- Email: [email protected]
Activation of biochemical factors in CMV-infected tobacco by ningnanmycin
Pesticide Biochemistry and Physiology 156 (2019) 116–122
Contents lists available at ScienceDirect
Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest
Activation of biochemical factors in CMV-infected tobacco by ningnanmycin a
a
a
a
Di Gao , Dongmei Wang , Kai Chen , Maoxi Huang , Xin Xie
b,⁎
a,⁎
T
, Xiangyang Li
a
State Key Laboratory Breeding Base of Green Pesticide and Agricultural Bioengineering, Key Laboratory of Green Pesticide and Agricultural Bioengineering, Ministry of Education, Guizhou University, Guiyang 550025, PR China College of Agriculture, Guizhou University, Guiyang 550025, PR China
b
A R T I C LE I N FO
A B S T R A C T
Keywords: Cucumber mosaic virus Ningnanmycin Enzymes Biochemical factors
Cucumber mosaic virus (CMV) is a plant virus with one of the largest host ranges, the widest distribution, and economic importance, and ningnanmycin (NNM) is a commercial antiviral agent. Studies have shown that NNM induces and promotes pathogenesis-related proteins in tobacco mosaic virus-inoculated tobacco. In the present study, the defense enzymes and the biochemical factors of CMV-inoculated tobacco treated with NNM were measured. The biochemical factors of CMV-inoculated tobacco leaves treated with NNM were analyzed. Results showed that the phenylalanine ammonia-lyase, peroxidase, polypheuoloxidase, and superoxide in the CMVinoculated tobacco leaves treated with NNM were higher than those in non-treated tobacco leaves. Furthermore, NNM activated the oxidation–reduction process, metabolic process, and oxidoreductase activity in the CMVinfected tobacco.
1. Introduction Cucumber mosaic virus (CMV) is a member of the genus Cucumovirus, family Bromoviridae (Di et al., 2010a). CMV has a wide plant host range. It causes huge economic losses to crop production (Jacquemond, 2012). This virus contains three essential single-stranded RNA, namely, RNA1, RNA2, and RNA3 (Kang et al., 2012; Moyle et al., 2018; Revathy and Bhat, 2017; Yamaguchi et al., 2005). CMV RNA encodes viral helicase, replicase, movement, and coat proteins (Kang et al., 2012; Shen et al., 2014). The replicase of CMV is responsible for plant defense pathways (Mochizuki and Ohki, 2012). Meanwhile, the coat and movement proteins of CMV are important for viral transmission (Zhang et al., 2017a; Nemes et al., 2014; Guiu-Aragonés and DíazPendón, 2015; Salánki et al., 2004). In a virus–host system, the host can produce self-defense substances to resist pathogenic bacteria (Di et al., 2012; Di et al., 2010b; Elena and Rodrigo, 2012; Alazem and Lin, 2015). However, the self-defense substances cannot inhibit the invasion of pathogenic bacteria if no allogenic materials are present, such as antiviral compounds ningnanmycin (NNM), chitosan oligosaccharide, cytosinpeptidemycin, salicylic acid, and dufulin (DFL). NNM is a commonly used antimicrobial agent that exhibits antiviral activity against tobacco mosaic virus (TMV) (Wang et al., 2012; Xiang et al., 1995; Li et al., 2017; Li et al., 2016). NNM
strengthens the defensive enzyme activities and promotes the systemic accumulation of pathogenesis-related proteins in TMV-inoculated tobacco (Han et al., 2014). Chitosan oligosaccharide strengthens defensive enzyme activities to enhance rice disease resistance by the mitogen-activated protein kinase signaling cascade pathway (Jones and Dangl, 2006). Cytosinpeptidemycin up-regulates serine and threonine protein kinase SAPK7 induce ABA response and can up-regulate some resistance genes (Shi et al., 2018; Yang et al., 2017a). Salicylic acid (SA) activates reactive oxygen species and temperature stress signals (Zipfel, 2014). DFL activates the SA signaling pathway to induce host plants to generate antiviral responses (Chen et al., 2012). Xiangcaoliusuobingmi triggers the abscisic acid (ABA) pathway to induce host plants to generate antiviral responses (Yu et al., 2017). The innovation of new compounds and new mechanisms for studying the role of highly active antiviral compounds has become the focus of research attention (Gao et al., 2012; Li et al., 2007; Long et al., 2015; Chen et al., 2016; Zhang et al., 2016; Xie et al., 2018; Wu et al., 2017; Zhang et al., 2017b; Lan et al., 2017; Wang et al., 2018). The traditional antiviral compound screening method is mainly inoculation by the half leaf method performed on Nicotiana glutinosa in the laboratory (Ma et al., 2014). However, this screening method cannot clarify the specific single target of drug action. In our previous studies, NNM was screened with antiviral activity
Abbreviations: CMV, Cucumber mosaic virus; TMV, Tobacco mosaic virus; NNM, ningnanmycin; DFL, dufulin; RIB, ribavirin; SA, salicylic acid; ABA, abscisic acid; PAL, phenylalanine ammonia-lyase; POD, peroxidase; SOD, superoxide; H2O2, hydrogen peroxide; GO, Gene ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; FPKM, fragments per kilobase million; RT-qPCR, Reverse transcription-quantitative real-time PCR ⁎ Corresponding author. E-mail addresses: [email protected] (X. Xie), [email protected] (X. Li). https://doi.org/10.1016/j.pestbp.2019.02.012 Received 20 October 2018; Received in revised form 9 January 2019; Accepted 11 February 2019 Available online 12 February 2019 0048-3575/ © 2019 Published by Elsevier Inc.
Pesticide Biochemistry and Physiology 156 (2019) 116–122
D. Gao, et al.
and then quenched in an ice bath to stop the reaction. At 290 nm, the OD2 value was measured by subtracting OD1 as the net value added for activity. An increase of 0.01 per hour to OD290 amount of enzyme activity as a unit of U was obtained and repeated three times for each sample. For the POD, an enzyme solution was diluted five times with guaiacol as the substrate, and 20 μL diluted crude enzyme extract was added to a 15 mL test tube that contained 3 mL 0.1 M pH 5.8 of 18 mM guaiacol in a sodium phosphate buffer. The solution was mixed and balanced uniformly at 30 °C in a water bath for 5 min. Then, we added 50 μL of 2.5% (v/v) hydrogen peroxide (H2O2) solution and mixed evenly to start an enzyme reaction with the same volume of distilled water instead of hydrogen peroxide as the blank control, as a zero instrument. After 5 min, the OD470 values were measured. The experiment was repeated three times with each sample. For the SOD, the solution was mixed, and a control tube was placed in darkness. The other tube, at 4000 Lux daylight, reacted for 20 min (requested by the light pipe in line). At the end of the reaction, the order was not made according to the blank control tube of light; the other tube was measured for its absorbance value. For the chlorophyll content, similarly grown K326 was selected. At first, the sixth leaf from the top was selected and treated with a brush dipped in viral juice. The entire leaf was inoculated with the virus and then rinsed with sterile water. Leaves were dried and coated for pharmaceutical facilities. The samples were measured every two days for their chlorophyll content, which was determined as follows. The test samples were placed into 5 mL of 2:1 acetone–ethanol mixture in a refrigerator at 4 °C. Dark extraction was conducted for 24 h. The chlorophyll after extraction was placed in a 1 cm-thick cuvette, with the 2:1 mixture as reference. The UV spectrophotometer was used at 645 and 663 nm to measure absorbance and chlorophyll content (mg·g−1 FW) with Ca + Cb. Ca = 12.7 A663–2.69 A645. Cb = 22.7A645–4.68 A663. Total chlorophyll content = [20.2A645 + 8.02A663]V/1000╳W. In the above equations, A645 and A663 are the absorbance values at the corresponding wavelengths, V is the volume of extraction, W is the leaf fresh weight, and chlorophyll content is described in mg·g−1.
against CMV using CMV inoculated by half leaf methods (Ma et al., 2014; Long et al., 2015b). However, the underlying mechanism of NNM on CMV-infected tobacco remains unclear. Therefore, we must study the specific mechanism of action of antiviral drugs and guide the innovation of new pesticides. In this study, we first investigate the defense activity and chlorophyll content in CMV-inoculated leaves treated with NNM. Then, we analyze the mechanism of the molecular response for the CMV-infected tobacco triggered by NNM using transcriptome sequence technology coupled with bioinformatics and qPCR methods. Our results indicate that NNM can effectively control the tobacco disease caused by CMV by enhancing plant host resistance. 2. Materials and methods 2.1. Plant material and samples collection The CMV virus source was bought from Wuhan Institute of Virology, Chinese Academy of Sciences. Tobacco K326 plants were maintained in an air-conditioned greenhouse at 24 °C with a 16 h daylight and 8 h dark cycle. After three months, the tobacco plants were inoculated at the 5–6 leaf stages with CMV of the control group (CK), 0.5 mg/mL NNM was sprayed on the CMV-inoculated tobacco plants of the treatment group (N), and 0.5 mg/mL ribavirin (RIB) was sprayed on the CMV-inoculated tobacco plants of the treatment group (R). 24 h later, samples of the tobacco plants were collected (on days 1, 3, 5, and 7) and maintained at −80°С for further use. The treatments were conducted under a randomized design with three replicates. NNM (85%), original agent and RIB (98%), and original agent were bought from an insecticide factory. The structural formulae of NNM and RIB are listed in Table 1. 2.2. Defense activity and chlorophyll content measurement 1.0 g leaves (treatment group and control group), 2.0 mL of 0.2 M pH 8.8 sodium borate buffer (containing 5 mM β-mercaptoethanol, 1 mM EDTA), and 2.0 mL sodium borate were placed in a mortar. The mixture was ground into homogenate and transferred to centrifuge tubes. Then, the sample was stirred for 5 min at 4 °C. The sample was refrigerated at 20,000 g for 20 min. The supernatants were stored at −40 °C for further analysis of the phenylalanine ammonia-lyase (PAL), peroxidase (POD), superoxide (SOD), and chlorophyll content (Wang and Huang, 2006). For the PAL, crude enzyme extract was treated with 0.05 M pH 8.8 sodium borate buffer, diluted five times with its L-phenylalanine as the substrate to 3 mL 0.05 M pH 8.8 by sodium borate buffer and 0.5 mL enzyme solution as the blank control. The instrument was set to zero. A UV spectrophotometer was operated at 290 nm, and the OD1 value was measured. The reaction was conducted at 40 °C in a water bath for 5 h
2.3. cDNA library construction and Illumina sequencing We select the CK group and the N group on day 5 for further analysis. Total RNA from fresh leaves in the CK group and the N group on day 5 was extracted using the TRIzol reagent method (Invitrogen Carlsbad, USA). RNA degradation and contamination were monitored on 1% agarose gels. RNA purity was checked using the NanoPhotometer® spectrophotometer (IMPLEN, USA). RNA concentration was measured using a Qubit® RNA Assay Kit in Qubit® 2.0 Fluorometer (Life Technologies, USA). RNA integrity was assessed
Table 1 Series of anti-viral agents. Serial number
Abbreviation
Ningnanmycin
NNM
Ribavirin
RIB
Structures
117
Pesticide Biochemistry and Physiology 156 (2019) 116–122
D. Gao, et al.
Table 2 Primer sequences and the reaction condition used in reverse transcription (RT)-quantitative PCR. Genes name
Forward primer (5′–3′)
Reverse primer (5′–3′)
SOD PAL POD PR-1a β-actin
CTCTGCCATAGACACCAACTT ATACTGCCTCCACTCGGGAT GAATGGGGGCTTCTCTGCTT CAATACGGCGAAAACCTAGCTGA GACGTGACCTAACTGATAACCTGAT
CCAAGTTCGGTCCTTTAATAA ACGCTCGATTATATGGCGCT TTTGGTGCAGCCCTCTTCTC CCTAGCACATCCAACACGAA CTCTCAGCACCAATGGTAATAACTT
sequencing discrepancies when calculating the abundance of expressions.
using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, USA). The cDNA library construction and Illumina sequencing of the samples were performed by Novogene Bioinformatics Technology Co., Ltd. (Beijing, China). A total of 3 μg RNA was used as input material for the RNA sample preparations. Sequencing libraries were generated using NEB Next® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA), and index codes were added to attribute sequences to each sample. In brief, mRNA was purified from total RNA using poly-T oligo-attached magnetic beads. Fragmentation was conducted using divalent cations under elevated temperatures in NEB Next First-Strand Synthesis Reaction Buffer (5×). First-strand cDNA was synthesized using a random hexamer primer and M-MuLV reverse transcriptase (RNase H). Second-strand cDNA synthesis was subsequently performed by DNA polymerase I and RNase H. Remaining products were inserted into blunt ends by exonuclease/polymerase. After adenylation in each ends, a NEB Next Adaptor with hairpin loop structure was constructed for hybridization. To select cDNA fragments of lengths of preferentially 150–200 bp, the library fragments were purified with an AMPure XP system (Beckman Coulter, USA). Then, 3 μL USER Enzyme (NEB, USA) was added to size-selected, adaptor-ligated cDNA and incubated at 37 °C for 15 min, followed by 5 min at 95 °C before PCR. PCR was performed with Phusion High-Fidelity DNA polymerase, Universal PCR primers, and Index (X) Primer. Finally, the PCR products were purified (AMPure XP system), and the library quality was assessed on an Agilent Bioanalyzer 2100 system.
2.6. Gene expression analysis by reverse transcription-qPCR Total RNA was extracted using a Trizol reagent kit (TakaRa, Dalian, China). RNA was reverse-transcribed using a cDNA kit (TakaRa) according to the manufacturer's instructions. The experiments were performed in 10 μL reaction volume and SYBRPremixExTaqII (TakaRa), and an iCycleriQ multicolor real-time PCR Detection System (Bio-Rad, California, CA, USA) was used. Primer sequence information is listed in Table 2. Gene expression was normalized using β-actin as the internal control. The relative copy numbers of the genes were calculated by the 2−ΔΔCt method (Livak and Schmittgen, 2001). 2.7. Statistical analysis Data (mean ± SE) from various samples were subjected to one-way nested analysis of variance (ANOVA) followed by a least significant difference test (LSD) for two sample comparisons and the Tukey test for multiple comparisons for a mean comparison using SPSS Statistics 19.0 (IBM, Chicago, IL, USA). 3. Results and discussion 3.1. Effect of NNM on tobacco defense enzymes
2.4. De novo assembly of short reads and gene annotation
As shown in Fig. 1A, the CMV group of PAL activity in tobacco leaves was increased more than the CK group during days 1–5 and reached the maximum during day 5, there were no significant differences between days 5 and 7. After spraying by NNM, the NNM group of PAL activity was increased more than the TMV group during days 3–7 with significant differences. However, the RIB group of PAL activity in the tobacco leaves was the same as the CMV group with no significant differences. These results indicated that NNM can induce the enhancement of PAL activity to promote plant substances in the metabolism of phenylalanine to generate sufficient phenolic compounds, lignin, and other secondary material. As illustrated in Fig. 1B, the CMV group of POD activity in the tobacco leaves increased more than the CK group during days 1–5 and reached the maximum during days 5–7. After spraying by NNM and RIB, the NNM group of POD activity increased more than the CK and RIB groups during days 3–7 with significant differences. These findings indicated that NNM can stimulate an increase in POD activity and enhance plant resistance against CMV diseases. Otherwise, the RIB group can passivate the virus replication, and the POD activity of the RIB group cannot activate. As depicted in Fig. 1C, compared with CK treatment groups, the CMV group of SOD activity in the leaves decreased considerably during days 1–3 with significant differences. Then, the CMV group of SOD activity maintained a low level during days 5–7 with no significant differences. However, the NNM and RIB groups of SOD activity increased more than the CMV group during days 1–5 with significant differences, reached the maximum on day 5, and dropped during day 7. These results indicated that NNM can increase tobacco SOD activity and enhance the host activity in terms of the scavenging of reactive oxygen
Raw data (raw reads) in fastq format were first processed by inhouse Perl scripts. In this step, clean data (clean reads) were obtained by removing the reads containing adapter, reads containing ploy-N, and low-quality reads from the raw data. Simultaneously, Q20, Q30, GCcontent, and sequence duplication level of the clean data were calculated. All downstream analyses were based on clean data with high quality. De novo transcriptome assembly was conducted using the short reads assembly program Trinity (Grabherr et al., 2011). The overlap settings used for the assembly were 30 bp and 80% similarity, and all the other parameters were set to their default values. Unigenes > 150 bp were aligned by BLASTx with protein databases, including Nr, Swiss-Prot, Kyoto Encyclopedia of Genes and Genomes (KEGG), and COG (e-value < 10−5), to identify proteins with high sequence identity and to assign putative functional annotations. Next, we used the program Blast2GO to obtain Gene ontology (GO) annotations of the unigenes (Conesa et al., 2005), and we obtained the GO functional classifications using the software WEGO (Ye et al., 2006). 2.5. Expression level analysis for unigenes The expression levels (abundances) of the unigenes were calculated by using the fragments per kilobase million (FPKM) method (Trapnell et al., 2010) as follows: FPKM (A) = (1,000,000 × C × 1000)/(N × L), where FPKM (A) is the expression level of gene A, C is the number of reads uniquely aligned to gene A, N is the total number of reads uniquely aligned to all genes, and L is the number of bases in gene A. The FPKM method can eliminate the influence of different gene lengths and 118
Pesticide Biochemistry and Physiology 156 (2019) 116–122
D. Gao, et al.
Fig. 1. PAL, POD, SOD activity, and chlorophyll content in leaves treated with compounds. Different letters in same column pattern are significantly different from each other following by the Duncan's multiple range test to significantly difference at p < .05. Vertical bars refer to mean ± SD (n = 3).
species, thereby reducing the amount of reactive oxygen responsible for cell damage. As shown in Fig. 1D, compared with CMV treatment groups, the NNM and RIB groups of the chlorophyll content of tobacco increased during days 1–7 with significant differences and reached the highest level on day 7. However, in the CMV group, the chlorophyll content of tobacco was lower than in the CK treatment groups during days 1–7 with no significant differences. These findings indicated that NNM and RIB can recover the chloroplast damaged by CMV. 3.2. Tobacco leaves transcriptome sequencing and assembly of CK and N (NNM) The tobacco leaves of CK and N transcriptome were sequenced using the Illumina HiSeq™2500 platform and assembled using Trinity (r20140413p1). In total, ~6.16 (CK) and ~6.03 (N) million raw reads were obtained. After filtering, 5.97 (CK) and 5.83 (N) million clean reads were generated, which comprised 8.95 (CK) and 8.75 (N) gigabases (Gb). The error rates were 0.01% (CK) and 0.01% (N). The Q20 values were 98.12% (CK) and 97.61% (N). The Q30 values were 94.90% (CK) and 93.63% (N). The GC contents were 42.85% (CK) and 42.16% (N).
Fig. 2. Numbers of identified genes showed up- and down-regulation among the N and CK groups. Red spots represent the up-regulated genes, and blue dots represent the down-regulated genes. The horizontal coordinates indicate the change in multiple expression between the N and CK groups. The longitudinal coordinates indicate the magnitude of differences in gene level. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
3.3. Analysis of gene expression obtained using the Blast2GO pipeline according to a BLASTx search against a non-redundant (NR) database. The GO annotations were used to classify the transcripts into functional groups on the basis of specific GO categories. Among the 33,296 unigenes in the N groups, 5132 (15.41%) could be assigned to various GO terms, and of the 30,689 unigenes in the CK groups, 2525 (8.23%) could be assigned to various GO terms (Fig. 3 and Supplementary Table 1). In the molecular function category, the genes expressed in the N groups were mostly enriched for biological processes (e.g., oxidation
Gene expression results showed the total numbers of the identified genes, which included 2456 up-regulated proteins (red dots) and 2070 down-regulated proteins (blue dots) in the N and CK groups was 4526 in the volcano plot (Fig. 2). 3.4. Gene ontology (GO) annotation Gene ontology (GO) annotations for all of the unigenes were 119
Pesticide Biochemistry and Physiology 156 (2019) 116–122
D. Gao, et al.
play important roles in defending the disease. Few studies have shown that α-linolenic acid played an important role in gene expression and plant stress (Sun et al., 2017), and proline played an important role in plant osmoregulation and plant drought resistance (Yang et al., 2017b; Yamada et al., 2005). The results showed that alpha-linolenic acid metabolism; alanine, aspartate, glutamate, and linoleic acid metabolism; and valine, leucine, and isoleucine degradation, and arginine, proline metabolism were the key factors in the tobacco leaves by N groups (Supplementary Table 2). In the previous studies, studies reported that NNM could regulate systemic acquired resistance and induce systemic resistance (Han et al., 2014). Some antiviral compounds could activate the biochemical factors in CMV infected plant. For instance, quinazoline derivative could increase the chlorophyll content in plants and enhance photosynthesis in CMV-infected plant (Xie et al., 2018), and dithioacetal derivatives could induce the accumulation of abscisic acid to enhance the CMV disease resistance (Chen et al., 2018), and dithioacetal compound xiangcaoliusuobingmi could trigger the abscisic acid pathway to enhance the CMV disease resistance (Shi et al., 2018).
Fig. 3. Venn diagram for genes identification in the N and CK groups. In the total protein, 33,296 (N) and 30,689 (CK) were identified in the two groups, of which 5132 and 2525 genes are shown in the yellow and pink parts, respectively, and these were specifically expressed in the N and CK groups, respectively. FPKM > 1 was used as a standard of gene expression. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
3.6. Gene expression levels of PAL, POD, SOD, and PR-1a To verify the high-expression defense genes by NNM, defense genes PAL, POD, SOD, and PR-1a were investigated by reverse transcription quantitative real-time PCR (RT-qPCR). The results demonstrated that the relative expression levels of PAL, POD, SOD, and PR-1a by NNM were significantly higher than those of the CK group on day 5. The relative expression levels of PAL, POD, SOD, and PR-1a gene were −1.03 (CK −0.65), −1.48 (CK −0.75), −1.33 (CK −1.00), and −1.10 (CK −0.87), respectively, which were highly up-regulated by NNM treatment after 5 days. There were significant differences of PAL, POD, and SOD between the N group and the CK group (Fig. 5).
reduction process, metabolic process, and single-organism metabolic process) and molecular functions (e.g., oxidoreductase activity). As regards biological process categorization, the most common were oxidation reduction and metabolic processes (Fig. 4).
3.5. KEGG pathway annotation KEGG was used to research the response to the action of NNM in tobacco. KEGG pathway enrichment analysis revealed that the upregulated differentially expressed genes between N and CK treatment were mainly enriched with genes regulating alpha-linolenic acid metabolism; alanine, aspartate, glutamate metabolism; valine, leucine, and isoleucine degradation, and arginine, proline metabolism. These genes
4. Conclusions Given that the activity of anti-plant virus compounds is related to host tobacco, virus, and compounds, we determined the effect of antiCMV compound NNM on defense enzyme activity and chlorophyll
Fig. 4. Gene ontology (GO) classifications of the N and CK group unigenes. “*” represent the highly enriched GO term. 120
Pesticide Biochemistry and Physiology 156 (2019) 116–122
D. Gao, et al.
2010. Proteomic analysis of the plant-virus interaction in cucumber mosaic virus (cmv) resistant transgenic tomato. J. Proteome Res. 9, 5684–5697. Di, C.M., Benvenuto, E., Donini, M., 2012. Recent insights into plant-virus interactions through proteomic analysis. J. Proteome Res. 11, 4765–4780. Elena, S.F., Rodrigo, G., 2012. Towards an integrated molecular model of plant–virus interactions. Curr. Opin. Virol. 2, 713–718. Gao, S., Zhang, R.Y., Yu, Z.H., Xi, Z., 2012. Antofine analogues can inhibit tobacco mosaic virus assembly through small-molecule-rna interactions. Chembiochem 13, 1622–1627. Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I., Adiconis, X., Fan, L., Raychowdhury, R., Zeng, Q.D., Chen, Z.H., Mauceli, E., Hacohen, N., Gnirke, A., Rhind, N., Palma, F.D., Birren, B., Nusbaum, C., Lindblad-Toh, K., Lindblad-Toh, N., Regev, A., 2011. Full-length transcriptome assembly from rna-seq data without a reference genome. Nat. Biotechnol. 29, 644–652. Guiu-Aragonés, C., Díaz-Pendón, J.A., 2015. Four sequence positions of the movement protein of cucumber mosaic virus determine the virulence against cmv1-mediated resistance in melon. Mol. Plant Pathol. 16, 675–684. Han, Y.G., Luo, Y., Qin, S.R., Lei, X., Wan, B., Du, L.F., 2014. Induction of systemic resistance against tobacco mosaic virus by ningnanmycin in tobacco, Pestic. Biochem. Phys. 111, 14–18. Jacquemond, M., 2012. Cucumber mosaic virus. Adv.Virus Res. 84, 439–504. Jones, J.D., Dangl, J.L., 2006. The plant immune system. Nature 444, 323–329. Kang, W.H., Seo, J.K., Chung, B.N., Kim, K.H., Kang, B.C., 2012. Helicase domain encoded by cucumber mosaic virus rna1 determines systemic infection of cmr1 in pepper. PLoS One 7, e43136. Lan, X.M., Xie, D.D., Yin, L.M., Wang, Z.Z., Chen, J., Zhang, A.W., Song, B.A., Hu, D.Y., 2017. Novel α,β-unsaturated amide derivatives bearing α-amino phosphonate moiety as potential antiviral agents. Bioorg. Med. Chem. Lett. 27, 4270–4273. Li, Y.M., Wang, L.H., Li, S.L., Chen, X.Y., Shen, Y.M., Zhang, Z.K., He, H.P., Xu, W.B., Shu, Y.L., Liang, G.D., Fang, R.X., Hao, X.J., 2007. Seco-pregnane steroids target the subgenomic rna of alphavirus-like rna viruses. P. Nati. Acad. Sci. USA 104, 8083–8088. Li, X.Y., Chen, Z., Jin, L.H., Hu, D.Y., Yang, S., 2016. New strategies and methods to study interactions between tobacco mosaic virus coat protein and its inhibitors. Int. J. Mol. Sci. 17, 841–846. Li, X.Y., Hao, G.F., Wang, Q.M., Chen, Z., Ding, Y., Yu, L., Song, D.Y.Hu.B.A., 2017. Ningnanmycin inhibits tobacco mosaic virus virulence by binding directly to its coat protein discs. Oncotarget 8, 82446–82458. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative pcr and the 2(−delta delta c(t)) method. Methods 25, 402–408. Long, C.W., Li, P., Chen, M.H., Dong, L.R., Hu, D.Y., Song, B.A., 2015. Synthesis, antitobacco mosaic virus and cucumber mosaic virus activity, and 3D-QSAR study of novel 1,4-pentadien-3-one derivatives containing 4-thioquinazoline moiety. Eur. J. Med. Chem. 102, 639–647. Ma, J., Li, P., Li, X.Y., Shi, Q.C., Wan, Z.H., Hu, D.Y., Song, B.A., 2014. Synthesis and antiviral bioactivity of novel 3-((2-((1e,4e)-3-oxo-5-arylpenta-1,4-dien-1-yl)phenoxy) methyl)-4(3h)-quinazolinone derivatives. J. Agric. Food Chem. 62, 8928–8934. Mochizuki, T., Ohki, S.T., 2012. Cucumber mosaic virus: viral genes as virulence determinants. Mol. Plant Pathol. 13, 217–225. Moyle, R., Pretorius, L.S., Shuey, L.S., Nowak, E., Schenk, P.M., 2018. Analysis of the complete genome sequence of cucumber mosaic virus strain k. Genome Announc. 6, e00053. Nemes, K., Gellért, Á., Balázs, E., Salánki, K., 2014. Alanine scanning of cucumber mosaic virus (cmv) 2b protein identifies different positions for cell-to-cell movement and gene silencing suppressor activity. PLoS One 9, e112095. Revathy, K.A., Bhat, A.I., 2017. Complete genome sequencing of cucumber mosaic virus from black pepper revealed rare deletion in the methyltransferase domain of 1a gene. Virus Dis. 28, 309–314. Salánki, K., Gellért, A., Huppert, E., Náray-Szabó, G., Balázs, E., 2004. Compatibility of the movement protein and the coat protein of cucumoviruses is required for cell-tocell movement. J. Gen. Virol. 85, 1039–1048. Shen, Y., Zhao, X.H., Yao, M., Li, C., Miriam, K., Zhang, X., Tao, X.R., 2014. A versatile complementation assay for cell-to-cell and long distance movements by cucumber mosaic virus based agro-infiltration. Virus Res. 190, 25–33. Shi, J., Yu, L., Song, B.A., 2018. Proteomics analysis of xiangcaoliusuobingmi-treated capsicum annuum l, infected with cucumber mosaic virus. Pestic. Biochem. Phys. 149, 113–122. Sun, H., Chen, L., Li, J., Hu, M., Ullah, A., He, X., Yang, X., Zhang, X., 2017. The JASMONATE ZIM-domain gene family mediates JA signaling and stress response in cotton. Plant Cell Physiol. 58, 2139–2154. Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., Salzberg, S.L., Wold, B.J., Pachter, L., 2010. Transcript assembly and quantification by rna-seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 28, 511–515. Wang, X.K., Huang, J.L., 2006. Experimental Principle and Technology for Plant Physiology and Biochemistry, Second ed. Higher Education Press, Beijing. Wang, B.N., Yang, X.F., Zeng, H.M., Liu, H., Zhou, T.T., Tan, B.B., Yuan, J.J., Guo, L.H., Qiu, D.W., 2012. The purification and characterization of a novel hypersensitive-like response-inducing elicitor from verticillium dahliae that induces resistance responses in tobacco. Appl. Microbiol. Biotechnol. 93, 191–201. Wang, Y.Y., Xu, F.Z., Zhu, Y.Y., Song, B.A., Luo, D.X., Yu, G., Chen, S.H., Xue, W., Wu, J., 2018. Pyrazolo[3,4- d ]pyrimidine derivatives containing a schiff base moiety as potential antiviral agents. Bioorg. Med. Chem. Lett. 28, 2979–2984. Wu, Z.X., Zhang, J., Chen, J.X., Pan, J.K., Zhao, L., Liu, D.Y., Zhang, A.W., Chen, J., Hu, D.Y., Song, B.A., 2017. Design, synthesis, antiviral bioactivity, and 3d-qsar study of novel ferulic acid ester derivatives containing quinazoline moiety. Pest Manag. Sci.
Fig. 5. Gene expression analysis of the defense genes by RT-qPCR. The gene expression levels of PAL, POD, SOD, and PR-1a in tobacco K326 leaves on day 5 were highly up-regulated by N groups. Different letters in same column pattern are significantly different from each other following by the Duncan's multiple range test to significantly difference at p < .05. Vertical bars refer to mean ± SD (n = 3).
index in tobacco, and we used RIB as the control agent. The results showed that the content of PAL, POD, SOD, and chlorophyll in tobacco leaves increased significantly after being sprayed with NNM for days 1–7. The best activity was achieved on day 5. Then, we selected the transcriptome sequencing study on the tobacco leaves of the NNM treatment group and the CK treatment group on day 5. GO enrichment results showed that the NNM treatment group can enhance the tobacco oxidation reduction process, metabolic process, and single-organism metabolic process. Differential gene KEGG enrichment results showed that the NNM treatment group can accelerate tobacco alpha-linolenic acid metabolism; alanine, aspartate, glutamate, and linoleic acid metabolism; and valine, leucine, and isoleucine degradation, and arginine, proline metabolism. Furthermore, q-PCR results showed that the defense genes PAL, POD, SOD, and PR-1a were up-regulated by NNM on day 5 in CMV-inoculated leaves. The results corresponded to recent studies that implied that NNM strengthens the defensive enzyme activities and promotes the systemic accumulation of pathogenesis-related proteins in TMV- and CMV-inoculated tobacco thereby producing antiviral activity (Han et al., 2014). Supplementary data to this article can be found online at https:// doi.org/10.1016/j.pestbp.2019.02.012. Acknowledgement This work was supported by National Key Research and Development Program of China (No. 2017YFD0200503-3) and National Natural Science Foundation of China (Nos. 21502032 and 31460460). References Alazem, M., Lin, N., 2015. Roles of plant hormones in the regulation of host–virus interactions. Mol. Plant Pathol. 16, 529–540. Chen, Z., Zeng, M.J., Song, B.A., Hou, C.R., Hu, D.Y., Li, X.Y., Wang, Z.C., Fan, H.T., Bi, L., Liu, J.J., Yu, D.D., Jin, L.H., Yang, S., 2012. Dufulin activates hrbp1 to produce antiviral responses in tobacco. PLoS One 7, e37944. Chen, M.H., Li, P., Hu, D.Y., Zeng, S., Li, T., Jin, L.H., Yue, M., Song, B.A., 2016. Synthesis, antiviral activity, 3d-qsar, and interaction mechanisms study of novel malonate derivatives containing quinazolin-4(3h)-one moiety. Bioorg. Med. Chem. Lett. 26, 168–173. Chen, J., Shi, J., Yu, L., Liu, D.Y., Gan, X.H., Song, B.A., Hu, D.Y., 2018. Design, synthesis, antiviral bioactivity, and defense mechanisms of novel dithioacetal derivatives bearing a strobilurin moiety. J. Agric. Food Chem. 66, 5335–5345. Conesa, A., Götz, S., García-Gómez, J.M., Terol, J., Talón, M., Robles, M., 2005. Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 21, 3674–3676. Di, C.M., Villani, M.E., Bianco, L., Lombardi, R., Perrotta, G., Benvenuto, E., Donini, M.,
121
Pesticide Biochemistry and Physiology 156 (2019) 116–122
D. Gao, et al.
Ye, J., Fang, L., Zheng, H.K., Zhang, Y., Chen, J., Zhang, Z.J., Wang, J., Li, S.T., Li, R.Q., Bolund, L., Wang, J., 2006. Wego: a web tool for plotting GO annotations. Nucleic Acids Res. 34, 293–297. Yu, L., Wang, W.L., Zeng, S., Chen, Z., Yang, A.M., Shi, J., Zhao, X.Z., Song, B.A., 2017. Label-free quantitative proteomics analysis of cytosinpeptidemycin responses in southern rice black-streaked dwarf virus-infected rice. Pestic. Biochem. Phys. 147, 20–26. Zhang, G.P., Hao, G.F., Kan, J.P., Zhang, J., Hu, D.Y., Song, B.A., 2016. Asymmetric synthesis and bioselective activities of α-amino-phosphonates based on the dufulin motif. J. Agric. Food Chem. 64, 4207–4213. Zhang, X.P., Liu, D.S., Yan, T., Fang, X.D., Dong, K., Xu, J., Wang, Y., Yu, J.L., Wang, X.B., 2017a. Cucumber mosaic virus coat protein modulates the accumulation of 2b protein and antiviral silencing that causes symptom recovery in planta. PLoS Pathog. 13, e1006522. Zhang, J., Zhao, L., Zhu, C., Wu, Z.X., Zhang, G.P., Gan, X.G., Liu, D.Y., Pan, J.K., Hu, D.Y., Song, B.A., 2017b. Facile synthesis of novel vanillin derivatives incorporating a bis(2-hydroxyethyl)dithioacetal moiety as antiviral agents. J. Agric. Food Chem. 65, 4582–4588. Zipfel, C., 2014. Plant pattern-recognition receptors. Trends Immunol. 35, 345–351.
73, 2079–2089. Xiang, G.X., Hu, H.Z., Chen, J.R., Chen, W.X., Wu, L.S., 1995. A new agricultural antibiotic—ningnanmycin. Acta Microbiol Sin. 36, 368–374. Xie, D.D., Shi, J., Zhang, A.W., Lei, Z.W., Zu, G.C., Fu, Y., Gan, X.H., Yin, L.M., Song, B.A., Hu, D.Y., 2018. Syntheses, antiviral activities and induced resistance mechanisms of novel quinazoline derivatives containing a dithioacetal moiety. Bioorg. Chem. 80, 433–443. Yamada, M., Morishita, H., Urano, K., Shiozaki, N., Yamaguchi-Shinozaki, K., Shinozaki, K., Yoshiba, Y., 2005. Effects of free proline accumulation in petunias under drought stress. J. Exp. Bot. 56, 1975–1981. Yamaguchi, N., Seshimo, Y., Yoshimoto, E., Ahn, H.I., Ryu, K.H., Choi, J.K., Masuta, C., 2005. Genetic mapping of the compatibility between a lily isolate of cucumber mosaic virus and a satellite rna. J. Gen.Virol. 86, 2359–2369. Yang, A.M., Yu, L., Chen, Z., Zhang, S.X., Shi, J., Zhao, X.Z., Yang, Y.Y., Hu, D.Y., Song, B.A., 2017a. Label-free quantitative proteomic analysis of chitosan oligosaccharidetreated rice infected with southern rice black-streaked dwarf virus. Viruses 9, 115. Yang, H., Zhao, L., Zhao, S., Wang, J., Shi, H., 2017b. Biochemical and transcriptomic analyses of drought stress responses of LY1306 tobacco strain. Sci. Rep. 7, 17442. https://doi.org/10.1038/s41598-017-17045-2.
122
Contents lists available at ScienceDirect
Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest
Activation of biochemical factors in CMV-infected tobacco by ningnanmycin a
a
a
a
Di Gao , Dongmei Wang , Kai Chen , Maoxi Huang , Xin Xie
b,⁎
a,⁎
T
, Xiangyang Li
a
State Key Laboratory Breeding Base of Green Pesticide and Agricultural Bioengineering, Key Laboratory of Green Pesticide and Agricultural Bioengineering, Ministry of Education, Guizhou University, Guiyang 550025, PR China College of Agriculture, Guizhou University, Guiyang 550025, PR China
b
A R T I C LE I N FO
A B S T R A C T
Keywords: Cucumber mosaic virus Ningnanmycin Enzymes Biochemical factors
Cucumber mosaic virus (CMV) is a plant virus with one of the largest host ranges, the widest distribution, and economic importance, and ningnanmycin (NNM) is a commercial antiviral agent. Studies have shown that NNM induces and promotes pathogenesis-related proteins in tobacco mosaic virus-inoculated tobacco. In the present study, the defense enzymes and the biochemical factors of CMV-inoculated tobacco treated with NNM were measured. The biochemical factors of CMV-inoculated tobacco leaves treated with NNM were analyzed. Results showed that the phenylalanine ammonia-lyase, peroxidase, polypheuoloxidase, and superoxide in the CMVinoculated tobacco leaves treated with NNM were higher than those in non-treated tobacco leaves. Furthermore, NNM activated the oxidation–reduction process, metabolic process, and oxidoreductase activity in the CMVinfected tobacco.
1. Introduction Cucumber mosaic virus (CMV) is a member of the genus Cucumovirus, family Bromoviridae (Di et al., 2010a). CMV has a wide plant host range. It causes huge economic losses to crop production (Jacquemond, 2012). This virus contains three essential single-stranded RNA, namely, RNA1, RNA2, and RNA3 (Kang et al., 2012; Moyle et al., 2018; Revathy and Bhat, 2017; Yamaguchi et al., 2005). CMV RNA encodes viral helicase, replicase, movement, and coat proteins (Kang et al., 2012; Shen et al., 2014). The replicase of CMV is responsible for plant defense pathways (Mochizuki and Ohki, 2012). Meanwhile, the coat and movement proteins of CMV are important for viral transmission (Zhang et al., 2017a; Nemes et al., 2014; Guiu-Aragonés and DíazPendón, 2015; Salánki et al., 2004). In a virus–host system, the host can produce self-defense substances to resist pathogenic bacteria (Di et al., 2012; Di et al., 2010b; Elena and Rodrigo, 2012; Alazem and Lin, 2015). However, the self-defense substances cannot inhibit the invasion of pathogenic bacteria if no allogenic materials are present, such as antiviral compounds ningnanmycin (NNM), chitosan oligosaccharide, cytosinpeptidemycin, salicylic acid, and dufulin (DFL). NNM is a commonly used antimicrobial agent that exhibits antiviral activity against tobacco mosaic virus (TMV) (Wang et al., 2012; Xiang et al., 1995; Li et al., 2017; Li et al., 2016). NNM
strengthens the defensive enzyme activities and promotes the systemic accumulation of pathogenesis-related proteins in TMV-inoculated tobacco (Han et al., 2014). Chitosan oligosaccharide strengthens defensive enzyme activities to enhance rice disease resistance by the mitogen-activated protein kinase signaling cascade pathway (Jones and Dangl, 2006). Cytosinpeptidemycin up-regulates serine and threonine protein kinase SAPK7 induce ABA response and can up-regulate some resistance genes (Shi et al., 2018; Yang et al., 2017a). Salicylic acid (SA) activates reactive oxygen species and temperature stress signals (Zipfel, 2014). DFL activates the SA signaling pathway to induce host plants to generate antiviral responses (Chen et al., 2012). Xiangcaoliusuobingmi triggers the abscisic acid (ABA) pathway to induce host plants to generate antiviral responses (Yu et al., 2017). The innovation of new compounds and new mechanisms for studying the role of highly active antiviral compounds has become the focus of research attention (Gao et al., 2012; Li et al., 2007; Long et al., 2015; Chen et al., 2016; Zhang et al., 2016; Xie et al., 2018; Wu et al., 2017; Zhang et al., 2017b; Lan et al., 2017; Wang et al., 2018). The traditional antiviral compound screening method is mainly inoculation by the half leaf method performed on Nicotiana glutinosa in the laboratory (Ma et al., 2014). However, this screening method cannot clarify the specific single target of drug action. In our previous studies, NNM was screened with antiviral activity
Abbreviations: CMV, Cucumber mosaic virus; TMV, Tobacco mosaic virus; NNM, ningnanmycin; DFL, dufulin; RIB, ribavirin; SA, salicylic acid; ABA, abscisic acid; PAL, phenylalanine ammonia-lyase; POD, peroxidase; SOD, superoxide; H2O2, hydrogen peroxide; GO, Gene ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; FPKM, fragments per kilobase million; RT-qPCR, Reverse transcription-quantitative real-time PCR ⁎ Corresponding author. E-mail addresses: [email protected] (X. Xie), [email protected] (X. Li). https://doi.org/10.1016/j.pestbp.2019.02.012 Received 20 October 2018; Received in revised form 9 January 2019; Accepted 11 February 2019 Available online 12 February 2019 0048-3575/ © 2019 Published by Elsevier Inc.
Pesticide Biochemistry and Physiology 156 (2019) 116–122
D. Gao, et al.
and then quenched in an ice bath to stop the reaction. At 290 nm, the OD2 value was measured by subtracting OD1 as the net value added for activity. An increase of 0.01 per hour to OD290 amount of enzyme activity as a unit of U was obtained and repeated three times for each sample. For the POD, an enzyme solution was diluted five times with guaiacol as the substrate, and 20 μL diluted crude enzyme extract was added to a 15 mL test tube that contained 3 mL 0.1 M pH 5.8 of 18 mM guaiacol in a sodium phosphate buffer. The solution was mixed and balanced uniformly at 30 °C in a water bath for 5 min. Then, we added 50 μL of 2.5% (v/v) hydrogen peroxide (H2O2) solution and mixed evenly to start an enzyme reaction with the same volume of distilled water instead of hydrogen peroxide as the blank control, as a zero instrument. After 5 min, the OD470 values were measured. The experiment was repeated three times with each sample. For the SOD, the solution was mixed, and a control tube was placed in darkness. The other tube, at 4000 Lux daylight, reacted for 20 min (requested by the light pipe in line). At the end of the reaction, the order was not made according to the blank control tube of light; the other tube was measured for its absorbance value. For the chlorophyll content, similarly grown K326 was selected. At first, the sixth leaf from the top was selected and treated with a brush dipped in viral juice. The entire leaf was inoculated with the virus and then rinsed with sterile water. Leaves were dried and coated for pharmaceutical facilities. The samples were measured every two days for their chlorophyll content, which was determined as follows. The test samples were placed into 5 mL of 2:1 acetone–ethanol mixture in a refrigerator at 4 °C. Dark extraction was conducted for 24 h. The chlorophyll after extraction was placed in a 1 cm-thick cuvette, with the 2:1 mixture as reference. The UV spectrophotometer was used at 645 and 663 nm to measure absorbance and chlorophyll content (mg·g−1 FW) with Ca + Cb. Ca = 12.7 A663–2.69 A645. Cb = 22.7A645–4.68 A663. Total chlorophyll content = [20.2A645 + 8.02A663]V/1000╳W. In the above equations, A645 and A663 are the absorbance values at the corresponding wavelengths, V is the volume of extraction, W is the leaf fresh weight, and chlorophyll content is described in mg·g−1.
against CMV using CMV inoculated by half leaf methods (Ma et al., 2014; Long et al., 2015b). However, the underlying mechanism of NNM on CMV-infected tobacco remains unclear. Therefore, we must study the specific mechanism of action of antiviral drugs and guide the innovation of new pesticides. In this study, we first investigate the defense activity and chlorophyll content in CMV-inoculated leaves treated with NNM. Then, we analyze the mechanism of the molecular response for the CMV-infected tobacco triggered by NNM using transcriptome sequence technology coupled with bioinformatics and qPCR methods. Our results indicate that NNM can effectively control the tobacco disease caused by CMV by enhancing plant host resistance. 2. Materials and methods 2.1. Plant material and samples collection The CMV virus source was bought from Wuhan Institute of Virology, Chinese Academy of Sciences. Tobacco K326 plants were maintained in an air-conditioned greenhouse at 24 °C with a 16 h daylight and 8 h dark cycle. After three months, the tobacco plants were inoculated at the 5–6 leaf stages with CMV of the control group (CK), 0.5 mg/mL NNM was sprayed on the CMV-inoculated tobacco plants of the treatment group (N), and 0.5 mg/mL ribavirin (RIB) was sprayed on the CMV-inoculated tobacco plants of the treatment group (R). 24 h later, samples of the tobacco plants were collected (on days 1, 3, 5, and 7) and maintained at −80°С for further use. The treatments were conducted under a randomized design with three replicates. NNM (85%), original agent and RIB (98%), and original agent were bought from an insecticide factory. The structural formulae of NNM and RIB are listed in Table 1. 2.2. Defense activity and chlorophyll content measurement 1.0 g leaves (treatment group and control group), 2.0 mL of 0.2 M pH 8.8 sodium borate buffer (containing 5 mM β-mercaptoethanol, 1 mM EDTA), and 2.0 mL sodium borate were placed in a mortar. The mixture was ground into homogenate and transferred to centrifuge tubes. Then, the sample was stirred for 5 min at 4 °C. The sample was refrigerated at 20,000 g for 20 min. The supernatants were stored at −40 °C for further analysis of the phenylalanine ammonia-lyase (PAL), peroxidase (POD), superoxide (SOD), and chlorophyll content (Wang and Huang, 2006). For the PAL, crude enzyme extract was treated with 0.05 M pH 8.8 sodium borate buffer, diluted five times with its L-phenylalanine as the substrate to 3 mL 0.05 M pH 8.8 by sodium borate buffer and 0.5 mL enzyme solution as the blank control. The instrument was set to zero. A UV spectrophotometer was operated at 290 nm, and the OD1 value was measured. The reaction was conducted at 40 °C in a water bath for 5 h
2.3. cDNA library construction and Illumina sequencing We select the CK group and the N group on day 5 for further analysis. Total RNA from fresh leaves in the CK group and the N group on day 5 was extracted using the TRIzol reagent method (Invitrogen Carlsbad, USA). RNA degradation and contamination were monitored on 1% agarose gels. RNA purity was checked using the NanoPhotometer® spectrophotometer (IMPLEN, USA). RNA concentration was measured using a Qubit® RNA Assay Kit in Qubit® 2.0 Fluorometer (Life Technologies, USA). RNA integrity was assessed
Table 1 Series of anti-viral agents. Serial number
Abbreviation
Ningnanmycin
NNM
Ribavirin
RIB
Structures
117
Pesticide Biochemistry and Physiology 156 (2019) 116–122
D. Gao, et al.
Table 2 Primer sequences and the reaction condition used in reverse transcription (RT)-quantitative PCR. Genes name
Forward primer (5′–3′)
Reverse primer (5′–3′)
SOD PAL POD PR-1a β-actin
CTCTGCCATAGACACCAACTT ATACTGCCTCCACTCGGGAT GAATGGGGGCTTCTCTGCTT CAATACGGCGAAAACCTAGCTGA GACGTGACCTAACTGATAACCTGAT
CCAAGTTCGGTCCTTTAATAA ACGCTCGATTATATGGCGCT TTTGGTGCAGCCCTCTTCTC CCTAGCACATCCAACACGAA CTCTCAGCACCAATGGTAATAACTT
sequencing discrepancies when calculating the abundance of expressions.
using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, USA). The cDNA library construction and Illumina sequencing of the samples were performed by Novogene Bioinformatics Technology Co., Ltd. (Beijing, China). A total of 3 μg RNA was used as input material for the RNA sample preparations. Sequencing libraries were generated using NEB Next® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA), and index codes were added to attribute sequences to each sample. In brief, mRNA was purified from total RNA using poly-T oligo-attached magnetic beads. Fragmentation was conducted using divalent cations under elevated temperatures in NEB Next First-Strand Synthesis Reaction Buffer (5×). First-strand cDNA was synthesized using a random hexamer primer and M-MuLV reverse transcriptase (RNase H). Second-strand cDNA synthesis was subsequently performed by DNA polymerase I and RNase H. Remaining products were inserted into blunt ends by exonuclease/polymerase. After adenylation in each ends, a NEB Next Adaptor with hairpin loop structure was constructed for hybridization. To select cDNA fragments of lengths of preferentially 150–200 bp, the library fragments were purified with an AMPure XP system (Beckman Coulter, USA). Then, 3 μL USER Enzyme (NEB, USA) was added to size-selected, adaptor-ligated cDNA and incubated at 37 °C for 15 min, followed by 5 min at 95 °C before PCR. PCR was performed with Phusion High-Fidelity DNA polymerase, Universal PCR primers, and Index (X) Primer. Finally, the PCR products were purified (AMPure XP system), and the library quality was assessed on an Agilent Bioanalyzer 2100 system.
2.6. Gene expression analysis by reverse transcription-qPCR Total RNA was extracted using a Trizol reagent kit (TakaRa, Dalian, China). RNA was reverse-transcribed using a cDNA kit (TakaRa) according to the manufacturer's instructions. The experiments were performed in 10 μL reaction volume and SYBRPremixExTaqII (TakaRa), and an iCycleriQ multicolor real-time PCR Detection System (Bio-Rad, California, CA, USA) was used. Primer sequence information is listed in Table 2. Gene expression was normalized using β-actin as the internal control. The relative copy numbers of the genes were calculated by the 2−ΔΔCt method (Livak and Schmittgen, 2001). 2.7. Statistical analysis Data (mean ± SE) from various samples were subjected to one-way nested analysis of variance (ANOVA) followed by a least significant difference test (LSD) for two sample comparisons and the Tukey test for multiple comparisons for a mean comparison using SPSS Statistics 19.0 (IBM, Chicago, IL, USA). 3. Results and discussion 3.1. Effect of NNM on tobacco defense enzymes
2.4. De novo assembly of short reads and gene annotation
As shown in Fig. 1A, the CMV group of PAL activity in tobacco leaves was increased more than the CK group during days 1–5 and reached the maximum during day 5, there were no significant differences between days 5 and 7. After spraying by NNM, the NNM group of PAL activity was increased more than the TMV group during days 3–7 with significant differences. However, the RIB group of PAL activity in the tobacco leaves was the same as the CMV group with no significant differences. These results indicated that NNM can induce the enhancement of PAL activity to promote plant substances in the metabolism of phenylalanine to generate sufficient phenolic compounds, lignin, and other secondary material. As illustrated in Fig. 1B, the CMV group of POD activity in the tobacco leaves increased more than the CK group during days 1–5 and reached the maximum during days 5–7. After spraying by NNM and RIB, the NNM group of POD activity increased more than the CK and RIB groups during days 3–7 with significant differences. These findings indicated that NNM can stimulate an increase in POD activity and enhance plant resistance against CMV diseases. Otherwise, the RIB group can passivate the virus replication, and the POD activity of the RIB group cannot activate. As depicted in Fig. 1C, compared with CK treatment groups, the CMV group of SOD activity in the leaves decreased considerably during days 1–3 with significant differences. Then, the CMV group of SOD activity maintained a low level during days 5–7 with no significant differences. However, the NNM and RIB groups of SOD activity increased more than the CMV group during days 1–5 with significant differences, reached the maximum on day 5, and dropped during day 7. These results indicated that NNM can increase tobacco SOD activity and enhance the host activity in terms of the scavenging of reactive oxygen
Raw data (raw reads) in fastq format were first processed by inhouse Perl scripts. In this step, clean data (clean reads) were obtained by removing the reads containing adapter, reads containing ploy-N, and low-quality reads from the raw data. Simultaneously, Q20, Q30, GCcontent, and sequence duplication level of the clean data were calculated. All downstream analyses were based on clean data with high quality. De novo transcriptome assembly was conducted using the short reads assembly program Trinity (Grabherr et al., 2011). The overlap settings used for the assembly were 30 bp and 80% similarity, and all the other parameters were set to their default values. Unigenes > 150 bp were aligned by BLASTx with protein databases, including Nr, Swiss-Prot, Kyoto Encyclopedia of Genes and Genomes (KEGG), and COG (e-value < 10−5), to identify proteins with high sequence identity and to assign putative functional annotations. Next, we used the program Blast2GO to obtain Gene ontology (GO) annotations of the unigenes (Conesa et al., 2005), and we obtained the GO functional classifications using the software WEGO (Ye et al., 2006). 2.5. Expression level analysis for unigenes The expression levels (abundances) of the unigenes were calculated by using the fragments per kilobase million (FPKM) method (Trapnell et al., 2010) as follows: FPKM (A) = (1,000,000 × C × 1000)/(N × L), where FPKM (A) is the expression level of gene A, C is the number of reads uniquely aligned to gene A, N is the total number of reads uniquely aligned to all genes, and L is the number of bases in gene A. The FPKM method can eliminate the influence of different gene lengths and 118
Pesticide Biochemistry and Physiology 156 (2019) 116–122
D. Gao, et al.
Fig. 1. PAL, POD, SOD activity, and chlorophyll content in leaves treated with compounds. Different letters in same column pattern are significantly different from each other following by the Duncan's multiple range test to significantly difference at p < .05. Vertical bars refer to mean ± SD (n = 3).
species, thereby reducing the amount of reactive oxygen responsible for cell damage. As shown in Fig. 1D, compared with CMV treatment groups, the NNM and RIB groups of the chlorophyll content of tobacco increased during days 1–7 with significant differences and reached the highest level on day 7. However, in the CMV group, the chlorophyll content of tobacco was lower than in the CK treatment groups during days 1–7 with no significant differences. These findings indicated that NNM and RIB can recover the chloroplast damaged by CMV. 3.2. Tobacco leaves transcriptome sequencing and assembly of CK and N (NNM) The tobacco leaves of CK and N transcriptome were sequenced using the Illumina HiSeq™2500 platform and assembled using Trinity (r20140413p1). In total, ~6.16 (CK) and ~6.03 (N) million raw reads were obtained. After filtering, 5.97 (CK) and 5.83 (N) million clean reads were generated, which comprised 8.95 (CK) and 8.75 (N) gigabases (Gb). The error rates were 0.01% (CK) and 0.01% (N). The Q20 values were 98.12% (CK) and 97.61% (N). The Q30 values were 94.90% (CK) and 93.63% (N). The GC contents were 42.85% (CK) and 42.16% (N).
Fig. 2. Numbers of identified genes showed up- and down-regulation among the N and CK groups. Red spots represent the up-regulated genes, and blue dots represent the down-regulated genes. The horizontal coordinates indicate the change in multiple expression between the N and CK groups. The longitudinal coordinates indicate the magnitude of differences in gene level. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
3.3. Analysis of gene expression obtained using the Blast2GO pipeline according to a BLASTx search against a non-redundant (NR) database. The GO annotations were used to classify the transcripts into functional groups on the basis of specific GO categories. Among the 33,296 unigenes in the N groups, 5132 (15.41%) could be assigned to various GO terms, and of the 30,689 unigenes in the CK groups, 2525 (8.23%) could be assigned to various GO terms (Fig. 3 and Supplementary Table 1). In the molecular function category, the genes expressed in the N groups were mostly enriched for biological processes (e.g., oxidation
Gene expression results showed the total numbers of the identified genes, which included 2456 up-regulated proteins (red dots) and 2070 down-regulated proteins (blue dots) in the N and CK groups was 4526 in the volcano plot (Fig. 2). 3.4. Gene ontology (GO) annotation Gene ontology (GO) annotations for all of the unigenes were 119
Pesticide Biochemistry and Physiology 156 (2019) 116–122
D. Gao, et al.
play important roles in defending the disease. Few studies have shown that α-linolenic acid played an important role in gene expression and plant stress (Sun et al., 2017), and proline played an important role in plant osmoregulation and plant drought resistance (Yang et al., 2017b; Yamada et al., 2005). The results showed that alpha-linolenic acid metabolism; alanine, aspartate, glutamate, and linoleic acid metabolism; and valine, leucine, and isoleucine degradation, and arginine, proline metabolism were the key factors in the tobacco leaves by N groups (Supplementary Table 2). In the previous studies, studies reported that NNM could regulate systemic acquired resistance and induce systemic resistance (Han et al., 2014). Some antiviral compounds could activate the biochemical factors in CMV infected plant. For instance, quinazoline derivative could increase the chlorophyll content in plants and enhance photosynthesis in CMV-infected plant (Xie et al., 2018), and dithioacetal derivatives could induce the accumulation of abscisic acid to enhance the CMV disease resistance (Chen et al., 2018), and dithioacetal compound xiangcaoliusuobingmi could trigger the abscisic acid pathway to enhance the CMV disease resistance (Shi et al., 2018).
Fig. 3. Venn diagram for genes identification in the N and CK groups. In the total protein, 33,296 (N) and 30,689 (CK) were identified in the two groups, of which 5132 and 2525 genes are shown in the yellow and pink parts, respectively, and these were specifically expressed in the N and CK groups, respectively. FPKM > 1 was used as a standard of gene expression. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
3.6. Gene expression levels of PAL, POD, SOD, and PR-1a To verify the high-expression defense genes by NNM, defense genes PAL, POD, SOD, and PR-1a were investigated by reverse transcription quantitative real-time PCR (RT-qPCR). The results demonstrated that the relative expression levels of PAL, POD, SOD, and PR-1a by NNM were significantly higher than those of the CK group on day 5. The relative expression levels of PAL, POD, SOD, and PR-1a gene were −1.03 (CK −0.65), −1.48 (CK −0.75), −1.33 (CK −1.00), and −1.10 (CK −0.87), respectively, which were highly up-regulated by NNM treatment after 5 days. There were significant differences of PAL, POD, and SOD between the N group and the CK group (Fig. 5).
reduction process, metabolic process, and single-organism metabolic process) and molecular functions (e.g., oxidoreductase activity). As regards biological process categorization, the most common were oxidation reduction and metabolic processes (Fig. 4).
3.5. KEGG pathway annotation KEGG was used to research the response to the action of NNM in tobacco. KEGG pathway enrichment analysis revealed that the upregulated differentially expressed genes between N and CK treatment were mainly enriched with genes regulating alpha-linolenic acid metabolism; alanine, aspartate, glutamate metabolism; valine, leucine, and isoleucine degradation, and arginine, proline metabolism. These genes
4. Conclusions Given that the activity of anti-plant virus compounds is related to host tobacco, virus, and compounds, we determined the effect of antiCMV compound NNM on defense enzyme activity and chlorophyll
Fig. 4. Gene ontology (GO) classifications of the N and CK group unigenes. “*” represent the highly enriched GO term. 120
Pesticide Biochemistry and Physiology 156 (2019) 116–122
D. Gao, et al.
2010. Proteomic analysis of the plant-virus interaction in cucumber mosaic virus (cmv) resistant transgenic tomato. J. Proteome Res. 9, 5684–5697. Di, C.M., Benvenuto, E., Donini, M., 2012. Recent insights into plant-virus interactions through proteomic analysis. J. Proteome Res. 11, 4765–4780. Elena, S.F., Rodrigo, G., 2012. Towards an integrated molecular model of plant–virus interactions. Curr. Opin. Virol. 2, 713–718. Gao, S., Zhang, R.Y., Yu, Z.H., Xi, Z., 2012. Antofine analogues can inhibit tobacco mosaic virus assembly through small-molecule-rna interactions. Chembiochem 13, 1622–1627. Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I., Adiconis, X., Fan, L., Raychowdhury, R., Zeng, Q.D., Chen, Z.H., Mauceli, E., Hacohen, N., Gnirke, A., Rhind, N., Palma, F.D., Birren, B., Nusbaum, C., Lindblad-Toh, K., Lindblad-Toh, N., Regev, A., 2011. Full-length transcriptome assembly from rna-seq data without a reference genome. Nat. Biotechnol. 29, 644–652. Guiu-Aragonés, C., Díaz-Pendón, J.A., 2015. Four sequence positions of the movement protein of cucumber mosaic virus determine the virulence against cmv1-mediated resistance in melon. Mol. Plant Pathol. 16, 675–684. Han, Y.G., Luo, Y., Qin, S.R., Lei, X., Wan, B., Du, L.F., 2014. Induction of systemic resistance against tobacco mosaic virus by ningnanmycin in tobacco, Pestic. Biochem. Phys. 111, 14–18. Jacquemond, M., 2012. Cucumber mosaic virus. Adv.Virus Res. 84, 439–504. Jones, J.D., Dangl, J.L., 2006. The plant immune system. Nature 444, 323–329. Kang, W.H., Seo, J.K., Chung, B.N., Kim, K.H., Kang, B.C., 2012. Helicase domain encoded by cucumber mosaic virus rna1 determines systemic infection of cmr1 in pepper. PLoS One 7, e43136. Lan, X.M., Xie, D.D., Yin, L.M., Wang, Z.Z., Chen, J., Zhang, A.W., Song, B.A., Hu, D.Y., 2017. Novel α,β-unsaturated amide derivatives bearing α-amino phosphonate moiety as potential antiviral agents. Bioorg. Med. Chem. Lett. 27, 4270–4273. Li, Y.M., Wang, L.H., Li, S.L., Chen, X.Y., Shen, Y.M., Zhang, Z.K., He, H.P., Xu, W.B., Shu, Y.L., Liang, G.D., Fang, R.X., Hao, X.J., 2007. Seco-pregnane steroids target the subgenomic rna of alphavirus-like rna viruses. P. Nati. Acad. Sci. USA 104, 8083–8088. Li, X.Y., Chen, Z., Jin, L.H., Hu, D.Y., Yang, S., 2016. New strategies and methods to study interactions between tobacco mosaic virus coat protein and its inhibitors. Int. J. Mol. Sci. 17, 841–846. Li, X.Y., Hao, G.F., Wang, Q.M., Chen, Z., Ding, Y., Yu, L., Song, D.Y.Hu.B.A., 2017. Ningnanmycin inhibits tobacco mosaic virus virulence by binding directly to its coat protein discs. Oncotarget 8, 82446–82458. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative pcr and the 2(−delta delta c(t)) method. Methods 25, 402–408. Long, C.W., Li, P., Chen, M.H., Dong, L.R., Hu, D.Y., Song, B.A., 2015. Synthesis, antitobacco mosaic virus and cucumber mosaic virus activity, and 3D-QSAR study of novel 1,4-pentadien-3-one derivatives containing 4-thioquinazoline moiety. Eur. J. Med. Chem. 102, 639–647. Ma, J., Li, P., Li, X.Y., Shi, Q.C., Wan, Z.H., Hu, D.Y., Song, B.A., 2014. Synthesis and antiviral bioactivity of novel 3-((2-((1e,4e)-3-oxo-5-arylpenta-1,4-dien-1-yl)phenoxy) methyl)-4(3h)-quinazolinone derivatives. J. Agric. Food Chem. 62, 8928–8934. Mochizuki, T., Ohki, S.T., 2012. Cucumber mosaic virus: viral genes as virulence determinants. Mol. Plant Pathol. 13, 217–225. Moyle, R., Pretorius, L.S., Shuey, L.S., Nowak, E., Schenk, P.M., 2018. Analysis of the complete genome sequence of cucumber mosaic virus strain k. Genome Announc. 6, e00053. Nemes, K., Gellért, Á., Balázs, E., Salánki, K., 2014. Alanine scanning of cucumber mosaic virus (cmv) 2b protein identifies different positions for cell-to-cell movement and gene silencing suppressor activity. PLoS One 9, e112095. Revathy, K.A., Bhat, A.I., 2017. Complete genome sequencing of cucumber mosaic virus from black pepper revealed rare deletion in the methyltransferase domain of 1a gene. Virus Dis. 28, 309–314. Salánki, K., Gellért, A., Huppert, E., Náray-Szabó, G., Balázs, E., 2004. Compatibility of the movement protein and the coat protein of cucumoviruses is required for cell-tocell movement. J. Gen. Virol. 85, 1039–1048. Shen, Y., Zhao, X.H., Yao, M., Li, C., Miriam, K., Zhang, X., Tao, X.R., 2014. A versatile complementation assay for cell-to-cell and long distance movements by cucumber mosaic virus based agro-infiltration. Virus Res. 190, 25–33. Shi, J., Yu, L., Song, B.A., 2018. Proteomics analysis of xiangcaoliusuobingmi-treated capsicum annuum l, infected with cucumber mosaic virus. Pestic. Biochem. Phys. 149, 113–122. Sun, H., Chen, L., Li, J., Hu, M., Ullah, A., He, X., Yang, X., Zhang, X., 2017. The JASMONATE ZIM-domain gene family mediates JA signaling and stress response in cotton. Plant Cell Physiol. 58, 2139–2154. Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., Salzberg, S.L., Wold, B.J., Pachter, L., 2010. Transcript assembly and quantification by rna-seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 28, 511–515. Wang, X.K., Huang, J.L., 2006. Experimental Principle and Technology for Plant Physiology and Biochemistry, Second ed. Higher Education Press, Beijing. Wang, B.N., Yang, X.F., Zeng, H.M., Liu, H., Zhou, T.T., Tan, B.B., Yuan, J.J., Guo, L.H., Qiu, D.W., 2012. The purification and characterization of a novel hypersensitive-like response-inducing elicitor from verticillium dahliae that induces resistance responses in tobacco. Appl. Microbiol. Biotechnol. 93, 191–201. Wang, Y.Y., Xu, F.Z., Zhu, Y.Y., Song, B.A., Luo, D.X., Yu, G., Chen, S.H., Xue, W., Wu, J., 2018. Pyrazolo[3,4- d ]pyrimidine derivatives containing a schiff base moiety as potential antiviral agents. Bioorg. Med. Chem. Lett. 28, 2979–2984. Wu, Z.X., Zhang, J., Chen, J.X., Pan, J.K., Zhao, L., Liu, D.Y., Zhang, A.W., Chen, J., Hu, D.Y., Song, B.A., 2017. Design, synthesis, antiviral bioactivity, and 3d-qsar study of novel ferulic acid ester derivatives containing quinazoline moiety. Pest Manag. Sci.
Fig. 5. Gene expression analysis of the defense genes by RT-qPCR. The gene expression levels of PAL, POD, SOD, and PR-1a in tobacco K326 leaves on day 5 were highly up-regulated by N groups. Different letters in same column pattern are significantly different from each other following by the Duncan's multiple range test to significantly difference at p < .05. Vertical bars refer to mean ± SD (n = 3).
index in tobacco, and we used RIB as the control agent. The results showed that the content of PAL, POD, SOD, and chlorophyll in tobacco leaves increased significantly after being sprayed with NNM for days 1–7. The best activity was achieved on day 5. Then, we selected the transcriptome sequencing study on the tobacco leaves of the NNM treatment group and the CK treatment group on day 5. GO enrichment results showed that the NNM treatment group can enhance the tobacco oxidation reduction process, metabolic process, and single-organism metabolic process. Differential gene KEGG enrichment results showed that the NNM treatment group can accelerate tobacco alpha-linolenic acid metabolism; alanine, aspartate, glutamate, and linoleic acid metabolism; and valine, leucine, and isoleucine degradation, and arginine, proline metabolism. Furthermore, q-PCR results showed that the defense genes PAL, POD, SOD, and PR-1a were up-regulated by NNM on day 5 in CMV-inoculated leaves. The results corresponded to recent studies that implied that NNM strengthens the defensive enzyme activities and promotes the systemic accumulation of pathogenesis-related proteins in TMV- and CMV-inoculated tobacco thereby producing antiviral activity (Han et al., 2014). Supplementary data to this article can be found online at https:// doi.org/10.1016/j.pestbp.2019.02.012. Acknowledgement This work was supported by National Key Research and Development Program of China (No. 2017YFD0200503-3) and National Natural Science Foundation of China (Nos. 21502032 and 31460460). References Alazem, M., Lin, N., 2015. Roles of plant hormones in the regulation of host–virus interactions. Mol. Plant Pathol. 16, 529–540. Chen, Z., Zeng, M.J., Song, B.A., Hou, C.R., Hu, D.Y., Li, X.Y., Wang, Z.C., Fan, H.T., Bi, L., Liu, J.J., Yu, D.D., Jin, L.H., Yang, S., 2012. Dufulin activates hrbp1 to produce antiviral responses in tobacco. PLoS One 7, e37944. Chen, M.H., Li, P., Hu, D.Y., Zeng, S., Li, T., Jin, L.H., Yue, M., Song, B.A., 2016. Synthesis, antiviral activity, 3d-qsar, and interaction mechanisms study of novel malonate derivatives containing quinazolin-4(3h)-one moiety. Bioorg. Med. Chem. Lett. 26, 168–173. Chen, J., Shi, J., Yu, L., Liu, D.Y., Gan, X.H., Song, B.A., Hu, D.Y., 2018. Design, synthesis, antiviral bioactivity, and defense mechanisms of novel dithioacetal derivatives bearing a strobilurin moiety. J. Agric. Food Chem. 66, 5335–5345. Conesa, A., Götz, S., García-Gómez, J.M., Terol, J., Talón, M., Robles, M., 2005. Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 21, 3674–3676. Di, C.M., Villani, M.E., Bianco, L., Lombardi, R., Perrotta, G., Benvenuto, E., Donini, M.,
121
Pesticide Biochemistry and Physiology 156 (2019) 116–122
D. Gao, et al.
Ye, J., Fang, L., Zheng, H.K., Zhang, Y., Chen, J., Zhang, Z.J., Wang, J., Li, S.T., Li, R.Q., Bolund, L., Wang, J., 2006. Wego: a web tool for plotting GO annotations. Nucleic Acids Res. 34, 293–297. Yu, L., Wang, W.L., Zeng, S., Chen, Z., Yang, A.M., Shi, J., Zhao, X.Z., Song, B.A., 2017. Label-free quantitative proteomics analysis of cytosinpeptidemycin responses in southern rice black-streaked dwarf virus-infected rice. Pestic. Biochem. Phys. 147, 20–26. Zhang, G.P., Hao, G.F., Kan, J.P., Zhang, J., Hu, D.Y., Song, B.A., 2016. Asymmetric synthesis and bioselective activities of α-amino-phosphonates based on the dufulin motif. J. Agric. Food Chem. 64, 4207–4213. Zhang, X.P., Liu, D.S., Yan, T., Fang, X.D., Dong, K., Xu, J., Wang, Y., Yu, J.L., Wang, X.B., 2017a. Cucumber mosaic virus coat protein modulates the accumulation of 2b protein and antiviral silencing that causes symptom recovery in planta. PLoS Pathog. 13, e1006522. Zhang, J., Zhao, L., Zhu, C., Wu, Z.X., Zhang, G.P., Gan, X.G., Liu, D.Y., Pan, J.K., Hu, D.Y., Song, B.A., 2017b. Facile synthesis of novel vanillin derivatives incorporating a bis(2-hydroxyethyl)dithioacetal moiety as antiviral agents. J. Agric. Food Chem. 65, 4582–4588. Zipfel, C., 2014. Plant pattern-recognition receptors. Trends Immunol. 35, 345–351.
73, 2079–2089. Xiang, G.X., Hu, H.Z., Chen, J.R., Chen, W.X., Wu, L.S., 1995. A new agricultural antibiotic—ningnanmycin. Acta Microbiol Sin. 36, 368–374. Xie, D.D., Shi, J., Zhang, A.W., Lei, Z.W., Zu, G.C., Fu, Y., Gan, X.H., Yin, L.M., Song, B.A., Hu, D.Y., 2018. Syntheses, antiviral activities and induced resistance mechanisms of novel quinazoline derivatives containing a dithioacetal moiety. Bioorg. Chem. 80, 433–443. Yamada, M., Morishita, H., Urano, K., Shiozaki, N., Yamaguchi-Shinozaki, K., Shinozaki, K., Yoshiba, Y., 2005. Effects of free proline accumulation in petunias under drought stress. J. Exp. Bot. 56, 1975–1981. Yamaguchi, N., Seshimo, Y., Yoshimoto, E., Ahn, H.I., Ryu, K.H., Choi, J.K., Masuta, C., 2005. Genetic mapping of the compatibility between a lily isolate of cucumber mosaic virus and a satellite rna. J. Gen.Virol. 86, 2359–2369. Yang, A.M., Yu, L., Chen, Z., Zhang, S.X., Shi, J., Zhao, X.Z., Yang, Y.Y., Hu, D.Y., Song, B.A., 2017a. Label-free quantitative proteomic analysis of chitosan oligosaccharidetreated rice infected with southern rice black-streaked dwarf virus. Viruses 9, 115. Yang, H., Zhao, L., Zhao, S., Wang, J., Shi, H., 2017b. Biochemical and transcriptomic analyses of drought stress responses of LY1306 tobacco strain. Sci. Rep. 7, 17442. https://doi.org/10.1038/s41598-017-17045-2.
122