- Email: [email protected]
Activation of GR but not PXR by dexamethasone attenuated acetaminophen hepatotoxicities via Fgf21 induction
Accepted Manuscript Title: Activation of GR but not PXR by Dexamethasone Attenuated Acetaminophen Hepatotoxicities via Fgf21 Induction Authors: Saurabh G. Vispute, Pengli Bu, Yuan Le, Xingguo Cheng PII: DOI: Reference:
S0300-483X(17)30009-4 http://dx.doi.org/doi:10.1016/j.tox.2017.01.009 TOX 51812
To appear in:
Toxicology
Received date: Revised date: Accepted date:
8-8-2016 5-1-2017 9-1-2017
Please cite this article as: Vispute, Saurabh G., Bu, Pengli, Le, Yuan, Cheng, Xingguo, Activation of GR but not PXR by Dexamethasone Attenuated Acetaminophen Hepatotoxicities via Fgf21 Induction.Toxicology http://dx.doi.org/10.1016/j.tox.2017.01.009 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Title: Activation of GR but not PXR by Dexamethasone Attenuated Acetaminophen
Hepatotoxicities via Fgf21 Induction Authors: Saurabh G. Vispute, Pengli Bu, Yuan Le, and Xingguo Cheng* Affiliations: Department of Pharmaceutical Sciences, College of Pharmacy and Health Sciences, St. John’s University, 8000 Utopia Parkway, Queens, NY 11439, USA (S.G.V., P.B., Y.L., and X.C.) Department of Biological Sciences, College of Liberal Arts and Sciences, St. John's University, 8000 Utopia Parkway, Queens, NY 11439, USA (P.B.) *Corresponding Author: Xingguo Cheng, Ph.D.: Department of Pharmaceutical Sciences, St. John’s University, 8000 Utopia Parkway, Queens, NY 11439, USA. E-mail: [email protected]
Running title: DEX-induced Fgf21 protects against acetaminophen toxicity
Number of table: 1 Number of figures: 8 Number of references: 44 Number of words in the Abstract: 211 Number of words in the Introduction: 333 Number of words in the Discussion: 1322
Abbreviation: APAP, Acetaminophen; bp, base pair; ChIP, chromatin immunoprecipitation; Cyp, cytochrome p450 enzyme; DEX, dexamethasone; Fgf21, fibroblast growth factor 21; GR, glucocorticoid receptor; GRE, glucocorticoid receptor response element; GSH, Glutathione; i.p., intraperitoneal; NAPQI, N-acetyl-p-benzoquinone imine; PGC1α, peroxisome proliferator-activated receptor gamma coactivator protein-1alpha; PPAR, peroxisome proliferator-activated receptor;
1
PXR, pregnane X receptor; TSS, transcription start site; WAT, white adipose tissue; WT, wild-type
2
Abstract: Glucocorticoid receptor (GR) signaling is indispensable for cell growth and development, and plays important roles in drug metabolism. Fibroblast growth factor (Fgf) 21, an important regulator of glucose, lipid, and energy metabolism, plays a cytoprotective role by attenuating toxicities induced by chemicals such as dioxins, acetaminophen (APAP), and alcohols. The present study investigates the impact of dexamethasone (DEX)-activated GR on Fgf21 expression and how it affects the progression of APAP-induced hepatotoxicity. Our results showed that DEX dose/concentration- and time-dependently increased Fgf21 mRNA and protein expression in mouse liver as well as cultured mouse and human hepatoma cells. By using PXR-null mouse model, we demonstrated that DEX induced Fgf21 expression by a PXR-independent mechanism. In cultured mouse and human hepatoma cells, inhibition of GR signaling, by RU486 (Mifepristone) or GR silencing using GR-specific siRNA, attenuated DEX-induced Fgf21 expression. In addition, DEX increased luciferase reporter activity driven by the 3.0-kb mouse and human Fgf21/FGF21 gene promoter. Further, ChIP-qPCR assays demonstrated that DEX increased the binding of GR to the specific cis-regulatory elements located in the 3.0-kb mouse and human Fgf21/FGF21 gene promoter. Pretreatment of 2 mg/kg DEX ameliorated APAP-induced liver injury in wild-type but not Fgf21-null mice. In conclusion, via GR activation, DEX induced Fgf21 expression in mouse liver and human hepatoma cells. Highlights:
DEX induced Fgf21/Fgf21 expression in both mouse and human liver/hepatoma cells.
Fgf21 is a direct target gene of GR.
Pretreatment of 2mg/kg DEX attenuates acetaminophen hepatotoxicity.
Key words: Fgf21, dexamethasone, glucocorticoid receptor, acetaminophen, hepatotoxicity
3
Introduction: Fibroblast growth factor (Fgf) 21 is originally recognized as a metabolic regulator of glucose, lipid, and energy homeostasis (Itoh and Ornitz, 2008; 2011; Kharitonenkov et al., 2005; Potthoff et al., 2009). Recent studies suggest that Fgf21 is also a stress-induced factor in the liver (Luo and McKeehan, 2013) and gain-of-function of Fgf21 can protect against endoplasmic reticulum stress (Jiang et al., 2014), oxidative stress (Xu et al., 2015; Yu et al., 2015), xenobiotic-induced stress, cardiac atrophy (Planavila et al., 2015), and acetaminophen-induced hepatotoxicity (Ye et al., 2014). In mouse liver, Fgf21 can be induced by fasting and ketogenic diet as an adaptive response via a peroxisome proliferator-activated receptor (PPAR) α-dependent mechanism (Bohensky et al., 2010). Our previous study also demonstrated that activation of aryl hydrocarbon receptor (AhR) induced mouse and human Fgf21 expression and Fgf21 induction attenuated dioxin-induced toxicities (Rier, 2002).
Glucocorticoid receptor (GR) signaling plays an important role in cellular processes such as inflammation, cell proliferation and differentiation, stress response, and metabolism. Upon ligand binding, GR translocates into the nucleus. In the nucleus, activated GR, as either dimer or monomer, can directly bind to the GR response elements (GREs) located in the promoter of its target genes and thus regulate their expression (Lim et al., 2015; Schiller et al., 2014). GR can be activated by endogenous chemicals (e.g. cortisol) or synthetic corticosteroids such as dexamethasone (DEX) and prednisone.
A previous report showed that glucocorticoids stimulated Fgf21 transcription in mouse liver as well as in cultured primary mouse hepatocytes via interaction between GR and PPARα activation (Patel et al., 2015). In the present study, we showed that DEX increased Fgf21 expression in mouse liver as well as in cultured mouse and human hepatoma cells by directly increasing the binding of GR to the specific cis-regulatory elements that are located within the 3.0-kb mouse or human
4
Fgf21/FGF21 gene promoter. In addition, we showed that pretreatment of 2 mg/kg DEX in mice, via Fgf21 induction, attenuated the progression of acetaminophen-induced acute liver injury.
5
Materials and Methods: Materials. Dexamethasone (DEX) was purchased from Alfa Aesar (Ward Hill, MA). Formaldehyde and Mifepristone (RU486) were purchased from TCI America (Cambridge, MA). All other chemicals, unless otherwise indicated, were purchased from Thermo Fisher Scientific (Fairlawn, NJ). Chromatin immunoprecipitation (ChIP) assay kit (EZ-ChIP 17-391) and mouse FGF-21 ELISA Kit (EZRMFGF21-26K) were purchased from Millipore (Billerica, MA). DualLuciferase Reporter assay system was purchased from Promega (Madison, WI).
Anti-Fgf21 antibodies against mouse and human Fgf21/FGF21 protein were obtained from Biovendor (Asheville, NC; Cat. # RD181108100, Lot # RD-2444 for Human anti-FGF21; Cat. # RD281108100, Lot # RD-2551 for mouse anti-Fgf21). β-actin antibody was obtained from Abgent (San Diego, CA; Cat. # AM1829B). Anti-GR polyclonal antibody (Cell Signaling Technology, Danvers, MA; Cat. # 3660), IgG (Cat. # 12-371B, Lot # 2713276) and RNA Pol II (Cat # 05-623B, Lot # 2548997) antibodies (Millipore, Billerica, MA), goat anti-mouse IgG horseradish peroxidase (HRP)-linked (Cat. # 31430, Thermo Fisher Scientific, Fairlawn, NJ), goat anti-rabbit biotin conjugate (Cat. # 31820, Lot # QA1966741) and avidin HRP-linked secondary antibodies (Cat. # 21130, Lot # PJ208901) (Pierce, Rockford, IL) were all obtained commercially.
Animals and treatment. Eight-week-old adult male C57BL/6 mice were purchased from The Jackson Laboratories (Bar Harbor, ME). Breeding pairs of Fgf21-null mice and corresponding wildtype mice were kindly provided by Dr. Steven Kliewer (UT Southwestern Medical Center, Dallas, TX) (Potthoff et al., 2009). The mice were housed according to the guidance of Association for Assessment and Accreditation of Laboratory Animal Care International at St. John’s University animal facility under a standard 12-h light: dark cycle with free access to regular rodent chow and water ad libitum.
6
Dose- and time-response study: Groups of five mice were administered DEX (2 and 50 mg/kg, i.p. dissolved in corn oil) once daily for 2, 7, and 14 days. Control groups received corn oil by the same route. All injections were administered in a volume of 5 ml/kg. Blood was collected on day 3, 8, and 15, and serum was isolated and stored at -80°C until use. Livers were collected on day 3, 8, and 15, snap-frozen in liquid nitrogen, and stored at -80°C. One portion of freshly collected liver sample was processed for ChIP assays.
DEX treatment in wild-type and PXR-null mice: Adult (approximately 8 weeks of age) male wildtype and age-matched male PXR-null mice (n=5/treatment) were administered i.p. once daily for 4 days with either corn oil or DEX (50 mg/kg). Livers were collected on Day 5, snap-frozen in liquid nitrogen, and stored at -80°C until use.
DEX and acetaminophen treatment. For pretreatment study, adult male wild-type mice (approximately 8-weeks of age) and age-matched male Fgf21-null mice were divided into four treatment groups (n=3-5/treatment). Group-1 and 2 received corn oil once daily through i.p. administration. Group-3 and 4 were once daily pre-treated with DEX (2 mg/kg, dissolved in corn oil; i.p. administration) for 7 days. On day 8, Group-2 and 4 mice were given a single i.p. administration of acetaminophen (300 mg/kg, dissolved in saline). After 4, 8, and 24 hours of acetaminophen challenge, blood was collected, and mouse sera were isolated and stored at -80°C until use. Livers were also collected, snap-frozen in liquid nitrogen, and stored at -80°C until use.
For co-treatment study, approximately eight-weeks old male wild-type mice (n=5/group) were given a single i.p. administration of vehicle (saline), DEX (2 mg/kg, dissolved in corn oil), acetaminophen (300 mg/kg, dissolved in saline), and co-treatment of DEX (2 mg/kg) and acetaminophen (300 mg/kg). Blood was collected 24 hours later. Mouse sera were isolated and stored at -80°C until use. Livers were also collected, snap-frozen in liquid nitrogen, and stored at -80°C.
7
Cell culture and treatment. Mouse Hepa1c1c7 cells were grown in Alpha 1x minimum essential medium (Mediatech, Inc., Manassas, VA) supplemented with 10% fetal bovine serum (Atlanta Biologicals, Flowery Branch, GA) at 37 °C in a humidified atmosphere of 5% CO2. Human Hep3B cells were grown in Dulbecco's Modified Eagle Media (Mediatech, Inc., Manassas, VA) supplemented with 10% fetal bovine serum (Atlanta Biologicals, Flowery Branch, GA) at 37 °C in a humidified atmosphere of 5% CO2.
Concentration- and time-dependent induction of Fgf21 expression by dexamethasone. Mouse Hepa1c1c7 and human Hep3B cells were cultured in 6-well plates and allowed to grow to 80-85% confluence. Cultured hepatoma cells, in triplicate, were incubated with vehicle (0.1% DMSO) or DEX (1μM, 3 μM, or 10μM) for 12 hours, 24 hours, or 48 hours. Then, cells were harvested and total RNAs were extracted using Trizol RNA extraction reagent (Life Technologies, Grand Island, NY).
DEX and RU486 co-treatment study. Mouse Hepa1c1c7 and human Hep3B cells were cultured in 6-well plates and allowed to grow to 80-85% confluence. Cultured hepatoma cells, in triplicate, were incubated with vehicle (0.1% DMSO), 10 μM DEX, or co-treatment of 3 μM RU486 and 10μM DEX. Cells were harvested 24 hours later and total RNAs were extracted.
siRNA mediated GR knockdown. Mouse Hepa1c1c7 and human Hep3B cells were seeded in 6well plates and transfected with either control (On-TARGETplus non-targeting pool siRNA) or GR specific siRNAs, L-045970-01-0005 (targeting mouse GR) and L-003424-00-0005 (targeting human GR) respectively (GE Dharmacon, Lafayette, CO) at various concentrations to determine the optimal knockdown efficiency. After achieving the optimal knockdown conditions (75% to 85% knockdown of GR mRNA with 10nM and 25nM siRNA), the cells were treated with DEX (10μM) for
8
24 hours. Cells were then harvested and total RNAs were extracted.
Protein extraction and Western blots. Cytoplasmic protein from mouse liver was extracted using NE-PER Nuclear and Cytoplasmic Extraction Reagent kit (Pierce Biotechnology, Inc., Rockford, IL), according to the manufacturer's instructions. The protein concentrations were quantified spectrophotometrically at 280nm. The protein samples (60 μg protein/lane) were resolved on a 15% SDS-polyacrylamide gel. Following electrophoresis, proteins were transferred to a 0.45μm polyvinylidene fluoride (PVDF) membrane. Then, the membrane was blocked for two hours in 5% BSA in Tris-buffered saline (TBS). The membrane was next incubated overnight with anti-mouse Fgf21 antibody (1:500 in 2.5% BSA in TBS) at 4°C. β-actin antibody was used as a loading control. After thorough washing, the membrane was incubated with goat anti-rabbit biotin-conjugated secondary antibody (1:5,000 dilution in 2.5% non-fat milk in TBS) for 2 hours at room temperature. The membrane was washed again and incubated with avidin HRP-linked secondary antibody (1:5,000) for 30 minutes at room temperature. Immunoreactive bands in the membrane were detected with Immobilon Chemiluminescence reagent (Millipore, Billerica, MA) and Biospectrum Imaging system (UVP, Upland, CA). The intensity of protein bands was quantified with ImageJ software (NIH).
Quantification of serum Fgf21 protein. Ten μL of mouse serum samples were processed for quantification of Fgf21 protein levels using Millipore’s Rat/Mouse FGF21 ELISA kit (Billerica, MA) as per the manufacturer’s instructions.
Total RNA isolation and quantitative real-time PCR. Total RNAs were isolated using Trizol RNA extraction reagent (Life Technologies, Grand Island, NY) according to the manufacturer's instructions. RNA pellets were re-suspended in diethyl pyrocarbonate-treated deionized water. RNA concentrations were quantified spectrophotometrically at 260nm using Eppendorf
9
Biospectrometer (Hauppauge, NY). RNA integrity of each sample was evaluated by formaldehyde agarose gel electrophoresis before quantification. The mRNA expression of individual gene(s) was quantified by quantitative real-time PCR (StepOnePlus™, Applied Biosystems, CA). Target gene mRNA levels were normalized to 18s rRNA expression and presented as relative fold/percent of the control group. Dual® Luciferase reporter assays. Construction of recombinant luciferase reporter plasmids. Mouse genomic DNA was used as the template to clone a 3.0-kb fragment containing the 5′-flanking region of mouse Fgf21 gene by highfidelity PCR. A human BAC clone (RP11-165B22 obtained from CHORI, Oakland, CA) was used as DNA template to clone a 3.0-kb fragment containing the 5′-flanking region of human FGF21 gene by high-fidelity PCR. The 3.0-kb PCR products were gel-purified and ligated to luciferase reporter gene vector pGL3-basic (Promega, Madison, WI). The sequences of recombinant reporter gene constructs were confirmed by DNA sequencing (Eurofins Genomics, Louisville, KY).
Transient transfection and Dual® Luciferase reporter Assays. Mouse Hepa1c1c7 and human Hep3B cells were seeded onto 24-well plates at a density of 5 x 104 cells/well and 8 x 104 cells/well, respectively. Each well was transfected with individual pGL3 reporter construct (empty pGL3-basic vector, mouse Fgf21-pGL3 reporter construct, or human FGF21-pGL3 reporter construct) (800 ng/well) and phRL-CMV vector encoding Renilla luciferase (10 ng/well) using Lipofectamine 2000 reagent (Life Technologies, Grand Island, NY). After transfection for 6 hours, the medium was replaced with fresh medium. Following 24 hours’ recovery, the cells were treated with DEX (10 μM) for another 24 hours. Then, cells were lysed and Dual® Luciferase reporter assays were performed according to the manufacturer's instructions (Promega, Madison, WI).
Chromatin Immunoprecipitation (ChIP)-qPCR assays. Online software Alibaba 2.1 (http://www.gene-regulation.com/pub/programs/alibaba2) was first used to screen putative GR
10
response elements (GREs) in the 3.0-kb promoter regions of the mouse or human Fgf21/FGF21 gene.
These putative GREs were further analyzed by ChIP-qPCR assays using mouse liver samples. Briefly, approximately 50 mg of mouse liver was homogenized using Dounce homogenizer in 1 ml of PBS supplemented with phenylmethylsulfonyl fluoride (PMSF) and protease inhibitor cocktail (Pierce, Rockford, IL). Then, liver tissue suspension was mixed with freshly prepared formaldehyde at a final concentration of 1% and gently rotated for 20 min at room temperature to allow DNAprotein cross-linking. Next, the processed liver tissue suspension was sonicated (sonication settings: amplitude 50; 10 seconds on and 30 seconds off, 25 cycles) to truncate genomic DNA into DNA fragments ranged between 200 and 1,000 bp by using Sonic Dismembrator ultrasonic processor (Fisher Scientific, Waltham, MA). ChIP assays were performed using EZ-ChIP assay kit (Millipore, Billerica, MA) as per the manufacturer's instructions. Specifically, 10 μg of GR antibody, 1μg IgG (negative control), and 1μg RNA Pol II (positive control) antibody were used for immunoprecipitation. Precipitated DNA was purified and dissolved in 20 μL of water. Three μL of DNA solution was used for the quantitative real-time PCR reaction. The primers flanking the specific putative GREs are given in Table 1.
ChIP assays were also performed in cultured mouse and human hepatoma cells. Briefly, cells were cultured in T-25 flask and treated with DEX (10μM) for 24 hours. Control group received fresh media with 0.1% DMSO. Freshly harvested cells were processed for DNA-protein crosslinking with formaldehyde at a final concentration of 1% for 10 min at room temperature. Sonication of processed cell lysate was performed using Sonic Dismembrator ultrasonic processor (Fisher Scientific, Waltham, MA) to sheet genomic DNA into DNA fragments ranged between 200 and 1,000 bp (sonication settings: amplitude 30; 10 seconds on and 30 seconds off, 6-8 cycles).
11
Quantification of Alanine aminotransferase (ALT), Aspartate aminotransferase (AST) and total glutathione (GSH) levels in mouse serum. The freshly collected mouse serum samples were analyzed by enzymatic colorimetric assays using ALT and AST assay kits in accordance with manufacturer's protocols (Pointe Scientific, Ann Arbor, MI). Total GSH levels in the serum samples were analyzed by EnzyChromTM GSH Assay Kit in accordance with manufacturer's protocol with absorbance measured at 412 nm (BioAssay Systems, Hayward, CA).
Histopathology. Fresh liver samples were embedded in Surgipath® Cryo-Gel™ embedding compound (Fisher Scientific Inc., Pittsburgh, PA) and kept frozen until cryosectioning. Liver sections (4 µm in thickness) were stained with hematoxylin and eosin for the evaluation of hepatocellular injury. Histological scorings of necrotic area in DEX and/or acetaminphen-treated mouse liver sections were evaluated by using ImageJ software (downloaded from NIH website at https://imagej.nih.gov/ij/download.html), as previously described (Carew et al., 2012).
Statistical Analysis. Data are expressed as mean ± standard error. Comparisons between two treatment groups (for instance, between control and one DEX-treated group) were analyzed by Student’s t tests. Comparisons between more than two treatment groups with multiple independent variables were analyzed by three-way ANOVA followed by Duncan’s post-hoc tests (Sigmaplot, Systat Software, Inc., CA). The statistical significance is considered at p < 0.05.
12
Results: Dose- and time-dependent induction of Fgf21 mRNA by DEX in mouse liver. A two-day treatment of 2 and 50 mg/kg of DEX induced Fgf21 mRNA expression by 3- and 8-fold, respectively (Fig. 1A). A seven-day treatment of 2 and 50 mg/kg of DEX induced Fgf21 mRNA expression by 10- and 40-fold, respectively. A fourteen-day treatment of 2 and 50 mg/kg of DEX induced Fgf21 mRNA by 9- and 45-fold, respectively. Therefore, DEX dose- and time-dependently increased Fgf21 mRNA expression in mouse liver and reached a plateau or steady state expression around 7 days.
Concentration- and time-dependent induction of Fgf21/FGF21 mRNA by DEX in cultured mouse and human hepatoma cells. To determine whether DEX similarly induces mouse and human Fgf21/FGF21 mRNA expression, mouse (Hepa1c1c7) and human (Hep3B) hepatoma cells were utilized. As depicted in Fig. 1B (Top panel), in mouse Hepa1c1c7 cells, DEX (1, 3, and 10 μM) up-regulated Fgf21 mRNA expression in time- and concentration-dependent manners, with a maximal induction (4-fold) observed at 24 hours following 10 μM DEX treatment. In human Hep3B cells, 3 μM DEX trended to increase Fgf21 expression. 10 μM DEX increased Fgf21 mRNA expression at 12, 24 and 48 hours after treatment, with a maximal induction (10-fold) observed after 24 hours of treatment (Fig. 1B, Bottom panel). In both mouse and human hepatoma cells, 48-hr treatment still increased Fgf21/FGF21 mRNA expression; however, its induction potency tended to be lower as compared to 24-hr treatment.
Induction of Fgf21 protein expression by DEX in mouse liver and serum. In mouse liver, 2-, 7and 14-day treatment of DEX (50 mg/kg) increased Fgf21 protein expression by 1.3-, 1.7- and 2.3fold, respectively (Fig. 2A).
Because liver-derived Fgf21 can be secreted into bloodstream, we next determined the serum
13
levels of Fgf21 protein following DEX treatment. As shown in Fig. 2B, Fgf21 protein is undetectable in control-treated mouse serum. Seven-day treatment of 2 mg/kg of DEX produced detectable protein levels in serum. Seven-day treatment of 50 mg/kg of DEX increased serum Fgf21 protein level to 50 pg/ml. Fourteen-day treatment of 2 and 50 mg/kg of DEX increased serum Fgf21 protein levels to 78 pg/ml and 194 pg/ml, respectively.
Similarly, in mouse Hepa1c1c7 and human Hep3B cells, DEX (10μM) increased Fgf21/FGF21 protein levels in a time-dependent manner. Specifically, in Hepa1c1c7 cells, 24- and 48-hour treatment of DEX increased Fgf21 protein levels by 3.3- and 3.8-fold, respectively (Fig. 2C, Top panel). In Hep3B cells, 24- and 48-hour treatment of DEX increased FGF21 protein expression approximately 1.7- and 1.9-fold, respectively (Fig. 2C, Bottom panel).
Induction of Fgf21 mRNA by DEX in mouse liver is independent of PXR. DEX is known to activate nuclear receptors PXR and GR (Huss and Kasper, 2000). To delineate the role of PXR activation in DEX-induced Fgf21 expression, PXR-null mouse model was used. As shown in Fig. 3A, DEX (50 mg/kg) increased Fgf21 mRNA expression in both wild-type and PXR-null mouse liver. Therefore, induction of Fgf21 mRNA by DEX in mouse liver is PXR-independent.
Co-treatment of Mifepristone (RU486) attenuated the DEX-induced Fgf21 expression. Because PXR is not responsible for DEX-induced Fgf21 expression, we next determined the role of GR in DEX-induced Fgf21 expression. First, we co-treated hepatoma cells with DEX and a pharmacological antagonist of GR, Mifepristone (RU486). As shown in Fig. 3B, co-treatment of RU486 (3 μM) attenuated 10 μM DEX-induced Fgf21/FGF21 expression by more than 60% in cultured mouse Hepa1c1c7 and human Hep3B cells, indicating that GR activation is likely required to mediate DEX-induced Fgf21 expression.
14
siRNA mediated knockdown of GR abolished DEX-induced Fgf21 expression. In addition to inhibiting GR, RU486 can also repress progesterone receptor and androgen receptor activities (Im and Appleman, 2010; Ulmann et al., 1990). Therefore, there is a need to pin down the exact role of GR in DEX-induced Fgf21 expression. One strategy is to specifically silence GR expression by siRNA and ask if Fgf21 can be still induced by DEX. Commercially validated siRNA that specifically targets the mouse GR or human GR, as described in Materials and Methods, were utilized to knock down GR expression in mouse Hepa1c1c7 and human Hep3B cells. Optimal GR knockdown (75-85% reduction in GR mRNA levels compared to control siRNA) and minimal cytotoxicity was achieved using 10 and 25nM GR-specific siRNA. The silencing effect was maintained for at least 72 hours after transfection. Forty-eight hours post siRNA transfection, cells were incubated with DEX (10 μM) for another 24 hours. As depicted in Fig. 3C, GR knockdown abolished the induction of Fgf21 mRNA in both mouse and human hepatoma cells, demonstrating that GR activation is essential for Fgf21 induction by DEX.
DEX stimulated mouse and human Fgf21/FGF21 promoter activity revealed in Fgf21/FGF21 promoter-driven luciferase reporter assays. Luciferase reporter constructs containing 3.0-kb promoter sequence of mouse or human Fgf21/FGF21 gene was generated as described in Materials and Methods. The mouse and human recombinant reporter constructs were then transfected into mouse Hepa1c1c7 and human Hep3B cells, respectively. Twenty-four hours post transfection, cells were treated with DEX (10 μM) or vehicle for another 24 hours. As shown in Fig. 4A and 4B, DEX increased mouse and human Fgf21/FGF21 promoter-driven luciferase activity 1.6- and 5-fold, respectively. Therefore, DEX-activated GR stimulated Fgf21 promoter activity, which then led to up-regulation of Fgf21 expression.
DEX increased GR binding to the Fgf21 promoter. Luciferase reporter assays demonstrated that the 3.0 kb of mouse and human Fgf21/FGF21 gene promoter can be transactivated by DEX-
15
activated GR. We further determined specific cis-regulatory elements within 3-kb Fgf21/Fgf21 gene promoter that mediate DEX-induced Fgf21 expression. In silico DNA analysis of 3-kb of the mouse and human Fgf21/FGF21 gene promoter identified several putative GREs upstream of transcription start site (TSS) (mouse: -1,000 bp, -2,780bp, -2,880bp; human: -380bp, -1,530bp, 2,530bp).
To determine whether DEX increased the GR binding to these putative GREs in the mouse Fgf21 promoter in vivo, ChIP-qPCR assays were performed in DEX-treated mouse liver. As shown in Fig. 5A (Top panel), DEX increased the binding of GR to the -1,000bp and -2,880bp fragments of mouse Fgf21 gene promoter more than 12-fold. In contrast, DEX decreased the binding of GR to the -2,780bp fragment.
Similar to in vivo study, DEX increased the binding of GR to the -1,000bp and -2,880bp fragments of mouse Fgf21 gene promoter by 6- and 3-fold, respectively in cultured Hepa1c1c7 cells (Fig. 5A, Bottom panel). In Hep3B cells, DEX only increased the binding of GR to the -380bp fragment of human Fgf21 gene promoter (5-fold) but not -1,530bp and the -2,530bp DNA fragments (Fig. 5B).
Regulation of Cyp3a11 mRNA expression in mouse liver and serum GSH level by DEX. Previous studies showed that DEX (at high doses, such as 50 mg/kg) exacerbated acetaminophen-induced acute liver injury in vivo by inducing Cyp3a that can contribute to acetaminophen toxicity and/or deplete glutathione (Madhu et al., 1992; Masson et al., 2010). We next determined whether 2 mg/kg DEX similarly induced Cyp3a11 or depleted glutathione as 50 mg/kg DEX did in mouse liver. As expected, seven-day treatment of 50 mg/kg of DEX induced Cyp3a11 mRNA expression 10-fold in mouse liver. In contrast, seven-day treatment of 2 mg/kg of DEX did not alter Cyp3a11 mRNA expression in mouse liver (Fig. 6A). In addition, 50 mg/kg DEX apparently decreased mouse serum glutathione levels, whereas 2 mg/kg DEX did not affect serum
16
glutathione levels (Fig. 6B). Therefore, 2 mg/kg DEX neither induced Cyp3a11 mRNA expression nor depleted glutathione levels as 50 mg/kg DEX. Consequently, in the following DEXacetaminophen interaction experiment, 2 mg/kg DEX regimen was utilized.
Synergistic induction of Fgf21 mRNA by DEX and acetaminophen in mouse liver. A single administration of acetaminophen (300m/kg) did not alter Fgf21 mRNA expression 4 hours later, but increased Fgf21 mRNA expression 13- and 2.6-fold, respectively 8- and 24-hour later. Seven-day pre-treatment of 2 mg/kg of DEX induced Fgf21 mRNA expression 6-fold in wild-type mouse liver. In contrast, co-treatment of low dose of DEX (pre-treated for 7 days) and acetaminophen (treated for 4, 8, and 24 hours) induced Fgf21 mRNA expression by 7-, 32-, and 4- fold, respectively (Fig. 6C). Therefore, co-treatment of 2 mg/kg DEX and acetaminophen synergistically induced Fgf21 expression compared to acetaminophen treatment alone.
Pre-treatment of 2 mg/kg of DEX attenuated acute acetaminophen hepatotoxicity. In wildtype mice, acetaminophen (300 mg/kg) increased serum ALT levels 4 hours later (Fig. 7A) and even higher 8 hours later (Fig. 7B), indicating that acetaminophen causes apparent liver injury. Pre-treatment with DEX (2 mg/kg) for 7 days markedly alleviated acetaminophen-increased ALT levels by 55% and 60%, 4 and 8 hours after treatment, respectively (Fig. 7A and 7B). In Fgf21-null mice, in absence of functional Fgf21, DEX pre-treatment had no protective effect on acetaminophen-induced ALT elevation (Fig. 7A and 7B).
In wild-type mice, acetaminophen continued to increase serum ALT (Fig. 7C) and AST (Fig. 7D) levels even 24 hours later. Pretreatment with DEX (2 mg/kg) for 7 days attenuated the induction of serum ALT and AST by acetaminophen by more than 60% and 40%, respectively (Fig. 7C and 7D). In contrast in Fgf21-null mice, DEX pre-treatment had no protective influence on serum ALT and AST levels (Fig. 7C and 7D). Therefore, pre-treatment of 2 mg/kg DEX for 7 days exhibited
17
protective effect on acetaminophen-induced liver injury.
Co-treatment of 2 mg/kg of DEX did not attenuate the progression of acute Acetaminophen hepatotoxicity. In wild-type mice, acetaminophen (300 mg/kg) markedly increased serum ALT and AST 24 hours after treatment (Fig. 7E). However, co-treatment of single dose of DEX (2 mg/kg) and acetaminophen at the same time caused similar elevation in serum ALT and AST levels (Fig. 7E). Therefore, distinct from DEX pretreatment, co-treatment of 2 mg/kg of DEX will not alleviate acetaminophen-induced liver injury.
Histopathology of mouse liver in DEX pretreatment-APAP interaction study. No obvious damage was observed in the livers of WT and Fgf21-null mice treated with vehicle (corn oil) or 2 mg/kg DEX (Fig. 8). In wild-type mouse liver, APAP (300mg/kg) caused regional necrosis and blood infiltration. However, pretreatment of 2 mg/kg DEX alleviated APAP-induced acute liver injury indicated by less necrosis and no blood infiltration in wild-type mouse liver. In Fgf21-null mice, 2 mg/kg DEX treatment for two weeks did not cause apparent liver injury. However, APAP produced clear necrosis regardless of DEX pretreatment or non-DEX pretreatment (Fig. 8A). Pretreatment of 2 mg/kg DEX even exaggerated APAP-induced acute liver injury in Fgf21-null mice, indicated by larger necrotic area. Taken together, 2mg/kg DEX pretreatment attenuated acetaminophen hepatotoxicity via Fgf21. ImageJ analysis of the images further demonstrated that pre-treatment of 2mg/kg DEX attenuated APAP-induced necrosis in wild-type mouse liver, but exaggerated it in Fgf21-null mouse liver (Fig. 8B).
18
Discussion: Recent studies, including our previous study, unveiled a cellular protective role of Fgf21, which can alleviate toxicities induced by various chemicals, such as of dioxins (Rier, 2002), alcohols (Zhu et al., 2014), and acetaminophen (Ye et al., 2014). Several reports have also shown that Fgf21 is interconnected with the glucocorticoid signaling (Beser et al., 2011; Patel et al., 2015). For instance, prednisolone, a synthetic glucocorticoid, increased serum Fgf21 level 2-fold after 7 days treatment in mice (Laskewitz et al., 2010). Patel et al. showed that glucocorticoids stimulated the transcription of Fg21 in a feed-forward loop in mouse liver as well as in cultured mouse primary hepatocytes via interaction between GR activation and PPARα activation (2015). In the present study, we reported that synthetic glucocorticoid DEX dose/concentration- and time-dependently induced mouse and human Fgf21/FGF21 expression (Fig. 1). DEX induced Fgf21 mRNA expression in wild-type mouse liver reached steady state around Day 7. Interestingly, we observed a remarkable increase in the serum Fgf21 levels corresponding to the induction of hepatic Fgf21 mRNA that is in agreement with several studies investigating the endocrine nature of Fgf21 (Markan et al., 2014; Zhang et al., 2008). The fold change in the serum Fgf21 levels after DEX treatment was comparable to previous reports in mouse models as well as clinical studies (Dushay et al., 2015; Spolcova et al., 2014). In addition, we showed that Fgf21 is a direct target gene of GR in mouse liver as well as in cultured mouse or human hepatoma cells. Moreover, pre-treatment of 2 mg/kg DEX mitigated acetaminophen-induced acute liver injury.
DEX can activate GR and/or PXR to mediate its pharmacological actions (Cool et al., 2002; Dieken and Miesfeld, 1992; Falkner et al., 2001). DEX administration induced Fgf21 mRNA expression in livers of both wild-type and PXR-null mice (Fig. 3A). In addition, our unpublished data also showed that treatment of pregnenolone-16α carbonitrile and spironolactone, two established mouse PXR activators, did not alter Fgf21 expression in mouse liver. Moreover, in silico DNA sequence analysis, using either NubiScan or AliBaba 2.1, did not reveal apparent PXR binding sites in the
19
8.0-kb promoter DNA sequences of mouse or human Fgf21/FGF21 genes. Therefore, PXR activation is not required for Fgf21 up-regulation by DEX.
Consequently, GR-mediated pathway seemed to be a logical candidate for Fgf21 regulation. A previous study reported that glucocorticoids up-regulated Fgf21 via increasing the binding of GR to a locus 4.4-kb downstream in mouse Fgf21 gene (Patel et al., 2015). However, such GR binding site was not conserved in human FGF21 gene (Patel et al., 2015). Our present studies, using both in vivo and in vitro approaches, demonstrated that DEX-activated GR binds to specific cisregulatory elements in 3.0-kb mouse and human Fgf21/FGF21 gene promoters. Specifically, coadministration of a GR antagonist, Mifepristone (RU486), abrogated the DEX-induced Fgf21/FGF21 mRNA expression in mouse and human hepatoma cells (Fig. 3B) and GR knockdown by GR-targeting siRNA, also abolished the DEX-induced Fgf21 expression (Fig. 3C). In addition, we showed that DEX increased luciferase reporter gene activities, which is driven by 3.0-kb mouse or human Fgf21/FGF21 gene promoter (Fig. 4). Luciferase reporter assays suggested that compared to mouse Fgf21 gene promoter, human FGF21 gene promoter tended to be more responsive to DEX-activated GR (Fig. 4). However, because the DNA sequences of mouse and human Fgf21/FGF21 gene promoters are very different, the regulation of Fgf21/FGF21 expression is species-different. In other words, we cannot compare the induction intensity of mouse and human Fgf21/FGF21 gene promoter-driven luciferase activity. Instead, we can state that both mouse and human Fgf21/FGF21 genes are regulated by GR signaling. Furthermore, ChIP-qPCR assays demonstrated that DEX increased the binding of GR to specific cis-regulatory elements located in the mouse Fgf21 gene promoter (GREs located at -1,000bp and -2,880bp upstream of transcription start site; Fig. 5A) and in the human Fgf21 gene promoter (GRE located at -380bp upstream of transcription start site; Fig. 5B). In general, ligand-activated GR forms a homodimer and then translocates into nucleus where it binds to a full consensus GRE containing two GR binding half sites separated by a 3bp spacer. However, recent studies also suggested that
20
GR can bind, as a functional monomer, to a single GR binding site to regulate the expression of its specific target genes (Schiller et al., 2014). Therefore, DEX-activated GR binds to the cisregulatory elements (herein GREs) in mouse and human Fgf21/FGF21 gene promoter, which were revealed in the present studies, and thus up-regulates Fgf21 expression.
Acetaminophen is metabolized in liver to a toxic metabolite N-acetyl-p-benzoquinone imine (NAPQI) by cytochrome P450 enzyme activity, such as Cyp3a11 in mouse liver. Then, NAPQI is detoxified by forming glutathione (GSH) conjugates in the liver (Jaeschke et al., 2011). In case of acetaminophen overdose, cellular GSH storage is depleted and subsequently NAPQI is not effectively detoxified. NAPQI covalently binds to mitochondrial proteins and triggers mitochondrial dysfunction, ATP depletion, and oxidative stress (Jaeschke et al., 2010a; Jaeschke et al., 2010b). Previous reports showed that glucocorticoid exposure worsened acetaminophen-induced liver injury in vivo (Madhu et al., 1992; Masson et al., 2010). This aggravation of acetaminopheninduced liver injury by DEX is mainly observed at relatively higher doses of DEX exposure, such as 50 mg/kg, and is primarily mediated by transcriptional induction of Cyp3a11 and glutathione depletion. Cyp3a11 is a well-known PXR target gene (Cheng and Klaassen, 2006; Cheng et al., 2005). Via PXR activation, DEX induced Cyp3a11 expression and thus enhanced acetaminophen toxication. In the present study, we showed that 2 mg/kg DEX did not markedly induce Cyp3a11 mRNA expression in mouse liver because such dose is not sufficient to activate PXR (Fig. 6A). In addition, 2 mg/kg DEX did not markedly reduce serum glutathione levels (Fig. 6B). In contrast, 50 mg/kg DEX apparently activated PXR and thus markedly induced Cyp3a11 mRNA expression. Moreover, 50 mg/kg DEX reduced serum glutathione levels (Fig. 6A and 6B). Therefore, low dose (2 mg/kg) DEX did not deteriorate acetaminophen toxicity because PXR is not apparently activated by such dose of DEX. Instead, as discussed above, pre-treatment of 2mg/kg DEX attenuated acetaminophen hepatotoxicities. Because 2 mg/kg DEX pre-treatment did not increase serum GSH levels, in fact denoted a decreasing trend (Fig. 6B), the protective effects of 2 mg/kg DEX
21
pre-treatment against acetaminophen-induced acute liver injury is not due to GSH. By using Fgf21-null mouse model, we further demonstrated that pre-treatment of 2 mg/kg DEX protects against APAP-induced acute hepatotoxicity via Fgf21 induction in mouse liver (Figs. 6-8). A recent finding showed that gain-of-function of Fgf21 ameliorated acetaminophen-induced liver injury (Ye et al., 2014).
Fasting, via activation of peroxisome proliferator-activated receptor (PPAR) alpha, markedly upregulated Fgf21 expression. If just considering increased Fgf21 expression, fasting will be a protective means to fight against acetaminophen overdose-induced acute liver injury. However, actually, fasting potentiated acetaminophen-induced liver injury even through Fgf21 is induced (Price et al., 1987). To explicate this, we should consider that during the fasting, hepatic glutathione storage was depleted, and glucuronidation and sulfation pathways were repressed (Price et al., 1987; Walker et al., 1982). Glutathione conjugation, glucuronidation, and sulfation are all involved in acetaminophen detoxification. Therefore, fasting exaggerated acetaminopheninduced liver injury even through it induced Fgf21 expression.
Our findings may also provide an explanation for previous observations that diabetic animals tolerate acetaminophen-induced liver injury better than non-diabetic animals (Doi and Ishida, 2009; Price and Jollow, 1982; Shankar et al., 2003). In the diabetic animals or patients, serum Fgf21/FGF21 levels are elevated as compared to non-diabetic animals or patients (Jian et al., 2012; Lin et al., 2014; Spolcova et al., 2014; Yu et al., 2002). Therefore, in response to acetaminophen challenge, Fgf21 levels will further increase in diabetic animals, which will confer the protective effect to acetaminophen-induced hepatotoxicity, similar to the effects of 2 mg/kg DEX pretreatment in the present study.
In conclusion, the present study demonstrates that DEX induced Fgf21 expression in mouse and
22
human liver/hepatoma cells, directly via GR activation. Moreover, low dose DEX-induced Fgf21 plays a protective role in attenuating acute acetaminophen-induced hepatotoxicity.
23
Conflict of interest: The authors declare that there is no conflict of interest.
24
Acknowledgements: This work was supported by St. John’s University Start funds (X.C.).
25
Authorship Contributions:
Participated in research design: Vispute, Bu, and Cheng Conducted experiments: Vispute, Le Performed data analysis: Vispute, Bu, Le, and Cheng Wrote or contributed to the writing of the manuscript: Vispute, Bu, Le, and Cheng
26
References: Beser MI, Pardo O, Beltran J and Yusa V (2011) Determination of per- and polyfluorinated substances in airborne particulate matter by microwave-assisted extraction and liquid chromatography-tandem mass spectrometry. J Chromatogr A 1218: 4847-55. Bohensky J, Leshinsky S, Srinivas V and Shapiro IM (2010) Chondrocyte autophagy is stimulated by HIF-1 dependent AMPK activation and mTOR suppression. Pediatr Nephrol 25:633-642. Carew JS, Esquivel JA, 2nd, Espitia CM, Schultes CM, Mulbaier M, Lewis JD, Janssen B, Giles FJ and Nawrocki ST (2012) ELR510444 inhibits tumor growth and angiogenesis by abrogating HIF activity and disrupting microtubules in renal cell carcinoma. PLoS One 7:e31120. Cheng X and Klaassen CD (2006) Regulation of mRNA expression of xenobiotic transporters by the pregnane x receptor in mouse liver, kidney, and intestine. Drug Metab Dispos 34:18631867. Cheng X, Maher J, Dieter MZ and Klaassen CD (2005) Regulation of mouse organic aniontransporting polypeptides (Oatps) in liver by prototypical microsomal enzyme inducers that activate distinct transcription factor pathways. Drug Metab Dispos 33:1276-1282. Cool S, Jackson R, Pincus P, Dickinson I and Nurcombe V (2002) Fibroblast growth factor receptor 4 (FGFR4) expression in newborn murine calvaria and primary osteoblast cultures. Int J Dev Biol 46:519-523. Dieken ES and Miesfeld RL (1992) Transcriptional transactivation functions localized to the glucocorticoid receptor N terminus are necessary for steroid induction of lymphocyte apoptosis. Mol Cellul Biol 12:589-597. Doi K and Ishida K (2009) Diabetes and hypertriglyceridemia modify the mode of acetaminopheninduced hepatotoxicity and nephrotoxicity in rats and mice. J Toxicol Sci 34:1-11. Dushay JR, Toschi E, Mitten EK, Fisher FM, Herman MA and Maratos-Flier E (2015) Fructose ingestion acutely stimulates circulating FGF21 levels in humans. Mol Metabol 4:51-57. Falkner KC, Pinaire JA, Xiao GH, Geoghegan TE and Prough RA (2001) Regulation of the rat glutathione S-transferase A2 gene by glucocorticoids: involvement of both the glucocorticoid and pregnane X receptors. Mol Pharmacol 60:611-619. Huss JM and Kasper CB (2000) Two-stage glucocorticoid induction of CYP3A23 through both the glucocorticoid and pregnane X receptors. Mol Pharmacol 58:48-57. Im A and Appleman LJ (2010) Mifepristone: pharmacology and clinical impact in reproductive medicine, endocrinology and oncology. Expert opinion on pharmacotherapy 11:481-488. Itoh N and Ornitz DM (2008) Functional evolutionary history of the mouse Fgf gene family. Dev Dyn 237:18-27. Itoh N and Ornitz DM (2011) Fibroblast growth factors: from molecular evolution to roles in development, metabolism and disease. J Biochem 149:121-130. Jaeschke H, McGill MR, Williams CD and Ramachandran A (2011) Current issues with acetaminophen hepatotoxicity--a clinically relevant model to test the efficacy of natural products. Life sciences 88:737-745. Jaeschke H, Williams CD, McGill MR and Farhood A (2010a) Herbal extracts as hepatoprotectants against acetaminophen hepatotoxicity. World journal of gastroenterology : WJG 16:24482450. Jaeschke H, Yan HM and Ramachandran A (2010b) Reactive nitrogen species in acetaminopheninduced mitochondrial damage and toxicity in mouse hepatocytes: a cautionary note on the impact of cell culture conditions. Chem Res Toxicol 23:1853-1854; author reply 1855-1858. Jian WX, Peng WH, Jin J, Chen XR, Fang WJ, Wang WX, Qin L, Dong Y and Su Q (2012) Association between serum fibroblast growth factor 21 and diabetic nephropathy. Metabolism 61:853-859. Jiang S, Yan C, Fang QC, Shao ML, Zhang YL, Liu Y, Deng YP, Shan B, Liu JQ, Li HT, Yang L, Zhou J, Dai Z, Liu Y and Jia WP (2014) Fibroblast growth factor 21 is regulated by the
27
IRE1alpha-XBP1 branch of the unfolded protein response and counteracts endoplasmic reticulum stress-induced hepatic steatosis. J Biol Chem 289:29751-29765. Kharitonenkov A, Shiyanova TL, Koester A, Ford AM, Micanovic R, Galbreath EJ, Sandusky GE, Hammond LJ, Moyers JS, Owens RA, Gromada J, Brozinick JT, Hawkins ED, Wroblewski VJ, Li DS, Mehrbod F, Jaskunas SR and Shanafelt AB (2005) FGF-21 as a novel metabolic regulator. J Clin Invest 115:1627-1635. Laskewitz AJ, van Dijk TH, Bloks VW, Reijngoud DJ, van Lierop MJ, Dokter WH, Kuipers F, Groen AK and Grefhorst A (2010) Chronic prednisolone treatment reduces hepatic insulin sensitivity while perturbing the fed-to-fasting transition in mice. Endocrinology 151:21712178. Lim HW, Uhlenhaut NH, Rauch A, Weiner J, Hubner S, Hubner N, Won KJ, Lazar MA, Tuckermann J and Steger DJ (2015) Genomic redistribution of GR monomers and dimers mediates transcriptional response to exogenous glucocorticoid in vivo. Genome research 25:836-844. Lin Y, Xiao YC, Zhu H, Xu QY, Qi L, Wang YB, Li XJ, Zheng ML, Zhong RS, Zhang Y, Xu XD, Wu BL, Xu ZM and Lu XH (2014) Serum fibroblast growth factor 21 levels are correlated with the severity of diabetic retinopathy. J Diabetes Res 2014:929756. Luo Y and McKeehan WL (2013) Stressed Liver and Muscle Call on Adipocytes with FGF21. Front Endocrinol 4:194. Madhu C, Maziasz T and Klaassen CD (1992) Effect of pregnenolone-16 alpha-carbonitrile and dexamethasone on acetaminophen-induced hepatotoxicity in mice. Toxicol Appl Pharmacol 115:191-198. Markan KR, Naber MC, Ameka MK, Anderegg MD, Mangelsdorf DJ, Kliewer SA, Mohammadi M and Potthoff MJ (2014) Circulating FGF21 is liver derived and enhances glucose uptake during refeeding and overfeeding. Diabetes 63:4057-4063. Masson MJ, Collins LA, Carpenter LD, Graf ML, Ryan PM, Bourdi M and Pohl LR (2010) Pathologic role of stressed-induced glucocorticoids in drug-induced liver injury in mice. Biochem Biophys Res Commun 397:453-458. Patel R, Bookout AL, Magomedova L, Owen BM, Consiglio GP, Shimizu M, Zhang Y, Mangelsdorf DJ, Kliewer SA and Cummins CL (2015) Glucocorticoids regulate the metabolic hormone FGF21 in a feed-forward loop. Mol Endocrinol 29:213-223. Planavila A, Redondo-Angulo I, Ribas F, Garrabou G, Casademont J, Giralt M and Villarroya F (2015) Fibroblast growth factor 21 protects the heart from oxidative stress. Cardiovasc Res 106:19-31. Potthoff MJ, Inagaki T, Satapati S, Ding X, He T, Goetz R, Mohammadi M, Finck BN, Mangelsdorf DJ, Kliewer SA and Burgess SC (2009) FGF21 induces PGC-1alpha and regulates carbohydrate and fatty acid metabolism during the adaptive starvation response. Proc Natl Acad Sci USA 106:10853-10858. Price VF and Jollow DJ (1982) Increased resistance of diabetic rats to acetaminophen-induced hepatotoxicity. J Pharmacol ExpTher 220:504-513. Price VF, Miller MG and Jollow DJ (1987) Mechanisms of fasting-induced potentiation of acetaminophen hepatotoxicity in the rat. Biochem Pharmacol 36:427-433. Rier SE (2002) The potential role of exposure to environmental toxicants in the pathophysiology of endometriosis. Ann N Y Acad Sci 955:201-212; discussion 230-202, 396-406. Schiller BJ, Chodankar R, Watson LC, Stallcup MR and Yamamoto KR (2014) Glucocorticoid receptor binds half sites as a monomer and regulates specific target genes. Genome Biol 15:418. Shankar K, Vaidya VS, Corton JC, Bucci TJ, Liu J, Waalkes MP and Mehendale HM (2003) Activation of PPAR-alpha in streptozotocin-induced diabetes is essential for resistance against acetaminophen toxicity. FASEB J 17:1748-1750. Spolcova A, Holubova M, Mikulaskova B, Nagelova V, Stofkova A, Lacinova Z, Jurcovicova J, Haluzik M, Maletinska L and Zelezna B (2014) Changes in FGF21 serum concentrations
28
and liver mRNA expression in an experimental model of complete lipodystrophy and insulinresistant diabetes. Physiol Res 63:483-490. Ulmann A, Teutsch G and Philibert D (1990) Ru 486. Scientific American 262:42-48. Walker RM, Massey TE, McElligott TF and Racz WJ (1982) Acetaminophen toxicity in fed and fasted mice. Can J Physiol Pharmacol 60:399-404. Xu P, Ye X, Zhang Y, Yuan Q, Liu M, Wu Q, Ren G and Li D (2015) Long-acting hypoglycemic effects of PEGylated FGF21 and insulin glargine in mice with type 1 diabetes. J Diabetes Complications 29:5-12. Ye D, Wang Y, Li H, Jia W, Man K, Lo CM, Wang Y, Lam KS and Xu A (2014) Fibroblast growth factor 21 protects against acetaminophen-induced hepatotoxicity by potentiating peroxisome proliferator-activated receptor coactivator protein-1alpha-mediated antioxidant capacity in mice. Hepatol 60:977-989. Yu C, Wang F, Jin C, Wu X, Chan WK and McKeehan WL (2002) Increased carbon tetrachlorideinduced liver injury and fibrosis in FGFR4-deficient mice. Am J Pathol 161:2003-2010. Yu Y, Li S, Liu Y, Tian G, Yuan Q, Bai F, Wang W, Zhang Z, Ren G, Zhang Y and Li D (2015) Fibroblast growth factor 21 (FGF21) ameliorates collagen-induced arthritis through modulating oxidative stress and suppressing nuclear factor-kappa B pathway. Int Immunopharmacol 25:74-82. Zhang X, Yeung DC, Karpisek M, Stejskal D, Zhou ZG, Liu F, Wong RL, Chow WS, Tso AW, Lam KS and Xu A (2008) Serum FGF21 levels are increased in obesity and are independently associated with the metabolic syndrome in humans. Diabetes 57:1246-1253. Zhu S, Ma L, Wu Y, Ye X, Zhang T, Zhang Q, Rasoul LM, Liu Y, Guo M, Zhou B, Ren G and Li D (2014) FGF21 treatment ameliorates alcoholic fatty liver through activation of AMPK-SIRT1 pathway. Acta Bioch Bioph Sin 46:1041-1048.
29
Figure Legends: Fig. 1. Induction of Fgf21 mRNA expression by DEX in mouse liver as well as in cultured mouse Hepa1c1c7 and human Hep3B hepatoma cells. A, Fgf21 mRNA expression in male C57BL/6 mouse liver after once daily administration of DEX (2 and 50 mg/kg) for 2, 7, and 14 days (n=5/treatment group). Control group received corn oil. B, Mouse Hepa1c1c7 and human Hep3B cells were treated, in tetraplicate, with 1, 3, and 10μM of DEX for 12, 24, and 48 hours, respectively. Control group received 0.1% DMSO. Messenger RNA expression of mouse (Top panel) and human (Bottom panel) Fgf21/FGF21 gene were determined. All data are expressed as mean ± S.E. Asterisk indicates statistical difference between DEX-treated group and control group (p < 0.05).
Fig. 2. Induction of Fgf21 protein expression by DEX in mouse liver as well as in cultured mouse and human hepatoma cells. A, The mice were treated with 50 mg/kg DEX once daily and sacrificed 2, 7 or 14 days later. Top panel, protein expression of Fgf21 and β-actin in mouse liver analyzed by Western blotting; Bottom panel, protein levels of Fgf21 in mouse liver are expressed as the ratio of Fgf21 to β-actin protein. B, The mice were treated with 2 and 50 mg/kg DEX once daily and sacrificed 7 and 14 days later. Mouse sera were isolated for Fgf21 protein quantification by ELISA. All data are expressed as mean ± S.E. (n=5/treatment). Asterisk indicates statistical difference between DEX-treated and control group (p < 0.05). C, Induction of Fgf21/FGF21 protein by DEX in mouse Hepa1c1c7 (Top panel) and human Hep3B (Bottom panel) hepatoma cells. Protein levels of Fgf21/FGF21 are expressed as the ratio of Fgf21/FGF21 to β-actin protein. All data are expressed as mean ± S.E. Asterisk indicates statistical difference between DEX-treated group and control group (p < 0.05).
Fig. 3. Mechanistic characterization of Fgf21 induction by DEX. A, Induction of Fgf21 mRNA by DEX in wild-type and PXR-null mouse liver. Adult male wild-type and age matched PXR-null mice
30
were treated with control (corn oil) or DEX (50 mg/kg) (n=5/treatment) once daily for 4 days. All data are expressed as mean ± S.E. Asterisk indicates statistical difference between DEX-treated group and control group (p < 0.05). B, Impact of co-treatment of 3μM RU486 on the 10μM DEXinduced Fgf21/FGF21 mRNA expression in cultured mouse Hepa1c1c7 (Top panel) and human Hep3B cells (Bottom panel). Asterisk indicates statistical difference between with DEX- and without DEX-treated groups (p < 0.05). ¥ indicates statistical difference between DEX-treated and co-treated (RU486 + DEX) groups (p < 0.05). C, Effect of GR knockdown on the 10μM DEXinduced Fgf21/FGF21 mRNA expression in cultured mouse Hepa1c1c7 (Top panel) and human Hep3B hepatoma cells (Bottom panel). All data were expressed as mean ± S.E. (n=4/treatment). Asterisk indicates statistical difference between DEX-treated GR-normal cells and DEX-treated GR-knockdown cells (p < 0.05).
Fig. 4. Regulation of mouse or human Fgf21/FGF21 promoter-driven luciferase reporter activity by DEX in cultured hepatoma cells. A, Mouse Hepa1c1c7 cells were transfected with mouse Fgf21 gene promoter-pGL3 recombinant reporter construct and then treated with DEX (10 μM) for 24 hours; B, Human Hep3B cells were transfected with human FGF21 gene promoter-pGL3 recombinant reporter construct and then treated with DEX (10 μM) for 24 hours. Dual luciferase assays were performed in triplicates. All data were expressed as mean ± S.E. Asterisk indicates statistical difference between DEX-treated group and control (0.1% DMSO) (p < 0.05).
Fig. 5. ChIP-qPCR assays of GR binding to the putative GREs located in mouse and human Fgf21/FGF21 gene promoter. A, relative GR binding quantified by qPCR following ChIP assay in DEX (50 mg/kg)-treated wild-type mouse livers (Top panel) or in DEX (10 μM)-treated mouse Hepa1c1c7 hepatoma cells (Bottom panel). B, relative GR binding quantified by qPCR following ChIP assay in DEX (10 μM)-treated human Hep3B hepatoma cells. The GR binding revealed by IgG-precipitation-driven ChIP-qPCR assays was used as negative control. The GR binding
31
revealed by RNA Pol II antibody-precipitation-driven ChIP-qPCR assays was used as positive control. The GR binding data are normalized to the GR binding revealed by IgG-precipitationdriven ChIP-qPCR assays.
Fig. 6. Dose-dependent regulation of Cyp3a11 and glutathione by DEX and Fgf21 induction by cotreatment of DEX (pre-treated for 7 days) and acetaminophen (300 mg/kg). Adult male C57BL/6 mice (n=5/treatment) were once daily administered DEX (2 and 50 mg/kg; i.p.) for 7 days. On day 8, Cyp3a11 mRNA expression in mouse liver (A) as well as serum glutathione levels (B) were analyzed by quantitative real-time PCR and EnzyChromTM GSH Assay Kit, respectively. C, Timedependent regulation of Fgf21 mRNA by co-treatment of acetaminophen and 2 mg/kg DEX in wildtype mouse liver. Adult male C57BL/6 mice were pre-treated with DEX (2 mg/kg; i.p.) once daily for 7 days. Then the mice were challenged with a single dose of acetaminophen (300 mg/kg; i.p.) for 4, 8, and 24 hours. Total RNA from mouse livers was analyzed by qRT-PCR (n=5/group). All data are expressed as mean ± S.E. (n=5/group). Asterisk indicates statistical difference between DEX treatment group and control group (p < 0.05).
Fig. 7. Effect of pre-treatment and co-treatment of 2mg/kg of DEX on acetaminophen toxicity. Adult (approximately 8-weeks of age) male wild-type mice and age-matched Fgf21-null mice were pretreated with DEX (2 mg/kg; i.p.), once daily for 7 days and then subjected to a single dose of acetaminophen treatment (300 mg/kg; i.p.) (n=3-5/treatment). Serum biomarkers of liver injury, ALT and AST were measured after 4, 8, and 24 hours. ALT levels were quantified in sera of wildtype and Fgf21-null mice 4 (A), 8 (B), and 24 hours (C) post acetaminophen challenge. D, AST levels in wild-type and Fgf21-null mice 24 hours post acetaminophen challenge. E, Effect of cotreatment of 2 mg/kg of DEX on acetaminophen toxicity. Adult (approximately 8-weeks of age) male wild-type mice were co-administered with DEX (2 mg/kg; i.p.) and acetaminophen (300 mg/kg; i.p.) (n=3-5/treatment). Serum ALT (Left panel) and AST (Right panel) levels in mouse sera
32
were measured 24 hours later. All data are expressed as mean ± S.E. Asterisk indicates statistical difference between DEX treatment and control treatment (corn oil). ¥ indicates statistical difference between acetaminophen alone and combination (DEX + Acetaminophen) groups. (p < 0.05).
Fig. 8. Histopathology of mouse liver pretreated with DEX prior to APAP challenge. A, Histology of mouse liver after DEX and/or APAP treatment. Adult male wild-type and age-matched male Fgf21null mice were divided into 4 groups (n=3-5/treatment). Group-1 and 2 received corn oil once daily through i.p. administration. Group-3 and 4 were once daily pre-treated with DEX (2 mg/kg, dissolved in corn oil; i.p. administration) for 7 days. On day 8, Group-2 and 4 mice were given a single i.p. administration of acetaminophen (300 mg/kg, dissolved in saline). After 24 hours of acetaminophen challenge, mouse livers were collected and processed for H&E staining. (Magnification 20x). B, histological scoring of necrotic area in liver sections of wild-type mice (Top panel) and Fgf21-null mice (Bottom panel). Percent necrosis was calculated using ImageJ software (Carew et al., 2012). Mean ± SD, n = 3-4. *Indicates a significant difference compared to controls (vehicle); ¥ indicates statistical difference between acetaminophen alone and combination (DEX + Acetaminophen) groups. (p < 0.05).
33
Table 1: qPCR primers flanking putative GREs in the 3kb promoter region of mouse and human Fgf21 genes for the ChIP-qPCR assays.
Species Human
Mouse
Location of GREs (upstream of TSS)
Forward primer
Reverse primer
-380 bp
5ʹ- tgtcagatcacgccctcc -3ʹ
5ʹ- gtgctgggctcctggaaaa -3ʹ
-1,350 bp
5ʹ- tgccttcagtctcttgcctc -3ʹ
5ʹ- tgggaatcaagtcaaactcctg -3ʹ
-2,530 bp
5ʹ- caggctaacgtagggtccag -3ʹ
5ʹ- ggcccagctgttttctcttt -3ʹ
-1,000 bp
5ʹ- aaagcatctggagagcacct -3ʹ
5ʹ- tagcattcgggccttgtg -3ʹ
-2,780 bp
5ʹ- ctgtaaaagcaagcccctgg -3ʹ
5ʹ- ggacatgggctgaatcgttc -3ʹ
-2,880 bp
5ʹ- tgggagccaggggaaaac -3ʹ
5ʹ- ctgatgtttgttcctgtctcaca -3ʹ
34
Accepted Manuscript Title: Activation of GR but not PXR by Dexamethasone Attenuated Acetaminophen Hepatotoxicities via Fgf21 Induction Authors: Saurabh G. Vispute, Pengli Bu, Yuan Le, Xingguo Cheng PII: DOI: Reference:
S0300-483X(17)30009-4 http://dx.doi.org/doi:10.1016/j.tox.2017.01.009 TOX 51812
To appear in:
Toxicology
Received date: Revised date: Accepted date:
8-8-2016 5-1-2017 9-1-2017
Please cite this article as: Vispute, Saurabh G., Bu, Pengli, Le, Yuan, Cheng, Xingguo, Activation of GR but not PXR by Dexamethasone Attenuated Acetaminophen Hepatotoxicities via Fgf21 Induction.Toxicology http://dx.doi.org/10.1016/j.tox.2017.01.009 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
S0300-483X(17)30009-4 http://dx.doi.org/doi:10.1016/j.tox.2017.01.009 TOX 51812
To appear in:
Toxicology
Received date: Revised date: Accepted date:
8-8-2016 5-1-2017 9-1-2017
Please cite this article as: Vispute, Saurabh G., Bu, Pengli, Le, Yuan, Cheng, Xingguo, Activation of GR but not PXR by Dexamethasone Attenuated Acetaminophen Hepatotoxicities via Fgf21 Induction.Toxicology http://dx.doi.org/10.1016/j.tox.2017.01.009 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Title: Activation of GR but not PXR by Dexamethasone Attenuated Acetaminophen
Hepatotoxicities via Fgf21 Induction Authors: Saurabh G. Vispute, Pengli Bu, Yuan Le, and Xingguo Cheng* Affiliations: Department of Pharmaceutical Sciences, College of Pharmacy and Health Sciences, St. John’s University, 8000 Utopia Parkway, Queens, NY 11439, USA (S.G.V., P.B., Y.L., and X.C.) Department of Biological Sciences, College of Liberal Arts and Sciences, St. John's University, 8000 Utopia Parkway, Queens, NY 11439, USA (P.B.) *Corresponding Author: Xingguo Cheng, Ph.D.: Department of Pharmaceutical Sciences, St. John’s University, 8000 Utopia Parkway, Queens, NY 11439, USA. E-mail: [email protected]
Running title: DEX-induced Fgf21 protects against acetaminophen toxicity
Number of table: 1 Number of figures: 8 Number of references: 44 Number of words in the Abstract: 211 Number of words in the Introduction: 333 Number of words in the Discussion: 1322
Abbreviation: APAP, Acetaminophen; bp, base pair; ChIP, chromatin immunoprecipitation; Cyp, cytochrome p450 enzyme; DEX, dexamethasone; Fgf21, fibroblast growth factor 21; GR, glucocorticoid receptor; GRE, glucocorticoid receptor response element; GSH, Glutathione; i.p., intraperitoneal; NAPQI, N-acetyl-p-benzoquinone imine; PGC1α, peroxisome proliferator-activated receptor gamma coactivator protein-1alpha; PPAR, peroxisome proliferator-activated receptor;
1
PXR, pregnane X receptor; TSS, transcription start site; WAT, white adipose tissue; WT, wild-type
2
Abstract: Glucocorticoid receptor (GR) signaling is indispensable for cell growth and development, and plays important roles in drug metabolism. Fibroblast growth factor (Fgf) 21, an important regulator of glucose, lipid, and energy metabolism, plays a cytoprotective role by attenuating toxicities induced by chemicals such as dioxins, acetaminophen (APAP), and alcohols. The present study investigates the impact of dexamethasone (DEX)-activated GR on Fgf21 expression and how it affects the progression of APAP-induced hepatotoxicity. Our results showed that DEX dose/concentration- and time-dependently increased Fgf21 mRNA and protein expression in mouse liver as well as cultured mouse and human hepatoma cells. By using PXR-null mouse model, we demonstrated that DEX induced Fgf21 expression by a PXR-independent mechanism. In cultured mouse and human hepatoma cells, inhibition of GR signaling, by RU486 (Mifepristone) or GR silencing using GR-specific siRNA, attenuated DEX-induced Fgf21 expression. In addition, DEX increased luciferase reporter activity driven by the 3.0-kb mouse and human Fgf21/FGF21 gene promoter. Further, ChIP-qPCR assays demonstrated that DEX increased the binding of GR to the specific cis-regulatory elements located in the 3.0-kb mouse and human Fgf21/FGF21 gene promoter. Pretreatment of 2 mg/kg DEX ameliorated APAP-induced liver injury in wild-type but not Fgf21-null mice. In conclusion, via GR activation, DEX induced Fgf21 expression in mouse liver and human hepatoma cells. Highlights:
DEX induced Fgf21/Fgf21 expression in both mouse and human liver/hepatoma cells.
Fgf21 is a direct target gene of GR.
Pretreatment of 2mg/kg DEX attenuates acetaminophen hepatotoxicity.
Key words: Fgf21, dexamethasone, glucocorticoid receptor, acetaminophen, hepatotoxicity
3
Introduction: Fibroblast growth factor (Fgf) 21 is originally recognized as a metabolic regulator of glucose, lipid, and energy homeostasis (Itoh and Ornitz, 2008; 2011; Kharitonenkov et al., 2005; Potthoff et al., 2009). Recent studies suggest that Fgf21 is also a stress-induced factor in the liver (Luo and McKeehan, 2013) and gain-of-function of Fgf21 can protect against endoplasmic reticulum stress (Jiang et al., 2014), oxidative stress (Xu et al., 2015; Yu et al., 2015), xenobiotic-induced stress, cardiac atrophy (Planavila et al., 2015), and acetaminophen-induced hepatotoxicity (Ye et al., 2014). In mouse liver, Fgf21 can be induced by fasting and ketogenic diet as an adaptive response via a peroxisome proliferator-activated receptor (PPAR) α-dependent mechanism (Bohensky et al., 2010). Our previous study also demonstrated that activation of aryl hydrocarbon receptor (AhR) induced mouse and human Fgf21 expression and Fgf21 induction attenuated dioxin-induced toxicities (Rier, 2002).
Glucocorticoid receptor (GR) signaling plays an important role in cellular processes such as inflammation, cell proliferation and differentiation, stress response, and metabolism. Upon ligand binding, GR translocates into the nucleus. In the nucleus, activated GR, as either dimer or monomer, can directly bind to the GR response elements (GREs) located in the promoter of its target genes and thus regulate their expression (Lim et al., 2015; Schiller et al., 2014). GR can be activated by endogenous chemicals (e.g. cortisol) or synthetic corticosteroids such as dexamethasone (DEX) and prednisone.
A previous report showed that glucocorticoids stimulated Fgf21 transcription in mouse liver as well as in cultured primary mouse hepatocytes via interaction between GR and PPARα activation (Patel et al., 2015). In the present study, we showed that DEX increased Fgf21 expression in mouse liver as well as in cultured mouse and human hepatoma cells by directly increasing the binding of GR to the specific cis-regulatory elements that are located within the 3.0-kb mouse or human
4
Fgf21/FGF21 gene promoter. In addition, we showed that pretreatment of 2 mg/kg DEX in mice, via Fgf21 induction, attenuated the progression of acetaminophen-induced acute liver injury.
5
Materials and Methods: Materials. Dexamethasone (DEX) was purchased from Alfa Aesar (Ward Hill, MA). Formaldehyde and Mifepristone (RU486) were purchased from TCI America (Cambridge, MA). All other chemicals, unless otherwise indicated, were purchased from Thermo Fisher Scientific (Fairlawn, NJ). Chromatin immunoprecipitation (ChIP) assay kit (EZ-ChIP 17-391) and mouse FGF-21 ELISA Kit (EZRMFGF21-26K) were purchased from Millipore (Billerica, MA). DualLuciferase Reporter assay system was purchased from Promega (Madison, WI).
Anti-Fgf21 antibodies against mouse and human Fgf21/FGF21 protein were obtained from Biovendor (Asheville, NC; Cat. # RD181108100, Lot # RD-2444 for Human anti-FGF21; Cat. # RD281108100, Lot # RD-2551 for mouse anti-Fgf21). β-actin antibody was obtained from Abgent (San Diego, CA; Cat. # AM1829B). Anti-GR polyclonal antibody (Cell Signaling Technology, Danvers, MA; Cat. # 3660), IgG (Cat. # 12-371B, Lot # 2713276) and RNA Pol II (Cat # 05-623B, Lot # 2548997) antibodies (Millipore, Billerica, MA), goat anti-mouse IgG horseradish peroxidase (HRP)-linked (Cat. # 31430, Thermo Fisher Scientific, Fairlawn, NJ), goat anti-rabbit biotin conjugate (Cat. # 31820, Lot # QA1966741) and avidin HRP-linked secondary antibodies (Cat. # 21130, Lot # PJ208901) (Pierce, Rockford, IL) were all obtained commercially.
Animals and treatment. Eight-week-old adult male C57BL/6 mice were purchased from The Jackson Laboratories (Bar Harbor, ME). Breeding pairs of Fgf21-null mice and corresponding wildtype mice were kindly provided by Dr. Steven Kliewer (UT Southwestern Medical Center, Dallas, TX) (Potthoff et al., 2009). The mice were housed according to the guidance of Association for Assessment and Accreditation of Laboratory Animal Care International at St. John’s University animal facility under a standard 12-h light: dark cycle with free access to regular rodent chow and water ad libitum.
6
Dose- and time-response study: Groups of five mice were administered DEX (2 and 50 mg/kg, i.p. dissolved in corn oil) once daily for 2, 7, and 14 days. Control groups received corn oil by the same route. All injections were administered in a volume of 5 ml/kg. Blood was collected on day 3, 8, and 15, and serum was isolated and stored at -80°C until use. Livers were collected on day 3, 8, and 15, snap-frozen in liquid nitrogen, and stored at -80°C. One portion of freshly collected liver sample was processed for ChIP assays.
DEX treatment in wild-type and PXR-null mice: Adult (approximately 8 weeks of age) male wildtype and age-matched male PXR-null mice (n=5/treatment) were administered i.p. once daily for 4 days with either corn oil or DEX (50 mg/kg). Livers were collected on Day 5, snap-frozen in liquid nitrogen, and stored at -80°C until use.
DEX and acetaminophen treatment. For pretreatment study, adult male wild-type mice (approximately 8-weeks of age) and age-matched male Fgf21-null mice were divided into four treatment groups (n=3-5/treatment). Group-1 and 2 received corn oil once daily through i.p. administration. Group-3 and 4 were once daily pre-treated with DEX (2 mg/kg, dissolved in corn oil; i.p. administration) for 7 days. On day 8, Group-2 and 4 mice were given a single i.p. administration of acetaminophen (300 mg/kg, dissolved in saline). After 4, 8, and 24 hours of acetaminophen challenge, blood was collected, and mouse sera were isolated and stored at -80°C until use. Livers were also collected, snap-frozen in liquid nitrogen, and stored at -80°C until use.
For co-treatment study, approximately eight-weeks old male wild-type mice (n=5/group) were given a single i.p. administration of vehicle (saline), DEX (2 mg/kg, dissolved in corn oil), acetaminophen (300 mg/kg, dissolved in saline), and co-treatment of DEX (2 mg/kg) and acetaminophen (300 mg/kg). Blood was collected 24 hours later. Mouse sera were isolated and stored at -80°C until use. Livers were also collected, snap-frozen in liquid nitrogen, and stored at -80°C.
7
Cell culture and treatment. Mouse Hepa1c1c7 cells were grown in Alpha 1x minimum essential medium (Mediatech, Inc., Manassas, VA) supplemented with 10% fetal bovine serum (Atlanta Biologicals, Flowery Branch, GA) at 37 °C in a humidified atmosphere of 5% CO2. Human Hep3B cells were grown in Dulbecco's Modified Eagle Media (Mediatech, Inc., Manassas, VA) supplemented with 10% fetal bovine serum (Atlanta Biologicals, Flowery Branch, GA) at 37 °C in a humidified atmosphere of 5% CO2.
Concentration- and time-dependent induction of Fgf21 expression by dexamethasone. Mouse Hepa1c1c7 and human Hep3B cells were cultured in 6-well plates and allowed to grow to 80-85% confluence. Cultured hepatoma cells, in triplicate, were incubated with vehicle (0.1% DMSO) or DEX (1μM, 3 μM, or 10μM) for 12 hours, 24 hours, or 48 hours. Then, cells were harvested and total RNAs were extracted using Trizol RNA extraction reagent (Life Technologies, Grand Island, NY).
DEX and RU486 co-treatment study. Mouse Hepa1c1c7 and human Hep3B cells were cultured in 6-well plates and allowed to grow to 80-85% confluence. Cultured hepatoma cells, in triplicate, were incubated with vehicle (0.1% DMSO), 10 μM DEX, or co-treatment of 3 μM RU486 and 10μM DEX. Cells were harvested 24 hours later and total RNAs were extracted.
siRNA mediated GR knockdown. Mouse Hepa1c1c7 and human Hep3B cells were seeded in 6well plates and transfected with either control (On-TARGETplus non-targeting pool siRNA) or GR specific siRNAs, L-045970-01-0005 (targeting mouse GR) and L-003424-00-0005 (targeting human GR) respectively (GE Dharmacon, Lafayette, CO) at various concentrations to determine the optimal knockdown efficiency. After achieving the optimal knockdown conditions (75% to 85% knockdown of GR mRNA with 10nM and 25nM siRNA), the cells were treated with DEX (10μM) for
8
24 hours. Cells were then harvested and total RNAs were extracted.
Protein extraction and Western blots. Cytoplasmic protein from mouse liver was extracted using NE-PER Nuclear and Cytoplasmic Extraction Reagent kit (Pierce Biotechnology, Inc., Rockford, IL), according to the manufacturer's instructions. The protein concentrations were quantified spectrophotometrically at 280nm. The protein samples (60 μg protein/lane) were resolved on a 15% SDS-polyacrylamide gel. Following electrophoresis, proteins were transferred to a 0.45μm polyvinylidene fluoride (PVDF) membrane. Then, the membrane was blocked for two hours in 5% BSA in Tris-buffered saline (TBS). The membrane was next incubated overnight with anti-mouse Fgf21 antibody (1:500 in 2.5% BSA in TBS) at 4°C. β-actin antibody was used as a loading control. After thorough washing, the membrane was incubated with goat anti-rabbit biotin-conjugated secondary antibody (1:5,000 dilution in 2.5% non-fat milk in TBS) for 2 hours at room temperature. The membrane was washed again and incubated with avidin HRP-linked secondary antibody (1:5,000) for 30 minutes at room temperature. Immunoreactive bands in the membrane were detected with Immobilon Chemiluminescence reagent (Millipore, Billerica, MA) and Biospectrum Imaging system (UVP, Upland, CA). The intensity of protein bands was quantified with ImageJ software (NIH).
Quantification of serum Fgf21 protein. Ten μL of mouse serum samples were processed for quantification of Fgf21 protein levels using Millipore’s Rat/Mouse FGF21 ELISA kit (Billerica, MA) as per the manufacturer’s instructions.
Total RNA isolation and quantitative real-time PCR. Total RNAs were isolated using Trizol RNA extraction reagent (Life Technologies, Grand Island, NY) according to the manufacturer's instructions. RNA pellets were re-suspended in diethyl pyrocarbonate-treated deionized water. RNA concentrations were quantified spectrophotometrically at 260nm using Eppendorf
9
Biospectrometer (Hauppauge, NY). RNA integrity of each sample was evaluated by formaldehyde agarose gel electrophoresis before quantification. The mRNA expression of individual gene(s) was quantified by quantitative real-time PCR (StepOnePlus™, Applied Biosystems, CA). Target gene mRNA levels were normalized to 18s rRNA expression and presented as relative fold/percent of the control group. Dual® Luciferase reporter assays. Construction of recombinant luciferase reporter plasmids. Mouse genomic DNA was used as the template to clone a 3.0-kb fragment containing the 5′-flanking region of mouse Fgf21 gene by highfidelity PCR. A human BAC clone (RP11-165B22 obtained from CHORI, Oakland, CA) was used as DNA template to clone a 3.0-kb fragment containing the 5′-flanking region of human FGF21 gene by high-fidelity PCR. The 3.0-kb PCR products were gel-purified and ligated to luciferase reporter gene vector pGL3-basic (Promega, Madison, WI). The sequences of recombinant reporter gene constructs were confirmed by DNA sequencing (Eurofins Genomics, Louisville, KY).
Transient transfection and Dual® Luciferase reporter Assays. Mouse Hepa1c1c7 and human Hep3B cells were seeded onto 24-well plates at a density of 5 x 104 cells/well and 8 x 104 cells/well, respectively. Each well was transfected with individual pGL3 reporter construct (empty pGL3-basic vector, mouse Fgf21-pGL3 reporter construct, or human FGF21-pGL3 reporter construct) (800 ng/well) and phRL-CMV vector encoding Renilla luciferase (10 ng/well) using Lipofectamine 2000 reagent (Life Technologies, Grand Island, NY). After transfection for 6 hours, the medium was replaced with fresh medium. Following 24 hours’ recovery, the cells were treated with DEX (10 μM) for another 24 hours. Then, cells were lysed and Dual® Luciferase reporter assays were performed according to the manufacturer's instructions (Promega, Madison, WI).
Chromatin Immunoprecipitation (ChIP)-qPCR assays. Online software Alibaba 2.1 (http://www.gene-regulation.com/pub/programs/alibaba2) was first used to screen putative GR
10
response elements (GREs) in the 3.0-kb promoter regions of the mouse or human Fgf21/FGF21 gene.
These putative GREs were further analyzed by ChIP-qPCR assays using mouse liver samples. Briefly, approximately 50 mg of mouse liver was homogenized using Dounce homogenizer in 1 ml of PBS supplemented with phenylmethylsulfonyl fluoride (PMSF) and protease inhibitor cocktail (Pierce, Rockford, IL). Then, liver tissue suspension was mixed with freshly prepared formaldehyde at a final concentration of 1% and gently rotated for 20 min at room temperature to allow DNAprotein cross-linking. Next, the processed liver tissue suspension was sonicated (sonication settings: amplitude 50; 10 seconds on and 30 seconds off, 25 cycles) to truncate genomic DNA into DNA fragments ranged between 200 and 1,000 bp by using Sonic Dismembrator ultrasonic processor (Fisher Scientific, Waltham, MA). ChIP assays were performed using EZ-ChIP assay kit (Millipore, Billerica, MA) as per the manufacturer's instructions. Specifically, 10 μg of GR antibody, 1μg IgG (negative control), and 1μg RNA Pol II (positive control) antibody were used for immunoprecipitation. Precipitated DNA was purified and dissolved in 20 μL of water. Three μL of DNA solution was used for the quantitative real-time PCR reaction. The primers flanking the specific putative GREs are given in Table 1.
ChIP assays were also performed in cultured mouse and human hepatoma cells. Briefly, cells were cultured in T-25 flask and treated with DEX (10μM) for 24 hours. Control group received fresh media with 0.1% DMSO. Freshly harvested cells were processed for DNA-protein crosslinking with formaldehyde at a final concentration of 1% for 10 min at room temperature. Sonication of processed cell lysate was performed using Sonic Dismembrator ultrasonic processor (Fisher Scientific, Waltham, MA) to sheet genomic DNA into DNA fragments ranged between 200 and 1,000 bp (sonication settings: amplitude 30; 10 seconds on and 30 seconds off, 6-8 cycles).
11
Quantification of Alanine aminotransferase (ALT), Aspartate aminotransferase (AST) and total glutathione (GSH) levels in mouse serum. The freshly collected mouse serum samples were analyzed by enzymatic colorimetric assays using ALT and AST assay kits in accordance with manufacturer's protocols (Pointe Scientific, Ann Arbor, MI). Total GSH levels in the serum samples were analyzed by EnzyChromTM GSH Assay Kit in accordance with manufacturer's protocol with absorbance measured at 412 nm (BioAssay Systems, Hayward, CA).
Histopathology. Fresh liver samples were embedded in Surgipath® Cryo-Gel™ embedding compound (Fisher Scientific Inc., Pittsburgh, PA) and kept frozen until cryosectioning. Liver sections (4 µm in thickness) were stained with hematoxylin and eosin for the evaluation of hepatocellular injury. Histological scorings of necrotic area in DEX and/or acetaminphen-treated mouse liver sections were evaluated by using ImageJ software (downloaded from NIH website at https://imagej.nih.gov/ij/download.html), as previously described (Carew et al., 2012).
Statistical Analysis. Data are expressed as mean ± standard error. Comparisons between two treatment groups (for instance, between control and one DEX-treated group) were analyzed by Student’s t tests. Comparisons between more than two treatment groups with multiple independent variables were analyzed by three-way ANOVA followed by Duncan’s post-hoc tests (Sigmaplot, Systat Software, Inc., CA). The statistical significance is considered at p < 0.05.
12
Results: Dose- and time-dependent induction of Fgf21 mRNA by DEX in mouse liver. A two-day treatment of 2 and 50 mg/kg of DEX induced Fgf21 mRNA expression by 3- and 8-fold, respectively (Fig. 1A). A seven-day treatment of 2 and 50 mg/kg of DEX induced Fgf21 mRNA expression by 10- and 40-fold, respectively. A fourteen-day treatment of 2 and 50 mg/kg of DEX induced Fgf21 mRNA by 9- and 45-fold, respectively. Therefore, DEX dose- and time-dependently increased Fgf21 mRNA expression in mouse liver and reached a plateau or steady state expression around 7 days.
Concentration- and time-dependent induction of Fgf21/FGF21 mRNA by DEX in cultured mouse and human hepatoma cells. To determine whether DEX similarly induces mouse and human Fgf21/FGF21 mRNA expression, mouse (Hepa1c1c7) and human (Hep3B) hepatoma cells were utilized. As depicted in Fig. 1B (Top panel), in mouse Hepa1c1c7 cells, DEX (1, 3, and 10 μM) up-regulated Fgf21 mRNA expression in time- and concentration-dependent manners, with a maximal induction (4-fold) observed at 24 hours following 10 μM DEX treatment. In human Hep3B cells, 3 μM DEX trended to increase Fgf21 expression. 10 μM DEX increased Fgf21 mRNA expression at 12, 24 and 48 hours after treatment, with a maximal induction (10-fold) observed after 24 hours of treatment (Fig. 1B, Bottom panel). In both mouse and human hepatoma cells, 48-hr treatment still increased Fgf21/FGF21 mRNA expression; however, its induction potency tended to be lower as compared to 24-hr treatment.
Induction of Fgf21 protein expression by DEX in mouse liver and serum. In mouse liver, 2-, 7and 14-day treatment of DEX (50 mg/kg) increased Fgf21 protein expression by 1.3-, 1.7- and 2.3fold, respectively (Fig. 2A).
Because liver-derived Fgf21 can be secreted into bloodstream, we next determined the serum
13
levels of Fgf21 protein following DEX treatment. As shown in Fig. 2B, Fgf21 protein is undetectable in control-treated mouse serum. Seven-day treatment of 2 mg/kg of DEX produced detectable protein levels in serum. Seven-day treatment of 50 mg/kg of DEX increased serum Fgf21 protein level to 50 pg/ml. Fourteen-day treatment of 2 and 50 mg/kg of DEX increased serum Fgf21 protein levels to 78 pg/ml and 194 pg/ml, respectively.
Similarly, in mouse Hepa1c1c7 and human Hep3B cells, DEX (10μM) increased Fgf21/FGF21 protein levels in a time-dependent manner. Specifically, in Hepa1c1c7 cells, 24- and 48-hour treatment of DEX increased Fgf21 protein levels by 3.3- and 3.8-fold, respectively (Fig. 2C, Top panel). In Hep3B cells, 24- and 48-hour treatment of DEX increased FGF21 protein expression approximately 1.7- and 1.9-fold, respectively (Fig. 2C, Bottom panel).
Induction of Fgf21 mRNA by DEX in mouse liver is independent of PXR. DEX is known to activate nuclear receptors PXR and GR (Huss and Kasper, 2000). To delineate the role of PXR activation in DEX-induced Fgf21 expression, PXR-null mouse model was used. As shown in Fig. 3A, DEX (50 mg/kg) increased Fgf21 mRNA expression in both wild-type and PXR-null mouse liver. Therefore, induction of Fgf21 mRNA by DEX in mouse liver is PXR-independent.
Co-treatment of Mifepristone (RU486) attenuated the DEX-induced Fgf21 expression. Because PXR is not responsible for DEX-induced Fgf21 expression, we next determined the role of GR in DEX-induced Fgf21 expression. First, we co-treated hepatoma cells with DEX and a pharmacological antagonist of GR, Mifepristone (RU486). As shown in Fig. 3B, co-treatment of RU486 (3 μM) attenuated 10 μM DEX-induced Fgf21/FGF21 expression by more than 60% in cultured mouse Hepa1c1c7 and human Hep3B cells, indicating that GR activation is likely required to mediate DEX-induced Fgf21 expression.
14
siRNA mediated knockdown of GR abolished DEX-induced Fgf21 expression. In addition to inhibiting GR, RU486 can also repress progesterone receptor and androgen receptor activities (Im and Appleman, 2010; Ulmann et al., 1990). Therefore, there is a need to pin down the exact role of GR in DEX-induced Fgf21 expression. One strategy is to specifically silence GR expression by siRNA and ask if Fgf21 can be still induced by DEX. Commercially validated siRNA that specifically targets the mouse GR or human GR, as described in Materials and Methods, were utilized to knock down GR expression in mouse Hepa1c1c7 and human Hep3B cells. Optimal GR knockdown (75-85% reduction in GR mRNA levels compared to control siRNA) and minimal cytotoxicity was achieved using 10 and 25nM GR-specific siRNA. The silencing effect was maintained for at least 72 hours after transfection. Forty-eight hours post siRNA transfection, cells were incubated with DEX (10 μM) for another 24 hours. As depicted in Fig. 3C, GR knockdown abolished the induction of Fgf21 mRNA in both mouse and human hepatoma cells, demonstrating that GR activation is essential for Fgf21 induction by DEX.
DEX stimulated mouse and human Fgf21/FGF21 promoter activity revealed in Fgf21/FGF21 promoter-driven luciferase reporter assays. Luciferase reporter constructs containing 3.0-kb promoter sequence of mouse or human Fgf21/FGF21 gene was generated as described in Materials and Methods. The mouse and human recombinant reporter constructs were then transfected into mouse Hepa1c1c7 and human Hep3B cells, respectively. Twenty-four hours post transfection, cells were treated with DEX (10 μM) or vehicle for another 24 hours. As shown in Fig. 4A and 4B, DEX increased mouse and human Fgf21/FGF21 promoter-driven luciferase activity 1.6- and 5-fold, respectively. Therefore, DEX-activated GR stimulated Fgf21 promoter activity, which then led to up-regulation of Fgf21 expression.
DEX increased GR binding to the Fgf21 promoter. Luciferase reporter assays demonstrated that the 3.0 kb of mouse and human Fgf21/FGF21 gene promoter can be transactivated by DEX-
15
activated GR. We further determined specific cis-regulatory elements within 3-kb Fgf21/Fgf21 gene promoter that mediate DEX-induced Fgf21 expression. In silico DNA analysis of 3-kb of the mouse and human Fgf21/FGF21 gene promoter identified several putative GREs upstream of transcription start site (TSS) (mouse: -1,000 bp, -2,780bp, -2,880bp; human: -380bp, -1,530bp, 2,530bp).
To determine whether DEX increased the GR binding to these putative GREs in the mouse Fgf21 promoter in vivo, ChIP-qPCR assays were performed in DEX-treated mouse liver. As shown in Fig. 5A (Top panel), DEX increased the binding of GR to the -1,000bp and -2,880bp fragments of mouse Fgf21 gene promoter more than 12-fold. In contrast, DEX decreased the binding of GR to the -2,780bp fragment.
Similar to in vivo study, DEX increased the binding of GR to the -1,000bp and -2,880bp fragments of mouse Fgf21 gene promoter by 6- and 3-fold, respectively in cultured Hepa1c1c7 cells (Fig. 5A, Bottom panel). In Hep3B cells, DEX only increased the binding of GR to the -380bp fragment of human Fgf21 gene promoter (5-fold) but not -1,530bp and the -2,530bp DNA fragments (Fig. 5B).
Regulation of Cyp3a11 mRNA expression in mouse liver and serum GSH level by DEX. Previous studies showed that DEX (at high doses, such as 50 mg/kg) exacerbated acetaminophen-induced acute liver injury in vivo by inducing Cyp3a that can contribute to acetaminophen toxicity and/or deplete glutathione (Madhu et al., 1992; Masson et al., 2010). We next determined whether 2 mg/kg DEX similarly induced Cyp3a11 or depleted glutathione as 50 mg/kg DEX did in mouse liver. As expected, seven-day treatment of 50 mg/kg of DEX induced Cyp3a11 mRNA expression 10-fold in mouse liver. In contrast, seven-day treatment of 2 mg/kg of DEX did not alter Cyp3a11 mRNA expression in mouse liver (Fig. 6A). In addition, 50 mg/kg DEX apparently decreased mouse serum glutathione levels, whereas 2 mg/kg DEX did not affect serum
16
glutathione levels (Fig. 6B). Therefore, 2 mg/kg DEX neither induced Cyp3a11 mRNA expression nor depleted glutathione levels as 50 mg/kg DEX. Consequently, in the following DEXacetaminophen interaction experiment, 2 mg/kg DEX regimen was utilized.
Synergistic induction of Fgf21 mRNA by DEX and acetaminophen in mouse liver. A single administration of acetaminophen (300m/kg) did not alter Fgf21 mRNA expression 4 hours later, but increased Fgf21 mRNA expression 13- and 2.6-fold, respectively 8- and 24-hour later. Seven-day pre-treatment of 2 mg/kg of DEX induced Fgf21 mRNA expression 6-fold in wild-type mouse liver. In contrast, co-treatment of low dose of DEX (pre-treated for 7 days) and acetaminophen (treated for 4, 8, and 24 hours) induced Fgf21 mRNA expression by 7-, 32-, and 4- fold, respectively (Fig. 6C). Therefore, co-treatment of 2 mg/kg DEX and acetaminophen synergistically induced Fgf21 expression compared to acetaminophen treatment alone.
Pre-treatment of 2 mg/kg of DEX attenuated acute acetaminophen hepatotoxicity. In wildtype mice, acetaminophen (300 mg/kg) increased serum ALT levels 4 hours later (Fig. 7A) and even higher 8 hours later (Fig. 7B), indicating that acetaminophen causes apparent liver injury. Pre-treatment with DEX (2 mg/kg) for 7 days markedly alleviated acetaminophen-increased ALT levels by 55% and 60%, 4 and 8 hours after treatment, respectively (Fig. 7A and 7B). In Fgf21-null mice, in absence of functional Fgf21, DEX pre-treatment had no protective effect on acetaminophen-induced ALT elevation (Fig. 7A and 7B).
In wild-type mice, acetaminophen continued to increase serum ALT (Fig. 7C) and AST (Fig. 7D) levels even 24 hours later. Pretreatment with DEX (2 mg/kg) for 7 days attenuated the induction of serum ALT and AST by acetaminophen by more than 60% and 40%, respectively (Fig. 7C and 7D). In contrast in Fgf21-null mice, DEX pre-treatment had no protective influence on serum ALT and AST levels (Fig. 7C and 7D). Therefore, pre-treatment of 2 mg/kg DEX for 7 days exhibited
17
protective effect on acetaminophen-induced liver injury.
Co-treatment of 2 mg/kg of DEX did not attenuate the progression of acute Acetaminophen hepatotoxicity. In wild-type mice, acetaminophen (300 mg/kg) markedly increased serum ALT and AST 24 hours after treatment (Fig. 7E). However, co-treatment of single dose of DEX (2 mg/kg) and acetaminophen at the same time caused similar elevation in serum ALT and AST levels (Fig. 7E). Therefore, distinct from DEX pretreatment, co-treatment of 2 mg/kg of DEX will not alleviate acetaminophen-induced liver injury.
Histopathology of mouse liver in DEX pretreatment-APAP interaction study. No obvious damage was observed in the livers of WT and Fgf21-null mice treated with vehicle (corn oil) or 2 mg/kg DEX (Fig. 8). In wild-type mouse liver, APAP (300mg/kg) caused regional necrosis and blood infiltration. However, pretreatment of 2 mg/kg DEX alleviated APAP-induced acute liver injury indicated by less necrosis and no blood infiltration in wild-type mouse liver. In Fgf21-null mice, 2 mg/kg DEX treatment for two weeks did not cause apparent liver injury. However, APAP produced clear necrosis regardless of DEX pretreatment or non-DEX pretreatment (Fig. 8A). Pretreatment of 2 mg/kg DEX even exaggerated APAP-induced acute liver injury in Fgf21-null mice, indicated by larger necrotic area. Taken together, 2mg/kg DEX pretreatment attenuated acetaminophen hepatotoxicity via Fgf21. ImageJ analysis of the images further demonstrated that pre-treatment of 2mg/kg DEX attenuated APAP-induced necrosis in wild-type mouse liver, but exaggerated it in Fgf21-null mouse liver (Fig. 8B).
18
Discussion: Recent studies, including our previous study, unveiled a cellular protective role of Fgf21, which can alleviate toxicities induced by various chemicals, such as of dioxins (Rier, 2002), alcohols (Zhu et al., 2014), and acetaminophen (Ye et al., 2014). Several reports have also shown that Fgf21 is interconnected with the glucocorticoid signaling (Beser et al., 2011; Patel et al., 2015). For instance, prednisolone, a synthetic glucocorticoid, increased serum Fgf21 level 2-fold after 7 days treatment in mice (Laskewitz et al., 2010). Patel et al. showed that glucocorticoids stimulated the transcription of Fg21 in a feed-forward loop in mouse liver as well as in cultured mouse primary hepatocytes via interaction between GR activation and PPARα activation (2015). In the present study, we reported that synthetic glucocorticoid DEX dose/concentration- and time-dependently induced mouse and human Fgf21/FGF21 expression (Fig. 1). DEX induced Fgf21 mRNA expression in wild-type mouse liver reached steady state around Day 7. Interestingly, we observed a remarkable increase in the serum Fgf21 levels corresponding to the induction of hepatic Fgf21 mRNA that is in agreement with several studies investigating the endocrine nature of Fgf21 (Markan et al., 2014; Zhang et al., 2008). The fold change in the serum Fgf21 levels after DEX treatment was comparable to previous reports in mouse models as well as clinical studies (Dushay et al., 2015; Spolcova et al., 2014). In addition, we showed that Fgf21 is a direct target gene of GR in mouse liver as well as in cultured mouse or human hepatoma cells. Moreover, pre-treatment of 2 mg/kg DEX mitigated acetaminophen-induced acute liver injury.
DEX can activate GR and/or PXR to mediate its pharmacological actions (Cool et al., 2002; Dieken and Miesfeld, 1992; Falkner et al., 2001). DEX administration induced Fgf21 mRNA expression in livers of both wild-type and PXR-null mice (Fig. 3A). In addition, our unpublished data also showed that treatment of pregnenolone-16α carbonitrile and spironolactone, two established mouse PXR activators, did not alter Fgf21 expression in mouse liver. Moreover, in silico DNA sequence analysis, using either NubiScan or AliBaba 2.1, did not reveal apparent PXR binding sites in the
19
8.0-kb promoter DNA sequences of mouse or human Fgf21/FGF21 genes. Therefore, PXR activation is not required for Fgf21 up-regulation by DEX.
Consequently, GR-mediated pathway seemed to be a logical candidate for Fgf21 regulation. A previous study reported that glucocorticoids up-regulated Fgf21 via increasing the binding of GR to a locus 4.4-kb downstream in mouse Fgf21 gene (Patel et al., 2015). However, such GR binding site was not conserved in human FGF21 gene (Patel et al., 2015). Our present studies, using both in vivo and in vitro approaches, demonstrated that DEX-activated GR binds to specific cisregulatory elements in 3.0-kb mouse and human Fgf21/FGF21 gene promoters. Specifically, coadministration of a GR antagonist, Mifepristone (RU486), abrogated the DEX-induced Fgf21/FGF21 mRNA expression in mouse and human hepatoma cells (Fig. 3B) and GR knockdown by GR-targeting siRNA, also abolished the DEX-induced Fgf21 expression (Fig. 3C). In addition, we showed that DEX increased luciferase reporter gene activities, which is driven by 3.0-kb mouse or human Fgf21/FGF21 gene promoter (Fig. 4). Luciferase reporter assays suggested that compared to mouse Fgf21 gene promoter, human FGF21 gene promoter tended to be more responsive to DEX-activated GR (Fig. 4). However, because the DNA sequences of mouse and human Fgf21/FGF21 gene promoters are very different, the regulation of Fgf21/FGF21 expression is species-different. In other words, we cannot compare the induction intensity of mouse and human Fgf21/FGF21 gene promoter-driven luciferase activity. Instead, we can state that both mouse and human Fgf21/FGF21 genes are regulated by GR signaling. Furthermore, ChIP-qPCR assays demonstrated that DEX increased the binding of GR to specific cis-regulatory elements located in the mouse Fgf21 gene promoter (GREs located at -1,000bp and -2,880bp upstream of transcription start site; Fig. 5A) and in the human Fgf21 gene promoter (GRE located at -380bp upstream of transcription start site; Fig. 5B). In general, ligand-activated GR forms a homodimer and then translocates into nucleus where it binds to a full consensus GRE containing two GR binding half sites separated by a 3bp spacer. However, recent studies also suggested that
20
GR can bind, as a functional monomer, to a single GR binding site to regulate the expression of its specific target genes (Schiller et al., 2014). Therefore, DEX-activated GR binds to the cisregulatory elements (herein GREs) in mouse and human Fgf21/FGF21 gene promoter, which were revealed in the present studies, and thus up-regulates Fgf21 expression.
Acetaminophen is metabolized in liver to a toxic metabolite N-acetyl-p-benzoquinone imine (NAPQI) by cytochrome P450 enzyme activity, such as Cyp3a11 in mouse liver. Then, NAPQI is detoxified by forming glutathione (GSH) conjugates in the liver (Jaeschke et al., 2011). In case of acetaminophen overdose, cellular GSH storage is depleted and subsequently NAPQI is not effectively detoxified. NAPQI covalently binds to mitochondrial proteins and triggers mitochondrial dysfunction, ATP depletion, and oxidative stress (Jaeschke et al., 2010a; Jaeschke et al., 2010b). Previous reports showed that glucocorticoid exposure worsened acetaminophen-induced liver injury in vivo (Madhu et al., 1992; Masson et al., 2010). This aggravation of acetaminopheninduced liver injury by DEX is mainly observed at relatively higher doses of DEX exposure, such as 50 mg/kg, and is primarily mediated by transcriptional induction of Cyp3a11 and glutathione depletion. Cyp3a11 is a well-known PXR target gene (Cheng and Klaassen, 2006; Cheng et al., 2005). Via PXR activation, DEX induced Cyp3a11 expression and thus enhanced acetaminophen toxication. In the present study, we showed that 2 mg/kg DEX did not markedly induce Cyp3a11 mRNA expression in mouse liver because such dose is not sufficient to activate PXR (Fig. 6A). In addition, 2 mg/kg DEX did not markedly reduce serum glutathione levels (Fig. 6B). In contrast, 50 mg/kg DEX apparently activated PXR and thus markedly induced Cyp3a11 mRNA expression. Moreover, 50 mg/kg DEX reduced serum glutathione levels (Fig. 6A and 6B). Therefore, low dose (2 mg/kg) DEX did not deteriorate acetaminophen toxicity because PXR is not apparently activated by such dose of DEX. Instead, as discussed above, pre-treatment of 2mg/kg DEX attenuated acetaminophen hepatotoxicities. Because 2 mg/kg DEX pre-treatment did not increase serum GSH levels, in fact denoted a decreasing trend (Fig. 6B), the protective effects of 2 mg/kg DEX
21
pre-treatment against acetaminophen-induced acute liver injury is not due to GSH. By using Fgf21-null mouse model, we further demonstrated that pre-treatment of 2 mg/kg DEX protects against APAP-induced acute hepatotoxicity via Fgf21 induction in mouse liver (Figs. 6-8). A recent finding showed that gain-of-function of Fgf21 ameliorated acetaminophen-induced liver injury (Ye et al., 2014).
Fasting, via activation of peroxisome proliferator-activated receptor (PPAR) alpha, markedly upregulated Fgf21 expression. If just considering increased Fgf21 expression, fasting will be a protective means to fight against acetaminophen overdose-induced acute liver injury. However, actually, fasting potentiated acetaminophen-induced liver injury even through Fgf21 is induced (Price et al., 1987). To explicate this, we should consider that during the fasting, hepatic glutathione storage was depleted, and glucuronidation and sulfation pathways were repressed (Price et al., 1987; Walker et al., 1982). Glutathione conjugation, glucuronidation, and sulfation are all involved in acetaminophen detoxification. Therefore, fasting exaggerated acetaminopheninduced liver injury even through it induced Fgf21 expression.
Our findings may also provide an explanation for previous observations that diabetic animals tolerate acetaminophen-induced liver injury better than non-diabetic animals (Doi and Ishida, 2009; Price and Jollow, 1982; Shankar et al., 2003). In the diabetic animals or patients, serum Fgf21/FGF21 levels are elevated as compared to non-diabetic animals or patients (Jian et al., 2012; Lin et al., 2014; Spolcova et al., 2014; Yu et al., 2002). Therefore, in response to acetaminophen challenge, Fgf21 levels will further increase in diabetic animals, which will confer the protective effect to acetaminophen-induced hepatotoxicity, similar to the effects of 2 mg/kg DEX pretreatment in the present study.
In conclusion, the present study demonstrates that DEX induced Fgf21 expression in mouse and
22
human liver/hepatoma cells, directly via GR activation. Moreover, low dose DEX-induced Fgf21 plays a protective role in attenuating acute acetaminophen-induced hepatotoxicity.
23
Conflict of interest: The authors declare that there is no conflict of interest.
24
Acknowledgements: This work was supported by St. John’s University Start funds (X.C.).
25
Authorship Contributions:
Participated in research design: Vispute, Bu, and Cheng Conducted experiments: Vispute, Le Performed data analysis: Vispute, Bu, Le, and Cheng Wrote or contributed to the writing of the manuscript: Vispute, Bu, Le, and Cheng
26
References: Beser MI, Pardo O, Beltran J and Yusa V (2011) Determination of per- and polyfluorinated substances in airborne particulate matter by microwave-assisted extraction and liquid chromatography-tandem mass spectrometry. J Chromatogr A 1218: 4847-55. Bohensky J, Leshinsky S, Srinivas V and Shapiro IM (2010) Chondrocyte autophagy is stimulated by HIF-1 dependent AMPK activation and mTOR suppression. Pediatr Nephrol 25:633-642. Carew JS, Esquivel JA, 2nd, Espitia CM, Schultes CM, Mulbaier M, Lewis JD, Janssen B, Giles FJ and Nawrocki ST (2012) ELR510444 inhibits tumor growth and angiogenesis by abrogating HIF activity and disrupting microtubules in renal cell carcinoma. PLoS One 7:e31120. Cheng X and Klaassen CD (2006) Regulation of mRNA expression of xenobiotic transporters by the pregnane x receptor in mouse liver, kidney, and intestine. Drug Metab Dispos 34:18631867. Cheng X, Maher J, Dieter MZ and Klaassen CD (2005) Regulation of mouse organic aniontransporting polypeptides (Oatps) in liver by prototypical microsomal enzyme inducers that activate distinct transcription factor pathways. Drug Metab Dispos 33:1276-1282. Cool S, Jackson R, Pincus P, Dickinson I and Nurcombe V (2002) Fibroblast growth factor receptor 4 (FGFR4) expression in newborn murine calvaria and primary osteoblast cultures. Int J Dev Biol 46:519-523. Dieken ES and Miesfeld RL (1992) Transcriptional transactivation functions localized to the glucocorticoid receptor N terminus are necessary for steroid induction of lymphocyte apoptosis. Mol Cellul Biol 12:589-597. Doi K and Ishida K (2009) Diabetes and hypertriglyceridemia modify the mode of acetaminopheninduced hepatotoxicity and nephrotoxicity in rats and mice. J Toxicol Sci 34:1-11. Dushay JR, Toschi E, Mitten EK, Fisher FM, Herman MA and Maratos-Flier E (2015) Fructose ingestion acutely stimulates circulating FGF21 levels in humans. Mol Metabol 4:51-57. Falkner KC, Pinaire JA, Xiao GH, Geoghegan TE and Prough RA (2001) Regulation of the rat glutathione S-transferase A2 gene by glucocorticoids: involvement of both the glucocorticoid and pregnane X receptors. Mol Pharmacol 60:611-619. Huss JM and Kasper CB (2000) Two-stage glucocorticoid induction of CYP3A23 through both the glucocorticoid and pregnane X receptors. Mol Pharmacol 58:48-57. Im A and Appleman LJ (2010) Mifepristone: pharmacology and clinical impact in reproductive medicine, endocrinology and oncology. Expert opinion on pharmacotherapy 11:481-488. Itoh N and Ornitz DM (2008) Functional evolutionary history of the mouse Fgf gene family. Dev Dyn 237:18-27. Itoh N and Ornitz DM (2011) Fibroblast growth factors: from molecular evolution to roles in development, metabolism and disease. J Biochem 149:121-130. Jaeschke H, McGill MR, Williams CD and Ramachandran A (2011) Current issues with acetaminophen hepatotoxicity--a clinically relevant model to test the efficacy of natural products. Life sciences 88:737-745. Jaeschke H, Williams CD, McGill MR and Farhood A (2010a) Herbal extracts as hepatoprotectants against acetaminophen hepatotoxicity. World journal of gastroenterology : WJG 16:24482450. Jaeschke H, Yan HM and Ramachandran A (2010b) Reactive nitrogen species in acetaminopheninduced mitochondrial damage and toxicity in mouse hepatocytes: a cautionary note on the impact of cell culture conditions. Chem Res Toxicol 23:1853-1854; author reply 1855-1858. Jian WX, Peng WH, Jin J, Chen XR, Fang WJ, Wang WX, Qin L, Dong Y and Su Q (2012) Association between serum fibroblast growth factor 21 and diabetic nephropathy. Metabolism 61:853-859. Jiang S, Yan C, Fang QC, Shao ML, Zhang YL, Liu Y, Deng YP, Shan B, Liu JQ, Li HT, Yang L, Zhou J, Dai Z, Liu Y and Jia WP (2014) Fibroblast growth factor 21 is regulated by the
27
IRE1alpha-XBP1 branch of the unfolded protein response and counteracts endoplasmic reticulum stress-induced hepatic steatosis. J Biol Chem 289:29751-29765. Kharitonenkov A, Shiyanova TL, Koester A, Ford AM, Micanovic R, Galbreath EJ, Sandusky GE, Hammond LJ, Moyers JS, Owens RA, Gromada J, Brozinick JT, Hawkins ED, Wroblewski VJ, Li DS, Mehrbod F, Jaskunas SR and Shanafelt AB (2005) FGF-21 as a novel metabolic regulator. J Clin Invest 115:1627-1635. Laskewitz AJ, van Dijk TH, Bloks VW, Reijngoud DJ, van Lierop MJ, Dokter WH, Kuipers F, Groen AK and Grefhorst A (2010) Chronic prednisolone treatment reduces hepatic insulin sensitivity while perturbing the fed-to-fasting transition in mice. Endocrinology 151:21712178. Lim HW, Uhlenhaut NH, Rauch A, Weiner J, Hubner S, Hubner N, Won KJ, Lazar MA, Tuckermann J and Steger DJ (2015) Genomic redistribution of GR monomers and dimers mediates transcriptional response to exogenous glucocorticoid in vivo. Genome research 25:836-844. Lin Y, Xiao YC, Zhu H, Xu QY, Qi L, Wang YB, Li XJ, Zheng ML, Zhong RS, Zhang Y, Xu XD, Wu BL, Xu ZM and Lu XH (2014) Serum fibroblast growth factor 21 levels are correlated with the severity of diabetic retinopathy. J Diabetes Res 2014:929756. Luo Y and McKeehan WL (2013) Stressed Liver and Muscle Call on Adipocytes with FGF21. Front Endocrinol 4:194. Madhu C, Maziasz T and Klaassen CD (1992) Effect of pregnenolone-16 alpha-carbonitrile and dexamethasone on acetaminophen-induced hepatotoxicity in mice. Toxicol Appl Pharmacol 115:191-198. Markan KR, Naber MC, Ameka MK, Anderegg MD, Mangelsdorf DJ, Kliewer SA, Mohammadi M and Potthoff MJ (2014) Circulating FGF21 is liver derived and enhances glucose uptake during refeeding and overfeeding. Diabetes 63:4057-4063. Masson MJ, Collins LA, Carpenter LD, Graf ML, Ryan PM, Bourdi M and Pohl LR (2010) Pathologic role of stressed-induced glucocorticoids in drug-induced liver injury in mice. Biochem Biophys Res Commun 397:453-458. Patel R, Bookout AL, Magomedova L, Owen BM, Consiglio GP, Shimizu M, Zhang Y, Mangelsdorf DJ, Kliewer SA and Cummins CL (2015) Glucocorticoids regulate the metabolic hormone FGF21 in a feed-forward loop. Mol Endocrinol 29:213-223. Planavila A, Redondo-Angulo I, Ribas F, Garrabou G, Casademont J, Giralt M and Villarroya F (2015) Fibroblast growth factor 21 protects the heart from oxidative stress. Cardiovasc Res 106:19-31. Potthoff MJ, Inagaki T, Satapati S, Ding X, He T, Goetz R, Mohammadi M, Finck BN, Mangelsdorf DJ, Kliewer SA and Burgess SC (2009) FGF21 induces PGC-1alpha and regulates carbohydrate and fatty acid metabolism during the adaptive starvation response. Proc Natl Acad Sci USA 106:10853-10858. Price VF and Jollow DJ (1982) Increased resistance of diabetic rats to acetaminophen-induced hepatotoxicity. J Pharmacol ExpTher 220:504-513. Price VF, Miller MG and Jollow DJ (1987) Mechanisms of fasting-induced potentiation of acetaminophen hepatotoxicity in the rat. Biochem Pharmacol 36:427-433. Rier SE (2002) The potential role of exposure to environmental toxicants in the pathophysiology of endometriosis. Ann N Y Acad Sci 955:201-212; discussion 230-202, 396-406. Schiller BJ, Chodankar R, Watson LC, Stallcup MR and Yamamoto KR (2014) Glucocorticoid receptor binds half sites as a monomer and regulates specific target genes. Genome Biol 15:418. Shankar K, Vaidya VS, Corton JC, Bucci TJ, Liu J, Waalkes MP and Mehendale HM (2003) Activation of PPAR-alpha in streptozotocin-induced diabetes is essential for resistance against acetaminophen toxicity. FASEB J 17:1748-1750. Spolcova A, Holubova M, Mikulaskova B, Nagelova V, Stofkova A, Lacinova Z, Jurcovicova J, Haluzik M, Maletinska L and Zelezna B (2014) Changes in FGF21 serum concentrations
28
and liver mRNA expression in an experimental model of complete lipodystrophy and insulinresistant diabetes. Physiol Res 63:483-490. Ulmann A, Teutsch G and Philibert D (1990) Ru 486. Scientific American 262:42-48. Walker RM, Massey TE, McElligott TF and Racz WJ (1982) Acetaminophen toxicity in fed and fasted mice. Can J Physiol Pharmacol 60:399-404. Xu P, Ye X, Zhang Y, Yuan Q, Liu M, Wu Q, Ren G and Li D (2015) Long-acting hypoglycemic effects of PEGylated FGF21 and insulin glargine in mice with type 1 diabetes. J Diabetes Complications 29:5-12. Ye D, Wang Y, Li H, Jia W, Man K, Lo CM, Wang Y, Lam KS and Xu A (2014) Fibroblast growth factor 21 protects against acetaminophen-induced hepatotoxicity by potentiating peroxisome proliferator-activated receptor coactivator protein-1alpha-mediated antioxidant capacity in mice. Hepatol 60:977-989. Yu C, Wang F, Jin C, Wu X, Chan WK and McKeehan WL (2002) Increased carbon tetrachlorideinduced liver injury and fibrosis in FGFR4-deficient mice. Am J Pathol 161:2003-2010. Yu Y, Li S, Liu Y, Tian G, Yuan Q, Bai F, Wang W, Zhang Z, Ren G, Zhang Y and Li D (2015) Fibroblast growth factor 21 (FGF21) ameliorates collagen-induced arthritis through modulating oxidative stress and suppressing nuclear factor-kappa B pathway. Int Immunopharmacol 25:74-82. Zhang X, Yeung DC, Karpisek M, Stejskal D, Zhou ZG, Liu F, Wong RL, Chow WS, Tso AW, Lam KS and Xu A (2008) Serum FGF21 levels are increased in obesity and are independently associated with the metabolic syndrome in humans. Diabetes 57:1246-1253. Zhu S, Ma L, Wu Y, Ye X, Zhang T, Zhang Q, Rasoul LM, Liu Y, Guo M, Zhou B, Ren G and Li D (2014) FGF21 treatment ameliorates alcoholic fatty liver through activation of AMPK-SIRT1 pathway. Acta Bioch Bioph Sin 46:1041-1048.
29
Figure Legends: Fig. 1. Induction of Fgf21 mRNA expression by DEX in mouse liver as well as in cultured mouse Hepa1c1c7 and human Hep3B hepatoma cells. A, Fgf21 mRNA expression in male C57BL/6 mouse liver after once daily administration of DEX (2 and 50 mg/kg) for 2, 7, and 14 days (n=5/treatment group). Control group received corn oil. B, Mouse Hepa1c1c7 and human Hep3B cells were treated, in tetraplicate, with 1, 3, and 10μM of DEX for 12, 24, and 48 hours, respectively. Control group received 0.1% DMSO. Messenger RNA expression of mouse (Top panel) and human (Bottom panel) Fgf21/FGF21 gene were determined. All data are expressed as mean ± S.E. Asterisk indicates statistical difference between DEX-treated group and control group (p < 0.05).
Fig. 2. Induction of Fgf21 protein expression by DEX in mouse liver as well as in cultured mouse and human hepatoma cells. A, The mice were treated with 50 mg/kg DEX once daily and sacrificed 2, 7 or 14 days later. Top panel, protein expression of Fgf21 and β-actin in mouse liver analyzed by Western blotting; Bottom panel, protein levels of Fgf21 in mouse liver are expressed as the ratio of Fgf21 to β-actin protein. B, The mice were treated with 2 and 50 mg/kg DEX once daily and sacrificed 7 and 14 days later. Mouse sera were isolated for Fgf21 protein quantification by ELISA. All data are expressed as mean ± S.E. (n=5/treatment). Asterisk indicates statistical difference between DEX-treated and control group (p < 0.05). C, Induction of Fgf21/FGF21 protein by DEX in mouse Hepa1c1c7 (Top panel) and human Hep3B (Bottom panel) hepatoma cells. Protein levels of Fgf21/FGF21 are expressed as the ratio of Fgf21/FGF21 to β-actin protein. All data are expressed as mean ± S.E. Asterisk indicates statistical difference between DEX-treated group and control group (p < 0.05).
Fig. 3. Mechanistic characterization of Fgf21 induction by DEX. A, Induction of Fgf21 mRNA by DEX in wild-type and PXR-null mouse liver. Adult male wild-type and age matched PXR-null mice
30
were treated with control (corn oil) or DEX (50 mg/kg) (n=5/treatment) once daily for 4 days. All data are expressed as mean ± S.E. Asterisk indicates statistical difference between DEX-treated group and control group (p < 0.05). B, Impact of co-treatment of 3μM RU486 on the 10μM DEXinduced Fgf21/FGF21 mRNA expression in cultured mouse Hepa1c1c7 (Top panel) and human Hep3B cells (Bottom panel). Asterisk indicates statistical difference between with DEX- and without DEX-treated groups (p < 0.05). ¥ indicates statistical difference between DEX-treated and co-treated (RU486 + DEX) groups (p < 0.05). C, Effect of GR knockdown on the 10μM DEXinduced Fgf21/FGF21 mRNA expression in cultured mouse Hepa1c1c7 (Top panel) and human Hep3B hepatoma cells (Bottom panel). All data were expressed as mean ± S.E. (n=4/treatment). Asterisk indicates statistical difference between DEX-treated GR-normal cells and DEX-treated GR-knockdown cells (p < 0.05).
Fig. 4. Regulation of mouse or human Fgf21/FGF21 promoter-driven luciferase reporter activity by DEX in cultured hepatoma cells. A, Mouse Hepa1c1c7 cells were transfected with mouse Fgf21 gene promoter-pGL3 recombinant reporter construct and then treated with DEX (10 μM) for 24 hours; B, Human Hep3B cells were transfected with human FGF21 gene promoter-pGL3 recombinant reporter construct and then treated with DEX (10 μM) for 24 hours. Dual luciferase assays were performed in triplicates. All data were expressed as mean ± S.E. Asterisk indicates statistical difference between DEX-treated group and control (0.1% DMSO) (p < 0.05).
Fig. 5. ChIP-qPCR assays of GR binding to the putative GREs located in mouse and human Fgf21/FGF21 gene promoter. A, relative GR binding quantified by qPCR following ChIP assay in DEX (50 mg/kg)-treated wild-type mouse livers (Top panel) or in DEX (10 μM)-treated mouse Hepa1c1c7 hepatoma cells (Bottom panel). B, relative GR binding quantified by qPCR following ChIP assay in DEX (10 μM)-treated human Hep3B hepatoma cells. The GR binding revealed by IgG-precipitation-driven ChIP-qPCR assays was used as negative control. The GR binding
31
revealed by RNA Pol II antibody-precipitation-driven ChIP-qPCR assays was used as positive control. The GR binding data are normalized to the GR binding revealed by IgG-precipitationdriven ChIP-qPCR assays.
Fig. 6. Dose-dependent regulation of Cyp3a11 and glutathione by DEX and Fgf21 induction by cotreatment of DEX (pre-treated for 7 days) and acetaminophen (300 mg/kg). Adult male C57BL/6 mice (n=5/treatment) were once daily administered DEX (2 and 50 mg/kg; i.p.) for 7 days. On day 8, Cyp3a11 mRNA expression in mouse liver (A) as well as serum glutathione levels (B) were analyzed by quantitative real-time PCR and EnzyChromTM GSH Assay Kit, respectively. C, Timedependent regulation of Fgf21 mRNA by co-treatment of acetaminophen and 2 mg/kg DEX in wildtype mouse liver. Adult male C57BL/6 mice were pre-treated with DEX (2 mg/kg; i.p.) once daily for 7 days. Then the mice were challenged with a single dose of acetaminophen (300 mg/kg; i.p.) for 4, 8, and 24 hours. Total RNA from mouse livers was analyzed by qRT-PCR (n=5/group). All data are expressed as mean ± S.E. (n=5/group). Asterisk indicates statistical difference between DEX treatment group and control group (p < 0.05).
Fig. 7. Effect of pre-treatment and co-treatment of 2mg/kg of DEX on acetaminophen toxicity. Adult (approximately 8-weeks of age) male wild-type mice and age-matched Fgf21-null mice were pretreated with DEX (2 mg/kg; i.p.), once daily for 7 days and then subjected to a single dose of acetaminophen treatment (300 mg/kg; i.p.) (n=3-5/treatment). Serum biomarkers of liver injury, ALT and AST were measured after 4, 8, and 24 hours. ALT levels were quantified in sera of wildtype and Fgf21-null mice 4 (A), 8 (B), and 24 hours (C) post acetaminophen challenge. D, AST levels in wild-type and Fgf21-null mice 24 hours post acetaminophen challenge. E, Effect of cotreatment of 2 mg/kg of DEX on acetaminophen toxicity. Adult (approximately 8-weeks of age) male wild-type mice were co-administered with DEX (2 mg/kg; i.p.) and acetaminophen (300 mg/kg; i.p.) (n=3-5/treatment). Serum ALT (Left panel) and AST (Right panel) levels in mouse sera
32
were measured 24 hours later. All data are expressed as mean ± S.E. Asterisk indicates statistical difference between DEX treatment and control treatment (corn oil). ¥ indicates statistical difference between acetaminophen alone and combination (DEX + Acetaminophen) groups. (p < 0.05).
Fig. 8. Histopathology of mouse liver pretreated with DEX prior to APAP challenge. A, Histology of mouse liver after DEX and/or APAP treatment. Adult male wild-type and age-matched male Fgf21null mice were divided into 4 groups (n=3-5/treatment). Group-1 and 2 received corn oil once daily through i.p. administration. Group-3 and 4 were once daily pre-treated with DEX (2 mg/kg, dissolved in corn oil; i.p. administration) for 7 days. On day 8, Group-2 and 4 mice were given a single i.p. administration of acetaminophen (300 mg/kg, dissolved in saline). After 24 hours of acetaminophen challenge, mouse livers were collected and processed for H&E staining. (Magnification 20x). B, histological scoring of necrotic area in liver sections of wild-type mice (Top panel) and Fgf21-null mice (Bottom panel). Percent necrosis was calculated using ImageJ software (Carew et al., 2012). Mean ± SD, n = 3-4. *Indicates a significant difference compared to controls (vehicle); ¥ indicates statistical difference between acetaminophen alone and combination (DEX + Acetaminophen) groups. (p < 0.05).
33
Table 1: qPCR primers flanking putative GREs in the 3kb promoter region of mouse and human Fgf21 genes for the ChIP-qPCR assays.
Species Human
Mouse
Location of GREs (upstream of TSS)
Forward primer
Reverse primer
-380 bp
5ʹ- tgtcagatcacgccctcc -3ʹ
5ʹ- gtgctgggctcctggaaaa -3ʹ
-1,350 bp
5ʹ- tgccttcagtctcttgcctc -3ʹ
5ʹ- tgggaatcaagtcaaactcctg -3ʹ
-2,530 bp
5ʹ- caggctaacgtagggtccag -3ʹ
5ʹ- ggcccagctgttttctcttt -3ʹ
-1,000 bp
5ʹ- aaagcatctggagagcacct -3ʹ
5ʹ- tagcattcgggccttgtg -3ʹ
-2,780 bp
5ʹ- ctgtaaaagcaagcccctgg -3ʹ
5ʹ- ggacatgggctgaatcgttc -3ʹ
-2,880 bp
5ʹ- tgggagccaggggaaaac -3ʹ
5ʹ- ctgatgtttgttcctgtctcaca -3ʹ
34
Accepted Manuscript Title: Activation of GR but not PXR by Dexamethasone Attenuated Acetaminophen Hepatotoxicities via Fgf21 Induction Authors: Saurabh G. Vispute, Pengli Bu, Yuan Le, Xingguo Cheng PII: DOI: Reference:
S0300-483X(17)30009-4 http://dx.doi.org/doi:10.1016/j.tox.2017.01.009 TOX 51812
To appear in:
Toxicology
Received date: Revised date: Accepted date:
8-8-2016 5-1-2017 9-1-2017
Please cite this article as: Vispute, Saurabh G., Bu, Pengli, Le, Yuan, Cheng, Xingguo, Activation of GR but not PXR by Dexamethasone Attenuated Acetaminophen Hepatotoxicities via Fgf21 Induction.Toxicology http://dx.doi.org/10.1016/j.tox.2017.01.009 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.