Activation of rat androgen receptor by androgenic ligands is unaffected by antiandrogens in Saccharomyces cerevisiae

Gene 209 (1998) 247–254

Activation of rat androgen receptor by androgenic ligands is unaffected by antiandrogens in Saccharomyces cerevisiae Seema Rana, Deepa Bisht, Pradip K. Chakraborti * Institute of Microbial Technology, Sector 39A, Chandigarh, 160 036, India Received 17 October 1997; received in revised form 9 January 1998; accepted 15 January 1998; Received by A. Bernardi

Abstract The E. coli lacZ has been utilized as a reporter to evaluate ligand-mediated activation of the rat androgen receptor (AR) in Saccharomyces cerevisiae strain YCR1. b-galactosidase activity was androgen-specific and was found to be inducible ~260-fold by dihydrotestosterone (DHT ), testosterone and R1881. None of the antiandrogens tested was able to antagonize the DHTdependent induction of b-galactosidase activity. In the gel retardation assay, exposure of the receptor to DHT in vitro led to the formation of a protein–DNA complex that was not detected in yeast extracts unexposed to hormone. However, activation of AR by a steroidal (cyproterone acetate) and a non-steroidal antiandrogen (flutamide) either alone or in combination with DHT also results in a similar migration pattern. Additionally, LEM1, the ABC transporter that selectively modulates the biological potency of steroids in yeast, although operative in YCR1, was not responsible for antiandrogen resistance. These results thus indicate the involvement of other non-receptor factor(s) in mediating the effect of antiandrogens in yeast. © 1998 Elsevier Science B.V. Keywords: Recombinant DNA; Dihydrotestosterone; Gene expression; Transcription factors; Steroid hormone; Agonist; Antagonist

1. Introduction Androgens are the key sex steroids of the male reproductive system in mammals and are involved in a wide variety of physiological functions, like growth, development, differentiation and reproduction (Mooradian et al., 1987). Therefore, androgens are used in different clinical situations, and at present, the possibility of using them to combat wasting in patients with AIDS as well as in other chronic diseases including cancer is being investigated (Holzman, 1996). Androgen action in target cells is mediated by high-affinity intracellular receptors that act directly in altering cellular gene expression. * Corresponding author. Tel: +91 172 690 004; Fax: +91 172 690 632; e-mail: [email protected] Abbreviations: ABC transporter, ATP binding cassette transporter; AR, androgen receptor; CA, cyproterone acetate; CAIS, complete androgen insensitivity syndrome; CsA, cyclosporin A; CYC1, cytochrome c1; Dex, dexamethasone; DHT, dihydrotestosterone; DOC, deoxycorticosterone; GR, glucocorticoid receptor; GRE, glucocorticoid response element; lacZ, b-galactosidase gene; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; SDS, sodium dodecyl sulphate; SRE, steroid response element; Trp, tryptophan; Ura, uracil; X-gal, 5-bromo-4-chloro-3-indolyl b-galactoside. 0378-1119/98/$19.00 © 1998 Elsevier Science B.V. All rights reserved. PII S 03 7 8 -1 1 1 9 ( 9 8 ) 0 0 0 54 - 7

Androgen receptors (AR) are grouped under steroidthyroid hormone super family of ligand modulated DNA-binding proteins that regulate transcription by binding as homodimer to specific upstream DNA sequences in the target genes ( Tsai and O’Malley, 1994), known as steroid response element (SRE). It has been observed that the steroids with core structures of nonaromatic A rings (androgens, progesterones, mineralocorticoids and glucocorticoids) recognize the same upstream cis-acting SREs, but their specificity for hormone dependent transcriptional activation depends on the ligand binding domain of the receptor ( Tsai and O’Malley, 1994). Thus, the regulation of a particular gene depends on the interaction of these DNA bound receptors with the transcriptional machinery in a manner that can be modified by coactivators, repressors and modulators (Simons, 1996). The conformation of the receptor homodimer bound to SRE is influenced by the nature of the ligand and is important for transactivation. As a result, a gene is induced or repressed by agonistic steroid, while antisteroids inhibit the biological effect of agonists. Like agonists, antagonists also have important clinical applications ( Tonetti and Jordan, 1996). Structurally, antiandrogens can be either steroidal or

248

S. Rana et al. / Gene 209 (1998) 247–254

non-steroidal, but their antagonistic activity has been reported to be exerted by inhibiting binding of agonist to the receptor ( Kemppainen et al., 1992). Alternatively, antagonists may also act to prevent ligand-induced transactivational activity ( Truss and Beato, 1993). The functional analysis with respect to different structural alterations in androgen receptors has been carried out by cotransfecting a receptor along with a reporter gene containing repeats of SREs at the 5∞ end of the promoter in mammalian cells devoid of endogenous receptor and subsequently monitoring the hormone inducible reporter activity (Chakraborti et al., 1991). Moreover, these expression systems are not limited to mammalian cells only, but have also been extended to non-mammalian hosts (Chang et al., 1992; Wong et al., 1993), and amongst them, yeast, Saccharomyces cerevisiae, has been widely used (Purvis et al., 1991; Mak et al., 1994; Doesburg et al., 1997; Gaido et al., 1997). Such a heterologous system truly reflects the biological activity of the receptor since it lacks an endogenous steroid receptor gene (Picard et al., 1991). Therefore, it can be effectively utilized as a tool for high-throughput screening of synthetic and natural androgen agonists and antagonists for their pharmacological use. However, to date, the mechanism of androgen antagonist action has not been evaluated with the yeast-expressed AR. This is particularly important for the effective utilization of such a system. In this communication, we report that yeast-expressed rat androgen receptor is not an exception from other steroid receptors (Zysk et al., 1995; Shiau et al., 1996) in exhibiting antisteroid resistance. Several postulations have been put forward for antagonist resistance, including cell permeability (Zysk et al., 1995) as well as efflux of selective ligands through LEM1 like ABC transporters ( Kralli et al., 1995; Kralli and Yamamoto, 1996) and the absence of cell-specific factors (Shiau et al., 1996) in yeast. We present here evidence for antiandrogen (both steroidal and non-steroidal )-dependent activation and subsequent DNA-binding of the yeastexpressed rat AR. The electrophoretic mobility of rat AR–SRE complexes was unaffected by the nature of the ligands used, suggesting that antiandrogens neither inhibit binding of receptor to SRE in vitro, nor result in anomalous protein–DNA complexes. Furthermore, antisteroids tested in our system did not show any evidence for ligand efflux. Our results therefore argue that non-receptor factor(s) are involved in modulation of receptor interactions and for manifestation of antagonistic behaviour of antiandrogens in yeast.

2. Materials and methods 2.1. Plasmid construction and yeast strain The 2m sequence of plasmid pSX26.1 (Schena and Yamamoto, 1988) was removed by EcoRI digestion.

The resulting ~7-kb fragment was gel-purified (Geneclean Bio 101, USA) and self-ligated to produce pCR4. Integrating vector pCR4 containing GRE-CYC1lacZ cassette was linearized at the unique StuI site present in its URA3 coding sequence. Upon transformation into the protease deficient yeast strain BJ5460, it integrated at the defective ura3–52 locus by homologous recombination. Transformants exhibiting uracil prototrophy were selected, and integration was further confirmed by Southern hybridization using the bgalactosidase (832-bp BamHI–ClaI fragment) and the ura3 (456-bp PstI–StuI fragment) as probes (results not shown). The integrated strain designated as YCR1 has been used for the functional assays, described in this study. Plasmid pGAR expressing the rat AR was constructed by subcloning the 2.8-kb EcoRI/PstI fragment of rat AR cDNA into the BamHI site of pG1 yeast expression vector, via an intermediate subcloning step. Basic methods for yeast manipulations were carried out as described by Rose et al. (1990). Liquid selection medium (SD medium) contains 0.67% yeast nitrogen base (Difco), 2% dextrose, and required supplements except for the relevant marker (SD -ura, SD -ura -trp) for prototrophic selection of appropriate plasmids. The transformation of plasmids pGAR or pGN795 (containing rat glucocorticoid receptor) into yeast was as described earlier (Schiestl et al., 1993). Restriction enzymes and other molecular biological reagents were procured from either New England Biolabs or Promega Corporation, USA. 2.2. Site-directed mutagenesis PCR was employed to generate two point mutants, R757C and R814Q, in the hormone binding domain of rat AR. Three forward primers, A (5∞ GTGGGCCAAGGCCTT 3∞), C1 (5∞ AATGAGTATTGCATGCAC 3∞), C2 (5∞ GATGAACTT CAAATGAACTACATC 3∞) and three reverse primers, B1 (5∞ GTGCATGCAATACTCATT 3∞), B2 (5∞ TAGTTCATTTGAAGTTCATCA 3∞), D (5∞ ACGCTCACCATATGGGACT 3∞), were synthesized (Ransom Hills, USA). Base mismatches (underlined bases) for the desired mutations were incorporated into primers B1, C1, B2 and C2. StuI and NdeI sites were incorporated into Primers A and D, respectively. To generate each mutant, two sets of primary and one set of secondary PCR reactions have been carried out following a method described elsewhere ( Ho et al., 1989) using the gel-purified 1.2-kb HindIII–PstI fragment of rat AR as a template. The following primer pair combinations were used for primary PCR reactions: A/B1 or C1/D for R757C; A/B2 or C2/D for R814Q. Secondary PCR was carried out with the flanking primers A and D. Thus, R757C and R814Q mutations were contained within the amplified 494-bp StuI–NdeI fragment of the rat AR. PCR products were klenowed,

S. Rana et al. / Gene 209 (1998) 247–254

kinased and concatamerized. The resulting multimers were digested with StuI and NdeI, and the 494-bp StuI–NdeI fragment bearing the mutations was then substituted for the corresponding wild-type fragment in the 2.8-kb rat AR backbone. Mutations were confirmed by sequencing (Sequenase, version 2.0 kit, Amersham). 2.3. b-Galactosidase assay Yeast cultures were grown to a log phase at 30°C in appropriate selection medium (SD -ura, SD -ura -trp). Cells (~5×106/ml ) were subcultured in fresh selection medium, treated with steroids (procured from Sigma Chemical Company, St. Louis, MO) in ethanol or ethanol alone (vehicle) as indicated in the figure legends, and grown for an additional 10 h. b-Galactosidase enzyme activity was assayed as described previously (Miller, 1992) and is expressed in Miller units. Plate assays have been carried out following the method of Wrenn and Katzenellenbogen (1993). Yeast extracts, where used, were prepared as described elsewhere (Mak et al., 1994). Qualitative b-galactosidase expression at the protein level when necessary has been monitored by Western blotting (10% SDS–PAGE resolved yeast extracts; total protein loaded~80 mg/gel slot) using antib-galactosidase monoclonal and anti-mouse IgG-horseradish peroxidase conjugated antibodies (both procured from Promega Corporation, USA) following the method described elsewhere (Chakraborti et al., 1991). Receptor expression was monitored using anti-AR antibody, a gift from Dr A. Caplan, Mount Sinai Medical Center, New York. Cyclosporin A (CsA) was a gift from Panacea Biotec, New Delhi, India. Cyclosporin concentrations used in our experimental conditions were not inhibitory to cell growth. 2.4. Electrophoretic gel mobility shift assay Unless mentioned otherwise, all operations were carried out at 4°C. Yeast lysate were prepared by disrupting cells (OD at harvesting=1.0) with glass beads in a 600 Dounce homogenizer under CO in HEDG buffer 2 (20 mM HEPES, pH 7.9, containing 0.5 mM dithiothreitol, 0.2 mM EDTA, 30 mM KCl, 20% glycerol and protease inhibitor cocktail; cell wet weight/volume= ~1 g/5 ml ) supplemented with androgen agonist (DHT ) and/or antagonists (cyproterone acetate and flutamide) or vehicle (1% ethanol ) followed by lowspeed centrifugation (~16 000×g for 30 min). The supernatants were then concentrated by 45% ammonium sulphate precipitation, the pellets obtained were dissolved in the same buffer (protein concentration= 1 mg/ml ), and 5 mg of protein were used for gel retardation assays. The lysate was incubated with varied concentrations of different androgens/antiandrogens or vehicle (see figure legend) for 2 h at 0°C. The DNA

249

binding reaction was performed at 23°C by incubating steroid bound lysates (15 ml ) with [c32P]ATP (BARC, India) labelled-androgen/glucocorticoid response element (ARE/GRE, double-stranded oligonucleotide, 5∞ TCGACTGTACAGGATGTTCTAGCTACT 3∞), poly dA–dT (2 mg) and bovine serum albumin (80 mg) for 15 min. The samples were then resolved in 5% native polyacrylamide gel electrophoresis (80 V ) using 0.5× TBE buffer (45 mM Tris, 45 mM boric acid and 0.1 mM EDTA, pH 8.4) followed by gel-drying and autoradiography.

3. Results and discussion 3.1. Androgen-inducible heterologous expression system The yeast-based steroid receptor expression system has been shown to recapitulate the regulatory machinery that controls androgen-dependent transcriptional activation of a gene ( Tsai and O’Malley, 1994). Such a genetic screen is ideal and advantageous for receptor structure–function studies as it is without any endogenous background (Picard et al., 1991), and a similar approach has already been described with human and mouse AR deletion mutants (Purvis et al., 1991; Mak et al., 1994; Caplan et al., 1995). To validate our system with the rat AR, we tested the activities of two point mutants ( R757C and R814Q) whose transactivational properties are well characterized in mammalian cells. In human AR, similar substitutions at the corresponding amino acids (positions 774 and 831) have been reported to be defective in both steroid binding as well as transactivational activities (Brown et al., 1990; Quigley et al., 1995), and the patients having these mutations exhibited complete androgen insensitivity syndrome (CAIS). Transformants (both wild type and mutants) were treated with DHT (1 nM to 10 mM ) or the vehicle (ethanol ) for 10 h. As determined by Western blot using anti-AR antibody, there was no apparent difference in the level of expression of wild-type or mutant ARs (data not shown). A sharp increase in the enzyme activity was obtained between 10 and 50 nM DHT in wild type, which gradually attained a steady state beyond the steroid concentrations of 100 nM ( Fig. 1). Unlike wild type, both the mutants failed to activate the reporter activity in yeast at hormone concentrations less than 1 mM (Fig. 1). Thus, these mutations of rat AR result in a right shift of the dose–response curve compared to the wild type, which reflects an impairment of the normal receptor function. It is also interesting to note here that the effect of these functional mutants is not species-specific. The relative efficiency ( Table 1) of non-androgenic ligands (aldosterone, cortisol, deoxycorticosterone, 17bestradiol, progesterone) in inducing b-galactosidase

250

S. Rana et al. / Gene 209 (1998) 247–254

Fig. 1. Response of mutant rat ARs to DHT induction in YCR1. Mutants were assayed for their response to increasing concentrations of DHT under the standardized conditions. b-galactosidase activity is expressed as a percentage of the maximum of wildtype rat AR obtained with 1 mM DHT (100%=376 Miller units). Reproducibility has been checked for five times, and the figure represents one such experiment.

activity was very low compared to androgens (DHT, R1881 and testosterone). The calculated  value 50 (concentration of the steroid at which 50% of maximum transcriptional activation has been achieved) for DHT was 44.9±9.6 nM (mean±SD, n=13; see Table 1 and also Fig. 1). This concentration of DHT is slightly greater than that reported for yeast-expressed human and mouse ARs (Purvis et al., 1991; Mak et al., 1994; Caplan et al., 1995). However, the induction ratio for rat AR expressed in our system in the presence of 1 mM DHT or testosterone or R1881 was ~260-fold above uninduced b-galactosidase levels. Compared to the existing reports (Fang et al., 1996), the consistently low background expression of our system reflects its greater sensitivity for detecting transactivation function of AR in S. cerevisiae upon induction with androgens. Interestingly, when both rat AR and the reporter cassette were present on 2m plasmids, all transformants exhibited hormone-independent transactivation (data not shown). This was attributed to the activation of basal level expression in all the multiple copies of the reporter plasmid by a hormone independent transactivation function of rat AR. 17b-Estradiol and progesterone induced b-galactosidase activity at 200-fold higher concenTable 1 Concentrations of different steroids required to achieve 50% bgalactosidase activity ( ) 50 Steroid



Dihydrotestosterone Testosterone R1881 17 b-estradiol Progesterone Cortisol Aldosterone

0.05 0.07 0.05 2.45 2.45 ND ND

ND, not detected.

50

(mM )

Fig. 2. Hormonal specificity of transcriptional activity by yeastexpressed rat AR. Transformants in liquid culture were incubated with indicated concentrations (in mM ) of DHT (D), testosterone ( T ), Cyproterone acetate (CA), flutamide ( F ), 17b-estradiol ( E2) and progesterone (P) or 1% ethanol (0) as vehicle. Reporter activity obtained with 50 nM of DHT has been considered as 100% (=131 Miller units). Representative data of three independent experiments are shown here.

trations (10 mM ) of DHT were ~75% and ~35%, respectively, to that of androgens ( Fig. 2). Furthermore, the androgen specificity of our system has been ascertained by the findings that at 100-nM concentrations of each steroid, b-galactosidase activity was strictly dependent on the treatment with androgens (DHT/R1881/ testosterone) only, but not any other steroid (data not shown). This specificity has also been reflected in a qualitative plate assay, in which steroid-induced cultures when plated in the presence of b-galactosidase substrate X-gal result in blue colonies only when induced with androgens. 3.2. Antagonist resistance in yeast system We were interested in evaluating the role of antiandrogens in exerting their antagonistic effect in a transactivational assay utilizing our heterologous expression system. This aspect was particularly interesting since antiestrogens have been reported to be ineffective in exhibiting their antagonistic behaviour with yeast-expressed estrogen receptors ( Wrenn and Katzenellenbogen, 1993; Zysk et al., 1995; Shiau et al., 1996). Antiandrogens, cyproterone acetate (CA) and flutamide in our system did not induce any reporter activity up to a concentration of 1 mM (Fig. 2). At higher concentrations (~10 mM ), only CA, but not the non-steroidal antiandrogen, flutamide, exhibited agonistic (~15% activity to that observed with 50 nM DHT ) behaviour. These observations are comparable to those of Kemppainen et al. (1992) with human AR expressed in CV1 cells. However, when evaluated for the antagonistic activity, none of the antiandrogens at the tested concentrations was able to antagonize the DHT-dependent induction of reporter activity ( Fig. 3 and data not

S. Rana et al. / Gene 209 (1998) 247–254

251

Fig. 3. Effect of CA on DHT dependent lac Z induction in YCR1 strain transformed with rat AR. Transformants were incubated with indicated concentrations of DHT in combination with varying concentrations of CA. The experiment has been repeated five times, and representative data are shown here.

shown). Pre-incubation with CA or flutamide followed by DHT induction also did not indicate any change in the situation (data not shown). Thus, the ineffectiveness of antiandrogens in yeast is in keeping with the existing reports of antagonistic resistance observed for antiestrogens in similar systems ( Zysk et al., 1995; Shiau et al., 1996). Steroid receptors exhibit a conformational change upon interaction with ligands that leads to a series of events like dissociation of non-receptor moiety, receptor dimerization and subsequent binding to target DNA at the cis-acting SRE sequences and finally activates the transcription machinery (Tsai and O’Malley, 1994). Like agonists, antagonists have been shown to induce binding of receptor to SRE (Bagchi et al., 1988; Kallio et al., 1994). However, agonist-induced receptor–SRE complexes have been reported to have undergo a faster migration in gel retardation assays compared to that of antagonists (Metzger et al., 1988; Kallio et al., 1994). To elucidate whether we can distinguish between agonists and antagonists on the basis of the mobility of the yeast-expressed rat AR receptor–DNA complexes, a gel retardation assay has been carried out. Both agonist (DHT )- and antagonist (CA and flutamide)-treated receptor bind 27-mer ARE/GRE ( Fig. 4). However, the mobility of the receptor–DNA complexes in response to agonists ( Fig. 4, lanes 2 and 7) or antagonists (Fig. 4, lanes 4 and 5) or in combination (Fig. 4, lanes 8 and 9) did not reflect any apparent distinction. Additionally, exposure of receptor to increasing concentrations of antagonist (up to 10−6 M for CA and 10−5 M for flutamide) along with DHT (5×10−8 M ) did not result in any alteration in the mobility pattern of the receptor–DNA complexes (data not shown). Thus, our results differ from those of Kallio et al. (1994) who have demonstrated that ligand-induced AR (synthesized

Fig. 4. Electrophoretic mobility shift assay for rat AR in YCR1 cells. Transformants of YCR1 containing rat AR were treated with 10−6 M DHT, ethanol, 10−7 M CA, 10−7 M flutamide, 10−7 M 17bestradiol, 5×10−8 M DHT and a combination of DHT with flutamide or CA. Yeast extracts were prepared as described in Materials and methods. Five micrograms of protein obtained with 45% ammonium sulphate cut were incubated with [c32P]ATP labelled GRE probe and protein–DNA complexes were resolved on a 5% non-denaturing polyacrylamide gel. Representative data are shown. Lane 1, YCR1 alone induced with 10−6 M DHT; lane 2, 10−6 M DHT; lane 3, ethanol; lane 4, 10−7 M CA; lane 5, 10−7 M flutamide; lane 6, 10−7 M 17b-estradiol; lane 7, 5×10−8 M DHT; lane 8, 5×10−8 M DHT+10−7 M CA; lane 9, 5×10−8 M DHT+10−7 M flutamide. Specificity of DNA binding of the hormone induced complexes was also determined by competition with a 50- to 100-fold molar excess of cold GRE (data not shown). Arrow indicating AR denotes receptor–SRE complexes.

in vitro utilizing reticulocyte lysate system)–ARE complexes exhibit distinct patterns of migration when treated with DHT as opposed to CA, as well as in agonist–antagonist competitions. This reflects the possibility that interactions between cellular factors contribute to recognition of the antiandrogens by yeast-expressed rat AR and thereby may play an important role in antagonist resistance. 3.3. Ligand-modulated efflux pump of yeast does not affect androgen transport The potency and responsiveness of a particular steroid (agonist or antagonist) is regulated in a cell-specific manner in mammalian cells ( Kralli et al., 1995; Tonetti and Jordan, 1996). Therefore, it is not unusual that factor(s) responsible for the recognition of antisteroids are absent in yeast (Shiau et al., 1996). Alternatively, certain yeast specific factor(s) may be responsible for such a discrepancy ( Zysk et al., 1995). Among them, the ligand effect modulator pump (PDR5/STS1/ YDR1/LEM1) belonging to the ABC (ATP binding

252

S. Rana et al. / Gene 209 (1998) 247–254

A

B

Fig. 5. Effect of CsA on receptor function in yeast. (A) Effects of various doses of CsA on GR responsiveness to Dex and DOC. YCR1 transformants carrying the GR expression plasmid pGN795 were treated for 10 h with indicated concentrations of CsA and 1 mM Dex or DOC. b-galactosidase enzyme activity obtained in the absence of CsA has been taken as 100% (=28 and 622 Miller Units for Dex and DOC, respectively), and a representative of three experiments is shown. (B) Effect of various doses of CsA on rat AR responsiveness to 100 nM DHT in the presence of vehicle ethanol or 1 mM CA. YCR1 cells carrying pGAR plasmid were treated for 10 h with indicated concentrations of hormone or CsA and the b-galactosidase activity assayed as described in Materials and methods. Enzyme activity obtained in the absence of CsA has been taken as 100% (=168 Miller Units). DHT concentrations of 10 nM and 1 mM have also been tested with similar results although the magnitude of induced bgalactosidase activity was different (data not shown). The reproducibility of the experiment has been checked in three different experiments, and representative data are shown here.

cassette) family of transporters has been reported to modulate intracellular levels of certain steroids selectively in yeast cells ( Kralli et al., 1995; Thompson, 1995; Kralli and Yamamoto, 1996). Immunosupressive agents like FK506 and CsA are known to inhibit such transporters (Arceci et al., 1992; Saeki et al., 1993) and are active in yeast as well ( Kunz and Hall, 1993). The involvement of this transporter in regulating response of dexamethasone (Dex) in the receptor-mediated signalling pathway in yeast has recently been shown utilizing FK506 ( Kralli and Yamamoto, 1996). To determine the efficacy of CsA in the process, YCR1 strain was transformed with rat glucocorticoid receptor cDNA (pGN795). Dex (positive control ) and DOC (negative control ) were used as ligands to monitor steroid-induced reporter activity in the presence of CsA. Whereas an increase in Dex-induced glucocorticoid receptor mediated reporter activity has been noticed with increasing concentrations of CsA, DOC induction did not show any alteration (Fig. 5A). This result is quite comparable with the effect of FK506 ( Kralli and Yamamoto, 1996) and suggests that a ligand-modulated efflux system is operative in YCR1. To gain an insight into the role of such transporters in affecting the transport of androgenic ligands, we utilized CsA in our system. We determined the reporter activity with pGAR-transformed cells in response to DHT or DHT and CA in combination. No significant alteration in the b-galactosidase activity was observed in the same YCR1 when rat AR is expressed and induced with DHT in the presence of CsA ( Fig. 5B). Furthermore, antiandrogens like cyproterone acetate did not inhibit the DHT-induced reporter activity, even in

the presence of CsA (Fig. 5B), which negates the possibility of the involvement of such an efflux pump in determining antiandrogen resistance in yeast. It is apparent from our results that DHT-induced reporter activity was unaffected in the presence of an excess of antiandrogens (Fig. 3). However, in the gel retardation assay, yeast-expressed rat AR binds to SRE following exposure to antiandrogens, even at concentrations as low as 100 nM ( Fig. 4). This discrepancy subscribes to the fact that the binding affinity of antiandrogens for rat AR is not the determining factor for their antagonistic effect, unlike the antiprogestagen ZK 98299 (Delarbre et al., 1993). Furthermore, our results do not support the postulation of Kuil et al. (1995) that antagonists act to prevent the dissociation of receptor associated proteins upon ligand binding to receptor. We have also addressed the question of active efflux of selective steroidal ligands in mediating antisteroidal resistance in our system. Among the host-specific factors, this aspect has received attention very recently. Utilizing an immunosupressive agent, CsA, which inhibits ABC transporters ( Fig. 5A), we have clearly demonstrated that the antiandrogen tested in our system did not show any evidence for ligand efflux (Fig. 5B). Therefore, based on the step-wise elimination of different possibilities, our results indicate that impairment of transcriptional activation by antiandrogens in yeast occurs at a step after the receptor binds to DNA. The exhibition of antiandrogen resistance distinctly reflects the involvement of yeast-specific non-receptor factor(s) in the process that may include either activator(s) or repressor(s). Interestingly, several transcriptional coactivators of steroid receptors like SRC1, ARA , GRIP1 (Onate 70

S. Rana et al. / Gene 209 (1998) 247–254

et al., 1995; Hong et al., 1996; Yeh and Chang, 1996) that enhance the agonist-dependent transcriptional activity in mammalian cells as well as in yeast have recently been identified. It remains to be seen whether similar receptor associated proteins are also essential for mediating antiandrogenic activity. Finally, the analysis of the point mutants (Fig. 1) in our study argues that mammalian AR signal transduction pathway could be reconstituted and genetically dissected in yeast. Thus, in addition to screening of novel androgens, this powerful system could also be effectively utilized for screening of functionally defective mutants (including point mutation) of AR. Additionally, it would be interesting to utilize our system in identifying as-yet unknown effector molecules that may be required by antiandrogens for exerting antagonistic behaviour in yeast. 3.4. Conclusions (1) We have utilized a sensitive reporter system for effective screening of natural or synthetic androgenic ligands as well as known functional mutants of AR. (2) b-galactosidase activity is strictly dependent upon the presence of androgens (DHT, R1881 and testosterone). (3) Antiandrogens, CA and flutamide, did not induce reporter activity up to concentrations of 1 mM. At a concentration of 10 mM, however, only CA exhibited agonistic behaviour resulting in 15% activity compared to that obtained with 50 nM DHT. Moreover, neither agonists nor antagonists could be differentiated on the basis of the mobility pattern of the receptor–DNA complexes. (4) In competition experiments, DHT-dependent induction of lac Z was unaffected by all concentrations of CA and flutamide, even in the presence of CsA. Thus, LEM1, though operative in yeast, does not play a role in selective efflux of androgen agonists or antagonists. (5) Our system provides an effective means for screening of unknown host-specific effector molecules that mediate antagonistic behaviour in yeast.

Acknowledgement We thank Dr C.M. Gupta, former Director, IMTECH, Chandigarh for his consistent encouragement and support in carrying out this work. We would also like to acknowledge the kind gifts of pG1, pGN795, pSX26.1 from Dr K. Yamamoto ( University of California, San Francisco); rat AR cDNA from Dr S. Liao ( University of Chicago, Chicago) and DHT from Dr S.S. Simons, Jr. (NIH, Bethesda). Yeast strains BJ5460 and BJ2168, created by Dr B. Jones, University

253

of Pittsburgh, were obtained from Dr A. Bachhawat, IMTECH, Chandigarh. Jankey Prasad and Amarjit Singh provided assistance during the course of this investigation. One of the authors (S.R.) is an SRF, CSIR, New Delhi, India. This project has been supported by a research grant from the DBT, New Delhi. This is Institute of Microbial Technology communication 014/97.

References Arceci, R.J., Kimberly, S., Bierer, B.E., 1992. Immunosuppressants FK506 and rapamycin function as reversal agents of multidrug resistance phenotype. Blood 80, 1528–1536. Bagchi, M.K., Elliston, J.F., Tsai, S.Y., Edwards, D.P., Tsai, M.-J., O’Malley, B.W., 1988. Steroid hormone-dependent interaction of human progesterone receptor with its target enhancer element. Mol. Endocrinol. 2, 1221–1229. Brown, T.R., Lubahn, D.B., Wilson, E.M., French, F.S., Migeon, C.J., Corden, J.L., 1990. Functional characterization of naturally occurring mutant androgen receptors from subjects with complete androgen insensitivity. Mol. Endocrinol. 4, 1759–1772. Caplan, A.J., Langley, E., Wilson, E.M., Vidal, J., 1995. Hormonedependent transactivation by the human androgen receptor is regulated by a dnaJ protein. J. Biol. Chem. 270, 5251–5257. Chakraborti, P.K., Garabedian, M.J., Yamamoto, K.R., Simons, S.S., Jr., 1991. Creation of ‘super’ glucocorticoid receptors by point mutations in the steroid binding domain. J. Biol. Chem. 266, 22075–22078. Chang, C., Wang, C., DeLuca, H.F., Ross, T.K., Shih, C.C.-Y., 1992. Characterization of human androgen receptor overexpressed in the baculovirus system. Proc. Natl. Acad. Sci. USA 89, 5946–5950. Delarbre, K., Guiochon-Mantel, A., Milgrom, E., 1993. In vivo evidence against the existence of antiprogestins disrupting receptor binding to DNA. Proc. Natl. Acad Sci. USA. 90, 4421–4425. Doesburg, P., Kuil, C.W., Berrevoets, C.W., Steketee, K., Faber, P.W., Mulder, E., Brinkmann, A.O., Trapman, J., 1997. Functional in vivo interaction between the amino-terminal, transactivation domain and the ligand binding domain of the androgen receptor. Biochemistry 36, 1052–1064. Fang, Y., Fliss, A.E., Robins, D.M., Caplan, A.J., 1996. Hsp 90 regulates androgen receptor hormone binding affinity in vivo. J. Biol. Chem. 271, 28697–28702. Gaido, K.W., Leonard, L.S., Gould, J.C., Babai, D., Portier, C.J., McDonnell, D., 1997. Evaluation of chemicals with endocrine modulating activity in a yeast-based steroid hormone receptor gene transcription assay. Toxicol. Appl. Pharmacol. 143, 205–212. Ho, S.N., Hunt, H.D., Horton, R.M., Pullen, J.K., Pease, L.R., 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene. 77, 51–59. Holzman, D., 1996. Testosterone, wasting and AIDS. Mol. Med. Today 2, 93 Hong, H., Kohli, K., Trivedi, A., Johnson, D.L., Stallcup, M.R., 1996. GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc. Natl. Acad. Sci. USA 93, 4948–4952. Kallio, P.J., Janne, O.A., Palvimo, J.J., 1994. Agonists, but not antagonists, alter the conformation of the hormone binding domain of androgen receptor. Endocrinology 134, 998–1001. Kemppainen, J.A., Lane, M.V., Sar, M., Wilson, E.M., 1992. Androgen receptor phosphorylation, turnover, nuclear transport, and transcriptional activation. J. Biol. Chem. 267, 968–974. Kralli, A., Bohen, S.P., Yamamoto, K.R., 1995. LEM1, an ATP-bind-

254

S. Rana et al. / Gene 209 (1998) 247–254

ing-cassette transporter, selectively modulates the biological potency of steroid hormones. Proc. Natl. Acad. Sci. USA 92, 4701–4705. Kralli, A., Yamamoto, K.R., 1996. An FK506-sensitive transporter selectively decreases intracellular levels and potency of steroid hormones. J. Biol. Chem. 271, 17152–17156. Kuil, C.W., Berrevoets, C.A., Mulder, E., 1995. Ligand-induced conformational alterations of the androgen receptor analyzed by limited trypsinization. J. Biol. Chem. 270, 27569–27576. Kunz, J., Hall, M.N., 1993. Cyclosporin A, FK506 and rapamycin: more than just immunosupression. Trends Biol. Sci. 18, 335–338. Mak, P., Young, C.Y.-F., Tindall, D.J., 1994. A novel yeast expression system to study androgen action. Rec. Proc. Horm. Res. 49, 347–352. Metzger, D., White, J.H., Chambon, P., 1988. The human oestrogen receptor functions in yeast. Nature 334, 31–36. Miller, J.H., 1992. A Short Course in Bacterial Genetics—A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria. Cold Spring Harbor Press, Cold Spring Harbor, NY. Mooradian, A.D., Morley, J.E., Korenman, S.G., 1987. Biological action of androgens. Endocr. Rev. 8, 1–28. Onate, S.A., Tsai, S.Y., Tsai, M.-J., O’Malley, B.W., 1995. Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270, 1354–1357. Picard, D., Schena, M., Yamamoto, K.R., 1991. An inducible expressin vector for both fission and budding yeast. Gene 86, 257–261. Purvis, I.J., Chotai, D., Dykes, C.W., Lubahn, D.B., French, F.S., Wilson, E.W., Hobden, A.N., 1991. An androgen-inducible expression system for Saccharomyces cerevisiae. Gene 106, 35–42. Quigley, C.A., DeBellis, A., Marschke, K.B., El-Awady, M.K., Wilson, E.M., French, F.S., 1995. Androgen receptor defects: historical, clinical, and molecular perspectives. Endocr. Rev. 16, 271–321. Rose, M.D., Winston, F., Hieter, P., 1990. Methods in Yeast Genetics—A Laboratory Course Manual. Cold Spring Harbor Press, Cold Spring Harbor, NY. Saeki, T., Ueda, K., Tanigwara, Y., Hori, R., Komano, T., 1993. Human P-glycoprotein transports cyclosporin A and FK506. J. Biol. Chem. 268, 6077–6080.

Schena, M., Yamamoto, K.R., 1988. Mammalian glucocorticoid receptor derivatives enhance transcription in yeast. Science 240, 965–967. Schiestl, R.H., Manivasakam, P., Woods, R.A., Gietz, R.D., 1993. Introducing DNA into yeast by transformation. Methods: A companion to Methods Enzymol. 5, 79–85. Shiau, S.-P., Glasebrook, A., Hardikar, S.D., Yang, N.N., Hershberger, C.L., 1996. Activation of the human estrogen receptor by estrogenic and antiestrogenic compounds in Saccharomyces cerevisiae: a positive selection system. Gene 179, 205–210. Simons, S.S., Jr., 1996. Environmental estrogens: Can two ‘alrights’ make a wrong? Science 272, 1451 Thompson, E.B., 1995. Membrane transporters of steroid hormones. Curr. Biol. 5, 730–732. Tonetti, D.A., Jordan, V.C., 1996. Targeted anti-estrogens to treat and prevent diseases in women. Mol. Med. Today 2, 218–223. Truss, M., Beato, M., 1993. Steroid hormone receptors: Interaction with deoxyribonucleic acid and transcription factors. Endocr. Rev. 14, 459–479. Tsai, M.-J., O’Malley, B.W., 1994. Molecular mechanisms of the action of steroid/thyroid receptor superfamily members. Annu. Rev. Biochem. 63, 451–486. Wong, C-i, Zhou, Z-x, Sar, M., Wilson, E.M., 1993. Steroid requirement for androgen receptor dimerization and DNA binding. J. Biol. Chem. 268, 19004–19012. Wrenn, C.K., Katzenellenbogen, B.S., 1993. Structure–function analysis of the hormone binding domain of human estrogen receptor by region specific mutagenesis and phenotypic screening in yeast. J. Biol. Chem. 268, 24089–24098. Yeh, S., Chang, C., 1996. Cloning and characterization of a specific coactivator, ARA , for the androgen receptor in human prostrate 70 cells. Proc. Natl. Acad. Sci. USA 93, 5517–5521. Zysk, J.R., Johnson, B., Ozenberger, B.A., Bingham, B., Gorksi, J., 1995. Selective uptake of estrogenic compounds by Saccharomyces cerevisiae: a mechanism for antiestrogen resistance in yeast expressing the mammalian estrogen receptor. Endocrinology 136, 1323–1326.