Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21

Article

Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21 Graphical Abstract

Authors Dae-Seok Kim, Cristel V. Camacho, Anusha Nagari, Venkat S. Malladi, Sridevi Challa, W. Lee Kraus

Correspondence [email protected]

In Brief Kim et al. demonstrate that snoRNAactivated PARP-1 ADPRylates DDX21 in BRCA1/2-wild-type breast cancer cells to promote enhanced ribosome biogenesis and cell proliferation. The snoRNA-PARP1-DDX21-ribosome biogenesis axis provides an alternative cellular pathway that can be targeted by PARPi for therapeutic benefits, irrespective of BRCA1/2 status.

Highlights d

snoRNAs bind PARP-1 to stimulate PARP-1 automodification and DDX21 interactions

d

snoRNA-activated PARP-1 PARylates DDX21 to promote nucleolar localization

d

PARylated DDX21 associates with the rDNA locus to drive ribosome biogenesis

d

PARP inhibitors block enhanced ribosome biogenesis and cancer cell growth

Kim et al., 2019, Molecular Cell 75, 1–16 September 19, 2019 ª 2019 Elsevier Inc. https://doi.org/10.1016/j.molcel.2019.06.020

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

Molecular Cell

Article Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21 Dae-Seok Kim,1,2 Cristel V. Camacho,1,2 Anusha Nagari,1,2 Venkat S. Malladi,1,2 Sridevi Challa,1,2 and W. Lee Kraus1,2,3,* 1Laboratory of Signaling and Gene Regulation, Cecil H. and Ida Green Center for Reproductive Biology Sciences, University of Texas Southwestern Medical Center, Dallas, TX 75390, USA 2Division of Basic Research, Department of Obstetrics and Gynecology, University of Texas Southwestern Medical Center, Dallas, TX 75390, USA 3Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.molcel.2019.06.020

SUMMARY

PARP inhibitors (PARPi) prevent cancer cell growth by inducing synthetic lethality with DNA repair defects (e.g., in BRCA1/2 mutant cells). We have identified an alternative pathway for PARPi-mediated growth control in BRCA1/2-intact breast cancer cells involving rDNA transcription and ribosome biogenesis. PARP-1 binds to snoRNAs, which stimulate PARP-1 catalytic activity in the nucleolus independent of DNA damage. Activated PARP-1 ADP-ribosylates DDX21, an RNA helicase that localizes to nucleoli and promotes rDNA transcription when ADP-ribosylated. Treatment with PARPi or mutation of the ADP-ribosylation sites reduces DDX21 nucleolar localization, rDNA transcription, ribosome biogenesis, protein translation, and cell growth. The salient features of this pathway are evident in xenografts in mice and human breast cancer patient samples. Elevated levels of PARP-1 and nucleolar DDX21 are associated with cancer-related outcomes. Our studies provide a mechanistic rationale for efficacy of PARPi in cancer cells lacking defects in DNA repair whose growth is inhibited by PARPi.

INTRODUCTION PARP-1 is a ubiquitously expressed nuclear enzyme that plays key roles in DNA repair and gene regulation (Gibson and Kraus, 2012; Gupte et al., 2017; Krishnakumar and Kraus, 2010). Upon activation, PARP-1 uses nicotinamide adenine dinucleotide (NAD+) to catalyze the addition of poly(ADP-ribose) (PAR) polymers on target proteins (Gupte et al., 2017; Ryu et al., 2015). PARP inhibitors (PARPi), a new class of anticancer agents that target PARP-1 and other nuclear PARPs, have shown promise for the treatment of ovarian and breast cancers, as well as other cancer types (Bitler et al., 2017; Weil and Chen, 2011). PARPi are thought to act by blocking the repair of damaged DNA by

PARP-1, thus inducing synthetic lethality in cancers that are deficient in homologous recombination (HR)-mediated DNA repair (e.g., those with inactivating mutations in BRCA1 or BRCA2) (Bryant et al., 2005; Farmer et al., 2005). Recent studies, however, have reported that PARPi may have significant clinical benefits in the absence of BRCA1/2 mutations or HR-mediated DNA repair deficiency (Bitler et al., 2017; Evans and Matulonis, 2017; Ledermann et al., 2014; Lheureux et al., 2017; Mirza et al., 2016; Scott et al., 2015), suggesting that the role of PARP-1 in DNA damage repair may not be the only reason for its therapeutic potential (Frizzell and Kraus, 2009). Although PARP-1 is upregulated in invasive and malignant tissues from breast cancer patients (Domagala et al., 2011), the precise mechanisms by which PARP-1 supports breast cancer cell growth remain largely unknown. Ribosome biogenesis, which begins in the nucleolus, is supported by small nucleolar RNAs (snoRNAs) (Tollervey and Kiss, 1997) and gene-regulating proteins, such as DDX21 (Calo et al., 2015) and PARP-1 (Boamah et al., 2012). snoRNAs are conserved small noncoding RNAs that guide the processing and site-specific post-transcriptional modification of RNAs (Watkins and Bohnsack, 2012). snoRNA-mediated modifications promote rRNA folding and stability in the nucleolus, thereby playing an essential role in ribosome biogenesis (Ja´dy and Kiss, 2001; Williams and Farzaneh, 2012). The DEAD-box RNA helicase DDX21 has been implicated in ribosome biogenesis, largely through regulation of rDNA transcription at rDNA loci, where it interacts with snoRNAs to regulate rRNA processing and modification (Calo et al., 2015). PARP-1 has been implicated in ribosomal biogenesis through its enrichment in the nucleolus and the ADP-ribosylation (ADPRylation) of several nucleolar proteins, which are required for structural integrity of the nucleolus (Boamah et al., 2012). In addition, PARP-1 has been shown to bind noncoding promoter-associated RNAs (pRNAs), which help establish silent rDNA chromatin and repress rRNA transcription (Guetg et al., 2012). However, the range of RNA types bound by PARP-1 and the functional consequences of PARP-1-RNA interactions are unknown (e.g., activation of PARP-1 catalytic activity). In addition, (1) the effects of PARP-1-RNA interactions in the nucleolus, (2) the role of site-specific modification of protein substrates by PARP-1 in ribosome biogenesis, and (3) the biological Molecular Cell 75, 1–16, September 19, 2019 ª 2019 Elsevier Inc. 1

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

A

E

B

C

D

F

G

H

I

Figure 1. Identification of PARP-1-Interacting RNAs by RIP-Seq (A) Top: native RNA immunoprecipitation (RIP) performed with an antibody to PARP-1 or PI in MCF-7 cells. Bottom: RNA pico analysis of nuclear RNAs in the PARP-1 and PI IPs. (B) Bar plot of the fraction of expressed RNA species in MCF-7 cells that interact with PARP-1. snoRNAs are significantly enriched compared with other types of RNA (p < 1 3 10
4, Fisher’s exact test).

(legend continued on next page)

2 Molecular Cell 75, 1–16, September 19, 2019

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

outcomes of PARP-1-dependent ribosome biogenesis in breast cancers and its potential as a target for PARPi have not been determined. Here, we show that activation of PARP-1 by snoRNAs, rather than damaged DNA, controls rDNA transcription, ribosome biogenesis, and protein translation to promote the growth of breast cancer cells. RESULTS RIP-Seq Reveals Preferential Binding of PARP-1 to snoRNAs PARP-1 binds broadly to RNAs (Melikishvili et al., 2017), but the specific types of RNA bound by PARP-1 and the cellular effects of the binding in breast cancer are unknown. We used PARP-1directed RNA immunoprecipitation (IP) coupled with deep sequencing (RIP-seq) performed under native conditions (Zhao et al., 2010) to determine the repertoire of PARP-1-binding RNAs in MCF-7 breast cancer cells. Using RIP-seq in MCF-7 cells with a PARP-1 antiserum in the absence of UV-induced crosslinking (to avoid PARP-1 activation through DNA damage-induced automodification; Figure S1A) (Zhao et al., 2010), we observed an enrichment of nuclear RNAs in the PARP-1 IP relative to the preimmune (PI) IP (Figure 1A). We prepared and sequenced RIP-seq libraries from immunoprecipitated RNAs and RNA sequencing (RNA-seq) libraries using total input RNA to normalize RIP-seq datasets. The sequencing reads exhibited good correlations between replicates (Figure S1B). Although long noncoding RNAs (lncRNAs) and mRNAs were the most abundant PARP-1-interacting RNA species, snoRNAs were the most highly enriched (Figures 1B, 1C, and S1C). Indeed, nearly half (46% [205 of 444]) of the expressed snoRNAs in MCF-7 cells (reads per kilobase of transcript per million mapped reads [RPKM] > 1) bound to PARP-1 (Figure S1C). Interestingly, the H/ACA box snoRNAs exhibited preferential binding to PARP-1 compared with the C/D box snoRNAs (Watkins and Bohnsack, 2012) (Figures 1D and S1C). In addition, we observed a large variation in the abundance of different PARP-1-interacting and non-interacting snoRNAs (Figure S1E), suggesting that PARP-1 binding to snoRNAs is not dependent on expression levels. We then selected subsets of PARP-1-interacting and non-interacting snoRNAs (Figure 1E), which we tested for binding to PARP-1 by native RIP-qPCR. PARP-1-interacting snoRNAs, but not non-interacting snoRNAs, were significantly enriched in the PARP-1 IP relative to the PI IPs (Figure 1F). Similar interactions were observed in MDA-MB-231, HCC-1143, and T47D breast cancer cells, demonstrating that specific PARP-1snoRNA interactions are conserved across multiple cell types

(Figure S1D). Furthermore, we performed in vitro RNA pulldowns and RNA electrophoretic mobility shift assays (RNAEMSAs) to test direct protein-RNA interactions using purified recombinant PARP-1 protein (Figure S1F) and in vitro transcribed snoRNAs (Figure S1G). Both the in vitro RNA pull-down assays (Figure S1H) and the RNA-EMSAs with 32P-end-labeled snoRNA probes (Figure 1G) yielded results consistent with those of the RIP-seq analyses, confirming the observed PARP-1snoRNA interactions. Specific snoRNAs (e.g., SNORA73A, SNORA73B, and SNORA74A) were bound directly by PARP-1 in vitro, whereas other snoRNAs (SNORA15 and SNORA65) were not (Figure 1G). PARP-1 binding in the RNA-EMSAs was competed with excess cold snoRNA probe, confirming the specificity of the PARP-1-snoRNA interactions (Figure S1I). Genome browser snapshots of RIP-seq and RNA-seq provide further illustration of the binding, consistent with the biochemical assays (Figures 1H and 1I). Together, these results indicate that a subset of expressed snoRNAs interact directly with PARP-1 in breast cancer cells. snoRNAs Interact with the PARP-1 DNA-Binding Domain to Stimulate PARP-1 Catalytic Activity Next, we explored potential biochemical outcomes of PARP1-snoRNA interactions. First, we determined the region of PARP-1 that interacts with snoRNAs using PARP-1 domain deletion mutants (Figures 2A and 2B). We tested three PARP-1-interacting snoRNAs (SNORA73A, SNORA73B, and SNORA74A) and one non-interacting snoRNA (SNORA15) using RNA-EMSAs with the PARP-1 domain deletion mutants. This revealed that the DNA-binding domain is necessary and sufficient for binding snoRNAs, while the PARP-1 catalytic domain was unable to interact with snoRNAs (Figure 2C). As expected, non-interacting SNORA15 failed to interact with any of the PARP-1 domain deletion mutants (Figure 2C). snoRNAs are predominantly encoded (hosted) in the introns of protein-coding genes, where they are transcribed, spliced, debranched, and trimmed before being exported to the nucleolus in a mature form (Figure S2A) (Williams and Farzaneh, 2012). In this regard, we determined which type of transcript (i.e., primary RNA, mature snoRNA, or mature host mRNA) is the target for PARP-1 binding. The snoRNA host genes MBD2 (SNORA37), SNHG4 (SNORA74A), and RCC1 or SNHG3 (SNORA73A and SNORA73B) were identified on the basis of annotations derived from the UCSC Genome Browser database. PARP-1 RIP-qPCR with target-specific primer sets revealed an enrichment of mature snoRNAs relative to host gene mRNAs (Figure S2B) and primary transcripts (Figure S2C) in the PARP-1

(C) Boxplot of normalized RIP-seq snoRNA levels from the PARP-1 and PI IPs. Bars marked with different letters are significantly different from each other (p < 2.2 3 10
15, Wilcoxon rank-sum test). (D) Bar plot showing the fraction of each type of snoRNA that binds to PARP-1 in MCF-7 cells. H/ACA box snoRNAs are significantly enriched relative to C/D box snoRNAs (p < 1.63 3 10
9, Fisher’s exact test). (E) Heatmaps showing the expression (RNA-seq) of 205 snoRNAs and their relative enrichment (PARP-1 IP/PI IP) (RIP-seq) in MCF-7 cells. (F) RIP-qPCR analyses showing enrichment of PARP-1-interacting (red bars) and non-interacting (blue bars) snoRNAs from RIP-seq. PI IPs and actin mRNA (ACTB) were used as negative controls as indicated (black bars). Each bar represents the mean + SEM; n = 4. (G) RNA-EMSAs showing direct, dose-dependent interactions between PARP-1 and snoRNAs. (H and I) Genome browser tracks of (top) RNA-seq (polyA-enriched and polyA-depleted) showing the expression of SNHG3 (H) and SNHG4 (I) host genes and their snoRNAs, respectively, and (bottom) RIP-seq from PARP-1 and PI IPs showing the binding of snoRNAs to PARP-1. See also Figure S1.

Molecular Cell 75, 1–16, September 19, 2019 3

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

Figure 2. snoRNAs Interact with the PARP-1 DNA-Binding Domain to Activate PARP-1 Catalytic Activity

C 138

0

A

B

D

E

F

IPs, suggesting that PARP-1 regulates mature snoRNA functions through direct interactions. We also examined the role of PARP-1 in regulating H/ACA box-mediated pseudouridylation of rRNA using an N-cyclohexyl-N0 -b-(4-methylmorpholinum ethyl) carbodiimide p-tosylate (CMCT) assay (Rocchi et al., 2014). Treatment of MCF-7 cells with PARPi PJ34 or olaparib had little effect on the pseudouridylation of 18S and 28S rRNAs (Figure S2D). Thus, modulation of rRNA pseudouridylation does not appear to be a major function of PARP-1. Also, snoRNA expression was not altered in response to treatment with PARPi in MCF-7 cells compared with human mammary epithelial cells (HMECs) (Figures S2E and S2F). A significant decrease in the levels of pre-rRNA transcripts, however, was observed in both cell lines (Figures S2G and S2H), suggesting that PARP-1 may

4 Molecular Cell 75, 1–16, September 19, 2019

(A) Schematic representation of the PARP-1 deletion mutants used in the EMSAs. (B) Purified recombinant PARP-1 domain deletion proteins were analyzed using SDS-PAGE with Coomassie blue staining (left) and western blotting (right). (C) EMSAs with PARP-1 domain deletion mutants using snoRNAs transcribed in vitro. (D) PARP-1-interacting-snoRNAs activate PARP-1 ADPRylation in vitro. Top: purified recombinant PARP-1 was incubated with sssDNA, empty vector pcDNA-T7 RNA, PARP-1-interacting snoRNAs (red bars), or non-interacting snoRNAs (blue bars), plus NAD+. Automodification of PARP-1 was analyzed using western blotting for PAR. Bottom: quantification of results from the experiments shown at top. Each bar represents the mean + SEM, n = 2. (E) Effects of PARP-1 automodification on snoRNA binding. EMSAs were carried out with increasing concentrations of NAD+ during the ADPRylation reaction to stimulate PARP-1 automodification. Restoration of PARP-1-snoRNA interactions by treatment with the PARP inhibitor PJ34. (F) Quantification of results from the experiments shown in (E). Each point represents the mean ± SEM; n = 4. Points marked with different letters are significantly different from each other (p < 0.05, two-tailed Student’s t test). See also Figure S2.

regulate rDNA transcription through direct interactions with snoRNAs. PARP-1 is an ADP-ribosylating enzyme whose activity is allosterically activated by binding to single- or double-stranded DNA breaks (Wang et al., 2006), nucleosomes (Kim et al., 2005), and single-stranded RNA (ssRNA) (Huambachano et al., 2011). We tested the possibility that snoRNAs may activate PARP-1 catalytic activity using an in vitro PARP-1 autoPARylation assay, in which PARP-1 ADP-ribosylates itself (automodification). As expected, recombinant PARP-1 was automodified following the addition of NAD+ in the presence of sonicated salmon sperm DNA (sssDNA) (Figure 2D). Interestingly, PARP-1 was also robustly automodified in the presence of in vitro transcribed PARP-1interacting snoRNAs (37, 73A, 73B, and 74A) but not noninteracting snoRNAs (15, 65) or an empty vector control RNA (Figure 2D). Prior automodification of PARP-1 by snoRNA-mediated activation decreased PARP-1’s ability to subsequently bind to snoRNAs in EMSAs, and the PARP-1snoRNA interaction was recovered by treatment with PJ34 (Figures 2E and 2F). Together, these findings indicate that snoRNA-PARP-1 interactions activate PARP-1 catalytic activity and automodification, causing reduced affinity of PARP-1

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

B

A

D WT

F

G

WT

WT

E

W

W

T

C

T

WT:

H

I

J

Figure 3. DDX21 Is ADPRylated by PARP-1 (A) In vitro ADPRylation reactions containing PARP-1, DDX21, and sssDNA, with or without PJ34 and NAD+, were subjected to western blotting for PAR, PARP-1, and DDX21. (B) Schematic representation of DDX21 showing PARP-1-dependent sites of ADPRylation. (C) FLAG-tagged WT or ADPRylation site mutant (MutA) DDX21 was expressed in HEK293T cells, immunopurified, and subjected to SDS-PAGE with silver staining (left) or western blotting (right). Molecular weight (M.W.) markers in kilodaltons are shown. (D) MutA DDX21 shows reduced ADPRylation in vitro compared with WT DDX21. ADPRylation reactions containing PARP-1, DDX21 (WT or MutA), and NAD+ were subjected to western blotting for PAR, PARP-1, and DDX21. (legend continued on next page)

Molecular Cell 75, 1–16, September 19, 2019 5

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

for snoRNAs, perhaps allowing it to transmodify (PARylate) other target proteins. DDX21 Interacts with and Is ADPRylated by PARP-1 The DEAD-box family RNA helicase DDX21 was recently found to bind snoRNAs and rDNA chromatin, as well as regulate rDNA transcription (Calo et al., 2015). Furthermore, we recently identified DDX21 as a site-specific ADPRylation substrate of PARP-1 using a proteome-wide chemical biology and mass spectrometry approach (Gibson et al., 2016). Thus, we explored potential functional links between snoRNAs, PARP-1, DDX21, and rRNA regulation. Using biochemical assays, we showed that DDX21 is indeed ADPRylated by PARP-1, and the ADPRylation was sensitive to treatment with PJ34 (Figure 3A), as expected. We previously identified five glutamate or aspartate residues in the N terminus of DDX21 (E13, D15, E43, E67, and E196), which are ADPRylated by PARP-1 (Figure 3B) (Gibson et al., 2016). We generated constructs for the expression of wild-type (WT) or an alaninesubstituted ADPRylation site mutant of DDX21 (MutA) (Figures 3B and 3C). In vitro ADPRylation assays with purified DDX21 proteins showed a substantial decrease in the ADPRylation of MutA compared with WT DDX21 (Figure 3D). Similar results were obtained with FLAG-tagged MutA DDX21 immunoprecipitated from transfected HEK293T (Figure 3E). These results confirm the previously identified ADPRylation sites in the N terminus of DDX21. Next, we determined if DDX21 and PARP-1 interact in cells, if such interactions might lead to PARP-1-dependent ADPRylation of DDX21, and if ADPRylation of DDX21 might affect its interactions with PARP-1. Western blot analysis of DDX21 immunoprecipitated from MCF-7 cells revealed that it interacts with endogenous PARP-1 (Figure 3F, top) and is ADPRylated (Figure S3A). Treatment with PJ34 substantially reduced DDX21 ADPRylation (Figure S3A) and its interaction with PARP-1 (Figure 3F, top). Reciprocal IP of PARP-1 yielded similar results (Figure 3F, bottom; Figure S3B). These data suggest that PARP-1 catalytic activity is a pre-requisite for DDX21-PARP-1 interactions. Thus, we determined if ADPRylation (or PAR) is sufficient to promote interactions between PARP-1 and DDX21. First, we tested the ability of purified PAR formed by PARP-1 automodification in vitro to bind to DDX21. We used dot-blot assays with unmodified recombinant PARP-1 and purified PAR, both of which bound to the nitrocellulose membrane, as the interaction

substrates (Figure 3G, top) and found that DDX21 bound robustly to PAR but not unmodified PARP-1 (Figure 3G, bottom; Figures S3C and S3D). Similar results were obtained in a pull-down assay using automodified or unmodified PARP-1 immobilized on anti-FLAG-M2 beads, in which recombinant DDX21 (Figure S3E) bound robustly to automodified, but not unmodified PARP-1 (Figure 3H). In addition, ARH3 treatment inhibited DDX21 interactions with automodified PARP-1, suggesting that PAR is required for PARP-1-DDX21 interactions (Figures S3F–S3H). On the basis of these results, we performed in vitro PARylation assays to determine if snoRNA-activated PARP-1 ADPRylates DDX21. Upon the addition of the PARP-1-interacting SNORA74A, PARP-1 was robustly automodified and ADPRylation of DDX21 was observed (Figures 3I and 3J). Importantly, the non-interacting SNORA15 was incapable of stimulating automodification of PARP-1 or ADPRylation of DDX21 (Figures 3I and 3J). Finally, UV-induced automodification of PARP-1 increased its ability to bind to DDX21 (Figures S3I and S3J), indicating that PAR is an important mediator of DDX21-PARP-1 interactions, regardless of the stimulus that promotes PARP-1 activity (e.g., physiological snoRNAs or pathological UV-induced damage). snoRNA-Activated PARP-1 ADPRylates DDX21 in Cells to Promote Cell Proliferation To determine the role of snoRNAs in the functional interactions between PARP-1 and DDX21, we performed IP assays in MCF-7 cells with or without RNase A treatment to remove all snoRNAs. PARP-1 was co-immunoprecipitated with DDX21, which was ADPRylated, confirming an interaction between PARP-1 and DDX21, as well as DDX21 ADPRylation in vivo (Figures 4A and 4B). Treatment of the immunoprecipitates with RNase A ablated the co-IP of PARP-1 with DDX21 (Figures 4A and 4B, top), as well as PARP-1 and DDX21 ADPRylation (Figures 4A and 4B, bottom), consistent with PJ34 treatment (Figure 3F). We also explored more specifically how snoRNAs regulate DDX21-PARP-1 interactions and ADPRylation in vivo using antisense oligonucleotides (ASOs) to knock down PARP-1-interacting SNORA74A and non-interacting SNORA15. Among the PARP-1-interacting snoRNAs, we chose SNORA74A as an example for two main reasons: (1) it has an intermediate abundance level (Figure S1E), which allows efficient knockdown (Figure 4C), and (2) SNORA74A is an effective activator of PARP-1 catalytic activity (Figure 2D). Transfection of the SNORA74A or

(E) MutA DDX21 shows reduced ADPRylation in cells compared with WT DDX21. FLAG-tagged DDX21 (WT or MutA) was immunoprecipitated from HEK293T cells and subjected to western blotting for PAR, FLAG, and DDX21. (F) PARP-1 enzymatic activity is required for PARP-1-DDX21 interactions. Top: western blot analysis of endogenous DDX21 immunoprecipitated from MCF-7 cells treated with or without PJ34. Bottom: reciprocal IP of endogenous PARP-1 yields similar results. (G) DDX21 binds to PAR in vitro. Recombinant PARP-1 or purified PAR were spotted onto a nitrocellulose membrane. Input: western blotting for PARP-1 (top) or PAR (bottom) showing that they bind to the membrane. Bound: western blotting of the spotted membrane with DDX21. (H) Automodified PARP-1, but not unmodified PARP-1, interacts with DDX21 in vitro. FLAG-tagged PARP-1 immobilized on anti-FLAG M2 beads was incubated with DDX21, sssDNA, and NAD+. The bound material was analyzed using western blotting for PAR, PARP-1, and DDX21. (I) snoRNA-activated PARP-1 ADPRylates DDX21. In vitro ADPRylation reaction containing PARP-1, DDX21, NAD+, and a snoRNA (PARP-1-interacting SNORA74A or non-interacting SNORA15). The reactions were analyzed using western blotting for PAR, PARP-1, and DDX21. (J) Quantification of results from the experiments shown in (I) (lanes with SNORA74A and SNORA15). Each bar represents the mean + SEM; n = 3. Bars marked with different letters are significantly different from each other (p < 0.05, two-tailed Student’s t test). See also Figure S3.

6 Molecular Cell 75, 1–16, September 19, 2019

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

A

B

C

Figure 4. snoRNA-Activated PARP-1 ADPRylates DDX21

(A and B) RNase A treatment inhibits PARP-1DDX21 interactions (top) and PARP-1 or DDX21 ADPRylation (bottom). Endogenous PARP-1 (A) or DDX21 (B) was immunoprecipitated from MCF-7 cells in the absence or presence of RNase A. The immunoprecipitates were washed in low salt wash buffer (top panels, for interactions) or in high salt wash buffer (bottom panels, for ADPRylation) and analyzed using western blotting for PARP-1, DDX21, and PAR. (C) Antisense oligonucleotide (ASO)-mediated D E F knockdown of SNORA74A or SNORA15 (compared with a control knockdown with an ASO targeting GFP). SNORA74A and SNORA15 levels were determined by RT-qPCR and normalized to mRNA encoding b-actin. Each bar represents the mean + SEM; n = 2. (D and E) Reduced ADPRylation of PARP-1 (D) and DDX21 (E) immunoprecipitated from MCF-7 cells transfected with an ASO targeting SNORA74A (compared with an ASO targeting SNORA15). The immunoprecipitates were subjected to western blotting for PARP-1, DDX21, and PAR. (F) Reduced PARP-1-DDX21 interactions in MCF-7 G H I cells transfected with an ASO targeting SNORA74A (compared with an ASO targeting SNORA15). PARP-1 (top) and DDX21 (bottom) immunoprecipitates were subjected to western blotting for PARP-1, DDX21, and PAR. (G) siRNA-mediated knockdown of PARP-1 with one of three different siRNAs inhibits the proliferation of MCF-7 cells compared with knockdown with a control siRNA. Each point represents the mean ± range; n = 2. (H) shRNA-mediated knockdown (KD) of DDX21 with one of two different shRNAs inhibits the proliferation of MCF-7 cells compared with knockdown with a control shRNA targeting luciferase (Luc). Each point represents the mean ± range; n = 2. (I) ASO-mediated knockdown of SNORA74A inhibits the proliferation of MCF-7 cells compared with knockdown with a control ASO targeting GFP. Each point represents the mean ± SEM; n = 4. See also Figure S4.

SNORA15-targeting ASO into MCF-7 cells decreased their levels, as expected, but a GFP-targeting ASO did not (Figure 4C). SNORA74A knockdown led to a substantial reduction in ADPRylation of both PARP-1(Figure 4D) and DDX21 (Figure 4E), as well as DDX21-PARP-1 interactions (Figure 4F), compared with SNORA15 knockdown. The significant reduction in ADPRylation suggests that SNORA74A is a major activator of PARP-1. These results are consistent with our prior data, showing that RNase A treatment disrupts PARP-1-DDX21 interaction and their ADPRylation in MCF-7 cells (Figures 4A and 4B). In cell proliferation assays, depletion of PARP-1 by small interfering RNA (siRNA) or DDX21 by short hairpin RNA (shRNA) caused a significant reduction in MCF-7 cell proliferation (Figures 4G, 4H, S4A, S4B, and S4D). Importantly, depletion of the PARP-1-interacting SNORA74A also caused a significant reduction in proliferation (Figures 4I, S4C, and S4D). Interestingly, primary HMECs exhibited an undetectable level of PAR (Figure S4E), and depletion of DDX21 using siRNAs (Figure S4F) did not cause a significant reduction in cell proliferation, unlike the reductions observed in MCF-7 (BRCA1 WT) and MDA-MB436 (BRCA1 mutant) cells (Figure S4G). Collectively, these

results suggest that snoRNAs stimulate functional interactions between PARP-1 and DDX21, including stimulation of PARP-1 catalytic activity resulting in DDX21 ADPRylation, to promote proliferation in breast cancer cells but not normal cells. PAR Binding through the DDX21 RNA Binding Motif Mediates Functional Interactions between PARP-1 and DDX21 Next, we examined the nature of the DDX21-PAR interactions in more detail. In this regard, we observed that activation of PARP-1 by PARP-1-interacting snoRNAs (e.g., 37 and 74A), but not non-interacting snoRNAs (e.g., 15), promoted robust binding with DDX21 (Figure 5A). Previous studies have shown that DDX21 binds to RNA through its C terminus (Holmstro¨m et al., 2008). We hypothesized that DDX21 may bind PAR, which resembles a nucleic acid, in a similar manner. To test this hypothesis, we performed DDX21-PAR binding experiments with or without SCARNA2, a snoRNA that interacts with DDX21 through its C-terminal RNA binding domain, which is used as a competitor. The addition of SCARNA2 ablated interactions between DDX21 and PAR on automodified PARP-1 (Figure 5B),

Molecular Cell 75, 1–16, September 19, 2019 7

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

A

B

C

WT:

E

F

W T

W T

D

H

G

I

W

T

W

W

T

T

T W

W

T

WT

WT

WT

WT

WT

L

WT

K

J

Figure 5. DDX21 Binds to PAR on Automodified PARP-1 through Its RNA Binding Motif and Is Required for DDX21 ADPRylation (A) Automodified PARP-1 stimulated by snoRNAs, but not unmodified PARP-1, interacts with DDX21. Recombinant DDX21 was incubated with recombinant FLAG-tagged PARP-1 immobilized on anti-FLAG M2 beads plus NAD+, with or without the indicated PARP-1-interacting and non-interacting snoRNAs. The bound material was analyzed using western blotting for PAR, PARP-1, and DDX21. (B) A DDX21-interacting snoRNA and ADPRylated PARP-1 compete for binding to DDX21. Recombinant DDX21 was incubated with FLAG-tagged PARP-1 immobilized on anti-FLAG M2 beads plus NAD+, with or without the DDX21-interacting snoRNA (SCARNA2). The bound material was analyzed using western blotting for PAR, PARP-1, and DDX21. (C) Schematic representation of DDX21 showing the point mutations used to generate the PAR-binding deficient mutant (MutP). (legend continued on next page)

8 Molecular Cell 75, 1–16, September 19, 2019

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

suggesting that the DDX21 RNA binding domain may mediate binding to PAR. To explore this in more detail, we mutated two RNA binding site residues in DDX21 (K774 and R775) with alanine substitutions (generating ‘‘MutP,’’ PAR-binding defective) (Figure 5C). In IP assays in HEK293T, FLAG-tagged MutP DDX21, but not WT DDX21, showed a considerable decrease in binding to PARP-1 (perhaps via PAR) (Figure 5D, top), and similar results were obtained in MCF-7 cells (Figure 5D, bottom). In ADPRylation assays with WT or MutP DDX21 purified from HEK293T cells (Figure 5E), MutP DDX21 showed a reduction in ADPRylation compared with WT DDX21 (Figures 5F and 5G). Furthermore, in dot-blot assays with purified PAR, MutP DDX21 showed a reduction in PAR binding compared with WT DDX21 (Figures 5H and 5I). To determine the role of ADPRylation of DDX21 by snoRNAactivated PARP-1, we used MCF-7 cells that allow simultaneous doxycycline (Dox)-induced (1) knockdown of endogenous DDX21 by an shRNA and (2) ectopic overexpression of either shRNA-resistant WT, MutA (ADPRylation mutant), or MutP (PAR-binding mutant) DDX21 (Figure 5J). Consistent with our observations in HEK293T cells, MutA (Figure 5K) and MutP (Figure 5L) DDX21 exhibited substantially reduced ADPRylation compared with WT DDX21 in MCF-7 cells, confirming that the sites identified by mass spectrometry are indeed major acceptor sites for PARP-1-mediated ADPRylation. Next, we used the engineered MCF-7 cells to examine whether ADPRylation of DDX21 affects its RNA binding ability. RIP-qPCR with three previously identified DDX21-interacting snoRNAs (SCARNA2, SNORA62, and SNORA67; Calo et al., 2015) revealed increased binding to these snoRNAs by MutA DDX21 compared with WT DDX21 (Figure S5A), and by PJ34 treatment (Figure S5B), indicating that ADPRylation of DDX21 attenuates its RNA binding ability. In a series of related follow-up experiments, we found that MutA DDX21 purified from HEK293T cells exhibited reduced ADPRylation (Figure S5C), enhanced binding to SCARNA2, and a shift in the mobility of the DDX21-snoRNA complex in EMSAs compared with WT DDX21 (Figures S5D and S5E). In addition, in biochemical assays, PARP-1-mediated ADPRylation of DDX21 caused a substantial reduction in DDX21 binding to

snoRNAs, which is rescued by PJ34 treatment (Figure S5F), corroborating our results showing that ADPRylation of DDX21 reduces its binding to snoRNAs. Finally, RNA-seq experiments after knockdown of endogenous DDX21 (Figure S5G) indicate that DDX21 does not affect the expression of snoRNA host genes (Figures S5H–S5J) or snoRNAs (Figure S5K). ADPRylation of DDX21 Increases rRNA Levels, Translation, and Breast Cancer Cell Proliferation Emerging evidence has highlighted the role of DDX21 in ribosome biogenesis, largely through regulation of rDNA transcription (Calo et al., 2015). Interestingly, immunofluorescent staining of MCF-7 cells treated with PJ34 or niraparib showed a redistribution of DDX21 from the nucleolus to the nucleoplasm (Figure 6A), similar to effects observed upon inhibition of Pol I by actinomycin D (Figure S6A) (Calo et al., 2015). PARPi treatment also caused a substantial reduction in the nucleolar localization of PARP-1 (Figure 6A), without affecting the localization of the nucleolar marker NOP58 (Figure 6B). These observations indicate that automodification of PARP-1 and ADPRylation of DDX21 are important for their nucleolar retention. DDX21 has been shown to bind the Pol I transcription complex at rDNA loci to regulate rDNA transcription (Calo et al., 2015). In chromatin IP (ChIP)-qPCR assays in MCF-7 cells, DDX21 was highly enriched at multiple regions within the rDNA locus transcribed region, especially at 8 kb (Figure 6C). This binding was significantly decreased upon treatment with PJ34 or niraparib (Figures 6D, S6B, and S6C). In similar experiments, although MutA DDX21 can localize properly to the nucleolus, but MutP has a slight defect in nucleolar localization (Figures S6D and S6E), neither mutant was able to restore the binding of DDX21 to the rDNA locus as did WT DDX21 (Figures S6F and S6G). Together, these results indicate that ADPRylation of DDX21 by PARP-1 is required for DDX21 occupancy at the rDNA locus. Next, we examined the effect of ADPRylation of DDX21 on rDNA transcription. The levels of the nuclear 18S and 28S rRNAs were significantly decreased upon PARP-1 inhibition with PJ34 or niraparib, as determined using an RNA BioAnalyzer (Figures 6E and 6F), resulting in a substantial reduction in ribosome bound ribosomal proteins (Figures 6G and 6H). Furthermore, rDNA transcription was restored only after knockdown of

(D) The DDX21 RNA binding domain is required for PAR-dependent binding to PARP-1, as shown by IP of FLAG-tagged MutP DDX21 versus WT DDX21 in HEK293T and MCF-7 cells. (E) FLAG-tagged WT or MutP DDX21 was expressed in HEK293T cells and immunopurified. Left: SDS-PAGE with silver staining. Right: western blotting for DDX21. Molecular weight (M.W.) markers in kilodaltons are shown. (F) PAR binding by DDX21 is required for PARP-1-mediated ADPRylation of DDX21. In vitro ADPRylation assays containing PARP-1, NAD+, sssDNA, and DDX21 (WT or MutP) as indicated. The reactions were subjected to western blotting for PAR, PARP-1, and DDX21. (G) Quantification of the results from experiments shown in (F). Each bar represents the mean + SEM; n = 3. Bars marked with different letters are statistically different from each other (p < 0.05, two-tailed Student’s t test). (H) MutP DDX21 exhibits impaired PAR binding compared with WT DDX21. Purified WT or MutP DDX21 was spotted onto a nitrocellulose membrane, dried, incubated with free PAR, and analyzed using western blotting for PAR. (I) Quantification of the results from experiments shown in (H). Each bar represents the mean + SEM; n = 3. Bars marked with different letters are statistically different from each other (p < 0.05, two-tailed Student’s t test). (J) Generation of MCF-7 cell lines for simultaneous Dox-induced (1) shRNA-mediated knockdown of endogenous DDX21 and (2) re-expression of exogenous shRNA-resistant FLAG-tagged WT, MutA, or MutP DDX21. Western blotting for FLAG, DDX21, and SNRP70 is shown. (K and L) Validation of PARP-1-mediated ADPRylation of DDX21 using the engineered MCF-7 cells from (J). Immunoprecipitated FLAG-tagged WT compared with MutA (K) or MutP (L) DDX21 was analyzed using western blotting for PAR, FLAG, and DDX21. See also Figure S5.

Molecular Cell 75, 1–16, September 19, 2019 9

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

A

B

C

D

G

I

E

F

H

J

K

L

(legend on next page)

10 Molecular Cell 75, 1–16, September 19, 2019

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

endogenous DDX21 by ectopically expressed WT DDX21, but not MutA or MutP DDX21 (Figures S6H and S6I). Because reductions in rDNA transcription should presumably reduce ribosome biogenesis and function, and PARPi have been shown to regulate translation upon DNA damage (Zhen et al., 2017), we determined the effects of DDX21 ADPRylation on protein synthesis using puromycin incorporation assays (Schmidt et al., 2009). Translation was significantly reduced by PARP-1 inhibition (Figures 6I and 6J), and by MutA or MutP DDX21 (Figures S6J–S6M) compared with untreated controls and WT DDX21, respectively. Finally, we determined the role of PARP-1-mediated ADPRylation of DDX21 on the proliferation of breast cancer cells. In MCF-7 cells, PARP-1 inhibition by PJ34 or niraparib (Figures 6K and 6L), or depletion of DDX21 by a Dox-inducible shRNA (Figure S6N), caused a significant reduction in cell proliferation. Furthermore, expression of shRNA-resistant WT DDX21, but not MutA or MutP DDX21, restored cell proliferation (Figure S6N). Collectively, our results indicate that snoRNA-activated PARP-1 ADP-ribosylates DDX21 to control DDX21 nucleolar localization, rDNA transcription, ribosome biogenesis, translation, and breast cancer cell proliferation. Inhibition of PARP-1 Reduces Tumor Cell Growth by Modulating rRNA Levels, DDX21 ADPRylation, and DDX21 Localization In Vivo To investigate the potential physiological and clinical significance of the snoRNA-PARP-1-DDX21-ribosome biogenesis pathway, we analyzed the expression of these proteins in breast tumor (The Cancer Genome Atlas [TCGA]) and normal (TCGA and Genotype-Tissue Expression [GTEx]) samples. The expression of snoRNAs, PARP-1, a ribosome-related gene set, and ribosomal protein L26-like 1 (RPL26L1, known to be exclusively upregulated in breast carcinomas; Guimaraes and Zavolan, 2016), but not the expression of DDX21, were all significantly higher in breast tumor samples compared with normal tissue (Figures 7A–7E). Furthermore, significant positive correlations among these proteins was observed by immunohistochemical staining of a breast cancer tissue microarray (Figures S7A–S7E). To investigate the in vivo impact of PARP-1 inhibition on breast cancer cell growth, we performed a xenograft experiment using MCF-7 cell line engineered for Dox-inducible knockdown of

endogenous DDX21 with ectopic re-expression of FLAG-tagged WT DDX21. Inhibition of PARP-1 catalytic activity with niraparib caused a significant reduction in tumor growth (Figures 7F–7H). Western blotting and IP assays using nuclear extracts from xenograft tumor tissues with or without niraparib treatment in vivo showed that niraparib dramatically abolished PARP-1 ADPRylation (Figure 7I) and subsequent DDX21 ADPRylation (Figure 7J). Interestingly, niraparib did not promote the accumulation of gH2AX foci in BRCA1/2-WT MCF-7 cells, indicating that the effects of niraparib are independent of DNA damage, although such foci were readily apparent in response to cisplatin and methyl methanesulfonate (MMS) (Figures 7K and S7F). Finally, we isolated total nuclear RNA from tumor tissue with or without niraparib treatment (Figure S7G) and observed that the levels of 18S and 28S rRNAs were significantly decreased upon niraparib treatment (Figures 7L and 7M). Immunostaining revealed that (1) niraparib substantially reduced the nucleolar localization of DDX21 (increased pan-nuclear staining of DDX21) in xenograft tumors (Figures 7N and 7O), and (2) high levels of PARP-1 expression are closely associated with DDX21 nucleolar retention in human breast cancer tissue (Figures 7P and 7Q). Collectively, our results indicate that PARP-1 catalytic activity controls DDX21 ADPRylation, DDX21 nucleolar localization, rDNA transcription, and breast cancer cell proliferation in vivo (Figure S7H). DISCUSSION We have discovered a pathway for PARP-1-dependent regulation of ribosome biogenesis and growth control in breast cancer cells that includes (1) snoRNA binding to and activation of PARP-1, (2) PAR-mediated interactions between PARP-1 and DDX21 that lead to site-specific ADPRylation of DDX21, (3) enhanced association of DDX21 with rDNA chromatin, and (4) increased rDNA transcription and cell growth (Figure S7H). Importantly, our studies identify snoRNAs as DNA damage-independent activators of PARP-1 catalytic activity, which affects DDX21 ADPRylation and nucleolar localization. Furthermore, we demonstrate significant positive correlations among PARP-1, nucleolar DDX21, and RPL26L1 expression in human breast cancer tissues. Collectively, our studies indicate that

Figure 6. ADPRylation of DDX21 Regulates Ribosome Biogenesis and Affects Breast Cancer Cell Proliferation (A and B) Inhibition of PARP-1 catalytic activity by PJ34 or niraparib promotes the redistribution of DDX21 from the nucleolus to the nucleoplasm (A), but does not affect the nucleolar localization of NOP58 (B), as assessed using confocal fluorescence microscopy analysis in MCF-7 cells. Scale bars, 5 mm. (C) DDX21 localizes to chromatin at multiple regions within the rDNA locus in MCF-7 cells as determined using ChIP-qPCR. Each point represents the mean ± SEM; n = 3. (D) PARP-1 catalytic activity is required for DDX21 occupancy at the 8 kb rDNA locus. ChIP-qPCR analyses for DDX21 following treatment of MCF-7 cells with PJ34 or niraparib. Each bar represents the mean + SEM; n = 3. Bars marked with different letters are statistically different from each other (p < 0.05, two-tailed Student’s t test). (E and F) PARP-1 catalytic activity is required for rDNA transcription resulting in the production of both 18S and 28S rRNA. Total nuclear RNA was isolated from MCF-7 cells treated with or without PJ34 or niraparib. The RNA size was visualized (E) using an RNA BioAnalyzer and was quantified (F). The boxplots in (F) marked with different letters are statistically different from each other (p < 0.05, two-tailed Student’s t test). (G and H) PARP inhibition reduces translation efficiency. MCF-7 cell fractionation and examination of ribosomal proteins RPS3, RPL10, RPL26L1 in ribosome or whole-cell fractions treated with PJ34 or niraparib assessed using western blotting (G) and quantified (H). Bars marked with different letters are statistically different from each other (p < 0.05, two-tailed Student’s t test). (I and J) PARP-1 catalytic activity is critical for protein synthesis. Puromycin incorporation is substantially reduced by treatment with PARPi PJ34 (I) or niraparib (J). (K and L) Cell proliferation response of MCF-7 cells treated with different doses of PJ34 (K) or niraparib (L) over a period of 7 days assessed using crystal violet cell proliferation assay. Each point represents the mean ± SEM, n = 2. See also Figure S6.

Molecular Cell 75, 1–16, September 19, 2019 11

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

A

B

C

F

D

H

G

K

I

L

M

P

J

E

N

O

P

Q

(legend on next page)

12 Molecular Cell 75, 1–16, September 19, 2019

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

this pathway may provide an alternative target for the therapeutic action of PARPi in cancer cells lacking DNA repair defects. PARP-1, DDX21, and rDNA Transcription in Breast Cancer Our studies reveal an extensive set of physical and functional interactions among PARP-1, DDX21, and the rDNA locus that require PARP-1 catalytic activity. Disruption of these interactions through snoRNA or PARP-1 knockdown, PARPi treatment, mutation of target ADPRylation sites on DDX21, or other experimental manipulations leads to (1) depletion of PARP-1 and DDX21 from the nucleolus and the rDNA locus (Figures 6A–6F and S6B–S6I), (2) reduced cellular ribosome content, including rRNA (Figures 6E and 6F) and ribosome-bound ribosomal proteins (Figures 6G and 6H), and (3) reduced protein translation (Figures 6I, 6J, and S6J– S6M). The dramatic (50%) reduction in rRNA content in cells in which the interactions are disrupted inhibits the growth of breast cancer cells (Figures 4G–4I, 6K, 6L, and S6N). Our analyses highlight the importance of PARP-1 catalytic activity in regulating the nucleolar localization of DDX21, ultimately impacting ribosome biogenesis. In addition, our results from the IHC staining analyses of human breast cancer samples suggests that DDX21 nucleolar localization may be a readily assayable biomarker of cancer biology and clinical responses to PARPi. These results are consistent with those of previous studies showing widespread enhanced rDNA transcription in breast cancer cells, which is accompanied by increased cellular growth, proliferation, and tumorigenesis (Belin et al., 2009; Drygin et al., 2009; Ruggero and Pandolfi, 2003). In addition, snoRNAs are overexpressed in murine mammary cancers and human breast cancers, correlating with increased rDNA transcription (Williams and Farzaneh, 2012). Interestingly, analyses of gene expression profiles from breast cancer patients identified DDX21 as a prognostic marker in breast cancer (Cimino et al., 2008). Moreover, DDX21 expression increases with tumor grade in breast cancer

patient tissues, and depletion of DDX21 results in a substantial reduction in tumorigenicity through the regulation of rRNA processing (Zhang et al., 2014). Thus, the molecular and biochemical interactions among PARP-1, DDX21, and the rDNA locus that we identified here fit well with their known roles in cancer. snoRNAs Are DNA Damage-Independent Activators of PARP-1 Catalytic Activity PARP-1’s catalytic activity is allosterically stimulated from a low basal state. For decades, the focus of the field has been on the activation of PARP-1 by damaged DNA (e.g., nicks, doublestrand breaks) under conditions of genotoxic stress (Kraus and Lis, 2003; Krishnakumar and Kraus, 2010). But PARP-1 also plays important roles in physiological processes and hence requires catalytic activators that function in the absence of DNA damage and cellular stress. Our results using both biochemical and cell-based assays show clearly that snoRNA binding to the ‘‘DNA-binding’’ domain of PARP-1 can serve as a potent activator of PARP-1 catalytic activity (Figure 2). The more modest level of activation and PAR lengths we observed with snoRNAs (Figure 2D) are likely to direct the cell down a different signaling path than the extreme level of activation and PAR lengths achieved with sheared DNA. The selectivity of this activation with different classes of snoRNAs may provide a wealth of potential regulatory outcomes. rDNA Transcription and Ribosome Biogenesis as an Alternative Target for PARPi in Cancers PARPi are thought to act by blocking the repair of damaged DNA by PARP-1, thus inducing synthetic lethality in cancers that are deficient in HR-mediated DNA repair (Bryant et al., 2005; Farmer et al., 2005). Recent studies have also suggested that PARP inhibition may induce replication stress and subsequent DNA damage (Hanzlikova et al., 2018; Maya-Mendoza et al., 2018; Parsels et al., 2018). The snoRNA-PARP-1-DDX21-ribosome biogenesis

Figure 7. Inhibition of PARP-1 Reduces Tumor Cell Growth by Modulating rRNA Levels, DDX21 ADPRylation, and DDX21 Localization In Vivo (A–E) RNA-seq expression data for (A) snoRNAs (p < 2.2e-16), (B) PARP-1 (p < 2.2e-16), (C) DDX21, (D) ribosome proteins (p < 0.02), and (E) RPL26L1 (p < 2.2e-16) in primary tumors (TCGA breast cancer samples) compared with normal tissues (TCGA or GTEx). Bars marked with different letters are statistically different from each other (p < 0.05, two-tailed Student’s t test). (F) Niraparib reduces tumor cell growth in vivo. Xenograft tumor growth curves showing MCF-7 tumors engineered for simultaneous Dox-inducible knockdown of DDX21 with ectopic re-expression of FLAG-tagged WT DDX21, treated with vehicle (n = 5) or 25 mg/kg niraparib (n = 5) intraperitoneally (i.p.) 5 days a week over 3 weeks. Each point represents the mean ± SEM, n = 5. Points marked with different letters are significantly different from each other (p < 0.05; two-tailed Student’s t test). (G and H) Graph shows tumor weights at end of experiment (G). Niraparib-treated tumors are significantly smaller than vehicle-treated tumors (H). Points marked with different letters are statistically different from each other (p < 0.05, two-tailed Student’s t test). (I) Tumor tissues from (H) were analyzed using western blotting for PAR, PARP-1, FLAG-DDX21, and SNRP70. (J) Validation of PARP-1-mediated ADPRylation of DDX21 using tumor tissue from (H). Immunoprecipitated FLAG-tagged WT DDX21 was analyzed using western blotting for PAR and FLAG. (K) The effects of niraparib are not DNA damage dependent. Representative immunofluorescent staining of gamma-H2AX from MCF-7 xenograft tumor tissue, showing lack of DNA-damage foci. Scale bars, 50 mm. (L and M) PARP-1 catalytic activity is required for rDNA transcription in vivo resulting in the production of both 18S and 28S rRNA. Total nuclear RNA was isolated from MCF-7 xenograft tumor cells. The RNA size was visualized (L) using an RNA BioAnalyzer and was quantified (M). The points in (M) marked with different letters are statistically different from each other (p < 0.05, two-tailed Student’s t test). (N and O) Representative immunohistochemical staining of FLAG (WT DDX21) from MCF-7 xenograft tumor tissue (N) and quantification of pan-nuclear FLAGtagged WT DDX21 (O) from vehicle-treated (n = 5) or niraparib-treated (n = 5) treated xenograft tumors (three images each). The points in (O) marked with different letters are statistically different from each other (p < 0.05, two-tailed Student’s t test). Scale bars, 25 mm. (P and Q) Representative immunohistochemical staining of PARP-1 or DDX21 from breast disease spectrum tissue microarray (P) and quantification of nucleolar DDX21 intensity in low- versus high-PARP-1 breast cancer samples (Q). Scale bars, 50 mm. The boxes in (Q) marked with different letters are statistically different from each other (p < 0.05, two-tailed Student’s t test). See also Figure S7.

Molecular Cell 75, 1–16, September 19, 2019 13

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

pathway we have identified herein is likely to provide an alternate cellular pathway that can be targeted by PARPi for therapeutic benefits, which is independent of HR, DNA damage, and replication stress. In this regard, recent studies have shown that PARPi can have significant clinical benefits in the absence of BRCA1/2 mutations or HR-mediated DNA repair deficiencies (Bitler et al., 2017; Evans and Matulonis, 2017; Ledermann et al., 2014; Lheureux et al., 2017; Mirza et al., 2016; Scott et al., 2015), results that are corroborated by our xenograft studies (Figure 7F). Furthermore, our analyses clearly show that the snoRNA-PARP-1DDX21-ribosome biogenesis pathway is upregulated in human breast cancers, providing a potential new target for breast cancer therapy independent of DNA damage and greatly expanding the clinical utility of PARPi. Importantly, some cancers may become ‘‘addicted’’ to protein synthesis, which is needed to support the high biosynthetic requirements of rapid cell growth and division (Belin et al., 2009; Ruggero and Pandolfi, 2003). Reduced ribosome biogenesis can have a profound negative effect on the growth of these cancer cells, which would explain the efficacy of PARPi in the pathways that we described herein. PAR- and RNA-Mediated Interactions in the Biology of PARP-1 Our biochemical and molecular analyses have demonstrated how a complex biological process can be mediated by site-specific ADPRylation on a single substrate protein, in this case DDX21. Mutation of the identified and confirmed ADPRylation sites has a profound effect on biological outcomes, in essence distilling a series of molecular interactions down to the post-translational modification of a few amino acid residues on DDX21 (Figures S6H and S6I). In addition, our results identify molecular interactions driven by PAR and RNA binding domains in PARP-1 and DDX21. Unexpectedly, we found that the ‘‘RNA binding’’ motif in DDX21 binds PAR (Figures 5C–5I), and the ‘‘DNA binding’’ domain in PARP-1 binds RNA (Figures 2A–2C). The similarity of the chemical compositions and structures of PAR, RNA, and DNA suggests that promiscuity in binding by various proteins is likely to be the norm (Fischbach et al., 2018). Finally, our results highlight the importance of PAR-mediated interactions in cellular processes, with the binding of DDX21 to autoADPRylated PARP-1 via PAR acting to facilitate PARP-1-mediated ADPRylation of DDX21 (Figures 4 and 5), similar to what has be reported previously for p53 (Fischbach et al., 2018) and PAR-dependent ubiquitylation, in which initial PARylation of a protein is required for subsequent ubiquitylation by PAR-binding E3 ubiquitin ligase (Gibson and Kraus, 2012). STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d

KEY RESOURCES TABLE LEAD CONTACT AND MATERIALS AVAILABILITY EXPERIMENTAL MODELS AND SUBJECT DETAILS B Cell Culture B Generation of Knockdown and Ectopic Cell Lines B Experiments with Mice

14 Molecular Cell 75, 1–16, September 19, 2019

d

d d

METHOD DETAILS B Cell Treatments B Antibodies B Molecular Cloning to Generate Knockdown and Expression Vectors B Expression and Purification of Recombinant Proteins B Knockdown using Oligonucleotide-based Approaches B Cell Proliferation Assays B Preparation of Nuclear Extracts and Western Blotting B Native RNA Immunoprecipitation (RIP) B RIP-seq and RNA-seq Library Preparation B Analysis of RNA-seq Datasets B Analysis of RIP-seq Datasets B In Vitro Transcription to Generate snoRNAs B In Vitro ADP-ribosylation of PARP-1 by snoRNAs B In Vitro ADP-ribosylation of DDX21 by DNA-Activated PARP-1 B In Vitro ADP-ribosylation of DDX21 by snoRNA-Activated PARP-1 B RNA Electrophoretic Mobility Shift Assays (RNA EMSAs) B In Vitro RNA Pull Down Assays B Detection of DDX21 ADP-ribosylation by Immunoprecipitation from 293T Cells B Detection of DDX21 and PARP-1 ADP-ribosylation by Immunoprecipitation from MCF-7 Cells after Treatment with PJ34 or RNase A B Detection of Endogenous PARP-1/DDX21 Interactions by Immunoprecipitation B Detection of Associations between DDX21 and PARP1-Catalyzed Poly (ADP-ribose) B Isolation of Poly(ADP-ribose) (PAR) and Dot Blot Assays B ERCC Spike-in RNA-seq Data Analysis B Apoptosis Assays B Immunofluorescent Staining and Confocal Microscopy B Chromatin Immunoprecipitation-qPCR (ChIP-qPCR) at the rDNA Locus B CMCT Modification-based Pseudouridylation Assays B Monitoring Nuclear rRNA Abundance B Ribosome Fractionation B Monitoring Translation by Puromycin Incorporation B Mining Public Databases B Histology and Immunostaining QUANTIFICATION AND STATISTICAL ANALYSIS DATA AND CODE AVAILABILITY B Genomic Datasets B Custom Scripts

SUPPLEMENTAL INFORMATION Supplemental Information can be found online at https://doi.org/10.1016/j. molcel.2019.06.020. ACKNOWLEDGMENTS We thank the following for their assistance: Minho Chae for assistance with analysis of sequencing data, Keun Woo Ryu for the recombinant PARP-1 deletion mutants, Tim Hou for the polyA-enriched and polyA-depleted RNA-seq

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

data, Rebecca Gupte for the FACS analysis, Yang Peng for assistance with pathology analyses, and Shrikanth Gadad and Bryan Gibson for intellectual input and critical comments on this manuscript. We also acknowledge and thank the following UT Southwestern core facilities: the Live Cell Imaging Core for microscopy support (Dr. Katherine Luby-Phelps), the Next Generation Sequencing Core for deep sequencing services (Vanessa Schmid), the Histo Pathology Core for histology services, and the Tissue Management Shared Resource for providing human tissues and immunohistochemical support. This work was supported by a postdoctoral fellowship from the U.S. Department of Defense (DOD) Breast Cancer Research Program (BC134066) to D.-S.K. This work was also supported by a grant from the NIH/National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) (R01 DK058110) and funds from the Cecil H. and Ida Green Center for Reproductive Biology Sciences Endowment to W.L.K. AUTHOR CONTRIBUTIONS D.-S.K. and W.L.K. conceived this project, designed the experiments, and oversaw their execution. D.-S.K. performed all of the biochemical and cell-based experiments. C.V.C. and D.-S.K. performed the in vivo mouse experiments and the experiments with human cancer samples, and S.C. and D.-S.K. performed the ribosome fractionation assay. A.N. and V.S.M. analyzed the RIP-seq and RNA-seq data. D.-S.K. prepared the initial drafts of the figures and text, which were edited by C.V.C. and W.L.K. and finalized by W.L.K. W.L.K secured funding to support this project and provided intellectual support for all aspects of the work. DECLARATION OF INTERESTS W.L.K. is a founder and consultant for Ribon Therapeutics, Inc. He is also coholder of U.S. Patent 9,599,606 covering the ADP-ribose detection reagent used herein, which has been licensed to and is sold by EMD Millipore. Received: June 19, 2018 Revised: April 16, 2019 Accepted: June 17, 2019 Published: July 24, 2019 REFERENCES Anders, S., Pyl, P.T., and Huber, W. (2015). HTSeq—a Python framework to work with high-throughput sequencing data. Bioinformatics 31, 166–169. Belin, S., Beghin, A., Solano-Gonza`lez, E., Bezin, L., Brunet-Manquat, S., Textoris, J., Prats, A.C., Mertani, H.C., Dumontet, C., and Diaz, J.J. (2009). Dysregulation of ribosome biogenesis and translational capacity is associated with tumor progression of human breast cancer cells. PLoS ONE 4, e7147. Belin, S., Hacot, S., Daudignon, L., Therizols, G., Pourpe, S., Mertani, H.C., Rosa-Calatrava, M., and Diaz, J.J. (2010). Purification of ribosomes from human cell lines. Curr. Protoc. Cell Biol. Chapter 3. Unit 3.40. Bitler, B.G., Watson, Z.L., Wheeler, L.J., and Behbakht, K. (2017). PARP inhibitors: clinical utility and possibilities of overcoming resistance. Gynecol. Oncol. 147, 695–704.

analysis of predefined sets of neoplastic tissues. Int. J. Cancer 123, 1327–1338. Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., and Gingeras, T.R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21. Domagala, P., Huzarski, T., Lubinski, J., Gugala, K., and Domagala, W. (2011). PARP-1 expression in breast cancer including BRCA1-associated, triple negative and basal-like tumors: possible implications for PARP-1 inhibitor therapy. Breast Cancer Res. Treat. 127, 861–869. Drygin, D., Siddiqui-Jain, A., O’Brien, S., Schwaebe, M., Lin, A., Bliesath, J., Ho, C.B., Proffitt, C., Trent, K., Whitten, J.P., et al. (2009). Anticancer activity of CX-3543: a direct inhibitor of rRNA biogenesis. Cancer Res. 69, 7653–7661. Evans, T., and Matulonis, U. (2017). PARP inhibitors in ovarian cancer: evidence, experience and clinical potential. Ther. Adv. Med. Oncol. 9, 253–267. Farmer, H., McCabe, N., Lord, C.J., Tutt, A.N., Johnson, D.A., Richardson, T.B., Santarosa, M., Dillon, K.J., Hickson, I., Knights, C., et al. (2005). Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917–921. €ger, A., Hampp, S., Assmann, G., Rank, L., Hufnagel, M., Fischbach, A., Kru Sto¨ckl, M.T., Fischer, J.M.F., Veith, S., Rossatti, P., et al. (2018). The C-terminal domain of p53 orchestrates the interplay between non-covalent and covalent poly(ADP-ribosyl)ation of p53 by PARP1. Nucleic Acids Res. 46, 804–822. Frizzell, K.M., and Kraus, W.L. (2009). PARP inhibitors and the treatment of breast cancer: beyond BRCA1/2? Breast Cancer Res. 11, 111. Gibson, B.A., and Kraus, W.L. (2012). New insights into the molecular and cellular functions of poly(ADP-ribose) and PARPs. Nat. Rev. Mol. Cell Biol. 13, 411–424. Gibson, B.A., Zhang, Y., Jiang, H., Hussey, K.M., Shrimp, J.H., Lin, H., Schwede, F., Yu, Y., and Kraus, W.L. (2016). Chemical genetic discovery of PARP targets reveals a role for PARP-1 in transcription elongation. Science 353, 45–50. Gibson, B.A., Conrad, L.B., Huang, D., and Kraus, W.L. (2017). Generation and characterization of recombinant antibody-like ADP-ribose binding proteins. Biochemistry 56, 6305–6316. Gong, J., Li, Y., Liu, C.J., Xiang, Y., Li, C., Ye, Y., Zhang, Z., Hawke, D.H., Park, P.K., Diao, L., et al. (2017). A Pan-cancer Analysis of the Expression and Clinical Relevance of Small Nucleolar RNAs in Human Cancer. Cell Rep. 21, 1968–1981. Guetg, C., Scheifele, F., Rosenthal, F., Hottiger, M.O., and Santoro, R. (2012). Inheritance of silent rDNA chromatin is mediated by PARP1 via noncoding RNA. Mol. Cell 45, 790–800. Guimaraes, J.C., and Zavolan, M. (2016). Patterns of ribosomal protein expression specify normal and malignant human cells. Genome Biol. 17, 236. Gupte, R., Liu, Z., and Kraus, W.L. (2017). PARPs and ADP-ribosylation: recent advances linking molecular functions to biological outcomes. Genes Dev. 31, 101–126.

Boamah, E.K., Kotova, E., Garabedian, M., Jarnik, M., and Tulin, A.V. (2012). Poly(ADP-ribose) polymerase 1 (PARP-1) regulates ribosomal biogenesis in Drosophila nucleoli. PLoS Genet. 8, e1002442.

Hanzlikova, H., Kalasova, I., Demin, A.A., Pennicott, L.E., Cihlarova, Z., and Caldecott, K.W. (2018). The importance of poly(ADP-ribose) polymerase as a sensor of unligated Okazaki fragments during DNA replication. Mol. Cell 71, 319–331.e3.

Bryant, H.E., Schultz, N., Thomas, H.D., Parker, K.M., Flower, D., Lopez, E., Kyle, S., Meuth, M., Curtin, N.J., and Helleday, T. (2005). Specific killing of BRCA2-deficient tumours with inhibitors of poly(ADP-ribose) polymerase. Nature 434, 913–917.

Holmstro¨m, T.H., Mialon, A., Kallio, M., Nymalm, Y., Mannermaa, L., Holm, T., Johansson, H., Black, E., Gillespie, D., Salminen, T.A., et al. (2008). c-Jun supports ribosomal RNA processing and nucleolar localization of RNA helicase DDX21. J. Biol. Chem. 283, 7046–7053.

Calo, E., Flynn, R.A., Martin, L., Spitale, R.C., Chang, H.Y., and Wysocka, J. (2015). RNA helicase DDX21 coordinates transcription and ribosomal RNA processing. Nature 518, 249–253.

Huambachano, O., Herrera, F., Rancourt, A., and Satoh, M.S. (2011). Doublestranded DNA binding domain of poly(ADP-ribose) polymerase-1 and molecular insight into the regulation of its activity. J. Biol. Chem. 286, 7149–7160.

Cimino, D., Fuso, L., Sfiligoi, C., Biglia, N., Ponzone, R., Maggiorotto, F., Russo, G., Cicatiello, L., Weisz, A., Taverna, D., et al. (2008). Identification of new genes associated with breast cancer progression by gene expression

Ja´dy, B.E., and Kiss, T. (2001). A small nucleolar guide RNA functions both in 20 -O-ribose methylation and pseudouridylation of the U5 spliceosomal RNA. EMBO J. 20, 541–551.

Molecular Cell 75, 1–16, September 19, 2019 15

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

Kim, M.Y., Mauro, S., Ge´vry, N., Lis, J.T., and Kraus, W.L. (2004). NAD+dependent modulation of chromatin structure and transcription by nucleosome binding properties of PARP-1. Cell 119, 803–814.

Robinson, M.D., McCarthy, D.J., and Smyth, G.K. (2010). edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139–140.

Kim, M.Y., Zhang, T., and Kraus, W.L. (2005). Poly(ADP-ribosyl)ation by PARP-1: ‘PAR-laying’ NAD+ into a nuclear signal. Genes Dev. 19, 1951–1967.

Rocchi, L., Barbosa, A.J., Onofrillo, C., Del Rio, A., and Montanaro, L. (2014). Inhibition of human dyskerin as a new approach to target ribosome biogenesis. PLoS ONE 9, e101971.

Kraus, W.L., and Lis, J.T. (2003). PARP goes transcription. Cell 113, 677–683.

Ruggero, D., and Pandolfi, P.P. (2003). Does the ribosome translate cancer? Nat. Rev. Cancer 3, 179–192.

Krishnakumar, R., and Kraus, W.L. (2010). The PARP side of the nucleus: molecular actions, physiological outcomes, and clinical targets. Mol. Cell 39, 8–24.

Ryu, K.W., Kim, D.S., and Kraus, W.L. (2015). New facets in the regulation of gene expression by ADP-ribosylation and poly(ADP-ribose) polymerases. Chem. Rev. 115, 2453–2481.

Kung, J.T., Kesner, B., An, J.Y., Ahn, J.Y., Cifuentes-Rojas, C., Colognori, D., Jeon, Y., Szanto, A., del Rosario, B.C., Pinter, S.F., et al. (2015). Locus-specific targeting to the X chromosome revealed by the RNA interactome of CTCF. Mol. Cell 57, 361–375.

Schmidt, E.K., Clavarino, G., Ceppi, M., and Pierre, P. (2009). SUnSET, a nonradioactive method to monitor protein synthesis. Nat. Methods 6, 275–277.

Lawrence, M., Huber, W., Page`s, H., Aboyoun, P., Carlson, M., Gentleman, R., Morgan, M.T., and Carey, V.J. (2013). Software for computing and annotating genomic ranges. PLoS Comput. Biol. 9, e1003118.

Scott, C.L., Swisher, E.M., and Kaufmann, S.H. (2015). Poly (ADP-ribose) polymerase inhibitors: recent advances and future development. J. Clin. Oncol. 33, 1397–1406.

Ledermann, J., Harter, P., Gourley, C., Friedlander, M., Vergote, I., Rustin, G., Scott, C.L., Meier, W., Shapira-Frommer, R., Safra, T., et al. (2014). Olaparib maintenance therapy in patients with platinum-sensitive relapsed serous ovarian cancer: a preplanned retrospective analysis of outcomes by BRCA status in a randomised phase 2 trial. Lancet Oncol. 15, 852–861.

Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L., Gillette, M.A., Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., and Mesirov, J.P. (2005). Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. U S A 102, 15545–15550.

Lheureux, S., Lai, Z., Dougherty, B.A., Runswick, S., Hodgson, D.R., Timms, K.M., Lanchbury, J.S., Kaye, S., Gourley, C., Bowtell, D., et al. (2017). Long-term responders on Olaparib maintenance in high-grade serous ovarian cancer: clinical and molecular characterization. Clin. Cancer Res. 23, 4086–4094.

Sun, M., Gadad, S.S., Kim, D.S., and Kraus, W.L. (2015). Discovery, annotation, and functional analysis of long noncoding RNAs controlling cell-cycle gene expression and proliferation in breast cancer cells. Mol. Cell 59, 698–711.

Li, T., Zhou, X., Wang, X., Zhu, D., and Zhang, Y. (2010). Identification and characterization of human snoRNA core promoters. Genomics 96, 50–56.

Trapnell, C., Pachter, L., and Salzberg, S.L. (2009). TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25, 1105–1111.

Liao, Y., Smyth, G.K., and Shi, W. (2014). featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923–930.

Volders, P.J., Helsens, K., Wang, X., Menten, B., Martens, L., Gevaert, K., Vandesompele, J., and Mestdagh, P. (2013). LNCipedia: a database for annotated human lncRNA transcript sequences and structures. Nucleic Acids Res. 41, D246–D251.

Luo, X., Ryu, K.W., Kim, D.S., Nandu, T., Medina, C.J., Gupte, R., Gibson, B.A., Soccio, R.E., Yu, Y., Gupta, R.K., and Kraus, W.L. (2017). PARP-1 controls the adipogenic transcriptional program by PARylating C/EBPbeta and modulating Its transcriptional activity. Mol. Cell 65, 260–271. Maya-Mendoza, A., Moudry, P., Merchut-Maya, J.M., Lee, M., Strauss, R., and Bartek, J. (2018). High speed of fork progression induces DNA replication stress and genomic instability. Nature 559, 279–284. Melikishvili, M., Chariker, J.H., Rouchka, E.C., and Fondufe-Mittendorf, Y.N. (2017). Transcriptome-wide identification of the RNA-binding landscape of the chromatin-associated protein PARP1 reveals functions in RNA biogenesis. Cell Discov. 3, 17043. Mirza, M.R., Monk, B.J., Herrstedt, J., Oza, A.M., Mahner, S., Redondo, A., Fabbro, M., Ledermann, J.A., Lorusso, D., Vergote, I., et al.; ENGOT-OV16/ NOVA Investigators (2016). Niraparib maintenance therapy in platinum-sensitive, recurrent ovarian cancer. N. Engl. J. Med. 375, 2154–2164. Parsels, L.A., Karnak, D., Parsels, J.D., Zhang, Q., Ve´lez-Padilla, J., Reichert, Z.R., Wahl, D.R., Maybaum, J., O’Connor, M.J., Lawrence, T.S., and Morgan, M.A. (2018). PARP1 trapping and DNA replication stress enhance radiosensitization with combined WEE1 and PARP inhibitors. Mol. Cancer Res. 16, 222–232.

Tollervey, D., and Kiss, T. (1997). Function and synthesis of small nucleolar RNAs. Curr. Opin. Cell Biol. 9, 337–342.

Wacker, D.A., Ruhl, D.D., Balagamwala, E.H., Hope, K.M., Zhang, T., and Kraus, W.L. (2007). The DNA binding and catalytic domains of poly(ADPribose) polymerase 1 cooperate in the regulation of chromatin structure and transcription. Mol. Cell. Biol. 27, 7475–7485. Wang, M., Wu, W., Wu, W., Rosidi, B., Zhang, L., Wang, H., and Iliakis, G. (2006). PARP-1 and Ku compete for repair of DNA double strand breaks by distinct NHEJ pathways. Nucleic Acids Res. 34, 6170–6182. Wang, Q., Armenia, J., Zhang, C., Penson, A.V., Reznik, E., Zhang, L., Minet, T., Ochoa, A., Gross, B.E., Iacobuzio-Donahue, C.A., et al. (2018). Unifying cancer and normal RNA sequencing data from different sources. Sci. Data 5, 180061. Watkins, N.J., and Bohnsack, M.T. (2012). The box C/D and H/ACA snoRNPs: key players in the modification, processing and the dynamic folding of ribosomal RNA. Wiley Interdiscip. Rev. RNA 3, 397–414. Weil, M.K., and Chen, A.P. (2011). PARP inhibitor treatment in ovarian and breast cancer. Curr. Probl. Cancer 35, 7–50. Williams, G.T., and Farzaneh, F. (2012). Are snoRNAs and snoRNA host genes new players in cancer? Nat. Rev. Cancer 12, 84–88.

Revelle, W. (2018). psych: Procedures for Personality and Psychological Research (Evanston: Northwestern University), R package version 1.8.6.

Zhang, Y., Baysac, K.C., Yee, L.F., Saporita, A.J., and Weber, J.D. (2014). Elevated DDX21 regulates c-Jun activity and rRNA processing in human breast cancers. Breast Cancer Res. 16, 449.

Ringner, M., Fredlund, E., Hakkinen, J., Borg, A., and Staaf, J. (2011). GOBO: gene expression-based outcome for breast cancer online. PLoS One 6, e17911.

Zhao, J., Ohsumi, T.K., Kung, J.T., Ogawa, Y., Grau, D.J., Sarma, K., Song, J.J., Kingston, R.E., Borowsky, M., and Lee, J.T. (2010). Genome-wide identification of polycomb-associated RNAs by RIP-seq. Mol. Cell 40, 939–953.

Risso, D., Ngai, J., Speed, T.P., and Dudoit, S. (2014). Normalization of RNAseq data using factor analysis of control genes or samples. Nat. Biotechnol. 32, 896–902.

Zhen, Y., Zhang, Y., and Yu, Y. (2017). A cell-line-specific atlas of PARP-mediated protein Asp/Glu-ADP-ribosylation in breast cancer. Cell Rep. 21, 2326–2337.

16 Molecular Cell 75, 1–16, September 19, 2019

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

PARP-1

Active Motif

Cat# 39559, RRID:AB_2793257

Anti-ADP-ribose binding reagent

Millipore

Cat# MABE1031, RRID:AB_2665467

DDX21

Proteintech

Cat# 10528-1-AP, RRID:AB_2092705

NOP58

Invitrogen

Cat# PA5-54321, RRID:AB_2644745

FLAG

Sigma-Aldrich

Cat# F3165, RRID:AB_259529

RPS3

Bethyl

Cat# A303-841A, RRID:AB_2620192

RPL10

BioRad

Cat# VPA00362

RPL26

Sigma-Aldrich

Cat# HPA030449, RRID:AB_10602125

Puromycin

Millipore

Cat# MABE343, RRID:AB_2566826

b-actin

Cell Signaling

Cat# 4967, RRID:AB_330288

b-tubulin

Abcam

Cat# ab6046, RRID:AB_10807712

SNRP70

Abcam

Cat# ab51266, RRID:AB_882630

H2A.X (Ser139)

Sigma-Aldrich

Cat# 05-636, RRID:AB_309864

Rabbit IgG

ThermoFisher

Cat# 10500C, RRID:AB_2532981

Sigma-Aldrich

Cat# 1011

Antibodies

Chemicals, Peptides, and Recombinant Proteins CMCT [1-cyclohexyl-3-(2-(4-morpholinyl)ethyl) carbodiimide tosylate) Human PARP-1 domain deletion mutants (His-tagged)

This study

N/A

Human PARP-1 (Flag-tagged)

This study

N/A

Human DDX21, wild-type and mutants

This study

N/A

Human ARH3

This study

N/A

GFP

This study

N/A

Critical Commercial Assays EZ-10 DNAaway RNA Kit

Bio Basic

Cat# BS88133

RNA Screen Tape

Agilent

Cat# 5067-5578

This study

GEO: GSM3188702/GSM3188704

Deposited Data MCF-7 PARP1 IP RIP-seq data MCF-7 Preimmnune IP RIP-seq data

This study

GEO: GSM3188703/GSM3188705

MCF-7 input RNA-seq data

This study

GEO: GSM3188706/GSM3188707

MCF-7 polyA depleted RNA-seq data

This study

GEO: GSM3188708/GSM3188709

MCF-7 polyA enriched RNA-seq data

This study

GEO: GSM3188710/GSM3188711

MCF-7 DDX21KD polyA enriched RNA-seq data

This study

GEO: GSM3734976/ GSM3734977

MCF-7 LucKD polyA enriched RNA-seq data

This study

GEO: GSM3734978/ GSM3734979

MCF-7

ATCC

Cat# HTB-22

MDA-MB-231

ATCC

Cat# HTB-26, RRID:CVCL_0062

T47D

ATCC

Cat# HTB-133, RRID:CVCL_0553

HCC1143

ATCC

Cat# CRL-2321, RRID:CVCL_1245

MDA-MB-436

ATCC

Cat# HTB-130, RRID:CVCL_0623

293T

ATCC

Cat# CRL-3216, RRID:CVCL_0063

HMEC

ATCC

Cat# CRL-3243, RRID:CVCL_0307

Experimental Models: Cell Lines

(Continued on next page)

Molecular Cell 75, 1–16.e1–e14, September 19, 2019 e1

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Recombinant DNA pET19b-PARP-1 deletion mutants

This study

N/A

pFastBac-PARP-1

This study

N/A

pcDNA3-FLAG-DDX21, wild-type and mutants

This study

N/A

pInducer20-FLAG-DDX21, wild-type and mutants

This study

N/A

pFastBac-DDX21, wild-type and mutants

This study

N/A

pcDNA3-snoRNAs

This study

N/A

pCMV-VSV-G

Addgene

Plasmid no. 8454, RRID:Addgene_8454

pAdVAntage

Promega

Cat# TB207

psPAX2

Addgene

Plasmid no. 12260, RRID:Addgene_12260

pMD2.G

Addgene

Plasmid no. 12259, RRID:Addgene_12259

pTRIPZ-DDX21 shRNA

Dharmacon

RHS4740-EG9188

Primers for RT-qPCR

See Table S1

N/A

Primers for ChIP-qPCR

See Table S1

N/A

Primers for molecular cloning

See STAR Methods

N/A

FastQC

Babraham Bioinformatics

http://www.bioinformatics.babraham.ac.uk/ projects/fastqc/

Tophat

Trapnell et al., 2009

https://ccb.jhu.edu/software/tophat/index.shtml

STAR

Dobin et al., 2013

featureCounts program of the Subread package

Liao et al., 2014

http://subread.sourceforge.net

Gene Expression-Based Outcome for Breast Cancer Online (GOBO) tool

Ringner et al., 2011

http://co.bmc.lu.se/gobo

LNCipedia (v.4.0)

Volders et al., 2013

http://lncipedia.org/

HTSeq

Risso et al., 2014

https://htseq.readthedocs.io/en/release_0.11.1/

RUVSeq

Anders et al., 2015

http://bioconductor.org/packages/release/bioc/ html/RUVSeq.html

SNORic

Gong et al., 2017

http://bioinfo.life.hust.edu.cn/SNORic

psych package

Revelle, 2018

http://cran.r-project.org/web/packages/psych/ index.html

edgeR

Robinson et al., 2010

http://bioconductor.org/packages/release/bioc/ html/edgeR.html

GenomicRanges

Lawrence et al., 2013

http://bioconductor.org/packages/release/bioc/ html/GenomicRanges.html

MSigDB (Molecular Signatures Database)

Subramanian et al., 2005

http://software.broadinstitute.org/gsea/msigdb

Sequence-Based Reagents

Software and Algorithms

LEAD CONTACT AND MATERIALS AVAILABILITY As Lead Contact, W. Lee Kraus is responsible for all reagent and resource requests. Please contact W. Lee Kraus at Lee.Kraus@ utsouthwestern.edu with requests and inquiries. Raw and processed genomic data have been made publicly available through the NCBI’s GEO portal, as described below. Computing scripts and the initial output from computational analyses are available upon request. EXPERIMENTAL MODELS AND SUBJECT DETAILS Cell Culture MCF-7, MDA-MB-231, T74D, HCC-1143, MDA-MB-436, 293T and HMEC cells were purchased from the American Type Culture Collection (ATCC). These cells were used for cDNA library generation (RIP-seq and RNA-seq) and a variety of experiments described herein. MCF-7 cells were maintained in Minimum Essential Medium Eagle (Sigma-Aldrich, M1018) supplemented with 5% calf serum and 1% penicillin/streptomycin. MDA-MB-231, T74D, HCC-1143, and MDA-MB-436 cells were maintained in RPMI (Sigma-Aldrich,

e2 Molecular Cell 75, 1–16.e1–e14, September 19, 2019

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

R8758) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. 293T cells were cultured in DMEM (SigmaAldrich, D5796) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. Primary human mammary epithelial cells (HMEC) were maintained in Mammary Epithelial Cell Basal Medium (ATCC, PCS-600-030) supplemented with Mammary Epithelial Cell Growth Kit (ATCC, PCS-600-040). All cell lines were tested and verified as mycoplasma-free every 6 months. Generation of Knockdown and Ectopic Cell Lines Dox-inducible shRNA-mediated knockdown in MCF-7 Cells Lentiviruses were generated by transfection of pTRIPZ-based vectors for Dox-inducible expression of shRNAs targeting luciferase or human DDX21 together with pMD2.G and psPAX2 vectors into 293T cells using Lipofectamine 3000 (Invitrogen, L3000015) according to the manufacturer’s protocol. After 24 hours, the culture medium was replaced with fresh medium and the cells were maintained for an additional 24 hours. The virus-containing supernatants were collected, filtered through a 0.45 mm syringe filter, and concentrated by using a Lenti-X concentrator (Clontech, 631231). The filtered supernatants were used to infect MCF-7 cells supplemented with 1 mg/mL polybrene (Sigma-Aldrich) to increase the efficiency of viral transduction. Stably transduced cells were isolated under drug selection with 1 mg/mL puromycin (Sigma-Aldrich, P9620). Dox-inducible ectopic expression in MCF-7 cells Lentiviruses were generated by transfection of pINDUCER20-based vectors (Addgene, plasmid no. 44012) for Dox-inducible expression of shRNA-resistant wild-type (WT) or mutant (MutA or MutP) FLAG epitope-tagged DDX21, along with pCMV-VSV-G, pCMV-GAG-Pol-Rev, and pAdVAntage into 293T cells using Lipofectamine 3000 according to the manufacturer’s protocol. The virus-containing supernatants were collected and filtered as described above, and then used to infect the Dox-inducible shRNAexpressing MCF-7 cells described above, with subsequent selection using 1 mg/mL Geneticin (Life Technologies, 11811031). These engineered MCF-7 cell lines were used for simultaneous Dox-induced shRNA-mediated knockdown of endogenous DDX21 and ectopic expression of either WT or mutant FLAG epitope-tagged DDX21. Experiments with Mice All animal experiments were performed in compliance with the Institutional Animal Care and Use Committee (IACUC) at the UT Southwestern Medical Center. Female NOD scid gamma (NSG) mice at 6-8 weeks of age were used. We used female mice because mammary cancers occur primarily in females. In addition, the human cancer cell lines that we used for xenografts are from females. Mice were supplemented with 1.7 mg 17-b-estradiol 60-day release pellets (Innovative Research) implanted subcutaneously at the base of the neck under anesthesia. To establish breast cancer xenografts, MCF-7 cells engineered for doxycycline-inducible expression of FLAG-tagged WT-DDX21 (5 3 106 in 100 ml) were injected subcutaneously into the flank of the mice in a 1:1 ratio PBS and Matrigel (Fisher). Ten days post-tumor cell injection, the mice were placed on a doxycycline containing diet (625 mg/kg; Envigo). Mice carrying 100 mm3 subcutaneous tumors were randomized to receive 25 mg/kg of Niraparib (Selleck Chemicals) in 4% DMSO, 5% PEG 300, 5% Tween80 in saline or an equal volume of vehicle intraperitoneally, for 5 days a week (2 days off) for 3 weeks. The weight of the mice was monitored once a week and tumor growth measured using electronic calipers approximately every 3-4 days. Tumor volumes were calculated using a modified ellipsoid formula: Tumor volume = ½ (length 3 width2). Animals were euthanized at 35 days post-injection. Fresh tumor samples were fixed for 24 hours in 10% formalin. METHOD DETAILS Cell Treatments For treatment with PJ34 (20 mM; Enzo, ALX-270), Niraparib (20 mM; Selleck Chemicals, S7625) or Olaparib (20 mM; ApexBio), the cells were grown to 80% confluence and then treated with PJ34, Niraparib or Olaparib for 1 or 2 hours. For doxycycline (Dox; SigmaAldrich, D9891) induction, cells were treated with 1 mg/mL of Dox for 48-72 hours. For cell growth assays, cells were pretreated with 1 mg/mL of Dox for 48 hours, re-seeded into 6-well plates and grown with daily changes of Dox-containing medium (0.5-1 mg/mL) for the indicated times before collection. For Ultraviolet (UV)-induced PARP-1 automodification, the cells were UV irradiated (150 mJ/cm2) and harvested for western blotting or immunoprecipitation assays. Antibodies The custom rabbit polyclonal antiserum against PARP-1 used for western blotting and immunofluorescent staining assays was generated by using an antigen comprising the amino-terminal half of PARP-1 (Kim et al., 2004) (now available from Active Motif; cat. no. 39559). The custom recombinant antibody-like anti-ADP-ribose binding reagent was generated and purified in-house (Gibson et al., 2017) (now available from EMD Millipore; cat. no. MABE1031). The other antibodies used are as follows: DDX21 rabbit polyclonal antibody (Proteintech, 10528-1-AP), NOP58 rabbit polyclonal antibody (Invitrogen, PA5-5432), FLAG mouse monoclonal antibody (Sigma-Aldrich, F3165), RPS3 rabbit polyclonal antibody (Bethyl, A303-841A), RPL10 rabbit polyclonal antibody (BioRad, VPA00362), RPL26 rabbit polyclonal antibody (Sigma, HPA030449), puromycin mouse monoclonal antibody (Millipore, MABE343), b-actin rabbit polyclonal antibody (Cell Signaling, #4967), b-tubulin rabbit polyclonal antibody (Abcam, ab6046), SNRP70 rabbit polyclonal antibody (Abcam, ab51266), H2A.X (Ser139) mouse monoclonal antibody (Sigma, 05-636), and rabbit IgG (ThermoFisher Scientific, 10500C).

Molecular Cell 75, 1–16.e1–e14, September 19, 2019 e3

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

Molecular Cloning to Generate Knockdown and Expression Vectors Human cDNA pools cDNA pools were prepared by extraction of total RNA from MCF-7 cells using Trizol (Sigma-Aldrich, T9424), followed by reverse transcription using Superscript III Reverse Transcriptase (Invitrogen, 18080093) with random hexamer primers (Roche, 11034731001) according to the manufacturer’s instructions. The cDNA pools were used to amplify snoRNA and DDX21 cDNAs for subsequent cloning, as described below. In vitro transcription vectors cDNAs encoding individual human snoRNAs were amplified from a cDNA pool by PCR using the snoRNA-specific primer sets listed below and cloned into EcoRI- (or HindIII) and XbaI-digested pcDNA3 (ThermoFisher Scientific) downstream of the T7 promoter. SNORA15 Forward: 50 -CGGAATTCGCATGGCCGAATACTGTGTTTTTATC-30 SNORA15 Reverse: 50 -GCTCTAGAATTTGTATTCACCTTTAATAATGATATGC-3 0 SNORA65 Forward: 50 -CGGAATTCTCAGCCACCCGCCACTGCA-30 SNORA65 Reverse: 50 -GCTCTAGAGCTGTTCCCATGCTTTCGG-30 SNORA73A Forward: 50 -CGGAATTCTCCAACGTGGATACACCCGG-30 SNORA73A Reverse: 50 -GCTCTAGAGGCTGTTTCCTGCATGGTTTGT-30 SNORA73B Forward: 50 -CGGAATTCTCCAACGTGGATACCCTGGG-30 SNORA73B Reverse: 50 -GCTCTAGACTGGGAAGCTGTAGGAATATGCAG-30 SNORA74A Forward: 50 -CGGAATTCATCCAGCGGTTGTCAGCTATCC-30 SNORA74B Reverse: 50 -GCTCTAGAAATTGTTTGCACCCAGACTAGGATCA-3 0 SCARNA2 Forward: 50 -CGAAGCTTGTTTTAGGGAGGGAGAGCGG-30 SCARNA2 Reverse: 50 -GCTCTAGACCAGATCAGAATCGCCTCGATAATCA-30 Bacterial expression vectors pET19b (Novagen) bacterial expression vectors for 6xHis-tagged human PARP-1 domain deletion constructs were described previously (Wacker et al., 2007). Insect cell expression vectors The human DDX21 cDNA was amplified by PCR from pcDNA3-FLAG-DDX21 (see below) using the primers listed below, and then cloned into NotI- and XhoI-digested pFastBac-10xHis-TEV [described previously (Gibson et al., 2016)]. Recombinant bacmids were generated by transforming the pFastBac-10xHis-TEV-DDX21 vector into DH10BAC E. coli with subsequent blue/white colony screening using the Bac-to-Bac system (Invitrogen) according to the manufacturer’s instructions. The baculovirus-based insect cell expression vector for expressing N-terminally FLAG epitope-tagged human PARP-1 has been described previously (Gibson et al., 2016). DDX21 Forward: 50 -CGGCGGCCGCACCGGGAAAACTCCGTAGTGACGCT-30 DDX21 Reverse: 50 -GCCTCGAGTTATTGACCAAATGCTTTACTGAAACTCCGC-3 0 Mammalian expression vectors cDNAs encoding N-terminally FLAG epitope-tagged human wild-type (WT) DDX21 were cloned into BamHI- and XbaI-digested pcDNA3 using the primers listed below. The ADP-ribosylation site point mutant DDX21 cDNA (MutA) was synthesized as a gBlock Gene Fragment (Integrated DNA Technologies) and cloned into BamHI- and EcoRV-digested pcDNA3-FLAG-WT-DDX21. MutA contains codons for alanine to replace codons for glutamic acid at positions 13, 43, 67, and 196 and aspartic acid at position 15. The PAR binding-deficient mutant of DDX21 cDNA (MutP) was generated by mutating codons for lysine at position 774 and arginine at position 775 to a codon for alanine in the WT DDX21 cDNA using site-directed mutagenesis (QuikChange, Stratagene). The pcDNA-based vectors were used for transient transfection in 293T cells. DDX21 Forward: 50 -CGGGATCCATGGATTATAAGGATGACGATGACAAGCCGGGAA AACTCCGTAGTGACGCT-30 DDX21 Reverse: 50 -GCTCTAGATTATTGACCAAATGCTTTACTGAAACTCCGC-3 0 Lentiviral expression vectors To generate lentiviral vectors for expression of WT or mutant DDX21 in MCF-7 cells, the DDX21 cDNAs described above were subjected to mutagenesis of the shRNA target site (for Dharmacon V2THS_36558; see below) and cloned into pINDUCER20 (Addgene, plasmid no. 44012) using a Gibson Assembly kit (NEB, E2621). DDX21 shRNA target site: GCTGATCAAGTGGAAGAGATT shRNA vectors pTRIPZ-based vectors for Dox-inducible expression of shRNA targeting luciferase (Luc) was generated by cloning the doublestranded oligonucleotides listed below into XhoI- and EcoRI- digested pTRIPZ (Dharmacon). The Luc shRNA sequences have been tested extensively in previous studies (Gibson et al., 2016).

e4 Molecular Cell 75, 1–16.e1–e14, September 19, 2019

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

- Luc Forward 50 -TCGAgaaggtatattgctgttgacagtgagcgAGATATGGGCTGAATACAAATCtagtgaagccacagatgta GATTTGTATTCAGCCCATATCGtgcctactgcctcgg-3 0 - Luc Reverse 50 -AATTccgaggcagtaggcaCGATATGGGCTGAATACAAATCtacatctgtggcttcactaGATTTGTA TTCAGCCCATATCTcgctcactgtcaacagcaatataccttc-3 0 In the sequences above, Upper case is the target sequence. Lower case is thebackbone. Upper case italic at 50 end is the restriction enzyme site overhang. A set of pTRIPZ-based vectors for Dox-inducible expression of shRNAs targeting DDX21 were purchased from Dharmacon (RHS4740-EG9188). Six different shRNAs targeting DDX21 were tested; Dharmacon clone V2THS_36558 was found to give the most efficient knockdown and least off-target effects. Expression and Purification of Recombinant Proteins Purification of PARP-1 domain deletion mutants expressed in E. coli pET19b (Novagen) bacterial expression vectors for 6xHis-tagged human PARP-1 domain deletion constructs were described previously (Wacker et al., 2007). Purification of DDX21 expressed in mammalian cells 293T cells were seeded at 2 3 106 cells per 15 cm diameter plate and transfected at 60% confluence with pcDNA3 containing a cDNA encoding FLAG-tagged WT or mutant (MutA or MutP) human DDX21 as described above using Lipofectamine 3000 Reagent (Invitrogen, L3000015) for 48 hours according to the manufacturer’s specifications. The cells were collected in ice-cold PBS and pelleted by centrifugation in a microfuge at 1000 RCF for 5 minutes at 4 C. The cells were then resuspended in ice-cold Isotonic Buffer [10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.3 M sucrose, and 1x complete protease inhibitor cocktail (Roche, 11697498001)] and allowed to swell for 15 minutes on ice. The nuclei were released from the cells by the addition of NP-40 (0.65% v/v) with 10 s of vortexing, followed immediately by centrifugation at 11,000 RCF in a microfuge for 30 s at 4 C. The supernatant was removed and the nuclei were subjected to extraction on ice for 30 minutes in DDX21 Immunoaffinity Purification Extraction Buffer [25 mM Tris-HCl pH 7.5, 150 mM, 1% NP-40, 1 mM EDTA, 1x complete protease inhibitor cocktail, 250 nM APD-HPD (a PARG inhibitor; Millipore, 118415)] with occasional mixing. The resulting extract was clarified by two rounds of centrifugation at full speed in a microfuge for 10 minutes at 4 C and then incubated with equilibrated anti-M2-FLAG beads (Sigma-Aldrich, A2220) for 3 hours at 4 C with gentle mixing. The resin was washed three times with Immunoaffinity Purification Wash Buffer (25 mM Tris-HCl pH 7.5, 400 mM NaCl, 1% NP-40, 1 mM EDTA, and 1x complete protease inhibitor cocktail). The immunoaffinity purified DDX21 was eluted from the agarose resin by the addition of Immunoaffinity Purification Elution Buffer [25 mM Tris-HCl pH 7.5, 200 mM NaCl, 0.25% NP-40, 10% glycerol, 1 mM EDTA, 1x complete protease inhibitor cocktail, 250 nM APD-HPD, containing 0.2 mg/mL of 3x FLAG peptide (Sigma-Aldrich, F4799)]. The purified DDX21 was aliquoted, flash frozen in liquid N2, and stored at
80 C until use. Purification of PARP-1 expressed in Sf9 insect cells Sf9 insect cells, cultured in SF-II 900 medium (Invitrogen, 10902096), were transfected with 1 mg of bacmid driving expression of FLAG-tagged PARP-1 using Cellfectin transfection reagent (Invitrogen, 10362100) as described by the manufacturer. After five hours, the medium was supplemented with 10% FBS, penicillin and streptomycin, and collected as a baculovirus stock after three days. After multiple rounds of amplification of the stock, the resulting high titer baculovirus was used to infect fresh Sf9 cells to induce expression of FLAG-tagged PARP-1protein for two days. The cells were then collected by centrifugation. The cells were resuspended in FLAG Lysis Buffer (20 mM HEPES pH 7.9, 0.5 M NaCl, 4 mM MgCl2, 0.4 mM EDTA, 20% glycerol, 250 mM nicotinamide, 2 mM b-mercaptoethanol, 2x protease inhibitor cocktail) and lysed by Dounce homogenization and sonication. The lysate was clarified by centrifugation and mixed with an equal volume of FLAG Dilution Buffer (20 mM HEPES pH 7.9, 10% glycerol, 0.02% NP-40). The diluted lysate was mixed with anti-FLAG M2 agarose resin, washed twice with FLAG Wash Buffer #1 (20 mM HEPES pH 7.9, 150 mM NaCl, 2 mM MgCl2, 0.2 mM EDTA, 15% glycerol, 0.01% NP-40, 100 mM nicotinamide, 0.2 mM b-mercaptoethanol, 1 mM PMSF, 1 mM aprotinin, 100 mM leupeptin), twice with FLAG Wash Buffer #2 (20 mM HEPES pH 7.9, 1 M NaCl, 2 mM MgCl2, 0.2 mM EDTA, 15% glycerol, 0.01% NP-40, 100 mM nicotinamide, 0.2 mM b-mercaptoethanol, 1 mM PMSF, 1 mM aprotinin, 100 mM leupeptin), and twice with FLAG Wash Buffer #3 (20 mM HEPES pH 7.9, 200 mM NaCl, 2 mM MgCl2, 0.2 mM EDTA, 15% glycerol, 0.01% NP-40, 0.2 mM b-mercaptoethanol, 1 mM PMSF). The FLAG-tagged PARP-1 proteins were eluted from the anti-FLAG M2 agarose resin with FLAG Wash Buffer #3 containing 0.2 mg/mL 3x FLAG peptide, flash frozen in liquid N2, and stored at
80 C. Purification of DDX21 expressed in Sf9 insect cells 10xHis-tagged -TEV-DDX21 Sf9 cells were prepared as described above and were then collected by centrifugation. The cells were resuspended in His Lysis Buffer (20 mM HEPES pH 7.9, 0.5 M NaCl, 4 mM MgCl2, 0.4 mM EDTA, 20% glycerol, 10 mM imidazole, 2 mM b-mercaptoethanol, 2x protease inhibitor cocktail) and lysed by Dounce homogenization (Wheaton) and sonication. The lysate was clarified by centrifugation, and mixed with an equal volume of His Dilution Buffer (20 mM HEPES pH 7.9, 10% glycerol, 0.02% NP-40). The diluted lysate was mixed with Ni-NTA affinity chromatography (QIAGEN, 30210), washed twice with His Wash Buffer #1

Molecular Cell 75, 1–16.e1–e14, September 19, 2019 e5

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

(20 mM HEPES pH 7.9, 150 mM NaCl, 2 mM MgCl2, 0.2 mM EDTA, 15% glycerol, 0.01% NP-40, 10 mM imidazole, 0.2 mM b-mercaptoethanol, 1 mM PMSF, 1 mM aprotinin, 100 mM leupeptin), twice with His Wash Buffer #2 (20 mM HEPES pH 7.9, 1 M NaCl, 2 mM MgCl2, 0.2 mM EDTA, 15% glycerol, 0.01% NP-40, 20 mM imidazole, 0.2 mM b-mercaptoethanol, 1 mM PMSF, 1 mM aprotinin, 100 mM leupeptin), and twice with His Wash Buffer #3 (20 mM HEPES pH 7.9, 200 mM NaCl, 2 mM MgCl2, 0.2 mM EDTA, 15% glycerol, 0.01% NP-40, 30 mM imidazole, 0.2 mM b-mercaptoethanol, 1 mM PMSF). The 10xHis-tagged-TEV-DDX21 protein was eluted from the Ni-NTA affinity chromatography with Ni-NTA Elution Buffer (20 mM HEPES pH 7.9, 200 mM NaCl, 2 mM MgCl2, 10% glycerol, 0.01% NP-40, 400 mM imidazole, 0.2 mM b-mercaptoethanol, 1 mM PMSF, 1 mM aprotinin, 100 mM leupeptin). The eluates were dialyzed in His Dialysis Buffer (20 mM HEPES pH 7.9, 0.2 M NaCl, 10% glycerol, 0.04% NP-40, 0.1 mM PMSF, 5 mM b-mercaptoethanol) with TEV protease. The dialyzed proteins were concentrated as needed with a centrifugal concentrator, flash frozen in liquid N2, and stored at
80 C. Knockdown using Oligonucleotide-based Approaches Antisense oligonucleotide (ASO)-mediated knockdown ASO sequences (listed below) targeting GFP (control) or SNORA74A were designed according to on-line protocols from the manufacturer and purchased from Integrated DNA Technologies. snoRNA depletion was performed by transfecting 50 nM of the ASO into MCF-7 cells using Lipofectamine 3000 Reagent according to the manufacturer’s protocol. After 24 hours, total RNA was isolated using Trizol (Sigma-Aldrich, T9424) to assay for snoRNA knockdown by reverse transcription-quantitative real-time PCR (RT-qPCR; see below) and nuclear extracts were prepared as described below for western blotting. GFP ASO: 50 -mUmCmAmCmCT*T*C*A*C*C*C*T*C*TmCmCmAmCmU-30 SNORA74A ASO: 50 -mCmCmAmAmAC*C*T*C*A*A*T*A*A*A*mGmAmCmAmG-30 SNORA15 ASO: 50 -mCmUmGmCmUT*T*T*G*C*A*T*G*G*T*mGmUmCmUmG-30 m = RNA bases with 20 -O- methoxy-ethyl (MOE)-modified ribonucleotide. * = Phosphothioate linkages. For cell proliferation assays, the ASOs (targeting GFP or SNORA74A) were transfected into MCF-7 cells at a final concentration of 100 nM using Lipofectamine 3000 Reagent according to the manufacturer’s protocol. After 48 hours, the ASOs were transfected again and the cells were collected at the indicated times and assayed for proliferation using a crystal violet assay (see below). siRNA-mediated knockdown Commercially available siRNA oligos targeting human PARP-1 (Sigma-Aldrich, SASI_Hs01_00159524, SASI_Hs01_00159525, SASI_Hs01_0033277) and human DDX21 (Ambion, AM16708-1215016, AM16708-15353), as well as a universal negative control #1 (Sigma-Aldrich, SIC001), and a non-targeting siRNA #1 (Dharmacon, D-001810-01-05), were transfected into MCF-7 cells at a final concentration of 10 nM using Lipofectamine RNAiMAX reagent (Invitrogen, 13778150) according to the manufacturer’s instructions. After 24 hours or the times indicated, total RNA was isolated using Trizol (Sigma-Aldrich, T9424) and nuclear extracts were prepared as described below to assay for knockdown by RT-qPCR and western blotting, respectively (see below). Cell Proliferation Assays Cell proliferation was assessed using a crystal violet staining assay. MCF-7 cells were plated at a density of 1 3 105 cells per well in six well plates. The cells were grown to 50% confluence (approximately 1 day of growth) and transfected with 10 nM of siRNA oligos targeting human PARP-1 or DDX21 using 5 mL of Lipofectamine RNAiMAX reagent (Invitrogen) according to the manufacturer’s instructions. The cells were collected every 2-3 days after transfection. After collections, the cells were washed with PBS, fixed for 10 minutes with 10% formaldehyde at room temperature, and stored in PBS at 4 C until all time points had been collected. The fixed cells were stained with a 0.1% crystal violet in 20% methanol solution containing 200 mM phosphoric acid. After washing to remove unincorporated stain, the crystal violet was extracted using 10% glacial acetic acid and the absorbance was read at 595 nm. For Dox induction in the cell proliferation assays, cells expressing shRNAs targeting DDX21, or shRNA-resistant WT or mutant DDX21, were seeded into 6-well plates and grown with daily changes of Dox-containing medium (1 mg/mL Dox) for the indicated times before collection. All growth assays were performed a minimum of three times using independent platings of cells to ensure reproducibility. Preparation of Nuclear Extracts and Western Blotting The packed cell volume (PCV) was estimated, and the cell pellets were resuspended to homogeneity in 5x PCV of Isotonic Lysis Buffer (10 mM Tris,HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.3 M sucrose, 1 mM DTT, 1x protease inhibitor cocktail, 20 mM PJ34, and 500 nM ADP-HPD) and incubated on ice for 15 minutes. NP-40 was added in Isotonic Lysis Buffer to a final concentration of 0.6%, and the mixture was vortexed vigorously for 10 s. The lysate was subjected to a short burst of centrifugation for 30 s at 11,000 RCF in a microcentrifuge at 4 C to collect the nuclei. The pelleted nuclei were resuspended in ice-cold Nuclear Extraction Buffer [20 mM HEPES pH 7.9, 1.5 mM MgCl2, 0.42 M NaCl, 0.2 mM EDTA, 25% (v/v) glycerol, 1 mM DTT, 1x protease inhibitor cocktail, 20 mM PJ34 inhibitor, and 500 nM ADP-HPD)] and incubated with gentle mixing for 15 minutes at 4 C. The mixture was subjected to centrifugation at maximum speed in a microcentrifuge for 10 minutes at 4 C to remove the insoluble material. The supernatant was collected as the soluble nuclear extract. Protein concentrations for the nuclear extracts were determined using a Bradford protein assay (Bio-Rad).

e6 Molecular Cell 75, 1–16.e1–e14, September 19, 2019

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

For each fraction collected from the indicated conditions, 10 to 20 mg of protein were separated on an 8% to 12% polyacrylamideSDS gel and transferred to a nitrocellulose membrane. The membranes were blocked for 1 hour at room temperature in Tris-Buffered Saline (TBS) with 0.05% Tween (TBS-T) containing 5% nonfat dry milk. Primary antibodies and/or ADP-ribose detection reagent [PARP-1 (1:5000), DDX21 (1:2000), ADP-ribose detection reagent (1:500), Puromycin (1:2000), FLAG (1:5000), or SNRP70 (1:5000)] were diluted in 5% nonfat dry milk and incubated with membranes overnight at 4 C with gentle mixing. After extensive washing with TBS-T, the membranes were incubated with an appropriate HRP-conjugated secondary antibody (Pierce) diluted in 1% nonfat dry milk for 1 hour at room temperature. The membranes were washed extensively with TBS-T before chemiluminescent detection using SuperSignal West Pico substrate (ThermoFisher Scientific) and X-ray film or ChemiDoc system (Bio-Rad). Native RNA Immunoprecipitation (RIP) RIP was performed as previously described (Zhao et al., 2010), with the modifications below. MCF-7 cells were grown to approximately 80% confluency in two 150 mm diameter dishes for each immunoprecipitation, harvested, and then collected by centrifugation. The cell pellets were resuspended in Isotonic Buffer (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 300 mM sucrose, with freshly added 1 mM DTT and 1x complete protease inhibitor cocktail) and swollen on ice for 15 minutes. The nuclei were released by the addition of NP-40 to a final concentration of 0.6%, followed by vigorous vortexing for 10 s and immediate collection by centrifugation. The supernatant was removed and the nuclei were resuspended in 1 mL ice-cold Polysome Lysis Bufffer [10 mM HEPES pH 7.0, 200 mM KCl, 5 mM MgCl2, 0.5% NP-40, with freshly added 1 mM DTT, 1x protease complete inhibitor cocktail, and 100 U SUPERaseIn (Invitrogen, AM2696)]. The resuspended nuclei were passed through a 27.5-gauge needle 5 times. DNase I (400 U; Roche, 4716728001) was added and the suspension was incubated on ice for 40 minutes with occasional gentle mixing to promote lysis of the nuclei. The resulting nuclear extract was clarified by centrifugation at maximum speed in a microcentrifuge at 4 C, diluted 1:1 with Dilution Buffer (50 mM Tris-HCl, 150 mM NaCl, 1 mM MgCl2, 0.5% NP-40, with freshly added 1 mM DTT, 1x complete protease inhibitor cocktail, 100 U SUPERaseIn), and pre-cleared with preimmune serum and Protein A agarose beads for 1 hour at 4 C. Ten percent of the pre-cleared nuclear extract was saved as input to generate RNA-seq libraries to normalize the RIP-seq datasets. The remainder of the nuclear extract was used in immunoprecipitation reactions with preimmune serum (as a control) or antibodies against PARP-1 with incubation overnight at 4 C. The PARP-1 antibody/PARP-1/RNA complexes were collected using protein A agarose beads (Millipore, 16-125), washed several times with Wash Buffer (50 mM Tris-HCl, 200 mM NaCl, 1 mM MgCl2, 0.5% NP-40, with freshly added 1x complete protease inhibitor cocktail and 20 U SUPERaseIn). The PARP-1-bound RNAs were eluted from the agarose resin by the addition of Trizol reagent and isolated according to the manufacturer’s instructions. RIP-quantitative PCR (RIP-qPCR) The eluted PARP-1-bound RNAs were reverse transcribed using MMLV reverse transcriptase (Promega, M150B) with random hexamer or oligo(dT) primers (Sigma-Aldrich) to generate a cDNA pool. The cDNA was treated with 3 units of RNase H (Ambion) for 30 minutes at 37 C and then analyzed by qPCR using the primer sets listed below and a LightCycler 480 real-time PCR thermocycler (Roche) for 45 cycles. The RNA immunoprecipitated by PARP-1 was normalized to the input fraction. RIP-qPCR primers SNORA3 forward: 50 -GAGTCCTCGAAGAGTAACTG-30 SNORA3 reverse: 50 -ATGTCTCTAACCTGGTGAC-30 SNORA18 forward: 50 -GAAACGCCTCATAGAGTAAC-30 SNORA18 reverse: 50 -AACTGTCTTGTAATTCCTTCC-30 SNORA37 forward: 50 -GTGCTGAGAGAAAACCTTTG-30 SNORA37 reverse: 50 -AATTGTCCCATTGAATGACAG-30 SNORA73A forward: 50 -AACGTTGGAAATAAAGCTGG-30 SNORA73A reverse: 50 -GTTTGTCTCCCCAGTAATTG-30 SNORA73B forward: 50 -GATGTACAGTCCCTTTCC-30 SNORA73B reverse: 50 -CTGTAGGAATATGCAGGC-30 SNORA74A forward: 50 -GTTGTAGCTGAGTACCTTTG-30 SNORA74A reverse: 50 -CAGACTAGGATCAACTCCAC-30 SNORA15 forward: 50 -GCCGAATACTGTGTTTTTATC-30 SNORA15 reverse: 50 -ACCTTAGCATACCATCAGTC-30 SNORA65 forward: 50 -CTGACCAGGTCTCTGTTG-30 SNORA65 reverse: 50 -ATGAAGAACAACCCTGTTTC-30 SNORA70B forward: 50 -AAGCTGACTGAATTCCTTTC-30 SNORA 70B reverse: 50 -TCCCTTAGAGCAACCTATAC-30 SCARNA2 forward: 50 -CAGGGTGAGTGTGAGTGGAC-30 SCARNA2 reverse: 50 -GGTCACGATCCGATCAAATA-30 SNORA62 forward: 50 -AGCTTGGAGTTGAGGCTACTG-30 SNORA62 reverse: 50 -ACCCTTGTGGTGTTAGCGA-30 SNORA67 forward: 50 -CCTCTCAGGAAAGTAGCAG-30 SNORA67 reverse: 50 -GGAAATAAGCATCCCAGTTC-30

Molecular Cell 75, 1–16.e1–e14, September 19, 2019 e7

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

SNHG4 forward: 50 -ACCAAGATAAGTAACGATCCC-30 SNHG4 reverse: 50 -ACTCCGTCTCAAAAACAAAC-30 MBD2 forward: 50 -TCAGTCCAAGTGGTAAGAAG-30 MBD2 reverse: 50 -TTCTGAAGTCAAAACTGCTG-30 RCC1 forward: 50 -TACCATCAGCTTGGAACTCCG-30 RCC1 reverse: 50 -GTATGCTTTTCCTTCCGAATCCA-30 Primary transcript for SNORA37 #1 forward: 50 -GTCTTGGTTTGTATTTCCTCATCA-30 Primary transcript for SNORA37 #1 reverse: 50 -ATGCAGACAGCCTGCTTAGA-30 Primary transcript for SNORA37 #2 forward: 50 -TGTGATAGTCTTGGTTTGTATTTCC-30 Primary transcript for SNORA37 #2 reverse: 50 -ACGAACAATTGTGAACGGCA-30 Primary transcript for SNORA74A #1 forward: 50 -CACGCCTGTTTTGCAGTCAA-30 Primary transcript for SNORA74A #1 reverse: 50 -GGCTGTCCCTAAGACAACCT-30 Primary transcript for SNORA74A #2 forward: 50 -AGGACCTCCCTGAATGTTGC-30 Primary transcript for SNORA74A #2 reverse: 50 -ACAACCTGTCTTTTTCTGCAAAC-30 Primary transcript for SNORA73 #1 forward: 50 -TGTTTTGCAGGATTTGTTAAGG-30 Primary transcript for SNORA73 #1 reverse: 50 -TGACAAAGAGCTGATAAGCAAAA-30 Primary transcript for SNORA73 #2 forward: 50 -GTCGCTTCTTCTCCTTGGTA-30 Primary transcript for SNORA73 #2 reverse: 50 -TAGGGAAGCTCGGCTACTGA-30 Quantitative PCR (qPCR) cDNA pools were prepared by extraction of total RNA from cells treated with PJ34, Niraparib, or DDX21 siRNA using Trizol (SigmaAldrich, T9424) or EZ-10 DNAaway RNA Kit, followed by reverse transcription using MMLV reverse transcriptase (Promega, M150B) with random hexamer or oligo(dT) primers (Sigma-Aldrich) to generate a cDNA pool. The cDNA was treated with 3 units of RNase H (Ambion) for 30 minutes at 37 C and then analyzed by qPCR using the primer sets listed below and a LightCycler 480 real-time PCR thermocycler (Roche) for 45 cycles. qPCR primers 47S pre-rRNA forward-1: 50 - CTCCGTTATGGTAGCGCTGC
30 47S pre-rRNA reverse-1: 50 - GCGGAACCCTCGCTTCTC
30 47S pre-rRNA forward-2: 50 - GAACGGTGGTGTGTCGTT
30 47S pre-rRNA reverse-2: 50 - GCGTCTCGTCTCGTCTCACT
30 GAPDH forward: 50 -CCACTCCTCCACCTTTGAC
30 GAPDH reverse: 50 -ACCCTGTTGCTGTAGCCA
30 RIP-seq and RNA-seq Library Preparation Two biological replicates of immunoprecipitated PARP-1-bound RNA were used to generate strand-specific RIP-seq libraries as described previously (Sun et al., 2015). The libraries were subjected to QC analyses and sequenced using an Illumina HiSeq instrument to a depth of x mapped reads. Two biological replicates from total input RNA were used to generate RNA-seq libraries as described previously (Sun et al., 2015) to serve as a normalization control for the RIP-seq datasets. Analysis of RNA-seq Datasets The raw reads were aligned to the human reference genome (hg19/GRCh37) using default parameters in Tophat (v2.0.12) (Trapnell et al., 2009). We created a repository of annotations by merging the comprehensive gene annotations for reference chromosomes from GENCODE (v.19) and a comprehensive set of annotated lncRNAs from LNCipedia (v.4.0) (Volders et al., 2013). To determine expressed transcripts, we used custom R scripts to calculate the counts and RPKM using the Bioconductor packages GenomicRanges and edgeR (Lawrence et al., 2013; Robinson et al., 2010). Transcripts with RPKM R 1 were considered to be expressed and were used in the RIP-seq analysis. Analysis of RIP-seq Datasets The RIP-seq data was analyzed by using the software custom R scripts, and approaches described below. Read alignment RIP-seq reads were aligned to human reference genome (hg19/GRCh37), including autosomes, X chromosome, one complete copy of an rDNA repeat (GenBank ID: U13369.1), and the merged mRNA and lncRNA gene annotations described above. The reads were aligned using the STAR (v2.4.2a) software package (Dobin et al., 2013) using the following parameters: (1) a maximum of 20 multiple alignments (-outFilterMultimapNmax 20); (2) an eight nucleotide overhang was allowed for an unannotated junction (-alignSJoverhangMin 8); (3) a one nucleotide overhang was allowed for an annotated junction (-alignSJDBoverhangMin 1); (4) 20 nucleotides for the minimum intron length (-alignIntronMin 20); and (5) 100,000 nucleotides for maximum intron length (-alignIntronMax 20).

e8 Molecular Cell 75, 1–16.e1–e14, September 19, 2019

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

Calling PARP-1- bound transcripts To determine PARP-1-bound transcripts, we used custom R scripts to calculate the counts (RPKM), and fold change using the Bioconductor packages GenomicRanges and edgeR (Lawrence et al., 2013; Robinson et al., 2010). First, transcripts with RPKM R 1 as determined by RNA-seq were selected (see above). For these transcripts, we calculated the fold-change (FC), as determined by edgeR, of signal with PARP-1 antibody versus preimmune serum. PARP-1-bound transcripts were defined as those with a FC R 2. The bound transcripts were ordered based on expression, as determined by RNA-seq, and fold enrichment, as determined by RIP-seq. The snoRNAs were classified using data from the HUGO Gene Nomenclature Committee (HGNC) database of human gene names (http://www.genenames.org). Heatmap The RNA-seq read counts of 205 snoRNAs were calculated using the featureCounts program of the Subread package (http:// subread.sourceforge.net) and the RPKM values were calculated using the read counts. For the 205 snoRNAs of interest, log transformed RPKM values from RNA-seq and log transformed fold change values from RIP-seq (PARP1/PI) were presented in a heatmap representation using heatmap.2 function in the gplots R package. In Vitro Transcription to Generate snoRNAs To generate snoRNAs in vitro, XbaI-linearized plasmid DNA containing cDNA for the snoRNA of interest (pcDNA3-snoRNA) was gel purified on an agarose gel and transcribed with T7 RNA polymerase (Promega, P207B) according to the manufacturer’s protocol. One mg of the linearized plasmid DNA was incubated with T7 RNA polymerase and NTPs (10 mM each of ATP, CTP, GTP, and UTP) at 37 C for 35 minutes. The template DNA was then removed by treatment with DNase (Promega, M6101) at 37 C for 15 minutes. The reaction was stopped by the addition of 2 mL of 0.2 M EDTA (pH 8.0). The in vitro transcribed snoRNAs were purified using EZ-10 DNAaway RNA Kit (Biobasic, BS88136) and the size of the transcripts were confirmed using 1% denaturing agarose gel electrophoresis with Cyber Gold staining (Invitrogen, S11494). To generate biotin-labeled snoRNAs for pull down assays, an NTP labeling mixture containing biotin-UTP (10 mM each ATP, CTP, and GTP, 6.5 mM UTP, 3.5 mM biotin-UTP; Sigma, 11685597910) was used for in vitro transcription. In Vitro ADP-ribosylation of PARP-1 by snoRNAs Fifty nanograms of purified FLAG epitope-tagged recombinant PARP-1 protein was incubated with 200 nM of in vitro transcribed snoRNA in ADP-ribosylation Buffer (50 mM Tris-HCl pH 7.5, 12.5 mM MgCl2, 125 mM NaCl) with 10 mM NAD+ at room temperature for 15 minutes. The ADP-ribosylation reactions were stopped by the addition of 4x SDS-PAGE loading buffer followed by heating to 100 C for 10 minutes. In Vitro ADP-ribosylation of DDX21 by DNA-Activated PARP-1 Fifty nanograms of purified FLAG epitope-tagged recombinant PARP-1 protein was incubated with 700 ng of purified recombinant WT or mutant DDX21 in ADP-ribosylation Buffer [50 mM Tris pH 7.5, 12.5 mM MgCl2, 125 mM NaCl, 30 ng/mL sonicated salmon sperm DNA (ThermoFisher Scientific, AM9680)] with 5 mM NAD+ at room temperature for 15 minutes. The ADP-ribosylation reactions were stopped by the addition of 4x SDS-PAGE loading buffer followed by heating to 100 C for 10 minutes. To monitor PARP-1 automodification and DDX21 ADP-ribosylation, aliquots of the reactions were resolved on an 8% PAGE-SDS gel, transferred to a nitrocellulose membrane, and blotted with an ADP-ribose detection reagent (MABE1016, EMD Millipore). In Vitro ADP-ribosylation of DDX21 by snoRNA-Activated PARP-1 Fifty nanograms of purified FLAG epitope- tagged recombinant PARP-1 protein was incubated with 700 ng of purified recombinant DDX21 in ADP-ribosylation Buffer (50 mM Tris-HCl, pH 7.5, 12.5 mM MgCl2, 125 mM NaCl, 10 mM NAD+) with 200 nM of folded snoRNA at room temperature for 15 minutes. The ADP-ribosylation reactions were stopped and subjected to western blot analyses as described above. RNA Electrophoretic Mobility Shift Assays (RNA EMSAs) RNA EMSAs were performed as previously described (Kung et al., 2015), with minor modifications as described below. In vitro transcribed snoRNAs were 50 end labeled with [g-32P] ATP (1 mCi; PerkinElmer, NEG035C001MC) and T4 polynucleotide kinase (NEB, M0201S) according to the manufacturer’s instructions and then pre-folded in Folding Buffer (10 mM Tris-HCl pH 7.4, 100 mM NaCl, 1 mM EDTA) by incubating for 2 minutes at 95 C, 5 minutes at 50 C, 15 minutes at 37 C, and 15 minutes at room temperature. After incubation, 50 mM KCl and 10 mM MgCl2 were added, and the RNA was incubated on ice for 10 minutes and stored on ice until used. Recombinant proteins of interest (e.g., PARP-1, DDX21) were incubated with folded 50 end labeled RNA (10 nM) in Binding Buffer I [50 mM Tris-HCl pH 7.5, 100 mM KCl, 50 mM NaCl, 0.1% NP-40, 10 mM MgCl2, 1 mg/mL yeast tRNA (ThermoFisher Scientific, AM7119), 1 mg/mL BSA, 5% glycerol, 5 mM DTT, SUPERaseIn]. The samples were mixed gently, incubated for 15 minutes at room temperature, and subjected to polyacrylamide gel analysis as described below. PARP-1 automodification concurrent with snoRNA binding One hundred nM of recombinant PARP-1 was incubated with or without 50-250 mM of NAD+ in the presence of 10 nM of 32P- labeled snoRNA in PARylation/EMSA Buffer (50 mM Tris-HCl pH 7.5, 100 mM KCl, 50 mM NaCl, 5 mM MgCl2, 1.5 mg/ml BSA, 5% glycerol,

Molecular Cell 75, 1–16.e1–e14, September 19, 2019 e9

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

5 mM DTT, 1 mg/ml yeast tRNA, 5 U SUPERaseIn). After 15 minutes of incubation at room temperature, the samples were run on a 6% PAGE gel in 1x TBE buffer for 60 minutes at 100 V at 4 C. The gel was dried and subjected to phosphorimager analysis. DDX21 ADP-ribosylation prior to snoRNA binding One hundred nM of recombinant DDX21 was pre-incubated with 10 nM of recombinant PARP-1 in Binding Buffer II (50 mM Tris-HCl pH 7.5, 100 mM KCl, 50 mM NaCl, 0.1% NP-40, 10 mM MgCl2) with or without 30 ng/mL sonicated salmon sperm DNA and 25 mM NAD+ for 15 minutes at room temperature to stimulate DDX21 ADP-ribosylation. After incubation, 1 mg/mL yeast tRNA, 1 mg/mL BSA, 5% glycerol, 5 mM DTT, SUPERaseIn, and 10 nM of 32P- labeled snoRNA were added to the reactions. After an additional 15 minute incubation at room temperature, the samples were run on a 6% PAGE gel in 1x TBE buffer for 60 minutes at 100 V at 4 C. The gel was dried and subjected to phosphorimager analysis. Purification of DDX21 followed by snoRNA binding Fifty nM of WT or mutant DDX21, purified from 293T cells in the presence of PARG inhibitor (APD-HPD), were incubated in PARylation/EMSA Buffer (50 mM Tris-HCl pH 7.5, 100 mM KCl, 50 mM NaCl, 5 mM MgCl2, 1.5 mg/ml BSA, 5% glycerol, 5 mM DTT, 1 mg/ml yeast tRNA, 5 U SUPERaseIn) with or without 25 mM of NAD+ in the presence of 10 nM of 32P- labeled snoRNA. The reactions were incubated for 30 minutes at room temperature and run on a 5% acrylamide/Tris-Glycine gel for 1 hour at 4 C, which was then dried and subjected phosphorimager analysis. Competition with unlabeled snoRNAs For competition experiments, a 40-fold excess of unlabeled snoRNA was added before adding 32P-labeled snoRNA. In Vitro RNA Pull Down Assays snoRNAs were transcribed and labeled with biotin in vitro, and then folded, as described above. Recombinant PARP-1 (0.2 mg) was incubated with 5 nM of folded RNA in Binding Buffer (20 mM HEPES pH 7.9, 150 mM NaCl, 50 mM KCl, 10 mM MgCl2, 0.2 mM ZnCl2, 0.1% BSA, 0.2% NP-40, 5% glycerol, 15 mM b-mercaptoethanol, 0.2 mg/mL yeast tRNA, 1 mg/mL BSA, 100 U/mL SUPERaseIn) at room temperature for 1 hour, followed by incubation with equilibrated Streptavidin-agarose beads (ThermoFisher Scientific, 20377) at room temperature for 30 minutes. The beads containing the protein-RNA complex were washed four times in Binding Buffer containing an additional 200 mM of NaCl. The reactions were stopped by the addition of 4x SDS-PAGE Loading Buffer, followed by heating to 100 C for 10 minutes. In order to detect RNA-bound PARP-1, the samples were resolved on an 8% PAGE-SDS gel, transferred to a nitrocellulose membrane, and blotted with an antibody against PARP-1. Detection of DDX21 ADP-ribosylation by Immunoprecipitation from 293T Cells A pcDNA3-based plasmid encoding an expression cassette for an N-terminal FLAG epitope-tagged WT-DDX21 or an alaninesubstituted MutA-DDX21 were transfected into 293T cells using Lipofectamine LTX Reagent (Invitrogen, 15338500) or LipofectamineTM 3000 Reagent according to the manufacturer’s instructions. Forty-eight hours post-transfection, the cells were collected in ice-cold PBS and pelleted by centrifugation. The cells were then resuspended in ice-cold Isotonic Buffer (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, and 0.3 M Sucrose) for 15 minutes on ice to allow swelling. The nuclei were released from the cells by addition of NP-40 to 0.65% v/v, followed by vortexing for 10 s and immediate collection by centrifugation. The supernatant was removed and proteins were extracted from the nuclei by resuspension on ice for 30 minutes in Extraction Buffer (20 mM HEPES pH 7.9, 1.5 mM MgCl2, 0.42 M NaCl, 0.2 mM EDTA, 1% NP-40, 25% glycerol, 1 mM DTT, 1x protease inhibitor cocktail, 5 U SUPERaseIn, 250 nM APD-HPD) with occasional mixing to lyse the nuclei. The nuclear extract was clarified by centrifugation at maximum speed at 4 C in a microcentrifuge and diluted 1:1 with Dilution Buffer (20 mM HEPES, pH 7.9, 1.5 mM MgCl2, 0.2 mM EDTA, 1% NP-40, 1 mM DTT, 1x protease inhibitor cocktail, 5 U SUPERaseIn, 250 nM APD-HPD) and pre-cleared by incubation with IgG for 30 minutes, followed by incubation with Protein A-agarose beads for 30 minutes at 4 C with gentle mixing. The precleared nuclear extract was collected by centrifugation; two percent of the pre-cleared nuclear extract was saved as input for western blotting, and the remaining extract was mixed with anti-FLAG M2 agarose resin and incubated for overnight at 4 C with gentle mixing. On the next day, the nuclear extract bound to the anti-FLAG M2 agarose resin was washed five times thoroughly with Washing Buffer (20 mM HEPES pH 7.9, 400 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 1% NP-40, 1 mM DTT, 1x protease inhibitor cocktail, 5 U SUPERaseIn, 25 nM APD-HPD). The resin was collected and mixed with 1.5x SDS-PAGE Loading Buffer, followed by heating to 100 C for 10 minutes. The samples were resolved on an 8% PAGE-SDS gel, transferred to a nitrocellulose membrane, and blotted with an ADP-ribose detection reagent or a DDX21 antibody. Detection of DDX21 and PARP-1 ADP-ribosylation by Immunoprecipitation from MCF-7 Cells after Treatment with PJ34 or RNase A Nuclear extraction from MCF-7 cells was performed as described above. The nuclear extract was diluted 1:1 with Dilution Buffer (20 mM HEPES pH 7.9, 1.5 mM MgCl2, 0.2 mM EDTA, 1% NP-40, 1 mM DTT, 1x protease inhibitor cocktail, 5 U SUPERaseIn, 250 nM APD-HPD). The nuclear extract was pre-cleared with IgG and Protein A-agarose beads as described above, mixed with anti-DDX21 or anti-PARP-1 antibody, and incubated at 4 C overnight with gentle mixing. In some cases, the diluted nuclear extract was pretreated with 0.1 mg/mL RNase A (ThermoFisher Scientific, EN0531) for 30 minutes prior to immunoprecipitation. The next day, equilibrated Protein A-agarose was added and incubated with the immunoprecipitated extract at 4 C for 2 hours, followed by five washes with High Salt Wash Buffer 400 (20 mM HEPES pH 7.9, 400 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 1% NP-40,

e10 Molecular Cell 75, 1–16.e1–e14, September 19, 2019

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

1 mM DTT, 1x protease inhibitor cocktail, 5 U SUPERaseIn, 25 nM APD-HPD). The Protein A-agarose resin was collected and mixed with 1.5x SDS-PAGE Loading Buffer, followed by heating to 100 C for 10 minutes. The samples were resolved on an 8% PAGE-SDS gel, transferred to a nitrocellulose membrane, and blotted with an ADP-ribose detection reagent (EMD Millipore, MABE1016) (Gibson et al., 2017). Detection of Endogenous PARP-1/DDX21 Interactions by Immunoprecipitation Nuclear extraction from MCF-7 cells (with or without PJ34 treatment) was performed as described above. The nuclear extract was diluted, pre-cleared, and treated ± RNase A as described above. The extract was mixed with anti-DDX21 or anti-PARP-1 antibody and incubated overnight at 4 C with gentle mixing. The next day, equilibrated Protein A-agarose in Buffer (20mM HEPES pH 7.9, 150 mM NaCl) was added and incubated at 4 C for 2 hours followed by five washes with Low Salt Wash Buffer 200 (20 mM HEPES pH 7.9, 200 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 1% NP-40, 1 mM DTT, 1x protease inhibitor cocktail, 5 U SUPERaseIn, 25 nM APD-HPD). The Protein A-agarose resin was collected and mixed with 1.5x SDS-PAGE Loading Buffer, followed by heating to 100 C for 10 minutes. The samples were resolved on an 8% PAGE-SDS gel, transferred to a nitrocellulose membrane, and blotted with antibodies against PARP-1 and DDX21. Detection of Associations between DDX21 and PARP-1-Catalyzed Poly (ADP-ribose) Thirty nM of purified FLAG epitope-tagged recombinant PARP-1 protein was incubated with 30 mL of anti-FLAG M2 agarose resin in Binding Buffer (20 mM HEPES pH 7.9, 250 mM NaCl, 2 mM MgCl2, 0.2 mM EDTA, 15% glycerol, 2 mM DTT, 0.1% NP-40, and 1x protease inhibitor cocktail) for 2.5 hours at 4 C with gentle mixing. The anti-FLAG M2 agarose resin was washed thoroughly with Binding Buffer to remove unbound recombinant PARP-1 protein. The anti-FLAG M2 agarose resin-PARP-1 protein complexes were resuspended in ADP-ribosylation Buffer [50 mM Tris pH 7.5, 12.5 mM MgCl2, 125 mM NaCl, 100 ng/mL sonicated salmon sperm DNA (or snoRNA)] and incubated in the presence of 100 mM NAD+ at room temperature for 10 minutes. For treatment with ARH3, the ADP-ribosylation reactions described above were stopped by the addition of 20 mM PJ34. Then 100 nM of purified recombinant GST or ARH3 protein was added to the reactions and incubated at room temperature for 30 minutes with gentle mixing. The ADP-ribosylation reactions were stopped by the addition of High Salt Wash Buffer 1000 (20 mM HEPES pH 7.9, 1 M NaCl, 2 mM MgCl2, 0.2 mM EDTA, 10% glycerol, 2 mM DTT, 0.1% NP-40, and 1x protease inhibitor cocktail), washed four times with High Salt Wash Buffer 1000, and then equilibrated in DDX21 Binding Buffer (20 mM HEPES pH 7.9, 150 mM NaCl, 2 mM MgCl2, 0.2 mM EDTA, 10% glycerol, 2 mM DTT, 0.5% NP-40, and 1x protease inhibitor cocktail). Thirty nM of purified recombinant DDX21 was added to the PARP-1-bound resin and incubated for 2 hours at 4 C with gentle mixing. The resin was then washed four times with High Salt Wash Buffer 300 (20 mM HEPES, pH 7.9, 300 mM NaCl, 2 mM MgCl2, 0.2 mM EDTA, 10% glycerol, 2 mM DTT, 0.1% NP-40, and 1x protease inhibitor cocktail). The anti-FLAG M2 agarose resin was collected and mixed with 1.5x SDS-PAGE Loading Buffer, followed by heating to 100 C for 10 minutes. The samples were resolved on an 8% PAGE-SDS gel, transferred to a nitrocellulose membrane, and blotted with antibodies against PARP-1 and DDX21, or an ADP-ribose detection reagent. Isolation of Poly(ADP-ribose) (PAR) and Dot Blot Assays One microgram of purified FLAG epitope-tagged recombinant PARP-1 protein was incubated in ADP-ribosylation Buffer (50 mM Tris pH 7.5, 12.5 mM MgCl2, 125 mM NaCl, 30 ng/mL sonicated salmon sperm DNA) in the presence of 100 mM NAD+ at room temperature for 30 minutes. The reaction was treated first with DNase I (Roche, 4716728001) for 30 minutes at 37 C, followed by proteinase K (Ambion, AM2542; with 0.5% SDS, 10 mM EDTA) for 2 hours at 55 C to remove the sonicated salmon sperm DNA and the PARP-1 protein, respectively. The PAR was then isolated by phenol:chloroform:isoamyl alcohol extraction (Sigma, P2069; 25:24:1). For the dot blot experiments, equivalent reaction amounts of unmodified recombinant PARP-1 protein or purified PAR were spotted onto a nitrocellulose membrane and dried for 15 minutes at room temperature. The membrane was then blocked in TBS-T Buffer 150 (Tris-HCl pH 7.5, 150 mM NaCl, 0.05% Tween) supplemented with 5% skim milk for 1 hour at room temperature, followed by incubation in TBS-T 150 Buffer containing 5 nM of recombinant DDX21. The membrane was washed five times in TBS-T Buffer 300 (Tris-HCl pH 7.5, 300 mM NaCl, 0.05% Tween) and blotted with ADP-ribose detection reagent (MABE1016, EMD Millipore), or antibodies against DDX21 or PARP-1. Alternatively, purified recombinant DDX21 was spotted onto a nitrocellulose membrane, dried, and incubated with the purified PAR fraction from ADP-ribosylation reactions performed with or without PJ34. The membrane was washed five times in TBS-T Buffer 300 and blotted with an ADP-ribose detection reagent (MABE1016, EMD Millipore). ERCC Spike-in RNA-seq Data Analysis HTSeq (Risso et al., 2014) and RUVSeq (Anders et al., 2015) packages in R were used to determine the gene expression normalized to the ERCC spike-in control. The expression of host genes with intronic snoRNAs, which were obtained by comparing our gene universe with a list of intronic snoRNA host genes (Li et al., 2010), was represented as boxplots. The normalized counts per million values were log transformed and represented as a heatmap using heatmap.2 function in the gplots R package function with scale parameter set to ‘none’.

Molecular Cell 75, 1–16.e1–e14, September 19, 2019 e11

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

Apoptosis Assays The analysis of Annexin-V staining was carried out using an Annexin V-FITC Apoptosis Detection Kit (Invitrogen, 88-8005) according to the manufacturer’s instructions. The cells were collected, washed twice with cold PBS, and centrifuged at 1500 rpm for 5 minutes. The cells were then resuspended in 1x binding buffer at a concentration of 1-5x106 cells per ml, 100 mL of the cell suspension was transferred to a 5 mL culture tube, and 2.5 mL of Annexin V-FITC were added. The cells were then gently vortexed and incubated for 15 minutes at room temperature in the dark. The cells were washed in 1x binding buffer and resuspended in 200 mL of 1x binding buffer. We then added 2.5 mL of propidium iodide stain, and the samples were analyzed by flow cytometry. For each sample, 20,000 ungated events were acquired. PI (-)/Annexin (+) cells represent the early apoptotic populations. Immunofluorescent Staining and Confocal Microscopy MCF-7 cells were seeded on four-well chambered coverslips (ThermoFisher Scientific, 155411) one day prior to treatment. The following day, cells were treated with PJ34 for 2 or 6 hours and actinomycin D (Sigma, 0.2 mg/mL) for 1 hour. The treated cells were washed three times with PBS, fixed in 3.7% paraformaldehyde for 15 minutes at room temperature, and washed with PBS0.1% Tween 20 (PBS-T 0.1%). The cells were permeabilized for 5 minutes using PBS-T 0.5%, washed three times with PBS-T 0.1%, and incubated for 1 hour at room temperature in Blocking Solution (10% calf serum, 0.5% gelatin in PBS), and then washed twice with PBS-T 0.1%. The fixed cells were incubated at room temperature with a polyclonal antibody against PARP-1 or NOP58 in Incubation Solution (PBS containing 1% BSA) for 2 hours at room temperature and washed four times with PBS-T 0.1%. The cells were then incubated with Alexa Fluor 488 goat anti-rabbit IgG (ThermoFisher Scientific, R37116) in Blocking Solution for 1 hour at room temperature. After incubation, the cells were washed four times with PBS-T 0.1% and incubated at room temperature with a mouse monoclonal antibody against DDX21 in Incubation Solution for 2 hours at room temperature, followed by four washes with PBS-T 0.1%. The cells were then incubated with Alexa Fluor 594 goat anti-mouse IgG (ThermoFisher Scientific, A-11005) in Blocking Solution (10% calf serum, 0.5% gelatin in PBS) for 1 hour, washed four times with PBS-T 0.1%, incubated at room temperature with 4,6-diamindino-2-phenylindole nuclear dye (ThermoFisher Scientific, D1306) in PBS for 5 minutes, and then washed four times with PBST 0.1%. Finally, the coverslips were treated with VectaShield (Vector Laboratories, H-1000) and images were acquired using an inverted Zeiss LSM 780 confocal microscope. Chromatin Immunoprecipitation-qPCR (ChIP-qPCR) at the rDNA Locus ChIP-qPCR assays were performed as described previously (Luo et al., 2017). MCF-7 cells were cross-linked with 1% formaldehyde in PBS for 10 minutes at 37 C, quenched by the addition of 125 mM glycine, and incubated 5 minutes at 4 C. The cross-linked cells were collected in ice-cold PBS and pelleted by centrifugation. The cells were then resuspended by gentle mixing by pipetting in icecold Farnham Lysis Buffer (5 mM PIPES pH 8.0, 85 mM KCl, 0.5% NP-40) with freshly added 1 mM DTT and 1x protease inhibitor cocktail. The supernatant was removed, and the crude nuclear pellet was collected by centrifugation and resuspended in SDS Lysis Buffer (50 mM Tris-HCl pH 7.9, 1% SDS, 10 mM EDTA) with freshly added 1 mM DTT and 1x protease inhibitor cocktail. After a 10 minute incubation on ice, the lysate was sheared by sonication using a Bioruptor (Diagenode) to generate chromatin fragments of 250 bp in length. The sheared chromatin was clarified by centrifugation and then diluted ten-fold in ChIP Dilution Buffer (20 mM Tris-HCl pH 7.9, 0.5% Triton X-100, 2 mM EDTA, 150 mM NaCl) with freshly added 1 mM DTT and 1x protease inhibitor cocktail. The lysate was pre-cleared with equilibrated protein A-agarose beads and subjected to immunoprecipitation reactions with antibodies against DDX21 or rabbit IgG at 4 C overnight. The immunoprecipitates were collected by incubation with BSA-blocked protein A-agarose beads for 2 hours at 4 C with gentle mixing. After incubation, the beads were washed on ice once each with (1) Low Salt Wash Buffer (20 mM Tris-HCl pH 7.9, 2 mM EDTA, 125 mM NaCl, 0.05% SDS, 1% Triton X-100, 1 mM aprotinin, and 1 mM leupeptin), (2) High Salt Wash Buffer (20 mM Tris-HCl pH 7.9, 2 mM EDTA, 500 mM NaCl, 0.05% SDS, 1% Triton X-100, 1 mM aprotinin, and 1 mM leupeptin), (3) LiCl Wash Buffer (10 mM Tris-HCl pH 7.9, 1 mM EDTA, 250 mM LiCl, 1% NP-40, 1% sodium deoxycholate, 1 mM aprotinin, and 1 mM leupeptin), and (4) 1x Tris-EDTA (TE). The beads were then subjected to a final wash with 1x TE at room temperature. They were then collected by centrifugation, resuspended in ChIP Elution Buffer (100 mM NaHCO3, 1% SDS), and incubated on end-over-end rotator for 15 minutes at room temperature to elute the ChIPed DNA. The ChIPed DNA was de-crosslinked and cleared of protein and RNA by adding proteinase K and RNase H, and incubating overnight at 65 C. The ChIPed DNA was then extracted with phenol:chloroform:isoamyl alcohol (25:24:1), collected by ethanol precipitation, and analyzed by quantitative PCR using the rDNA-specific primers listed below (Calo et al., 2015). For the analysis, the ChIPed DNA was normalized to the input fraction. ChIP-qPCR primers rDNA 1kb forward: 50 -GGCGGTTTGAGTGAGACGAGA-30 rDNA 1kb reverse: 50 -ACGTGCGCTCACCGAGAGCAG-30 rDNA 4kb forward: 50 -CGACGACCCATTCGAACGTCT-30 rDNA 4kb reverse: 50 -CTCTCCGGAATCGAACCCTGA-30 rDNA 8kb forward: 50 -AGTCGGGTTGCTTGGGAATGC-30 rDNA 8kb reverse: 50 -CCCTTACGGTACTTGTTGACT-30 rDNA 13kb forward: 50 -ACCTGGCGCTAAACCATTCGT-30 rDNA 13kb reverse: 50 -GGACAAACCCTTGTGTCGAGG-30

e12 Molecular Cell 75, 1–16.e1–e14, September 19, 2019

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

rDNA 18kb forward: 50 -GTTGACGTACAGGGTGGACTG-30 rDNA 18kb reverse: 50 -GGAAGTTGTCTTCACGCCTGA-30 rDNA 27kb forward: 50 -CCTTCCACGAGAGTGAGAAGCG-30 rDNA 27kb reverse: 50 -CTCGACCTCCCGAAATCGTACA-30 rDNA 32kb forward: 50 -GGAGTGCGATGGTGTGATCT-30 rDNA 32kb reverse: 50 -TAAAGATTAGCTGGGCGTGG-30 rDNA 42kb forward: 50 -GCTTCTCGACTCACGGTTTC-30 rDNA 42kb reverse: 50 -CCGAGAGCACGATCTCAAA-30 rDNA 42.9kb forward: 50 -CCCGGGGGAGGTATATCTTT-30 rDNA 42.9kb reverse: 50 -CCAACCTCTCCGACGACA-30

CMCT Modification-based Pseudouridylation Assays CMCT [1-cyclohexyl-3-(2-(4-morpholinyl)ethyl) carbodiimide tosylate) modification was performed as previously described (Rocchi et al., 2014), with the modifications below. Total RNA isolated from PARP inhibitors (PJ34 and Olaparib)-treated or siRNA PARP-1treated MCF-7 cells were incubated with 200 nM of CMCT in BEU Buffer (7 M urea, 4 mM EDTA, 50 mM bicine pH 8.5). The reactions were incubated for 20 minutes at 37 C and the RNA was precipitated with GlycoBlue (Ambion, AM9515), washed with 75% ethanol, and dried. The pellets were re-suspended in sodium carbonate buffer (pH 10.4) and incubated at 37 C for 4 h. The resulting RNA was precipitated with GlycoBlue again, washed with 75% ethanol, dried, and resuspended in DEPC-treated water. For qPCR, the CMCTmodified RNA was reverse transcribed using MMLV Reverse Transcriptase and reverse primers specifically targeting 18S or 28S rRNA, listed below, using 5 minutes at 4 C, 60 minutes at 37 C, and 15 minutes at 70 C to generate cDNA, with subsequent storage at 4 C. The generated cDNA was analyzed by quantitative real-time PCR (qPCR) using gene-specific primers for 18S or 28S rRNA, listed below. The reaction was normalized to the CP value of a known non-pseudouridylated region of the 18S or 28S rRNA. qPCR primers 18S reverse: 50 -GCCCGAGGTTATCTAGAGTCACCAAAGCCG-30 28S reverse: 50 -CTGATGAGCGTCGGCATCGGGCGCCTTAAC-30 18S forward: 50 -TGAGTACGCACGGCCGGTACAGTGAAA-30 28S forward: 50 -AGAGGTCTTGGGGCCGAAACGATCTCAACC-30 18S positive control forward: 50 -ATCAGATCAAAACCAACCCGGTC-30 28S positive control forward: 50 -GGTAAGCAGAACTGGCGCT-30

Monitoring Nuclear rRNA Abundance Nuclei were isolated from MCF-7 cells as described above (see Preparation of Nuclear Extracts, above). The isolated nuclei were washed two times with ice-cold Isotonic Buffer (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.3 M sucrose, 1x complete protease inhibitor cocktail, and 10 U SUPERaseIn) to completely remove cytosolic fraction. The nuclei then were resuspended in 1 mL of Nuclei Buffer (50 mM Tris-HCl pH 7.9, 5 mM MgCl2, 10% glycerol, 0.1 mM EDTA, 20 U SUPERaseIn) and collected by centrifugation. The nuclei were resuspended in 1 mL of Nuclei Buffer again and counted using a hemocytometer. Total nuclear RNA was extracted from 1.0 to 1.5 million nuclei from each condition using the EZ-10 DNAaway RNA Kit. The total amount of the two major rRNAs (18S and 28S) were analyzed using an Agilent RNA ScreenTape System (Agilent Technologies) following the manufacturer’s protocol. Ribosome Fractionation Ribosomal fractions were isolated from cells as previously described (Belin et al., 2010). Briefly, MCF-7 cells were plated into 150 cm dishes at a density of 90% a day prior to the assay. The cells were treated with the inidcated PARP inhibitors for 3 hours, washed three times with ice cold PBS, and scraped gently into 1.5 mL Buffer A (250 mM sucrose, 250 mM KCl, 5 mM MgCl2, 50 m M Tris-HCl, pH 7.5 and supplemented with 1x protease inhibitor, PMSF, NaF, Na3Vo4, b-glycerophosphate, ADP-HPD and PJ34). IGEPAL-30 was added to a final concentration of 0.7% (v/v) and incubated on ice for 15 minutes with frequent mixing. Five percent of the lysate was separated and stored for input or whole cell extract. The remaining lysates were centrifuged at 750 RCF for 10 minutes and the supernatant was centrifuged again at 12,500 RCF to remove nuclear proteins. The protein concentration of the lysates was equilibrated using Buffer A and the KCl levels were adjusted to 500 mM with 3 M KCl. The lysates were loaded onto 2.5 mL of sucrose cushion (1 M sucrose, 0.5 M KCl, 5 mM MgCl2, 50 mM Tris-HCl pH 7.5) in polypropylene tubes (Beckman Coulter, 328874). The tubes were centrifuged for 4 hours at 45,000 rpm in a Beckman coulter ultracentrifuge (Optima L-80 XP) using a SW60Ti rotor. After the spin, the ribosomal pellet was resuspended in Buffer C (25 mM KCl, 5 mM MgCl2, 50 mM Tris-HCl pH 7.5 supplemented with 1x protease inhibitor, PMSF, NaF, Na3Vo4, b-glycerophosphate and ADP-HPD). Monitoring Translation by Puromycin Incorporation Translation monitoring was performed as previously described (Schmidt et al., 2009). Briefly, MCF-7 cells treated with PJ34 or Niraparib, or engineered MCF-7 cell induced by doxycycline treatment for 72 hours, were labeled with puromycin for 15 minutes. Whole

Molecular Cell 75, 1–16.e1–e14, September 19, 2019 e13

Please cite this article in press as: Kim et al., Activation of PARP-1 by snoRNAs Controls Ribosome Biogenesis and Cell Growth via the RNA Helicase DDX21, Molecular Cell (2019), https://doi.org/10.1016/j.molcel.2019.06.020

cell extracts were prepared from same number of cells in each condition, as described (Schmidt et al., 2009). Puromycin incorporation was visualized by western blotting with an antibody against puromycin. Mining Public Databases To determine the expression of snoRNAs and other genes of interest (ribosome-related genes, PARP-1, DDX21 and RPL26L1), we used publicly available resources, such as SNORic (Gong et al., 2017) and normalized gene expression matrix (data record 3) (Wang et al., 2018). The snoRNA expression matrix in breast invasive carcinoma was downloaded from SNORic (Gong et al., 2017) and the samples were segregated into tumor (n = 1077) and normal (n = 104) based on the sample ID. A threshold of RPKM > 0 in either normal or tumor samples was applied to obtain a refined set of 1278 snoRNAs whose expression was log transformed and plotted as boxplot. Further, we downloaded the data record 3 (Wang et al., 2018) to access normalized gene expression levels from GTEx and TCGA databases. We extracted the expression of PARP-1, DDX21, RPL26L1 and custom ribosome-related gene universe (as described below) from the above matrix and log transformed FPKM values were plotted as boxplots. The custom ribosome-related gene set was curated from MSigDB (Molecular Signatures Database) (Subramanian et al., 2005) by querying the database with the keyword ‘‘ribosome.’’ The gene sets from GO_Ribosome, GO_Ribosome_Assembly, GO_Ribosome_Biogenesis, KEGG_Ribosome were combined, and duplicate genes were removed to form a custom gene universe with 429 ribosome related genes. This list was further refined to identify the genes whose expression is at least 1.5-fold higher in TCGA tumor samples compared to TCGA normal and the fragments per kilo base million (FPKM) values were log transformed to be plotted as boxplots using the boxplot function in R. Histology and Immunostaining Xenograft tissues were processed for paraffin sectioning using standard protocols. A breast disease spectrum tissue microarray was purchased from US Biomax (Cat. no. BR2082b). Immunohistochemical staining was performed on a Dako Autostainer Link 48 system. Briefly, 5 mm paraffin sections were baked for 20 minutes at 60 C, then deparaffinized and hydrated before the antigen retrieval step. Heat-induced antigen retrieval was performed at pH 9 (FLAG) or pH 6 (PARP-1, DDX21, RPL26) for 20 minutes in a Dako PT Link. The tissue was incubated with a peroxidase block and then an antibody incubation (1:12000 FLAG, 1:1000 PARP-1, 1:100 DDX21 and RPL26) for 20 minutes. The staining was visualized using the EnVision FLEX visualization system. The intensity of staining for each antibody was scored on a scale of 0-3, where 3 is the highest intensity (expression). Scores were used to generate correlation plots using the Pearson correlation method of the pairs.panels function from psych package (Revelle, 2018) in R with jiggle argument set to ‘on’ and other default parameters. For immunofluorescence staining, 5 mm paraffin sections were deparaffinized in xylene and ethanol, followed by boiling in antigen retrieval solution (10 mM Na3C6H5O7 pH 6.0). Slides were blocked in blocking solution (5% bovine serum albumin, 0.4% Triton X-100, 0.2% Tween-20 in PBS) and incubated with primary antibody [H2A.X (Ser139) (1:1000)] diluted in blocking buffer for 1 hour at room temperature. The samples were then incubated with secondary antibody labeled with Alexa Fluor 488 (Thermo-Fisher) diluted in blocking buffer for 1 hour. The slides were mounted with VECTASHIELD mounting medium with DAPI (Vector Labs). Immunofluorescence staining was imaged using a Zeiss LSM880 confocal microscope, purchased with a shared instrumentation grant from the NIH (1S10OD021684-01 to Katherine Luby-Phelps). QUANTIFICATION AND STATISTICAL ANALYSIS All sequencing-based genomic experiments were performed a minimum of two times with independent biological samples. Statistical analyses for the genomic experiments were performed using standard genomic statistical tests as described above. All gene specific qPCR-based experiments were performed a minimum of three times with independent biological samples. Statistical analyses for the qPCR-based experiments was performed using GraphPad Prism 7. All tests and p values are provided in the corresponding figures or figure legends. DATA AND CODE AVAILABILITY Genomic Datasets The RNA-seq and RIP-seq datasets generated specifically for this study can be accessed from the NCBI’s Gene Expression Omnibus (GEO) repository (http://www.ncbi.nlm.nih.gov/geo/) using the superseries accession number GEO:GSE115761 (subseries GEO:GSE115760 and GEO:GSE115759), as well as the individual accession numbers listed in the Key Resources Table. Custom Scripts Custom R scripts for genomic data analyses are available from the Lead Contact on request.

e14 Molecular Cell 75, 1–16.e1–e14, September 19, 2019