Acute hypoxia-induced depletion of striatal nitric oxide synthase pathway

Journal of Chemical Neuroanatomy 47 (2013) 42–49

Contents lists available at SciVerse ScienceDirect

Journal of Chemical Neuroanatomy journal homepage: www.elsevier.com/locate/jchemneu

Acute hypoxia-induced depletion of striatal nitric oxide synthase pathway Francisco Molina a, Alma Rus b,*, Juan A´ngel Pedrosa b, Ma Luisa del Moral b a b

Department of Health Science, University of Jae´n, Paraje Las Lagunillas s/n, 23071 Jae´n, Spain Department of Experimental Biology, University of Jae´n, Paraje Las Lagunillas s/n, 23071 Jae´n, Spain

A R T I C L E I N F O

A B S T R A C T

Article history: Received 27 July 2012 Received in revised form 12 November 2012 Accepted 12 December 2012 Available online 20 December 2012

Hypoxia-induced alteration of nitric oxide (NO) production may lead to brain disease, especially in the areas most sensitive to oxygen deficiency, such as the striatum. To date, the behaviour of the striatal NO pathway under hypoxia/reoxygenation remains unknown and its elucidation constitutes the aim of this work. Wistar rats were submitted to hypoxia (20 min) and analyzed after 0 h, 24 h, and 5 days of reoxygenation. Expression, activity, and location of the NO synthase (NOS) isoforms (neuronal, endothelial, and inducible) as well as nitrated protein expression were analyzed in the rat striatum. NO levels were indirectly quantified as nitrates and nitrites (NOx), which act as NO-generating molecules. NOS isoform mRNA levels remained unaltered in hypoxic groups vs. normoxic control. However, quantification of immunoreaction showed a significant decrease in eNOS and nNOS after hypoxia. While in situ NOS activity and NOx levels fell, levels of nitrotyrosine-modified proteins rose throughout the reoxygenation period. Our data revealed the great complexity of the NO pathway, showing that both acute hypoxia and the successive recovery period down-regulated the NOS system in the rat striatum. However, under hypoxia/reoxygenation NO may be produced in a NOS-independent way from the NO-storage molecules, compensating for the hypoxia-reduced NOS activity. ß 2012 Elsevier B.V. All rights reserved.

Keywords: Nitric oxide Striatum Nitric oxide synthase Hypoxia Reoxygenation

1. Introduction Oxidative stress is an important contributing factor to the development of brain damage and disease (Peers et al., 2007). In this sense, oxidative stress characteristically increases in situations of hypoxia/reoxygenation (H/R) (Rouschop et al., 2009). Nitric oxide (NO) is an inorganic free radical, which has been traditionally related to hypoxic injury to the central nervous system (CNS) (Iadecola, 1997; Alonso et al., 2002; Serrano et al., 2003). NO is formed from L-arginine by NO synthase (NOS), which oxidizes the terminal guanidine nitrogen of L-arginine, releasing NO and citrulline (Moncada and Higgs, 1991). At least three distinct

Abbreviations: AHH, acute hypobaric hypoxia; CNS, central nervous system; eNOS, endothelial nitric oxide synthase; H/R, hypoxia/reoxygenation; iNOS, inducible nitric oxide synthase; L-NAME, NG-nitro-L-arginine methyl ester; NADPH-d, NADPH-diaphorase; nNOS, neuronal nitric oxide synthase; NO, nitric oxide; NOx, indirect quantification of NO level by measuring nitrates and nitrites; N-Tyr, nitrotyrosine; O.C.T medium, Optimal Cutting Temperature medium; PB, phosphate buffer; PBS, phosphate-buffered saline; RNS, reactive nitrogen species; ROS, reactive oxygen species; SD, standard deviation; RT-PCR, real-time polymerase chain reaction; VCl3, vanadium chloride. * Corresponding author at: Department of Experimental Biology (Building B-3), University of Jae´n, Campus Las Lagunillas s/n, 23071 Jae´n, Spain. Tel.: +34 953 012303; fax: +34 953 211875. E-mail address: [email protected] (A. Rus). 0891-0618/$ – see front matter ß 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jchemneu.2012.12.003

isoforms of NOS have been identified and cloned (Marleta, 1993): endothelial NOS (eNOS) and neuronal NOS (nNOS), both described as constitutive proteins, and inducible NOS (iNOS), induced by certain stimuli such as hypoxia (Moncada and Higgs, 1993; Ricciardolo et al., 2004; Rus et al., 2011a). The striatum is a basal ganglion of the brain that is more sensitive to hypoxia than other regions of the CNS (Erecinska and Silver, 1996). NO plays some functions in the striatum, including the control of the local blood flow (Snyder and Bredt, 1991) and the modulation of the release of other neuroactive substances (Manzoni et al., 1992). Active neurons produce reactive oxygen species (ROS) as a consequence of the aerobic metabolism. H/R conditions augment its production, promoting the reaction of NO with superoxide to form peroxynitrite. Peroxynitrite reacts with different biomolecules, including the nitration of tyrosine residues of peptides and proteins to form 3-nitro-L-tyrosine (nitrotyrosine) (Haddad et al., 1994), which has been conventionally used as a marker of the potentially cytotoxic effect of NO (Beckman and Koppenol, 1996). Nevertheless, tyrosine nitration may be a reversible process and can be considered a potential signalling event rather than a harmful phenomenon (Kuo et al., 2002; Ricciardolo et al., 2006). Under H/R, NO production may be altered (Chen et al., 2001), leading to a variety of pathologies. Therefore, the understanding of the behaviour of the NO pathway is crucial as the basis for future

F. Molina et al. / Journal of Chemical Neuroanatomy 47 (2013) 42–49

works aimed to develop original NO-based treatments for oxygen deprivation-related dysfunctions. In this context, the NO/NOS system has been analyzed under hypoxic conditions in numerous areas of the CNS. However, it is particularly striking that there is a paucity of literature focusing on the NO pathway in the hypoxic striatum, since this brain ganglion is especially susceptible to oxygen deprivation. In addition, few studies examine the period following the hypoxic stimulus. In fact, the analysis of the posthypoxia period is fundamental in this type of investigation since, although tissue reoxygenation is required for cell salvage, it may temporarily aggravate the hypoxic damage, partly due to excessive generation of ROS and reactive nitrogen species (RNS) (Eisei et al., 2001). Therefore, the behaviour of the striatal NO/NOS pathway remains unclear under H/R. These situations have been formerly investigated by our research group in several vital organs, ˜ uelo et al., including the CNS (Martı´nez-Romero et al., 2006; Can 2007), the lung (Rus et al., 2010a), and the heart (Rus et al., 2011b). In this light, the present study is addressed to investigate the NO pathway during acute H/R in the rat striatum. 2. Materials and methods 2.1. Animals The study was performed on mature adult (4–5 months old) male albino Wistar rats kept under standard conditions of light and temperature and allowed ad libitum access to food and water. All the experiments were conducted according to the guidelines on the use of animals for biochemical research of the European Communities Council Directive of 24 November 1986 (86/609/EEC), and the EU Directive 2010/63/EU. 2.2. Experimental procedure The acute hypobaric hypoxia (AHH) was carried out as previously published by our group (Lopez-Ramos et al., 2005; Rus et al., 2010b). Briefly, animals were placed in a chamber connected to a vacuum pump with a controlled air inflow and outflow. AHH was induced by downregulating the environmental O2 pressure to a final barometric pressure of 225 mm Hg, resulting in a 48 mm Hg O2 partial pressure. These conditions simulate an altitude of 8100 m and were maintained for 20 min. The ascent and descent speeds were kept at less than 305 m/min. After the AHH period, animals were kept under normobaric normoxic conditions for different reoxygenation times (0 h, 24 h, and 5 days), and then were sacrificed. Control animals were sacrificed after being maintained for 20 min in the chamber under normobaric normoxic conditions. A total of 20 albino Wistar rats were used for the biochemical experiments (5 animals per experimental group). After the corresponding reoxygenation times, the rats were killed by cervical dislocation and the whole brain was immediately removed and rinsed in saline solution. Then, the brain was sagittally cut following the sagittal fissure. Using a magnifying glass and following the rat brain atlas of Paxinos and Watson (1998), the striatum was located, removed, and stored at 80 8C until used. For histochemistry and immunohistochemistry, 20 rats (5 animals per experimental group) were anaesthetized with Ketolar (15 mg/100 g B.W.; Parke Davis, Madrid, Spain) and Rompun (1:5, v/v diluted in Ketolar; Bayer, Leverkusen, Germany), and then perfused at each reoxygenation time. 2.3. NOS isoforms and nitrotyrosine (N-Tyr) immunohistochemistry Deeply anaesthetized animals were perfused through the left ventricle with 50 mL of 0.01 M phosphate-buffered saline (PBS; pH 7.4), and then with 250 mL of 4% paraformaldehyde in 0.1 M phosphate buffer (PB). The whole brain was removed, rinsed in PBS, and post-fixed for another 4 h in the same fixative at room temperature. Each sample was then cryoprotected by immersion overnight at 4 8C in 0.1 M PB containing 30% sucrose. After that, the brain was embedded in O.C.T medium and frozen in 2-methylbutane pre-chilled in liquid nitrogen. The brain was then sectioned following a rostrocaudal direction using a cryostat (Leica CM1950,

43

Germany), and serial rostrocaudal sections (40 mm) were obtained since the appearance of the striatum up to the intersection of the first, second, and third ventricle. Free-floating sections were incubated for 30 min in PBS containing 0.2% Triton X100, and then in polyclonal anti-nNOS (Riveros Moreno et al., 1995; Uttenthal et al., 1998), anti-eNOS (Sigma Aldrich, Ref. SAB4502016), anti-iNOS (Uttenthal et al., 1998), and anti-nitrotyrosine (Uttenthal et al., 1998) antibodies (Table 1) diluted in PBS containing 0.2% Triton X-100 overnight at 4 8C. After several washes in PBS, the sections were incubated with biotinylated goat anti-rabbit IgG (1:100, Pierce, Rockford, IL, USA) for 1 h, and processed by the avidin–biotin peroxidise complex (ABC) procedure (Pierce, Rockford, IL, USA). The peroxidase activity was demonstrated following the nickel-enhanced diaminobenzidine assay (Shu et al., 1988). No immunolabelling was detected in negative controls when the primary antibody was either omitted or replaced with an equivalent concentration of preimmune serum. 2.4. NADPH-diaphorase (NADPH-d) histochemistry NOS isoforms have been shown to have NADPH-d activity, as evidenced by colocalization and co-precipitation of NADPH-d and NOS activity (Snyder, 1992). In fact, NADPH-d histochemistry has been widely used as an indirect way to determine in situ NOS activity (Kugler et al., 1994; Roufail et al., 1995; Moraes et al., 2001). Free-floating striatum sections were incubated for 4 h in PBS containing 0.1% Triton X-100. After several washes in 0.1 M Tris–HCl, pH 7.4 buffer, they were incubated in the dark, for 45 min at 37 8C, in 0.1 M Tris–HCl, pH 7.4, containing 1 mM b-NADPH and 2 mM NBT (in 70% dimethylformamide). The sections were then washed twice with 0.1 M Tris–HCl, pH 7.4, quickly dehydrated in a graded ethanol series, cleared and mounted in DPX (Fluka, Madrid, Spain). 2.5. Image processing for quantification of immunoreactive area The immunoreactive (NOS and N-Tyr) and NADPH-d positive structures were quantified by computerized-assisted image analysis using ImageJ (an NIH image analysis and processing software downloaded free from http://rsbweb.nih.gov/ij/) connected to a light microscope (Olympus, Hamburg, Germany). One random 1.56 mm2 field (image 10) on each section, and five sections (from rostral to caudal striatum) for each rat, were digitally captured and analyzed after background subtraction (minimal particular size 10 pixels) as follows. As a means of avoiding the usual biased segmentation of the stained structures, the immunoreactive area and the staining intensity, from black (0) to white (255), of each field was calculated as a function of the optical density following a modification of Sternberger’s method (Sternberger and Sternberger, 1986; Del Moral et al., 2004). The line segment corresponding to immunostaining was mathematically extrapolated to the axis representing the percentage of area per field using Origin 5.0, a data analysis and technical graphics software.

2.6. NO measurement The reaction of NO with ozone results in light emission, and this light (emitted in proportion to the NO concentration) is the basis for one of the most accurate NO assays available (Laitinen et al., 1993; Fontijn et al., 1997). NO rapidly reacts with oxygen and water to produce the stable products nitrites and nitrates (Davis et al., 2001). Thus, NO production was indirectly quantified by measuring nitrates and nitrites (NOx) using an ozone chemiluminescence-based method. For this technique, the striatum was homogenized in PBS with protease inhibitors (1:3, v/v). Afterwards, tissue homogenates were mixed 1:2:2 (v/v/v) with a deproteinization buffer (0.8 N NaOH and 16% ZnSO4), let stand at room temperature for 15 min and centrifuged for 5 min at 13,500 rpm. The total amount of NOx was determined by a modification (Lopez-Ramos et al., 2005) of the procedure described by Braman and Hendrix (1989) using the purge system of Sievers Instruments, model NOA 280i. A saturated solution of vanadium chloride (VCl3) in 1 M HCl was added to the nitrogen-bubbled purge vessel fitted with a cold-water condenser and a water jacket to permit heating of the reagent to 90 8C, using a circulating bath. HCl vapours were removed by a gas bubbler containing 1 M NaOH. The gas-flow rate in the detector was controlled by a needle valve adjusted to yield a constant pressure. Once the detector signal was stabilized, samples were injected into the purge vessel to react with the reagent, converting NOx to NO, which was then detected by ozoneinduced chemiluminescence. NOx concentrations were calculated by comparison to

Table 1 Antibodies used for immunohistochemistry to assess the location of neuronal, inducible and endothelial nitric oxide synthase (nNOS, iNOS, eNOS), as well as nitrotyrosine (NTyr) in the rat striatum sections. Antibody

Dilution

Reference

nNOS iNOS eNOS N-Tyr

1:1000 1:2000 1:150 1:1000

Gift from Professor J. Rodrigo, Cajal Institute of Madrid (Riveros Moreno et al., 1995; Uttenthal et al., 1998) Gift from Professor J. Rodrigo, Cajal Institute of Madrid (Uttenthal et al., 1998) Sigma Aldrich, Ref. SAB4502016 Gift from Professor J. Rodrigo, Cajal Institute of Madrid (Uttenthal et al., 1998)

F. Molina et al. / Journal of Chemical Neuroanatomy 47 (2013) 42–49

44

Table 2 Primers used in RT-PCR to assess the expression of endothelial nitric oxide synthase (eNOS) in the rat striatum homogenates. eNOS Forward-Sense Primer Reverse-Antisense Primer TaqMan Probe

50 ATCAAGAGATGGTCAACTATT 30 50 GCATTGGCTACTTCCTTA 30 50 TCTTCTTCCTGGTGATGCCTGT 30

standard solutions of sodium nitrate. Final NOx values were referred to the total protein concentration in the initial extracts. 2.7. Quantitative real-time polymerase chain reaction (RT-PCR) for NOS isoforms The striatum was homogenized in sterile PBS buffer (1:3, w/v) with a homogenator (Pellet Pestle Motor Cordless, Kontes, USA), and total RNA was directly isolated using PeqGold Microspin Total RNA kit (PeqLab, Erlangen, Germany) according to the manufacturer’s protocol. cDNA was synthesized from 1.5 mg total RNA using iScript cDNA Synthesis Kit (Bio-Rad), also following the manufacturer’s instructions. FAMTM dye-labelled rat nNOS (Assay ID: Rn00583793_m1) and iNOS (Assay ID: Rn00561646_m1) TaqMan gene expression assays were purchased from Applied Biosystems. Isoform-specific primers and probes for TaqMan RT-PCR (real-time polymerase chain reaction) for rat eNOS (Table 2) were designed using Beacon Designer 5.0 software (Molecular Beacons) in such a way that the amplicons contained rat eNOS exons 7–10 (GenBank Accession Number U53142), and were then synthesized by Eurogentec (Spain). VIC1 dye-labelled endogenous reference gene 18S ribosomal RNA (Assay ID: Hs99999901_s1) TaqMan gene expression assay was also purchased from Applied Biosystems. 18S ribosomal RNA has been reported to be the most appropriate housekeeping gene for hypoxia experiments (Nagelkerke et al., 2010). RT-PCR reactions were carried out in the CFX-96TM thermal cycler (Bio-Rad) according to Applied Biosystems amplification conditions, and following the manufacturer’s protocol for absolute quantification. For each sample, expression levels for the transcripts of interest were normalized to that of the endogenous 18S ribosomal RNA, and data were calculated as fold expression relative to the average of the control group. The relative expression of NOS was calculated by the 2[DDC(T)] method (Li et al., 2006). 2.8. Statistical analysis Data were expressed as mean  SD (standard deviation). The statistical treatment to evaluate significant differences between groups was performed with SPSS 17.0

software. The data followed neither a normal distribution (tested with Kolmogorov– Smirnov test; a-value = 0.05), nor the principle of homoscedasticity (tested with Levene test; a-value = 0.05); therefore they were tested using the Kruskal Wallis test. The degree of statistical significance was established by applying the U Mann Withney test to compare differences between means. The statistically significant differences vs. the control group were expressed as *p < 0.05; **p < 0.001.

3. Results 3.1. NOS mRNA expression The quantitative analysis of nNOS (Fig. 1A), eNOS (Fig. 1B), and iNOS (Fig. 1C) mRNA expression showed no changes in any hypoxic group vs. control group. 3.2. NOS immunohistochemistry In the striatum of adult rats, nNOS immunoreactive neurons (Fig. 2A–D) and eNOS immunoreactive cells (Fig. 2E–H), including endothelial cells, decreased after hypoxia, whereas iNOS immunostaining did not change in any group (Fig. 2I–L). The quantification of NOS immunoreactivity showed a decrease in nNOS immunostaining (Fig. 3A) at 0 h (p < 0.001) and 5 days (p < 0.001) of reoxygenation vs. control. Also eNOS (Fig. 3B) diminished after 5 days post-hypoxia (p < 0.05), while iNOS immunoreactivity (Fig. 3C) remained unaltered in comparison to the normoxic control. 3.3. NADPH-diaphorase (NADPH-d) histochemistry NADPH-d activity, indicative of in situ NOS activity, was detected in some neurons and blood vessels in the striatum. A remarkable reduction in NADPH-d staining occurred in striatal blood vessels after the hypoxic stimulus (Fig. 4). Quantification of NADPH-d staining revealed a decrease throughout the reoxygenation period (0 h: p < 0.05; 24 h: p < 0.001; 5 days: p < 0.001) in comparison to the normoxic control (Fig. 5).

Fig. 1. Nitric oxide synthase (NOS) isoform mRNA expression in the rat striatum. Real-time PCR analysis of nNOS (A), eNOS (B), and iNOS (C). Experimental groups: Control and 0 h, 24 h and 5 days post-hypoxia. Results were expressed as arbitrary units. Results are mean values of three independent experiments and five animals per group. All experiments were performed in triplicates, and the values were used to calculate the ratio of NOS to 18S ribosomal RNA, with a value of 1 used as the control.

F. Molina et al. / Journal of Chemical Neuroanatomy 47 (2013) 42–49

45

Fig. 2. Representative microphotographs of histological sections of rat striatum stained for nNOS (A–D), eNOS (E–H), and iNOS (I–L) immunohistochemistry (scale bars: 200 mm). Experimental groups: Control (C) and 0 h, 24 h and 5 days (5 d) post-hypoxia. nNOS immunoreactivity was detected in striatal neurons (arrow) in all the experimental groups. Magnifications of nNOS immunoreactive neurons are shown on microphotographs A–D. eNOS immunoreactivity was found in endothelial cells of the blood vessels (arrow) in the striatum of all the experimental groups. Striatal iNOS immunostaining (arrow) did not change in any group.

Fig. 3. Quantitative data from image analysis of histological sections of rat striatum stained for NOS isoforms immunohistochemistry. Image analysis of nNOS (A), eNOS (B), and iNOS (C). Experimental groups: Control and 0 h, 24 h and 5 days post-hypoxia. Results are mean values of 25 microphotographs (five microphotographs per animal and five animals per group). The statistically significant differences vs. the control group were expressed as *p < 0.05; **p < 0.001.

46

F. Molina et al. / Journal of Chemical Neuroanatomy 47 (2013) 42–49

Fig. 4. Representative microphotographs of histological sections of rat striatum showing NADPH-diaphorase staining (scale bars: 200 mm). Experimental groups: Control (C) and 0 h, 24 h and 5 days (5 d) post-hypoxia. In situ NOS activity was detected in neurons (arrow head) and endothelial cells of the blood vessels (arrow) in the rat striatum. Magnifications of NADPH-d positive neurons are shown on each microphotograph. A remarkable reduction in NADPH-d staining occurred in striatal blood vessels after the hypoxic stimulus.

3.4. NO production Fig. 6 shows the determinations of nitrates and nitrites (NOx) in the rat striatum. NOx levels significantly diminished throughout the reoxygenation period (0 h, 24 h, 5 days: p < 0.001) in comparison to the control group.

(p < 0.05) post-hypoxia compared to the control group. These higher values returned to control levels 5 days after the hypoxic stimulus (Fig. 8). 4. Discussion

Nitrotyrosine immunoreactivity, found in all the experimental groups, increased after hypoxia in the rat striatum (Fig. 7). The quantification of the immunoreaction showed higher levels of nitrotyrosine-modified proteins at 0 h (p < 0.05) and 24 h

In this study, we analyzed the NO pathway in the striatum of rats submitted to short-term hypoxia after 0 h, 24 h, and 5 days of reoxygenation. Our results revealed that the acute H/R model used diminished the expression of the NOS system in the rat striatum. In this light, H/R did not alter NOS isoform mRNA levels in any hypoxic group vs. normoxic control. In concordance, several hours of hypobaric hypoxia had no significant effect on eNOS mRNA

Fig. 5. Quantitative data from image analysis of histological sections of rat striatum showing NADPH-diaphorase staining. Experimental groups: Control and 0 h, 24 h and 5 days post-hypoxia. Results are mean values of 25 microphotographs (five microphotographs per animal and five animals per group). The statistically significant differences vs. the control group were expressed as *p < 0.05; **p < 0.001.

Fig. 6. Determination of nitrates and nitrites (NOx) in the rat striatum. Experimental groups: Control and 0 h, 24 h and 5 days post-hypoxia. Results are mean values of three independent experiments with five animals per group. The statistically significant differences vs. the control group were expressed as **p < 0.001.

3.5. Nitrotyrosine immunohistochemistry

F. Molina et al. / Journal of Chemical Neuroanatomy 47 (2013) 42–49

47

Fig. 7. Representative microphotographs of histological sections of rat striatum stained for nitrotyrosine immunohistochemistry (scale bars: 200 mm). Experimental groups: Control (C) and 0 h, 24 h and 5 days (5 d) post-hypoxia. Nitrotyrosine immunoreactivity (arrow) was found in the striatum of all the experimental groups.

levels in nodose ganglion and cerebellum (Prabhakar et al., 1996). Contrary to our findings, NOS isoform mRNA levels significantly rose in several areas of the CNS in response to H/R (cerebral cortex: ˜uelo et al., 2007; pineal gland: Kaur et al., 2007) and hypobaric Can hypoxia (nodose ganglion, cerebellum: Prabhakar et al., 1996; cortex, hippocampus: Maiti et al., 2010). However, we detected a decrease in nNOS protein expression at 0 h and 5 days post-hypoxia, as well as in eNOS at 5 days of reoxygenation. Inducible NOS remained unaltered under such conditions. In this sense, there are controversial results regarding the expression of NOS isoforms in the hypoxic CNS. In contrast to our results, while boosted nNOS protein expression was observed after several hours of hypobaric hypoxia in different areas of the CNS (Prabhakar et al., 1996; Castro-Blanco et al., 2003), including the striatum (Encinas et al., 2004), no changes in nNOS levels were reported in the CNS after H/R (Serrano et al.,

Fig. 8. Quantitative data from image analysis of histological sections of rat striatum stained for nitrotyrosine immunohistochemistry. Experimental groups: Control and 0 h, 24 h and 5 days post-hypoxia. Results are mean values of 25 microphotographs (five microphotographs per animal and five animals per group). The statistically significant differences vs. the control group were expressed as *p < 0.05.

˜uelo et al., 2007). Regarding eNOS, enhanced protein levels 2003; Can ˜ uelo et al., 2007; Kaur were found in the brain in response to H/R (Can et al., 2007). Lastly, although different hypoxia models increased iNOS expression in the brain (Kaur et al., 2007; Wang et al., 2009), a number of former works did not detect this isoform in the hypoxic CNS, including the striatum (Prabhakar et al., 1996; Matsuoka et al., 1997; Castro-Blanco et al., 2003; Serrano et al., 2003; Encinas et al., 2004). This discrepancy is possibly due to the severity and duration of the hypoxia model used, as well as the species and organ investigated. Finally, it is important to note that our conclusions regarding changes in NOS protein expression are based on immunohistochemical analysis following quantification of the immunoreactivity. Our results concerning NOS mRNA and protein expression show a mismatched pattern, which has been observed in prior studies in ˜ uelo et al., 2007; Rus et al., 2010a, 2011a). This our laboratory (Can divergence is frequent, since transcription and translation are influenced by numerous factors that can upset the coordination of the two responses (Li and Carmichael, 2006; Gry et al., 2009). In fact, many physiopathological stimuli, such as hypoxia, have been demonstrated to modulate NOS expression via mechanisms that alter steady-state NOS mRNA levels. These mechanisms involve changes in the rate of NOS gene transcription, as well as alteration of NOS mRNA processing and stability (Kleinert et al., 2004; Searles, 2006). It has been recognized for many years that NADPH-diaphorase (NADPH-d) activity identifies with NOS activity (Dawson and Dawson, 1996; Hope et al., 1991). Our results revealed that in situ NOS activity, detected in some striatal neurons and blood vessels, was significantly reduced throughout the reoxygenation period (0 h, 24 h, and 5 days). By contrast, NADPH-d staining was demonstrated to peak in the striatum after 7 h of hypoxia (Encinas et al., 2004) and after ischaemia/reperfusion (Nakashima et al., 1995). This decline in NADPH-d activity may be due to the decrease

48

F. Molina et al. / Journal of Chemical Neuroanatomy 47 (2013) 42–49

observed in NOS isoform expression. In addition, the remarkable reduction in NADPH-d staining in striatal blood vessels after the hypoxic stimulus suggests that the activity of eNOS, which is located mainly in endothelial cells, may be the main NOS activity affected by short-term hypoxia. Hypobaric hypoxic injury per se reportedly affects the NOSdependent mechanism of NO production (Rodrigo et al., 2000). The final products of NO in vivo are nitrite and nitrate (NOx), and thus the sum of both species is used as an index of total NO production (Green et al., 1982). In this work, we report that NOx levels diminished parallel to NADPH-d activity throughout the reoxygenation period (0 h, 24 h, and 5 days) in the rat striatum. In agreement, NOx values fell in cerebral cortex at 2 h and 24 h posthypoxia following the same hypoxia model described in this work ˜ uelo et al., 2007). However, other studies showed increased (Can (Kaur et al., 2007; Maiti et al., 2010) or unchanged (Lopez-Ramos et al., 2005) NO levels in the hypoxic CNS. As mentioned above, these controversial results are probably due to the tissue examined, and the severity and duration of the hypoxia model. The few studies available that analyzed the striatal NO/NOS system in situations of oxygen deficiency show opposite results from ours in the present work. In this sense, increased NO production and greater NOS expression and activity have been demonstrated in this brain ganglion after hypoxia (Lafuente et al., 2000; Encinas et al., 2004; Maiti et al., 2010) and ischaemia (Nakashima et al., 1995). However, our data revealed that the NO/ NOS system became depleted after acute H/R in the rat striatum. Supporting our findings, the NOS pathway has been shown to be impaired during a hypoxic episode (Manukhina et al., 2000). This phenomenon is related to the decrease in the alveolar O2 partial pressure occurring during hypobaric hypoxia. Because O2 is an essential substrate for NO synthesis by NOS, the activity of these enzymes may descend during hypoxia (Rodrigo et al., 2000), as revealed by our data. However, for cell survival under such conditions, the NO necessary for its vasodilation properties may be generated by reducing nitrites and nitrates, compensating in this way for the reduced NOS activity (Zhang et al., 1998; Berry and Hare, 2004). Nitrates and nitrites, products of the catabolism of NO, are given the role of NO-generating molecules in emergency situations, mainly when the medium becomes acidic (Samouilov et al., 2007). During hypoxia, the reduction of O2 in relation to carbon dioxide reduces the pH in the medium (Calbet et al., 2009), facilitating the generation of NO from the NO-storage molecules. In this context, this NOS-independent NO may partially inhibit the activity of NOS, concretely of eNOS, without decreasing eNOS mRNA levels, as our results reflect (Sheehy et al., 1998). As stated in the Introduction, NO can react with superoxide to nitrate proteins (Kochman et al., 2002). In fact, the nitration of proteins is part of the cycle of NO, which begins with the conversion of nitrates and nitrites to NO. In this way, our data revealed higher levels of nitrotyrosine-modified proteins in the rat striatum at 0 h and 24 h post-hypoxia. Similar results were found after hypobaric hypoxia in the rat striatum (Encinas et al., 2004), cerebellum (Serrano et al., 2003), and cerebral cortex (Castro˜ uelo et al., 2007). As mentioned above, NO Blanco et al., 2003; Can may be generated from nitrates and nitrites under hypoxic conditions. The methodology used in this work to determine the NO level consisted of measuring nitrates and nitrites (NOx) as an indirect way to assess the NO production. Therefore, our data concerning the lower NOx levels suggest that the decrease of these NO-generating molecules may result in the formation of NO, which might result in greater protein nitration. On the other hand, the hypothesis regarding the NO generation from NO-storage molecules under hypoxia is supported by previous data of our research group that revealed that protein nitration is significantly increased after the inhibition of NOS activity by L-NAME (NG-nitro-L-arginine

methyl ester, non-selective inhibitor of NOS activity) in the hypoxic lung (Rus et al., 2010a), heart (Rus et al., 2011c), and striatum (data not shown), indicating, in this case, that striatal NOS-derived NO is not involved in hypoxic-related nitrosative stress. Therefore, the NO responsible for the enhanced nitrated protein expression in this brain ganglion should be generated from nitrates and nitrites. In short, H/R is an important factor contributing to the development of brain injury. Under these conditions, NO production may be altered, and this could lead to a variety of pathologies. In this context, our data showed the enormous intricacy of the striatal NO pathway under situations of oxygen deficiency, demonstrating that acute H/R down-regulated the NOS system in this brain ganglion. However, during these conditions, NO may be produced in a NOS-independent way from the NO-storage molecules (nitrites and nitrates), compensating for the hypoxiareduced NOS activity. The present work may be the basis for future studies to design innovative therapies for hypoxia problems based on NO-pharmacology. Acknowledgements We wish to thank to Dr. Rafael Lomas for his statistic assistance. Supported by Instituto de Salud Carlos III (PI081222), University of Jae´n (RFC/PP2008/UJA_08_16_20), Junta de Andalucı´a (BIO0184), and Fondo Europeo de Desarrollo Regional (FEDER). References Alonso, D., Serrano, J., Rodriguez, I., Ruiz-Cabello, J., Fernandez, A.P., Encinas, J.M., Castro-Blanco, S., Bentura, M.L., Santacana, M., Richart, A., Fernandez-Vizarra, P., Uttenthal, L.O., Rodrigo, J., 2002. Effects of oxygen and glucose deprivation on the expression and distribution of neuronal and inducible nitric oxide synthases and on protein nitration in rat cerebral cortex. Journal of Comparative Neurology 443, 183–200. Beckman, J.S., Koppenol, W.H., 1996. Nitric oxide, superoxide, and peroxynitrite: the good, the bad, and ugly. American Journal of Physiology 271, C1424–C1437. Berry, C.E., Hare, J.M., 2004. Xanthine oxidoreductase and cardiovasculardisease: molecular mechanisms and pathophysiological implications. Journal of Physiology 555, 589–606. Braman, R.S., Hendrix, S.A., 1989. Nanogram nitrite and nitrate determination in environmental and biological materials by vanadium (III) reduction with chemiluminescence detection. Analytical Chemistry 61, 2715–2718. Calbet, J.A., Ra˚degran, G., Boushel, R., Saltin, B., 2009. On the mechanisms that limit oxygen uptake during exercise in acute and chronic hypoxia: role of muscle mass. Journal of Physiology 587, 477–490. ˜ uelo, A., Siles, E., Martı´nez-Romero, R., Peinado, M.A.M.A., Martı´nez-Lara, E., Can 2007. The nitric oxide system response to hypoxia/reoxygenation in the aged cerebral cortex. Experimental Gerontology 42, 1137–1145. Castro-Blanco, S., Encinas, J.M., Serrano, J., Alonso, D., Gomez, M.B., Sanchez, J., RiosTejada, F., Fernandez-Vizzara, P., Fernandez, A.P., Martinez-Murillo, R., Rodrigo, J., 2003. Expression of the nitrergic system and protein nitration in adult rat brains submitted to hypobaric hypoxia. Nitric Oxide 8, 182–201. Chen, H., Li, D., Saldeen, T., Mehta, J.L., 2001. TGFbeta(1) modulates NOS expression and phosphorylation of Akt/PKB in rat myocytes exposed to hypoxia-reoxygenation. American Journal of Physiology-Heart and Circulatory Physiology 281, H1035–H1039. Davis, K.L., Martin, E., Turko, I.V., Murad, F., 2001. Novel effects of nitric oxide. Annual Review of Pharmacology and Toxicology 41, 203. Dawson, V.L., Dawson, T.M., 1996. Nitric oxide neurotoxicity. Journal of Chemical Neuroanatomy 10, 179–190. Del Moral, M.L., Esteban, F.J., Herna´ndez, R., Blanco, S., Molina, F.J., Martı´nez-Lara, E., Siles, E., Viedma, G., Ruiz, A., Pedrosa, J.A., Peinado, M.A., 2004. Immunohistochemistry of neuronal nitric oxide synthase and protein nitration in the striatum of the aged rat. Microscopy Research and Technique 64, 304–311. Eisei, N., Akihide, N., Koji, U., Hirokazu, T., Minoru, O., Toshiro, F., Sergey, B., Micheal, S.G., 2001. Oxidative and nitrosative stress in acute renal ischemia. American Journal of Physiology 281, F948. ˜ oz, P., Rodrigo, J., Encinas, J.M., Ferna´ndez, A.P., Salas, E., Castro-Blanco, S., Mun Serrano, J., 2004. Nitric oxide synthase and NADPH-diaphorase after acute hypobaric hypoxia in the rat caudate putamen. Experimental Neurology 186, 33–45. Erecinska, M., Silver, I.A., 1996. Calcium handling by hippocampal neurons under physiologic and pathologic conditions. Advances in Neurology 71, 119–136. Fontijn, A., Sabadell, A.J., Ronco, R.J., 1997. Homogenous chemiluminiscent measurement of nitric oxide with ozone. Implications for continuous selective monitoring of gaseous air pollutants. Analytical Chemistry 42, 575–579.

F. Molina et al. / Journal of Chemical Neuroanatomy 47 (2013) 42–49 Green, L.C., Wagner, D.A., Glogowski, J., Skipper, P.L., Wishnok, J.S., Tannenbaum, S.R., 1982. Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Analytical Biochemistry 126, 131–138. Gry, M., Rimini, R., Stro¨mberg, S., Asplund, A., Ponte´n, F., Uhle´n, M., Nilsson, P., 2009. Correlations between RNA and protein expression profiles in 23 human cell lines. BMC Genomics 10, 365. Haddad, I.Y., Pataki, G., Hu, P., Galliani, C., Beckman, J.S., Matalon, S., 1994. Quantitation of nitrotyrosine levels in lung sections of patients and animals with acute lung injury. Journal of Clinical Investigation 94, 2407–2413. Hope, B.T., Michael, G.J., Knigge, K.M., Vincent, S.R., 1991. Neuronal NADPH diaphorase is a nitric oxide synthase. Proceedings of the National Academy of Sciences of the United States of America 88, 2811–2814. Iadecola, C., 1997. Bright and dark sides of nitric oxide in ischemic brain injury. Trends in Neurosciences 20, 132–139. Kaur, C., Sivakumar, V., Lu, J., Ling, E.A., 2007. Increased vascular permeability and nitric oxide production in response to hypoxia in the pineal gland. Journal of Pineal Research 42, 338–349. Kleinert, H., Pautz, A., Linker, K., Schwarz, P.M., 2004. Regulation of the expression of inducible nitric oxide synthase. European Journal of Pharmacology 500, 255– 266. Kochman, A., Koska, Cz., Metodiewa, D., 2002. Submolecular adventures of brain tyrosine: what are we searching for now? Amino Acids 23, 95–101. Kugler, P., Ho¨fer, D., Mayer, B., Drenckhahn, D., 1994. Nitric oxide synthase and NADP-linked glucose-6-phosphate dehydrogenase are co-localized in brush cells of rat stomach and pancreas. Journal of Histochemistry and Cytochemistry 42, 1317–1321. Kuo, W.N., Kocis, J.M., Mewar, M., 2002. Protein denitration/modification by glutathione-S-transferase and glutathione peroxidase. Journal of Biochemistry, Molecular Biology, and Biophysics 6, 143–146. Lafuente, J.V., Adan, B., Cervos-Navarro, J., 2000. Effects of chronic deep hypoxia on the expression of nitric oxide synthase in the rat brain. Acta Neurochirurgica (Suppl. 76), 111–113. Laitinen, J., Liesivuori, J., Linnainmaa, M., Kalliokoski, P., 1993. Evaluation of monitoring methods for nitrogen oxides. Annals of Occupational Hygiene 37, 307– 314. Li, H., Witte, K., August, M., Brausch, I., Godtel-Armbrust, U., Habermeier, A., Closs, E.I., Oelze, M., Munzel, T., Forstermann, U., 2006. Reversal of endothelial nitric oxide synthase uncoupling and up-regulation of endothelial nitric oxide synthase expression lowers blood pressure in hypertensive rats. Journal of the American College of Cardiology 47, 2536–2544. Li, S., Carmichael, S.T., 2006. Growth-associated gene and protein expression in the region of axonal sprouting in the aged brain after stroke. Neurobiology of Disease 23, 362–373. ˜ uelo, A., Martinez-Lara, E., Lopez-Ramos, J.C., Martinez-Romero, R., Molina, F., Can Siles, E., Peinado, M.A., 2005. Evidence of a decrease in nitric oxide-storage molecules following acute hypoxia and/or hypobaria, by means of chemiluminescence analysis. Nitric Oxide 13, 62–67. Maiti, P., Singh, S.B., Ilavazhagan, G., 2010. Nitric oxide system is involved in hypobaric hypoxia-induced oxidative stress in rat brain. Acta Histochemica 112, 222–232. Manukhina, E.B., Mashina SYu, Smirin, B.V., Lyamina, N.P., Senchikhin, V.N., Vanin, A.F., Malyshev, IYu., 2000. Role of nitric oxide in adaptation to hypoxia and adaptive defense. Physiological Research 49, 89–97. Manzoni, O., Prezeau, L., Marin, P., Deshager, S., Bockaert, J., Fagni, L., 1992. Nitric oxide-induced blockade of NMDA receptors. Neuron 8, 653–662. Marleta, M.A., 1993. Nitric oxide synthase: function and mechanism. Advances in Experimental Medicine and Biology 338, 281–284. ˜ uelo, A., Martı´nez- Lara, E., Herna´ndez, R., Del Moral, M.L., Martı´nez-Romero, R., Can Pedrosa, J.A., Peinado, M.A., Siles, E., 2006. Aging affects but does not eliminate the enzymatic antioxidative response to hypoxia/reoxygenation in cerebral cortex. Experimental Gerontology 41, 25–31. Matsuoka, Y., Kitamura, Y., Tooyama, I., Kimura, H., Taniguchi, T., 1997. In vivo hypoxia-induced neuronal damage with an enhancement of neuronal nitric oxide synthase immunoreactivity in hippocampus. Experimental Neurology 146, 57–66. Moncada, S., Higgs, E.A., 1991. Endogenous nitric oxide: physiology, pathology and clinical relevance. European Journal of Clinical Investigation 21, 361–374. Moncada, S., Higgs, E.A., 1993. The L-arginine-nitric oxide pathway. New England Journal of Medicine 329, 2002–2012. Moraes, N., Zago, D., Gagioti, S., Hoshida, M.S., Bevilacqua, E., 2001. NADPHdiaphorase activity and nitric oxide synthase isoforms in the trophoblast of Calomys callosus. Journal of Anatomy 198, 443–453. Nagelkerke, A., Mujcic, H., Wouters, B., Span, P.N., 2010. 18S is an appropriate housekeeping gene for in vitro hypoxia experiments. British Journal of Cancer 103, 590. Nakashima, M.N., Yamashita, K., Kataoka, Y., Yamashita, Y.S., Niwa, M., 1995. Time course of nitric oxide synthase activity in neuronal, glial, and endothelial cells of rat striatum following focal cerebral ischemia. Cellular and Molecular Neurobiology 15, 341–349.

49

Paxinos, G., Watson, C., 1998. The Rat Brain in Stereotaxic Coordinates. Academic Press, London. Peers, C., Pearson, H.A., Boyle, J.P., 2007. Hypoxia and Alzheimer’s disease. Essays in Biochemistry 43, 153–164. Prabhakar, N.R., Pieramici, S.F., Premkumar, D.R., Kumar, G.K., Kalaria, R.N., 1996. Activation of nitric oxide synthase gene expression by hypoxia in central and peripheral neurons. Brain Research. Molecular Brain Research 43, 341–346. Ricciardolo, F.L., Di Stefano, A., Sabatini, F., Folkerts, G., 2006. Reactive nitrogen species in the respiratory tract. European Journal of Pharmacology 533, 240– 252. Ricciardolo, F.L., Sterk, P.J., Gaston, B., Folkerts, G., 2004. Nitric oxide in health and disease of the respiratory system. Physiological Reviews 84, 731–765 (Review). Riveros Moreno, V., Heffernan, B., Torres, B., Chubb, A., Charles, I., Moncada, S., 1995. Purification to homogeneity and characterisation of rat brain recombinant nitric oxide synthase. European Journal of Biochemistry 230, 52–57. Rodrigo, J., Castro-Blanco, S., Ferna´ndez, A.P., Alonso, D., Serrano, J., Ferna´ndezVizarra, P., Encinas, J.M., Lo´pez, J.C., Go´mez de Terreros, F.J., del Valle, J., Navarro, L., Lo´pez, J.A., Santacana, M., Bentura, M.L., Uttenthal, L.O., Rı´os Tejada, F., 2000. Expression of neuronal and inducible nitric oxide synthase isoforms and generation of protein nitrotyrosine in rat brain following hypobaric hypoxia. RTO HFM ‘‘Operational Medical Issues in Hypo- and Hyperbaric Conditions.’’ RTO MP-062 38, 1–13. Roufail, E., Stringer, M., Rees, S., 1995. Nitric oxide synthase immunoreactivity and NADPH diaphorase staining are co-localised in neurons closely associated with the vasculature in rat and human retina. Brain Research 684, 36–46. Rouschop, K.M., Ramaekers, C.H., Schaaf, M.B., Keulers, T.G., Savelkouls, K.G., Lambin, P., Koritzinsky, M., Wouters, B.G., 2009. Autophagy is required during cycling hypoxia to lower production of reactive oxygen species. Radiotherapy and Oncology 92, 411–416. Rus, A., Del Moral, M.L., Molina, F., Peinado, M.A., 2011a. Upregulation of cardiac NO/ NOS system during short-term hypoxia and the subsequent reoxygenation period. European Journal of Histochemistry 55, e17. Rus, A., Molina, F., Peinado, M.A., Del Moral, M.L., 2010a. Endogenous nitric oxide can act as beneficial or deleterious in the hypoxic lung depending on the reoxygenation time. Anatomical Record (Hoboken) 293, 2193–2201. Rus, A., Peinado, M.A., Blanco, S., Del Moral, M.L., 2011b. Is endothelial-nitric-oxidesynthase-derived nitric oxide involved in cardiac hypoxia/reoxygenation-related damage? Journal of Bioscience 36 (1), 69–78. Rus, A., Peinado, M.A., Castro, L., Del Moral, M.L., 2010b. Lung eNOS and iNOS are reoxygenation time-dependent upregulated after acute hypoxia. Anatomical Record (Hoboken) 293, 1089–1098. Rus, A., Molina, F., Peinado MA´, Del Moral, M.L., 2011c. Nitric oxide averts hypoxiainduced damage during reoxygenation in rat heart. Microscopy Research and Technique 74, 1093–1103. Samouilov, A., Woldman, Y.Y., Zweier, J.L., Khramtsov, V.V., 2007. Magnetic resonance study of the transmembrane nitrite diffusion. Nitric Oxide 16, 362–370. Searles, C.D., 2006. Transcriptional and posttranscriptional regulation of endothelial nitric oxide synthase expression. American Journal of Physiology-Cell Physiology 291, C803–C816. Serrano, J., Encinas, J.M., Salas, E., Fernandez, A.P., Castro-Blanco, S., FernandezVizarra, P., Bentura, M.L., Rodrigo, J., 2003. Hypobaric hypoxia modifies constitutive nitric oxide synthase activity and protein nitration in the rat cerebellum. Brain Research 976, 109–119. Sheehy, A.M., Burson, M.A., Black, S.M., 1998. Nitric oxide exposure inhibits endothelial NOS activity but not gene expression: a role for superoxide. American Journal of Physiology 274, L833–L841. Shu, S.Y., Ju, G., Fan, L.Z., 1988. The glucose oxidase-DAB-nickel method in peroxidase histochemistry of the nervous system. Neuroscience Letters 85, 169–171. Snyder, S.H., Bredt, D.S., 1991. Nitric oxide as a neuronal messenger. Trends in Pharmacological Sciences 12, 125–128. Snyder, S.H., 1992. Nitric oxide and neurons. Current Opinion in Neurobiology 2, 323–327. Sternberger, L.A., Sternberger, N.H., 1986. The unlabeled antibody method: comparison of peroxidase-antiperoxidase with avidin–biotin complex by a new method of quantification. Journal of Histochemistry and Cytochemistry 34, 599–605. Uttenthal, L.O., Alonso, D., Fernandez, A.P., Campbell, R.O., Moro, M.A., Leza, J.C., Lizasoain, I., Esteban, F.J., Barroso, J.B., Valderrama, R., Pedrosa, J.A., Peinado, M.A., Serrano, J., Richart, A., Bentura, M.L., Santacana, M., Martinez-Murillo, R., Rodrigo, J., 1998. Neuronal and inducible nitric oxide synthase and nitrotyrosine immunoreactivities in the cerebral cortex of the aging rat. Microscopy Research and Technique 43, 75–88. Wang, Z.F., Kang, J., Dai, B., 2009. Expression and activation of hypoxia inducible factor-1alpha and iNOS in the brain of rats with chronic intermittent hypoxia. Zhonghua Jie He He Hu Xi Za Zhi. 32, 739–743. Zhang, Z., Naughton, D., Winyard, P.G., Benjamin, N., Blake, D.R., Symons, M.C., 1998. Generation of nitric oxide by a nitrite reductase activity of xanthine oxidase: a potential pathway for nitric oxide formation in the absence of nitric oxide synthase activity. Biochemical and Biophysical Research Communications 249, 767–772.