 55.7 ± 5.9% of time within the light chamber. There was a significant difference between the two groups (P < 0.001), suggesting that the animals with inflammatory pain had place escape/avoidance behavior.
62
F.-L. Chen et al. / Brain Research Bulletin 87 (2012) 60–66
Fig. 1. CFA peripheral injection induced bilateral mechanical allodynia and aversion to noxious stimuli. (A) The bilateral mechanical withdrawal threshold was decreased after CFA injection. It started from 4 h and maintained for more than 14 d. Saline injection did not induce obvious mechanical allodynia. (B) Percentage of time within the light side of the test chamber was increased after repeated mechanical stimulation in CFA treated animals. The data were presented as mean ± SEM (n = 5 for each group). *P < 0.05, **P < 0.01; ***P < 0.001 compared to BL (baseline).
3.2. The expression of astrocytic marker, GFAP is increased in the ACC after CFA injection To examine if astrocytes in the ACC are activated in CFA-induced inflammatory pain, we checked GFAP expression in the ACC at different times after CFA or saline injection. As unilateral paw injection of CFA caused bilateral mechanical allodynia, we checked GFAP expression on both ipsilateral and contralateral ACC. As shown in Fig. 2, GFAP mRNA in the contralateral ACC did not change at 4 h after CFA injection, but significantly increased at 3 d and 14 d, with higher expression at 3 d than 14 d. The expression pattern of GFAP mRNA in the ipsilateral ACC is similar to the contralateral side. Saline treatment did not change GFAP expression at any time point. To further check the protein level of GFAP expression, we conducted Western Blot on the samples from the same time points. The results showed a basal expression of GFAP in naïve rats. At 12 h after CFA injection, the GFAP expression did not change in either ipsilateral or contralateral ACC (Fig. 3), but GFAP significantly increased at 3 d and further increased at 14 d. The saline control group did not show any change at 12 h, 3 d, and 14 d (Fig. 3).
3.3. L-alpha-aminoadipate (L-˛-AA) injection into bilateral ACC prevents place escape/avoidance, but not mechanical allodynia in rats with inflammatory pain To investigate whether bilateral astrocytes activation in the ACC is involved in CFA-induced sensory or affective component of pain, we injected L-␣-AA into the bilateral ACC. L-␣-AA is a cytotoxin relatively specific for astrocytes [11,15,29,36]. Thirty minutes after L-␣-AA administration, CFA was injected into the paw. The mechanical allodynia was tested 6 h, 1 d, 3 d after CFA injection. The results showed that L-␣-AA, at doses of 10 nmol and 25 nmol did not change the paw withdrawal threshold compared to ACC-saline injection (P > 0.05, Fig. 4A). Then we conducted place escape/avoidance testing at 3 d after CFA injection to examine the effect of L-␣-AA on affective component of pain. The results showed that before L-␣-AA and CFA injection, the animals did not show place escape/avoidance behavior. The percentage of time that animals spent in the light chamber was about 10%. At day 3, the animals in the CFA/saline group spent significantly more time within the light chamber compared to preinjection (60.0 ± 11.3%, P < 0.01), so did the animals injected with 10 nmol L-␣-AA. However, the animals injected with 25 nmol L␣-AA spent a similar amount of time within the light area before and after injection (9.4 ± 0.8% vs. 10.2 ± 0.8%, P > 0.05). Therefore,
L-␣-AA at the doses of 25 nmol blocked the escape/avoidance behavior at day 3 (P < 0.01, compared to saline control, Fig. 4B). As GFAP mRNA and protein in the ACC was not increased at 4 h or 12 h after CFA injection, to check if astroglial activation is involved in the development of the affective pain, we tested the place escape/avoidance behavior at 12 h after CFA injection. As shown in Fig. 4C, at 12 h after CFA injection, both CFA/saline and CFA/L-␣-AA (25 nmol) groups spent more time in the light chamber than before CFA injection (P < 0.01). But there was no significant difference in the percentage of time that animals spent in the light chamber between saline and L-␣-AA groups (Saline group 66.6 ± 3.9%, CFA group 71.4 ± 2.8%, P > 0.05), suggesting that the early-developed pain affect is independent of astroglial activation. After completion of the behavior test, we conducted Nissl staining of the ACC sections. An example showing the location of syringe insertion is shown in Fig. 5.
3.4. L-˛-AA microinjection reduces GFAP mRNA expression and GFAP-positive astrocytes in the ACC To confirm the specific cytotoxic effect of L-␣-AA on astrocytes, we examined GFAP mRNA expression 1d after L-␣-AA intra-ACC injection. The results showed that L-␣-AA at the dose of 25 nmol significantly decreased GFAP mRNA expression (P < 0.001). But the expression of microglial marker CD14 mRNA in the same tissues was not significantly affected (Fig. 6A and B). In addition, L-␣-AA at the dose of 10 nmol had no significant effect on GFAP mRNA expression in the ACC (data not shown). We further undertook immunofluorescence staining of GFAP at 3 d after CFA injection to check the effect of L-␣-AA on the GFAP protein expression. In agreement with previous studies [15,29,36], L-␣-AA (25 nmol) produced a marked reduction of GFAP-positive astrocytes in the vicinity of the injection site (Fig. 6C and D).
4. Discussion In this study, we have two important findings. First, CFA peripheral injection persistently increased GFAP mRNA and protein expression in the bilateral ACC with the time-course closely correlated with the pain behavior. Second, inhibition of the astroglial function by astroglial toxin, L-␣-AA, decreased the place escape/avoidance behavior, but did not affect the paw withdrawal threshold, suggesting the involvement of astroglial activation in the ACC in the affective component of pain. To our knowledge this is
F.-L. Chen et al. / Brain Research Bulletin 87 (2012) 60–66
63
Fig. 2. CFA increased GFAP mRNA expression in the bilateral ACC. (A) The mRNA expression of GFAP and GAPDH in the ipsilateral and contralateral ACC after CFA or saline injection. (B) Intensity of GFAP mRNA bands (normalized to GAPDH). The data were presented as mean ± SEM (n = 3). **P < 0.01, ***P < 0.001 compared to saline group.
Fig. 3. CFA increased GFAP protein expression in the bilateral ACC. (A) The expression of GFAP and -actin in the bilateral ACC after CFA or saline injection. (B) Intensity of GFAP band (normalized to the band of -actin). The data were presented as mean ± SEM (n = 3). ***P < 0.001 compared to saline group.
64
F.-L. Chen et al. / Brain Research Bulletin 87 (2012) 60–66
Fig. 4. Intra-ACC injection of L-␣-AA did not affect CFA-induced mechanical allodynia, but blocked mechanical stimulation-induced aversion behavior on day 3. (A) Intra-ACC injection of L-␣-AA at doses of 10 and 25 nmol did not change paw withdrawal threshold at 6 h, 1 d, and 3 d after CFA injection. (B) L-␣-AA at the dose of 25 nmol decreased the percentage of time within the light chamber at 3 d after CFA injection. (3) L-␣-AA at the dose of 25 nmol did not affect the percentage of time within the light chamber at 12 h after CFA injection. The data were presented as mean ± SEM (n = 5). ***P < 0.001 compared to saline control. ++ P < 0.01, +++ P < 0.001 compared to pre-test.
the first study that specifically addresses the role of ACC astrocytes in pain affect. Previous experiments utilizing the CFA model have shown that CFA induced marked inflammation and inflammatory pain, which is characterized as heat hyperalgesia and mechanical allodynia [9,25]. Of special note, mechanical allodynia is not only more persistent than heat hyperalgesia, but also spread to the contralateral side [9,21]. Our results confirm that the peripheral injection of CFA results in bilateral mechanical allodynia. In addition, CFA-induced inflammatory pain also caused avoidance of the preferred location when the paradigm was combined with the application of a mechanical stimulus to the hyperalgesic paw, reflecting the affective components in animals with chronic pain [16]. Astrocytes in normal CNS are active and carry out various functions, including supporting and nourishing neurons, and regulating the external chemical environment of neurons. It has been demonstrated that astrocytes can be converted to reactive states and participate in the pathogenesis of neurological disorders after injury or under disease conditions [7,27,33]. In the supraspinal areas, astrocytic markers, GFAP and S100B upregulation were observed in the brain stem and forebrain following CFA peripheral injection [25]. It was found that GFAP and S100B were upregulated at 4 d and 14 d, but not 4 h after CFA in the forebrain [25]. Similarly, our results also showed GFAP mRNA and protein upregulation at 3 d and 14 d following CFA in the ACC bilaterally. In addition, no obvious increase of GFAP was found at 4 h. As in most cases, microglial reaction precedes astrocytic reaction [3,25,31], it is possible that microglia and astrocytes are involved in inflammatory pain in different phases.
L-␣-AA is a cytotoxin relatively specific for astrocytes. Ultrastructural evidence suggests that degeneration is confined to astrocytes after the injection of this toxin into the striatum [11,15,29]. Our results further showed L-␣-AA decreased GFAP mRNA, but not CD14 mRNA expression in the ACC. By using a PEAP model combined with an intra-ACC injection of L-␣-AA, we found that inhibition of astrocytes did not affect pain sensation as tested by the mechanical withdrawal threshold or pain affect as tested by the place-avoidance behavior at early phase (12 h) of the inflammatory pain. But L-␣-AA, blocked pain affect at 3 d after CFA injection without effect on pain sensation. These data indicate that astrocytes activation in the ACC may be involved in affective rather than sensory pain. In addition, astrocytes may play a role in the maintenance rather than the development of the pain affect. It has been demonstrated that the neurons in the ACC are involved in the affective component of pain. Peripheral injection of formalin increased the expression of NMDA receptors (NR2A and NR2B) [18], pERK and pCREB in the ACC neurons [2]. Selectively blocking the function of NR2A, NR2B, or the activation of ERK in the ACC abolished the acquisition of formalin-induced place avoidance, without affecting formalin-induced nociceptive behavior [2,18]. In the CNS, astrocytes outnumber neurons and are closely associated with neurons. It is well accepted that neuron-glial interactions participate in normal brain function and further contribute to neurological disorders including chronic pain [27]. Astrocytes activation may enhance neuronal transmission through the release of a variety of substances (e.g., proinflammatory cytokines, chemokines, ATP, excitatory amino acids, nitric oxide, D-serine, etc.). Proinflammatory cytokines, such as IL-1 and TNF-␣ have been especially implicated as important gliato-neuron signals [7,27,33]. Raghavendra et al. have shown that
Fig. 5. Photomicrograph of Nissl-stained coronal section from the rat that microinjected with L-␣-AA in the bilateral ACC (about Bregma 2.7 mm). Scale bar, 1 mm.
F.-L. Chen et al. / Brain Research Bulletin 87 (2012) 60–66
65
Fig. 6. Intra-ACC injection of L-␣-AA (25 nmol) reduced GFAP expression. (A) The mRNA expression of GFAP, GAPDH, and CD14 after intra-ACC injection of L-␣-AA or vehicle. (B) Intensity of GFAP or CD14 band (normalized to the band of GAPDH). The data were presented as mean ± SEM (n = 4–5). ***P < 0.001 compared to vehicle control. (C) Intra-ACC injection 25 nmol L-␣-AA caused a profound loss of GFAP-positive astroctytes in the vicinity of injection at 3 d after CFA injection. (D) The same volume of vehicle did not decrease the GFAP-positive astrocytes in the injection area at 3 d after CFA injection. Scale bar, 100 m.
CFA increased mRNA expression of IL-1, TNF-␣ and IL-6 in the forebrain [25]. Our previous results showed that formalin peripheral injection or pain-related aversion upregulated the expression of IL-1 and TNF-␣ in the ACC [19]. Electrophysiological studies demonstrated that IL-1 or TNF-␣ increased synaptic transmission in the spinal cord, ACC or hippocampal [1,12,14]. Besides proinflammatory cytokines, D-serine may also be released from astrocytes [30,35] and involved in modulating the function of NMDA receptors through the glycine site [20,22]. Ren et al. demonstrated that degradation of endogenous D-serine with D-amino acid oxidase (DAAO) effectively inhibited NMDA-evoked currents in ACC slices. Preadministration of DAAO into the ACC blocked pain-related aversion in the rat [28]. Taken together, these data suggest that the activated astrocytes in the ACC may be involved in the processing of the affective component of pain through the release of chemical mediators by which neuronal function is modulated. In conclusion, the peripheral injection of CFA increased the mRNA and protein expression of the astrocytic marker GFAP in the bilateral ACC. The inhibition of astroglial function by an astroglial toxin blocked the place-avoidance behavior, but not the paw withdrawal threshold, suggesting the involvement of astrocytes in the ACC in the affective component of pain. Modulating the function of astrocytes in the ACC may provide a new strategy for the prevention of chronic pain-induced emotional disturbance. Acknowledgements The authors wish to thank Mr. Ian Haigler for linguistic revision of the manuscript. This study was supported by the National Natural Science Foundation of China (NSFC) 30500153,
31171062, the Natural Science Research Program of Jiangsu Province 05KJB180100, the Program for New Century Excellent Talents NCET-09-0164, the Natural Science Foundation of Jiangsu Province BK2010273 and a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions. References [1] E.C. Beattie, D. Stellwagen, W. Morishita, J.C. Bresnahan, B.K. Ha, M. Von Zastrow, M.S. Beattie, R.C. Malenka, Control of synaptic strength by glial TNFalpha, Science 295 (2002) 2282–2285. [2] H. Cao, Y.J. Gao, W.H. Ren, T.T. Li, K.Z. Duan, Y.H. Cui, X.H. Cao, Z.Q. Zhao, R.R. Ji, Y.Q. Zhang, Activation of extracellular signal-regulated kinase in the anterior cingulate cortex contributes to the induction and expression of affective pain, J. Neurosci. 29 (2009) 3307–3321. [3] C. Cavaliere, G. Cirillo, M. Rosaria Bianco, F. Rossi, V. De Novellis, S. Maione, M. Papa, Gliosis alters expression and uptake of spinal glial amino acid transporters in a mouse neuropathic pain model, Neuron Glia Biol. 3 (2007) 141–153. [4] S.R. Chaplan, F.W. Bach, J.W. Pogrel, J.M. Chung, T.L. Yaksh, Quantitative assessment of tactile allodynia in the rat paw, J. Neurosci. Methods 53 (1994) 55–63. [5] G. Crombez, J.W. Vlaeyen, P.H. Heuts, R. Lysens, Pain-related fear is more disabling than pain itself: evidence on the role of pain-related fear in chronic back pain disability, Pain 80 (1999) 329–339. [6] E.L. Foltz, L.E. White Jr., Pain “relief” by frontal cingulumotomy, J. Neurosurg. 19 (1962) 89–100. [7] Y.J. Gao, R.R. Ji, Targeting astrocyte signaling for chronic pain, Neurotherapeutics 7 (2010) 482–493. [8] Y.J. Gao, W.H. Ren, Y.Q. Zhang, Z.Q. Zhao, Contributions of the anterior cingulate cortex and amygdala to pain- and fear-conditioned place avoidance in rats, Pain 110 (2004) 343–353. [9] Y.J. Gao, Z.Z. Xu, Y.C. Liu, Y.R. Wen, I. Decosterd, R.R. Ji, The c-Jun N-terminal kinase 1 (JNK1) in spinal astrocytes is required for the maintenance of bilateral mechanical allodynia under a persistent inflammatory pain condition, Pain 148 (2010) 309–319. [10] W. Guo, H. Wang, M. Watanabe, K. Shimizu, S. Zou, S.C. LaGraize, F. Wei, R. Dubner, K. Ren, Glial–cytokine–neuronal interactions underlying the mechanisms of persistent pain, J. Neurosci. 27 (2007) 6006–6018.
66
F.-L. Chen et al. / Brain Research Bulletin 87 (2012) 60–66
[11] S. Huck, F. Grass, H. Hortnagl, The glutamate analogue alpha-aminoadipic acid is taken up by astrocytes before exerting its gliotoxic effect in vitro, J. Neurosci. 4 (1984) 2650–2657. [12] D. Jia, G.D. Gao, Y. Liu, S.M. He, X.N. Zhang, Y.F. Zhang, M.G. Zhao, TNF-alpha involves in altered prefrontal synaptic transmission in mice with persistent inflammatory pain, Neurosci. Lett. 415 (2007) 1–5. [13] J.P. Johansen, H.L. Fields, B.H. Manning, The affective component of pain in rodents: direct evidence for a contribution of the anterior cingulate cortex, Proc. Natl. Acad. Sci. U.S.A. 98 (2001) 8077–8082. [14] Y. Kawasaki, L. Zhang, J.K. Cheng, R.R. Ji, Cytokine mechanisms of central sensitization: distinct and overlapping role of interleukin-1beta, interleukin-6, and tumor necrosis factor-alpha in regulating synaptic and neuronal activity in the superficial spinal cord, J. Neurosci. 28 (2008) 5189–5194. [15] M. Khurgel, A.C. Koo, G.O. Ivy, Selective ablation of astrocytes by intracerebral injections of alpha-aminoadipate, Glia 16 (1996) 351–358. [16] C.J. LaBuda, P.N. Fuchs, A behavioral test paradigm to measure the aversive quality of inflammatory and neuropathic pain in rats, Exp. Neurol. 163 (2000) 490–494. [17] S.C. LaGraize, C.J. Labuda, M.A. Rutledge, R.L. Jackson, P.N. Fuchs, Differential effect of anterior cingulate cortex lesion on mechanical hypersensitivity and escape/avoidance behavior in an animal model of neuropathic pain, Exp. Neurol. 188 (2004) 139–148. [18] T.T. Li, W.H. Ren, X. Xiao, J. Nan, L.Z. Cheng, X.H. Zhang, Z.Q. Zhao, Y.Q. Zhang, NMDA NR2A and NR2B receptors in the rostral anterior cingulate cortex contribute to pain-related aversion in male rats, Pain 146 (2009) 183–193. [19] Y. Lu, L. Zhu, Y.J. Gao, Pain-related aversion induces astrocytic reaction and proinflammatory cytokine expression in the anterior cingulate cortex in rats, Brain Res. Bull. 84 (2011) 178–182. [20] T. Matsui, M. Sekiguchi, A. Hashimoto, U. Tomita, T. Nishikawa, K. Wada, Functional comparison of D-serine and glycine in rodents: the effect on cloned NMDA receptors and the extracellular concentration, J. Neurochem. 65 (1995) 454–458. [21] E.D. Milligan, C. Twining, M. Chacur, J. Biedenkapp, K. O‘Connor, S. Poole, K. Tracey, D. Martin, S.F. Maier, L.R. Watkins, Spinal glia and proinflammatory cytokines mediate mirror-image neuropathic pain in rats, J. Neurosci. 23 (2003) 1026–1040. [22] J.P. Mothet, A.T. Parent, H. Wolosker, R.O. Brady Jr., D.J. Linden, C.D. Ferris, M.A. Rogawski, S.H. Snyder, D-serine is an endogenous ligand for the glycine site of the N-methyl-D-aspartate receptor, Proc. Natl. Acad. Sci. U.S.A. 97 (2000) 4926–4931. [23] A. Okada-Ogawa, I. Suzuki, B.J. Sessle, C.Y. Chiang, M.W. Salter, J.O. Dostrovsky, Y. Tsuboi, M. Kondo, J. Kitagawa, A. Kobayashi, N. Noma, Y. Imamura, K. Iwata, Astroglia in medullary dorsal horn (trigeminal spinal subnucleus caudalis) are involved in trigeminal neuropathic pain mechanisms, J. Neurosci. 29 (2009) 11161–11171.
[24] A. Ploghaus, I. Tracey, J.S. Gati, S. Clare, R.S. Menon, P.M. Matthews, J.N. Rawlins, Dissociating pain from its anticipation in the human brain, Science 284 (1999) 1979–1981. [25] V. Raghavendra, F.Y. Tanga, J.A. DeLeo, Complete, Freunds adjuvant-induced peripheral inflammation evokes glial activation and proinflammatory cytokine expression in the CNS, Eur. J. Neurosci. 20 (2004) 467–473. [26] P. Rainville, B. Carrier, R.K. Hofbauer, M.C. Bushnell, G.H. Duncan, Dissociation of sensory and affective dimensions of pain using hypnotic modulation, Pain 82 (1999) 159–171. [27] K. Ren, R. Dubner, Neuron-glia crosstalk gets serious: role in pain hypersensitivity, Curr. Opin. Anaesthesiol. 21 (2008) 570–579. [28] W.H. Ren, J.D. Guo, H. Cao, H. Wang, P.F. Wang, H. Sha, R.R. Ji, Z.Q. Zhao, Y.Q. Zhang, Is endogenous D-serine in the rostral anterior cingulate cortex necessary for pain-related negative affect? J. Neurochem. 96 (2006) 1636–1647. [29] M.J. Rodriguez, M. Martinez-Sanchez, F. Bernal, N. Mahy, Heterogeneity between hippocampal and septal astroglia as a contributing factor to differential in vivo AMPA excitotoxicity, J. Neurosci. Res. 77 (2004) 344–353. [30] M.J. Schell, M.E. Molliver, S.H. Snyder, D-serine, an endogenous synaptic modulator: localization to astrocytes and glutamate-stimulated release, Proc. Natl. Acad. Sci. U.S.A. 92 (1995) 3948–3952. [31] F.Y. Tanga, V. Raghavendra, J.A. DeLeo, Quantitative real-time RT-PCR assessment of spinal microglial and astrocytic activation markers in a rat model of neuropathic pain, Neurochem. Int. 45 (2004) 397–407. [32] T.R. Tolle, T. Kaufmann, T. Siessmeier, S. Lautenbacher, A. Berthele, F. Munz, W. Zieglgansberger, F. Willoch, M. Schwaiger, B. Conrad, P. Bartenstein, Regionspecific encoding of sensory and affective components of pain in the human brain: a positron emission tomography correlation analysis, Ann. Neurol. 45 (1999) 40–47. [33] L.R. Watkins, M.R. Hutchinson, A. Ledeboer, J. Wieseler-Frank, E.D. Milligan, S.F. Maier, Norman Cousins Lecture. Glia as the “bad guys”: implications for improving clinical pain control and the clinical utility of opioids, Brain Behav. Immun. 21 (2007) 131–146. [34] F. Wei, W. Guo, S. Zou, K. Ren, R. Dubner, Supraspinal glial–neuronal interactions contribute to descending pain facilitation, J. Neurosci. 28 (2008) 10482–10495. [35] Y. Yang, W. Ge, Y. Chen, Z. Zhang, W. Shen, C. Wu, M. Poo, S. Duan, Contribution of astrocytes to hippocampal long-term potentiation through release of D-serine, Proc. Natl. Acad. Sci. U.S.A. 100 (2003) 15194–15199. [36] Z.Y. Zhuang, Y.R. Wen, D.R. Zhang, T. Borsello, C. Bonny, G.R. Strichartz, I. Decosterd, R.R. Ji, A peptide c-Jun N-terminal kinase (JNK) inhibitor blocks mechanical allodynia after spinal nerve ligation: respective roles of JNK activation in primary sensory neurons and spinal astrocytes for neuropathic pain development and maintenance, J. Neurosci. 26 (2006) 3551–3560.