Acute toxicity of bisphenol A and its structural analogues and transcriptional modulation of the ecdysone-mediated pathway in the brackish water flea Diaphanosoma celebensis

Ecotoxicology and Environmental Safety 179 (2019) 310–317

Contents lists available at ScienceDirect

Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv

Acute toxicity of bisphenol A and its structural analogues and transcriptional modulation of the ecdysone-mediated pathway in the brackish water flea Diaphanosoma celebensis

T

Soyeon In1, Hae-Won Yoon1, Je-Won Yoo, Hayoung Cho, Ryeo-Ok Kim, Young-Mi Lee∗ Department of Life Science, College of Natural Sciences, Sangmyung University, Seoul, 03016, Republic of Korea

ARTICLE INFO

ABSTRACT

Keywords: Bisphenol A Bisphenol S Bisphenol F Endocrine disrupting chemicals Ecdysone receptor Brackish water flea Real-time RT-PCR

Bisphenol A (BPA) is a representative endocrine disrupting chemical (EDC) that has estrogenic effects in aquatic animals. In recent years, due to the continuing usage of BPA, its analogues have been developed as alternative substances to replace its use. The molting process is a pivotal point in the development and reproduction of crustaceans. However, studies of the effects of EDCs on molting in crustaceans at the molecular level are scarce. In the present study, we examined the acute toxicity of BPA and its analogues bisphenol F (BPF) and S (BPS) to the brackish water flea Diaphanosoma celebensis. We further identified four ecdysteroid pathway - related genes (cyp314a1, EcRA, EcRB, and USP) in D. celebensis, and investigated the transcriptional modulation of these genes during molting and after exposure to BPA and its analogues for 48 h. Sequencing and phylogenetic analyses revealed that these four genes are highly conserved among arthropods and may be involved in development and reproduction in the adult stage. The mRNA expression patterns of cyp314a1, EcRA and USP were matched with the molting cycle, suggesting that these genes play a role in the molting process in the adult stage in cladocerans. Following relative real-time polymerase chain reaction (RT-PCR) analyses, BPA and its analogues were found to modulate the expression of each of these four genes differently, indicating that these compounds can disrupt the normal endocrine system function of D. celebensis. This study improves our understanding of the molecular mode of action of BPA and its analogues in D. celebensis.

1. Introduction Endocrine disrupting chemicals (EDCs) have been the cause of great concern for the aquatic environment because they can stimulate or inhibit the normal function, production, and transport of endogenous hormones, resulting in adverse effects on growth, development, and reproduction in aquatic vertebrates and invertebrates (Segner et al., 2003). Bisphenol A (2,2,-bis-(4-hydroxyphenyl)propane; BPA) is a representative EDC, and has been widely used in the manufacturing of polycarbonate plastics, paper coatings, and epoxy resins for over 50 years (Vandenberg et al., 2012; Chen et al., 2016). Due to its continuous usage, BPA has been detected in many aquatic environments, including natural water bodies (Suzuki et al., 2004), wastewater (Lee et al., 2015), and sediments (Liao et al., 2012), as well as in living organisms (Zhang et al., 2013). Recently, 15 BPA analogues with two hydroxyphenyl groups each have been developed as alternative substances to

replace BPA because many studies showed that BPA has endocrine disrupting effects (Canesi and Fabbri, 2015). In particular, bisphenol S (4,40-sulfonyldiphenol; BPS) and bisphenol F (4,40-dihydroxydiphenylmethane; BPF), in addition to BPA, are now widely used in diverse applications, such as food packaging, receipt papers, dyes and tanning agents, and dental devices (Cabaton et al., 2009; Naderi et al., 2014). Concurrently with their increasing use in production, BPA (n.d.13,370 ng/g dw) and BPF (n.d.- 9,650 ng/g dw) have become the predominant bisphenols detected in the sediment of South Korea, followed by BPS (n.d.- 1,970 ng/g dw) (Liao et al., 2012). Several recent studies demonstrated that BPA analogues also have endocrine disruptive effects, like those of BPA, in rats and Daphnia (reviewed by Rochester and Bolden, 2015). The molting process in arthropods is modulated by ecdysone, and is a pivotal step in their growth, development, metamorphosis, and reproduction (Chang and Kaufman, 2005; Lafont and Mathieu, 2007). Ecdysone is converted into an active hormone, 20-hydroxyecdysone

Corresponding author. E-mail address: [email protected] (Y.-M. Lee). 1 These authors contributed equally in this work. ∗

https://doi.org/10.1016/j.ecoenv.2019.04.065 Received 29 January 2019; Received in revised form 18 April 2019; Accepted 22 April 2019 Available online 26 April 2019 0147-6513/ © 2019 Elsevier Inc. All rights reserved.

Ecotoxicology and Environmental Safety 179 (2019) 310–317

S. In, et al.

(20E), in a process catalyzed by ecdysone 20-monooxygenase (which is encoded by the CYP314A1 (Shade) gene) (Lafont et al., 2005). Subsequently, 20E is transported into the nucleus by binding to a heterodimer of two nuclear receptors (NRs), ecdysone receptor (EcR) and ultraspiracle (USP), which bind to the ecdysone response element (ERE) in the promoter regions of ecdysone-responsive genes and activate their transcription (Nakagawa and Henrich, 2009). There have been reports that several EDCs can modulate the expression of EcR and USP, and thus the, ecdysteroid-mediated pathway including these NRs may be a potential target of EDCs in arthropods (Kato et al., 2007; Hwang et al., 2010; Planelló et al., 2008; Puthumana et al., 2017). In particular, EcR and USP have been extensively investigated in insects (Martin et al., 2001; Casida, 2009; Nakagawa and Henrich, 2009). To date, however, the presence of EcR and USP have only been confirmed in studies of a few crustacean species, such as crabs (Kim et al., 2005), shrimps (Asazuma et al., 2007), freshwater water fleas (Kato et al., 2007), and copepods (Hwang et al., 2010; Puthumana et al., 2017). Although BP analogues are broadly distributed in the sediments of many marine environments, their endocrine disrupting effects are still lack. In addition, since the molting process is essential to survival in crustaceans, modulation of ecdysteroid pathway - related genes including EcR, USP, cyp314A1 in response to BP analogue are necessary, in particular, in marine crustaceans. The brackish water flea, Diaphanosoma celebensis (Cladocera, Sididae) is a euryhaline crustacean that is widely distributed in tropical Asia. Due to its role in the transfer of energy to upper trophic levels in the aquatic food webs, this species has been studied for its potential use in aquaculture as a substitute of live foods (e.g. rotifers, Artemia) for fish. In addition, it has several advantageous features, such as easy maintenance under laboratory conditions, short generation times (4–5 days), and parthenogenetic reproduction, which suggest that it may be useful as a model species for ecotoxicological studies (Marcial and Hagiwara, 2007; Kim et al., 2018; Bae et al., 2018). In a previous study, D. celebensis exposed to 17b-estradiaol and 4-nonylphenol showed modified reproduction (Marcial and Hagiwara, 2007). Thus, we hypothesized that molting process related genes can be modulated by such EDCs in this species. Potential target genes for EDCs were selected from our previous study, in which the transcriptome of D. celebensis was analyzed (Kim et al., 2018). In this study, the acute toxic effects of BPA, and its analogues, BPS and BPF on D. celebensis were investigated. Molecular cloning and sequence analyses of ecdysone-mediated pathway-related genes (two EcRs, USP, and cyp314a1) was also performed, and then their transcriptional modulation in D. celebensis after exposure to BPA and its analogues was further examined. This study will help improve our understanding of the molecular mode of action of BPA and its analogues in marine organisms.

Instant Ocean (Aquarium system, France). Cultures were maintained under a 12 h:12 h light/dark photoperiod and at a temperature of 25 ± 1 °C. Chlorella vulgaris cultured in Jaworski's medium was added as a food source once every 2 day at a density of 4 × 107 cells/L. 2.3. Waterborne exposure tests Stock solutions of BPA (2,2,-bis-(4-hydroxyphenyl)propane; 3 mg/ mL), BPF (4,40-dihydroxydiphenylmethane; 5 mg/mL) and BPS (4,40sulfonyldiphenol; 23 mg/mL) were made by dissolving these respective chemicals in dimethyl sulfoxide (DMSO). To determine the sublethal concentration to be used in the gene expression experiment, 24 h and 48 h acute toxicity tests were carried out according to OECD test guideline 202 (TG202; OECD, 2004) using adult D. celebensis (4-dayold) with 4 replicates of 5 individuals each per test. A final DMSO concentration of less than 0.05% was used, at which no mortality was observed. For our gene expression experiment, working solutions were prepared by adding stock solution to each 200 mL of 15 psμ seawater. Adult D. celebensis (4 days old) were exposed to three different concentrations each of BPA (0.12, 0.6, and 3.0 mg/L), BPS (0.92, 4.6, and 23.0 mg/L) and BPF (0.2, 1.0, and 5.0 mg/L) for 48 h in a 500 mL beaker, with ∼200 individuals exposed to each concentration. These concentrations were selected from those of our acute test. All tests were performed in triplicate. 2.4. Total RNA extraction and cDNA synthesis To quantify temporal patterns in gene expression during the molting period, we used 4-day-old D. celebensis. Each sample was harvested every 24 h for 6 days. After exposure to BPA and its analogues, each sample was collected and homogenized in five volumes of TRIzol reagent (Thermo Fisher Scientific Inc., USA). The total RNA was extracted from D. celebensis according to the manufacturer's instructions and stored at −80 °C until it was used in later analyses. Total RNA quality and quantity were confirmed by gel electrophoresis and Nano drop (Maestrogen nano drop, Taiwan). The cDNA was synthesized from 1 μg of the total RNA using ReverTra Ace® qPCR RT Master Mix (Toyobo Corp. Ltd., Japan). 2.5. Polymerase chain reaction (PCR) and sequence analysis To identify and confirm the presence of the full-length cDNA sequences of cyp314a1, two EcRs, and USP, sequences were obtained from our local database of D. celebensis transcriptome (Molecular Toxicology Laboratory, Sangmyung University). The genes of D. celebensis were designated Dccyp314a1, DcEcRA and DcEcRB, and USP, respectively. All PCR reactions included 2.5 μL of 10 × reaction buffer, 2.5 μL of dNTP (2 mM), 1 μL of 10 pmol primer set (Table 1), 1 μL of cDNA or gDNA, 0.5 μL of Geneall Taq (5U/μL), and 16.5 μL of PCR-grade water. The PCR protocol was as follows: an initial step at 95 °C for 2min; 35 cycles of 95 °C for 30s, 55 °C for 30s, 72 °C for 2min; and finally an extension step at 72 °C for 10min. The PCR product was visualized on 1% agarose gel and a purified AccuPrep ® Gel Purification Kit (Bioneer, South Korea) for sequencing. Conserved domains or motifs were analyzed using National Center for Biotechnology Information (NCBI). Basic Local Alignment Search Tool (BLAST) homology searches of these databases were carried out using the Blast +2.8.1 software from the NCBI.

2. Materials and methods 2.1. Reagents All of the chemicals and reagents used in this study were of molecular biology and ultrapure grade. These were purchased from SigmaAldrich Co. (Saint Louis, MO, USA) unless otherwise specified. All nucleotide synthesis and DNA nucleotide sequencing was performed at Macrogen (Seoul, South Korea). 2.2. Experimental organisms

2.6. Phylogenetic analysis

The strain of the cladoceran D. celebensis used in this study was obtained from Dr. Kyun-Woo Lee of the Korea Institute of Ocean Science & Technology (KIOST; Busan, South Korea) and has been maintained in the molecular toxicology laboratory of Sangmyung University, South Korea since 2015. The culture medium was 0.2 μmfiltered 15 practical salinity unit (psu) artificial seawater using an

To determine the phylogenetic positions of the cyp314a1, two EcRs and USP of D. celebensis, alignments of their deduced amino acid sequences with those of other species retrieved from GenBank were performed using ClustalX 1.83. Total sequence identity and the sequence identity of two conserved domains, the ligand-binding domain 311

Ecotoxicology and Environmental Safety 179 (2019) 310–317

S. In, et al.

Table 1 Primers used in this study. Gene

Oligo name

Sequence (5’→ 3′)

Amplicon size (bp)

Remarks

Dc_cyp314A1 (MK336427)

RT-F RT-R RT-F RT-R RT-F RT-R RT-F RT-R RT-F RT-R

CAACATACTGAGCAACGAAC ATGACACACGCCTTGAGATA GCATCAATGGTCACAGCAC GACTGTAAGGCGGTTCGTAG CGCTCCCTCGTTTACAGTC GATCCACTTCGCCAATATC CATCGGTCTCAAATGTCTGG TCCAGCATTTCCATCAAG TGGAAGGATTGACAGATTGA AAATCGCTCCACCAACTAAG

126

Real-time PCR amplification

96

Real-time PCR amplification

107

Real-time PCR amplification

87

Real-time PCR amplification

81

Real-time PCR amplification

Dc_EcRA (MK336428) Dc_EcRB (MK336429) Dc_USP (MK336430) 18S rRNA (AF144210.1)

(LBD) and DNA-binding domain (DBD) of the EcRs and USP, were calculated in GENEDOC (ver. 2.6) after being aligned using ClustalX. Phylogenetic trees were then constructed in MEGA 7.0 by estimation with 1000 bootstrap replicates using neighbor-joining methods.

binding domain (DBD) (267–357 aa for DcEcRA; 194–284 aa for DcEcRA; 74–150 aa for DcUSP) and ligand-binding domain (LBD) (425–653 aa for DcEcRA; 352–580 aa for DcEcRB; 180–382 aa for DcUSP) (Figs. S1 and S3). In particular, the isoform specific region of EcR was detected in both DcEcRs. DcEcRA had the specific A box in the position from 211 to 232 aa, whereas DcEcRB had the specific B-box in 108–126 aa of the A/B region (Fig. S2). As shown in Fig. S4, Dccyp314a1 had five conserved motifs, including Helix-C (WxxxR), Helix-I (GxE/DDT/S), Helix-K (ExxR), aromatic region (PERF, PxxFxPE/DRF), and the heme-binding region (PFxxGxRxCxG/A), which are commonly detected in cytochrome P450 (Maeda et al., 2008). In multiple alignments of the deduced amino acids of DcEcRs with those of other species, the shared total amino acid sequence identities of DcEcRA and DcEcRB ranged from 18% (Bombyx mori) to 68% (D. magna), and from 29% (Drosophila melanogaster) to 74% (D. magna), respectively (Table 2). The sequence identity between DcEcRA and DcEcRB was 68%. The conserved domains of DcEcRA and DcEcRB showed higher identities: that of DBD was 74–97% of identity in EcRA and 78–97% in EcRB; while that of LBD was 62–95% in EcRA and 56–95% in EcRB (Table 2). When the deduced amino acid sequences of DcUSP were compared with those of other species retrieved from GenBank, DcUSP showed the highest identity to D. magna USP (86%) and the lowest identity to insect USP (41%). The sequence identity of DBD ranged from 87% (T. japonicus) to 100% (D. magna), whereas those of NBD was from 42% (D. melanogaster) to 91% (D. magna) (Table 2). Dccyp314a1 had the highest sequence identity to that of Daphnia (49%) (data not shown).

2.7. Relative real-time polymerase chain reaction (RT-PCR) To examine patterns in the transcriptional expression of D. celebensis cyp314, two EcRs, and USP after exposure to BPA and its analogues, quantitative RT-PCR was performed in a CFX96™ real-time PCR system (Bio-Rad, USA). Each PCR reaction involved 2 μL of cDNA and 2 μL of a 10 pmol primer set (Table 1). Target gene - specific primers were designed for use in this study, in particular to allow the two EcRs, EcRA and EcRB, to be discriminated from each other. Each of the PCR products were analyzed on a 1.0% agarose gel under a UV transilluminator to check for the occurrence of a single band on the gel. Efficiency tests were performed, and showed that 90–105% efficiency was achieved. The PCR conditions were as follows: an initial step at 95 °C for 10min, followed by 40 cycles at 95 °C for 15sec and 60 °C for 1min. To check the amplification of a specific product, melting curves were produced under the following conditions: 95 °C for 15sec and then 60 °C for 1min with a 0.5 °C increase per second. All of these experiments used SYBR master mix (KAPA Bioassay System, USA), and were performed in triplicate. The threshold cycle (Ct) from each experiment was normalized relative to that of D. celebensis 18s rRNA (AF144210.1). The fold change was calculated using the 2-△△Ct method (Livak and Schmittgen, 2001).

3.2. Molecular phylogenetic analysis

2.8. Statistical analyses

Phylogenetic analyses of DcEcRA, DcEcRB, DcUSP, and Dccyp314a1 were performed with those of other species retrieved from GenBank.

Data from all experiments were presented herein as the mean ± standard deviation (S.D.) of three replicates. Lethal concentration (LCx) values were calculated using ToxRat professional version 2.09 (ToxRat Solutions GmbH). Relative mRNA expression levels were compared among treatments using one-way analysis of variance (oneway ANOVA) followed by Tukey's test. The PASW Statistics 18.0 program (SPSS Inc., Chicago, IL, USA) was used for all statistical analyses. A p value below 0.05 was regarded as statistically significant.

Table 2 Sequence identities of total region and two conserved domains, DBD and LBD in DcEcRs and DcUSP compared to those of other organisms.

EcR

3. Results 3.1. Molecular cloning of ecdysone pathway - related genes from D. celebensis The full-length cDNA sequences of two ecdysone receptors from D. celebensis (designated DcEcRA and DcEcRB, respectively) as well as Dccyp314a1 and DcUSP were cloned and sequenced in this study. Information on the amplified genes is summarized in Table S1. Searches of the NCBI databases for conserved domains revealed that the three nuclear receptors (NRs), DcEcRA, DcEcRB and DcUSP shared common NR structure (A/B-C-D-E/F), and two conserved domains, the DNA-

USP

312

Species

DBD

LBD

Total

GenBank Accession No.

D. celebensis EcRA D. magna EcRA1 D. magna EcRA2 D. melanogaster EcRA B. mori EcRA D. celebensis EcRB D. magna EcRB D. melanogaster EcRB B. mori EcRB D. celebensis USP D. magna RXR D. melanogaster USPA D. melanogaster USPB B. mori USP P. nana USP T. japonicus USP

1.00 0.97 0.97 0.86 0.74 1.00 0.97 0.86 0.78 1.00 1.00 0.93 0.93 0.93 0.88 0.87

1.00 0.95 0.95 0.62 – 1.00 0.95 0.62 0.56 1.00 0.91 0.42 0.42 0.43 0.51 0.60

1.00 0.68 0.65 0.29 0.18 1.00 0.74 0.29 0.38 1.00 0.86 0.41 0.41 0.41 0.47 0.49

This study BAF49029.1 BAF49031.1 NP_724456.1 NP_001166848.1 This study BAF49033.1 NP_724460.1 NP_001166846.1 This study ABF74729.1 NP_476781.1 NP_001259168.1 XP_021205553.1 APG80612.1 AID52845.1

Ecotoxicology and Environmental Safety 179 (2019) 310–317

S. In, et al.

Fig. 1. Phylogenetic analysis of the relationship between Diaphanosoma celebensis EcR and USP (A) and cyp314a1 (B) with those of other species constructed by the neighbor-joining method using MEGA 7.0 with 1000 bootstraps replicates. The GenBank accession no. of amino acid sequences used in phylogenetic analysis are as follows; for EcR, Daphnia magna (BAF49029.1; BAF49031.1; BAF49033.1), Tigriopus japonicus (ADD82902.1), Paracylopina nana (APG80611.1), Drosophila melanogaster (NP_724460.1; NP_724456.1), Bombyx mori (NP_001166848.1; NP_001037331.2; NP_001166846.1), for USP, D. magna (ABF74729.1), D. melanogaster (NP_476781.1; NP_001259168.1), B. mori (XP_021205553.1), P. nana (APG80612.1), T. japonicus (AID52845.1), for cyp314a1, D. magna (BAF35770.1), D. pulex (EFX77008.1), Zootermopsis nevadensis (XP_021924882.1), D. melanogaster (AAQ05972.1), Aedes aegypti (AAX85208.1), B. mori (BAE45332.1).

The cladoceran EcRA and EcRB were closely clustered with these genes of D. celebensis, but isoform-specific clustering was not observed (Fig. 1A). EcR and USP clustered separately, and each cluster was divided into three groups comprising the genes of cladocerans, copepods and insects. In the case of cyp314a1, cladoceran orthologues of this gene were also distinctly clustered with the insect cyp314a1 (Fig. 1B).

preliminary tests, molting was detected at an age of 5 days and 7–8 days under culture conditions. Thus, the mRNA levels at an age of 4 days were compared to those at the other ages (in days). Dccyp314a1 (Fig. 2A), DcEcRA (Fig. 2B), and DcUSP (Fig. 2D) showed similar expression patterns, having two peaks at ages of 5 days and 7–8 days, which matched the observed molting periods. On the other hand, expression levels of DcEcRB (Fig. 2C) rose only at an age of 8 days.

3.3. Acute toxicity 3.5. Transcriptional expression profiles of ecdysone pathway related genes in response to BPA and its analogues

BPA and its analogues had negative effects on the survival of D. celebensis after 24- and 48-h exposures. Based on the immobilization test, the concentrations at which 10% and 50% of the D. celebensis were killed within 24 h and 48 h (i.e. the 24 h- and 48 h- LC10 and LC50 values, respectively), and their 95% confidential intervals (C.I.) were determined. As shown in Table 3, the 24-h LC50 was 7.45 mg/L (95% C.I. 6.79–8.18 mg/L) for BPA, 106.64 mg/L (95% C.I. 73.51–154.70 mg/L) for BPS, and 17.42 mg/L (95% C.I. 10.33–46.50 mg/L) for BPF. The order of toxicity to D. celebensis was BPA > BPF > BPS in this study.

When D. celebensis was treated with BPA (0.12, 0.6, and 3.0 mg/L), BPS (0.92, 4.6, and 23.0 mg/L), and BPF (0.6, 1.0, and 5.0 mg/L) with different concentrations for 48 h, the mRNA expression levels of Dccyp314a1, DcEcRA, DcEcRB and DcUSP were investigated using qRTPCR. BPA significantly increased Dccyp314a1 and DcEcRA mRNA levels at low concentrations, and the expression of these mRNAs reached its maximum level at a BPA concentration of 0.6 mg/L (with an approximately 3-fold-change for cyp314a and a 5.5-fold-change for EcRA) (Fig. 3A). Meanwhile, DcEcRB and DcUSP expression was slightly but significantly elevated at intermediate concentrations. Normal levels of DcEcRB expression were recovered at high concentrations, while DcUSP expression remained altered. In D. celebensis exposed to BPS, all genes were down-regulated at 0.92 mg/L, and a significant increase in Dccyp314a1 and DcEcRB expression was observed at 23 mg/L (Fig. 3B).

3.4. Involvement of ecdysone pathway - related genes in the molting process To investigate the role of cyp314a1, EcRA, EcRB and USP during the molting process, their mRNA expression patterns were examined in D. celebensis collected at ages from 4 to 9 days old (Fig. 2). In our

Table 3 The 24 h - and 48 h - LCx values (mg/L) and 95% confidence interval (C.I.) of BPA and its analogues in D. celebensis. Chemicals

24 h LC10

24 h LC50

48 h LC10

48 h LC50

Bisphenol A Bisphenol S Bisphenol F

5.715 (4.923–6.635) 45.801 (31.804–65.956) 10.335 (0.048–14.217)

7.454 (6.790–8.183) 106.641 (73.512–154.698) 17.423 (10.326–46.498)

5.013 (4.148–6.058) 9.919 (6.551–15.016) 6.569 (n.d)

6.846 (6.146–7.625) 28.667 (22.229–36.970) 8.625 (n.d)

§n.d.: not detected. 313

Ecotoxicology and Environmental Safety 179 (2019) 310–317

S. In, et al.

Fig. 2. Transcriptional modulation of Dccyp314a1 (A), DcEcRA (B), DcEcRB (C), and DcUSP (D) during molting in adult Diaphanosoma celebensis (from 4 to 9 days old).

In the case of BPF exposure, the transcription of all genes was decreased at a low BPF concentration. The expression levels of Dccyp314a, DcEcRB and DcUSP remained reduced at even higher concentrations of BPF, whereas the expression of DcEcRA mRNA recovered to a normal level at the medium concentration, but was significantly upregulated at the highest BPF concentration tested (Fig. 3C).

vitellogenesis, and spermatogenesis in them (reviewed by Lafont and Mathieu, 2007; Mykles, 2011). Studies of the presence and role of 20E and the enzymes participating in its biosynthesis in other crustaceans remain scarce. In the present study, we cloned and sequenced the fulllength sequence of cyp314a1 from D. celebensis. Dccyp314a1 had conserved CYP450 structural motifs, including Helix-C (a heme-interacting region), Helix-I (a putative oxygen-binding pocket), Helix-K (a putative hydrogen binding sequence), the aromatic region, and the hemebinding region (Fig. S4). These conserved CYP450 motifs have also been commonly observed in insect 20-hydroxylase (Maeda et al., 2008). This finding suggests that Dccyp314a1 may be involved in catalyzing the biosynthesis of 20E, resulting in the regulation of the molting cycle in D. celebensis. Nuclear receptors, including ecdysone receptor (EcR) and ultraspiracle (USP), are involved in transporting ecdysteroids from the cytoplasm into the nucleus. However, studies on the presence and role of these genes in crustaceans are also still lacking. In the present study, we found two EcRs (EcRA and EcRB) and a USP in D. celebensis. These NRs had conserved structures and domains (Figs. S1 and S3). In particular, DcEcRA and DcEcRB contained isoform A-specific and B-specific regions, respectively, as have also been suggested to occur in D. magna EcR A and EcR B (Kato et al., 2007) (Fig. S2). The phylogenetic tree estimated herein showed that the DcEcRs and DcUSP were closely clustered with those of other crustacean species, which were grouped separately from those of insects (Fig. 1). Similar clustering patterns were previously observed for the EcR of the copepod Tigriopus japonicus (Hwang et al., 2010). Based on BlastX searching, sequence identity, conserved domains, and phylogenetic analysis, the two EcRs identified in D. celebensis were designated as DcEcRA and DcEcRB, respectively.

4. Discussion Bisphenol A has estrogenic effects and can disrupt normal endocrine system functions by binding to estrogen receptors (Chen et al., 2002). Recent studies using a yeast two-hybrid assay suggested that BPA analogues that were developed as substitutes for BPA also showed estrogenic and anti-androgenic effects, in the order of BPA > BPF > BPS (Chen et al., 2002;Rochester et al., 2015). Ecdysteroids are the main class of hormones in arthropods, and include the molting hormones produced by the molting glands of insects (prothoracic glands) and crustaceans (Y organs) (Chang and Kaufman, 2005). Thus, ecdysteroids also play key roles in arthropod development and reproduction. Several studies have reported that EDCs can interfere with the physiological processes regulated by ecdysteroids in crustaceans (LeBlanc, 2007; Hosamani et al., 2017). Thus, ecdysteroid pathway - related genes may be potential targets for EDCs, including BPA and its analogues. In crustaceans, ecdysone is transformed into the active hormone 20hydroxyecdysone (20E) by the CYP 450 enzyme, ecdysone 20-monooxygenase (also known as 20-hydroxylase, and encoded by CYP314A1 gene). The hormone 20E has mainly been identified in decapod crustaceans, and is known to be involved in the molting cycle, 314

Ecotoxicology and Environmental Safety 179 (2019) 310–317

S. In, et al.

In acute toxicity tests in the present study, BPA was shown to be the most toxic to D. celebensis, followed by BPF and BPS. Similar results were previously observed for a rotifer Brachionus koreanus (Park et al., 2018) and D. magna (Chen et al., 2002). However, after 24 h of exposure, BPS did not cause mortality in B. koreanus (Park et al., 2018) or the midge Chironomus riparius (Hahn et al., 2002; Herrero et al., 2018). The 48-h-EC50 value of BPA for D. magna was previously found to be 8.91 mg/L (Liu et al., 2007) or 10 mg/L (Chen et al., 2002), suggesting that D. celebensis (with an LC50 of 6.846 mg/L) is more sensitive to BPA than D. magna. Chen et al. (2016) suggested that the half-life of BPA (37.5 days) was higher than that of BPF and BPS (both 15 days) in water, and its bioaccumulation factor (BAF) was also higher than that of its analogues, in the order of BPA (172.7) > BPF (28.02) > BPS (3.535). These findings indicate that the different chemical and physiological properties of BPA analogues can contribute to them having different degrees of toxicity to organisms. With regard to the molting periods in D. celebensis, Segawa and Yang (1990) reported that molting occurs once a day before maturation, and then every two days after maturation in the similar culture conditions as those used in our study. In our preliminary tests, D. celebensis released the first brood of neonates at an age of almost 4 days, as found by Marcial and Hagiwara (2007), and molting was then observed at ages of 5 days and 7–8 days (data not shown). To investigate the role of ecdysone pathway - related genes during the molting periods, patterns in the mRNA expression of four such genes was examined in this study. The Dccyp314a1mRNA level showed an increase at two points (5 and 8 days) (Fig. 2A). In a variety of crustaceans, ecdysteroid levels are low during intermolt and postmolt, begin to increase during premolt, and peak just before molting (Johnson, 2003; Martin-Creuzburg et al., 2007). Maeda et al. (2008) suggested that E20-hydroxylase (cyp314a1) is regulated at the transcriptional level, and is involved in the production of 20E during the embryogenesis of Bombyx mori. Although information on transcriptional modulation of cyp314a1 during the molting process in crustaceans is lacking, our findings suggest that changes in Dccyp3141a mRNA levels may be related to the molting process in D. celebensis. In the present study, DcEcRA and DcEcRB mRNA expression levels in the examined developmental stages showed different patterns: DcEcRA expression had two peaks at 5 and 7 days, similarly to Dccyp314a1, whereas DcEcRB expression increased only at an age of 8 days (Fig. 2B and C). Contrary to our results, D. magna EcRB expression in a previous study showed two peaks during embryogenesis, while EcRA expression increased only before molting (Kato et al., 2007). In particular, the authors showed that the expression pattern of EcRB was matched to the molting cycle, suggesting that EcRB may be involved in the regulation of molting in D. magna. Regarding this point, several studies have shown that EcR isoforms play different roles in embryonic development and in the adult stage. In Drosophila melanogaster, EcR-A is responsible for adult differentiation, and EcR-B regulates the molting process in the larval stage (Talbot et al., 1993). DcUSP mRNA expression was upregulated at ages of 5 and 8 days, like that of DcEcRA (Fig. 2D). Similar results were reported for the brackish water copepod, Paracyclopina nana (Puthumana et al., 2017), in which USP expression was significantly increased in female adults. Meanwhile, D. magna USP expression showed small changes during embryonic development (Kato et al., 2007). The authors of that study demonstrated that EcR can form a heterodimer with USP, and the pairing between two NRs can change during molting and embryogenic development. Taken together, our findings indicate that DcEcRA may be mainly involved in molting and reproduction in the adult stage and act cooperatively with USP. However, the exact roles of the different EcR isoforms during developmental stage - dependent events should be explored more in this species. To understand the effect of BPA and its analogues on the ecdysteroid pathway, we further investigated the differential expression of

Fig. 3. The expression pattern of Dccyp314a1, DcEcRA, DcEcRB and DcUSP in Diaphanosoma celebensis exposed to A) bisphenol A (0.12, 0.6 and 3.0 mg/L), B) bisphenol S (0.92, 4.6 and 23.0 mg/L), and C) bisphenol F (0.6, 1.6 and 5.0 mg/ L), respectively, for 48 h. CON is a solvent control (DMSO). Data are shown as means ± S.D. of 3 replicates. Different lowercase letters indicate significant differences among concentrations, as determined using a one-way ANOVA followed by Turkey's test.

315

Ecotoxicology and Environmental Safety 179 (2019) 310–317

S. In, et al.

cyp314a1, EcRA, EcRB, and USP transcripts in D. celebensis exposed to these chemicals. A significant increase in Dccyp314a1 and DcEcRA mRNA expression was observed at concentrations of 0.12 and 0.6 mg/L of BPA (Fig. 3A). DcEcRB and DcUSP began to be upregulated at 0.6 mg/L of BPA. Similar results were previously found in the midge C. riparius when it was exposed to EDCs that included BPA (Planelló et al., 2008), NP (Nair and Choi, 2012), and pentachlorophenol (Morales et al., 2014). In Gammarus pulex, EcR mRNA expression was also significantly upregulated in response to exposure to four EDCs (ethylestradiol, 4-hydroxytamoxifen, 17a-methyltestosterone, and cyproterone acetate) as well as 20-hydroxyecdysone, suggesting that these EDCs can act in G. pulex in the same way as the natural molting hormone, modulating EcR expression and ultimately disrupting of the normal endocrine system function in this species (Gismondi, 2018). In particular, gene expression patterns in response to BPA showed an inverted U-shape curve (non-monotonic dose-response curve, NMDRC), which is a characteristic of EDCs, in particular, BPA in vitro assay and considered to be a problem for risk assessment of their impact (Vandenberg et al., 2012; Vandenberg, 2014). Expression patterns of BPS and BPF was different from those of BPA. Dccyp314a1 and DcEcRB mRNA level was significantly upregulated at a high concentration (23 mg/L) of BPS, whereas their level was downregulated at lower concentration (Fig. 3B). The expression levels of Dccyp314a1, DcEcRB, and DcUSP were reduced in all exposed groups, whereas transcription of DcEcRA was downregulated at a concentration of 0.6 mg/L of BPF, recovered to control levels at 1.0 mg/L, and was significantly elevated at 5 mg/L (Fig. 3C). Similarly, EcR mRNA level was also decreased after 48 h exposure in C. riparius exposed to plasticizer benzyl butyl phthalate (BBP) (Herrero et al., 2015) and BPS (Herrero et al., 2018). In contrast, 24-h exposure to BPS (5–500 μg/L) for 24 h showed a NMDRC of EcR mRNA expression (Herrero et al., 2018). However, NMDRCs of EDCs, except for BPA, are still controversial and depends on experimental designs, including a dose range (Vandenberg, 2014). Recent studies suggested that BPS and BPF also have estrogenic and anti-androgenic activities in several aquatic organisms and mammals (Rosenmai et al., 2014; reviewed by Rochester and Bolden, 2015). These studies also summarized the fact that the hormonal activity of BPF and BPS compared with that of BPA was similar or low, respectively, and that these analogues may have other endocrine disruptive effects than those of BPA. Interestingly, BP analogues showed different expression pattern of genes at higher and lower concentration in the present study. These findings suggest that they can play a different role as an ecdysteroid antagonist or agonist depending on exposure concentration, as suggested by Herrero et al. (2015). Taken together, our findings suggest that BPA analogues, like BPA, may also have the ability to modulate the ecdysteroid - mediated pathway, but with different mechanism from each other or BPA. Further study is necessary to understand the different effects of BP analogues on molting process. Several studies have suggested that EDCs, including BPA, have antiecdysteroidal activity in crustacean species, such as D. magna (LeBlanc et al., 2000; Mu et al., 2005) and copepods (Andersen et al., 2001), based on examinations of parameters like developmental abnormalities, fecundity, and molting. As mentioned above, BPA is known to have estrogenic effects in humans and other animals by interfering with nuclear receptors, such as estrogen receptors and thyroid receptors (Hiroi et al., 1999; Takayanagi et al., 2006; Zoeller, 2007). In a previous study, ligand-binding assay showed that BPA does not strongly bind to the lobster EcR, suggesting that other mechanisms may be involved in the disruption of ecdysteroid signaling by BPA exposure (Tarrant et al., 2011). The presence of vertebrate-type sex steroids was previously reported in crustaceans, such as crabs (Sarojini, 1963), shrimps (Nagabhushanam and Kulkarni, 1981), and D. magna (Baldwin and LeBlanc, 1994), which suggests that they may have vertebrate-like nuclear receptors. However, there is currently no evidences of the presence of sex steroid receptors in arthropods (Maglich et al., 2001;

Thornton, 2003). In a recent study, an estrogen receptor (ER) like protein was detected in the amphipod Gammarus fossarium, and its expression was induced by EE2 exposure and showed sex-specific patterns, indicating that ER orthologues may have been retained in some arthropods (Köhler et al., 2007). Besides vertebrate nuclear receptors, the estrogen-related receptors (ERRs) that have been identified in invertebrates share sequence similarity to ER and were able to bind to anthropogenic estrogenic ligands (Giguère, 2002). Takayanagi et al. (2006) suggested that BPA is a strong ligand for ERRγ. Indeed, ERR mRNA expression in the midge C. riparius was significantly upregulated after both short-term (24 h) and long-term (96 h) exposures to EDCs (BPA, NP and DEHP), and further luciferase activity was induced by three EDCs, suggesting that these compounds may be involved in the regulation of ERR in this species (Park and Kwak, 2010). In addition, Herrero et al. (2018) showed that a significant increase of ERR mRNA was observed in the midge C. riparius exposed to BPS at more than 5 μg/L for 24 h. In a preliminary study, we found that D. celebensis ERR mRNA was also highly over-expressed after exposure to BPA for 48 h (unpublished data). These findings suggest that the molecular mechanisms of action of BPA and its analogues on the endocrine system remain to be fully unveiled, and thus should be further studied in crustaceans. In conclusion, we investigated ecdysteroid pathway - related genes (cyp314a1, EcRA, EcRB, and USP) and their transcriptional modulation during molting and after exposure to BPA and its analogues in D. celebensis. Sequence similarity, conserved domains and phylogenetic analyses showed that these four genes are highly conserved across arthropods, and may act in the development and reproduction of adult D. celebensis. Cyp314a1, EcRA and USP may be mainly involved in the molting process in the adult stage of this species. BPA and its analogues modulated the expression of all four genes in different way, suggesting that they can all disrupt the normal endocrine system function of D. celebensis, but with different mechanisms. However, to better understand the molecular mechanisms underlying these effects of BPA and its analogues, further studies on the identification and characterization of genes involved in the ecdysteroid-signaling pathway in crustacean species are necessary. Acknowledgments This work was supported by a grant from the National Research Foundation of Korea (NRF-2009-0067801). Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ecoenv.2019.04.065. References Andersen, H.R., Wollenberger, L., Halling-Sørensen, B., Kusk, K.O., 2001. Development of copepod nauplii to copepodites - a parameter for chronic toxicity including endocrine disruption. Environ. Toxicol. Chem. 20, 2821–2829. Asazuma, H., Nagata, S., Kono, M., Nagasawa, H., 2007. Molecular cloning and expression analysis of ecdysone receptor and retinoid X receptor from the kuruma prawn, Marsupenaeus japonicus. Comp. Biochem. Physiol., B 148, 139–150. Bae, C., Kim, R.O., Kim, J.S., Lee, Y.M., 2018. Acute toxicity and modulation of an antioxidant defence system in the brackish water flea Diaphanosoma celebensis exposed to cadmium and copper. Toxicol. Environ. Health Sci. 10, 186–193. Baldwin, W.S., LeBlanc, G.A., 1994. In vivo biotransformation of testosterone by phase I and II detoxication enzymes and their modulation by 20-hydroxyecdysone in Daphnia magna. Aquat. Toxicol. 29, 103–117. Cabaton, N., Dumont, C., Severin, I., Perdu, E., Zalko, D., Cherkaoui-Malki, M., Chagnon, M.C., 2009. Genotoxic and endocrine activities of bis(hydroxyphenyl)methane (bisphenol F) and its derivatives in the HepG2 cell line. Toxicology 255, 15–24. Canesi, L., Fabbri, E., 2015. Environmental effects of BPA: Focus on aquatic species. Dose Response 13, 1–14. Casida, J.E., 2009. Pest toxicology: the primary mechanisms of pesticide action. Chem. Res. Toxicol. 22, 609–619. Chang, E.S., Kaufman, W.R., 2005. Endocrinology of crustacea and chelicerata. In: In:

316

Ecotoxicology and Environmental Safety 179 (2019) 310–317

S. In, et al. Gilbert, L.I., Iatrou, K., Gill, S.S. (Eds.), Comprehensive Molecular Insect Science, vol. 3. Elsevier/Pergamon, Amsterdam, pp. 805–842. Chen, D., Kannan, K., Tan, H., Zheng, Z., Feng, Y.L., Wu, Y., Widelka, M., 2016. Bisphenol analogues other than BPA: Environmental occurrence, human exposure, and toxicity – a review. Environ. Sci. Technol. 50, 5438–5453. Chen, M.Y., Ike, M., Fujita, M., 2002. Acute toxicity, mutagenicity, and estrogenicity of bisphenol-A and other bisphenols. Environ. Toxicol. 17, 80–86. Giguère, V., 2002. To ERR in the estrogen pathway. Trends Endocrinol. Metabol. 13, 220–225. Gismondi, E., 2018. Identification of molt-inhibiting hormone and ecdysteroid receptor cDNA sequences in Gammarus pulex, and variations after endocrine disruptor exposures. Ecotoxicol. Environ. Saf. 158, 9–17. Hahn, T., Schenk, K., Schulz, R., 2002. Environmental chemicals with known endocrine potential affect yolk protein content in the aquatic insect Chironomus riparius. Environ. Pollut. 120, 525–528. Herrero, Ó., Aquilino, M., Sánchez-Argüello, P., Planelló, R., 2018. The BPA-substitute bisphenol S alters the transcription of genes related to endocrine, stress response and biotransformation pathways in the aquatic midge Chironomus riparius (Diptera, Chironomidae). PLoS One 13 e0193387. Herrero, Ó., Planelló, R., Morcillo, G., 2015. The plasticizer benzyl butyl phthalate (BBP) alters the ecdysone hormone pathway, the cellular response to stress, the energy metabolism, and several detoxication mechanisms in Chironomus riparius larvae. Chemosphere 128, 266–277. Hiroi, H., Tsutsumi, O., Momoeda, M., Takai, Y., Osuga, Y., Taketani, Y., 1999. Differential interactions of bisphenol A and 17beta-estradiol with estrogen receptor alpha (ERalpha) and ERbeta. Endocr. J. 46, 773–778. Hosamani, N., Reddy, S.B., Reddy, R.P., 2017. Crustacean molting: Regulation and effects of environmental toxicants. J. Mar. Sci. Res. Dev. 7, 236. Hwang, D.S., Lee, J.S., Lee, K.W., Rhee, J.S., Han, J., Lee, J., Park, G.S., Lee, Y.M., Lee, J.S., 2010. Cloning and expression of ecdysone receptor (EcR) from the intertidal copepod, Tigriopus japonicus. Comp. Biochem. Physiol., C 151, 303–312. Johnson, C.L., 2003. Ecdysteroids in the oceanic copepod Calanus pacificus: variation during molt cycle and change associated with diapause. Mar. Ecol. Prog. Ser. 257, 159–165. Kato, Y., Kobayashi, K., Oda, S., Tatarazako, N., Watanabe, H., Iguchi, T., 2007. Cloning and characterization of the ecdysone receptor and ultraspiracle protein from the water flea Daphnia magna. J. Endocrinol. 193, 183–194. Kim, B.M., Kang, S., Kim, R.O., Jung, J.H., Lee, K.W., Rhee, J.S., Lee, Y.M., 2018. De novo transcriptome assembly of brackish water flea Diaphanosoma celebensis based on short-term cadmium and benzo[a]pyrene exposure experiments. Hereditas 155, 36. Kim, H.W., Chang, E.S., Mykles, D.L., 2005. Three calpains and ecdysone receptor in the land crab Gecarcinus lateralis: sequences, expression and effects of elevated ecdysteroid induced by eyestalk ablation. J. Exp. Biol. 208, 3177–3197. Köhler, H.R., Kloas, W., Schirling, M., Lutz, I., Reye, A.L., Langen, J.S., Triebskorn, R., Nagel, R., Schönfelder, G., 2007. Sex steroid receptor evolution and signaling in aquatic invertebrates. Ecotoxicology 16, 131–143. Lafont, R., Dauphin-Villemant, C., Warren, J.T., Rees, H., 2005. Ecdysteroid chemistry and biochemistry. In: In: Gilbert, L.I., Iatrou, K., Gill, S. (Eds.), Comprehensive Molecular Insect Science, vol. 3. Elsevier, Oxford, pp. 125–195. Lafont, R., Mathieu, M., 2007. Steroids in aquatic invertebrates. Ecotoxicology 16, 109–130. LeBlanc, G.A., 2007. Crustacean endocrine toxicology: a review. Ecotoxicology 16, 61–81. LeBlanc, G.A., Mu, X., Rider, C.V., 2000. Embryotoxicity of the alkylphenol degradation product 4-nonylphenol to the crustacean Daphnia magna. Environ. Health Perspect. 108, 1133–1138. Lee, S., Liao, C., Song, G.J., Ra, K., Kannan, K., Moon, H.B., 2015. Emission of bisphenol analogues including bisphenol A and bisphenol F from wastewater treatment plants in Korea. Chemosphere 119, 1000–1006. Liao, C., Liu, F., Moon, H.-B., Yamashita, N., Yun, S., Kannan, K., 2012. Bisphenol analogues in sediments from industrialized areas in the United States, Japan, and Korea: spatial and temporal distributions. Environ. Sci. Technol. 46, 11558–11565. Liu, H.L., Liu, X.H., Wang, X.Y., Wang, X.R., Yu, H.X., 2007. Toxicity of BPA and TBBPA to Daphnia magna and zebrafish Brachydanio rerio. Huanjing Kexue 28, 1784–1787. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2− ΔΔCT method. Methods 25, 402–408. Maeda, S., Nakashima, A., Yamada, R., Hara, N., Fujimoto, Y., Ito, Y., Sonobe, H., 2008. Molecular cloning of ecdysone 20-hydroxylase and expression pattern of the enzyme during embryonic development of silkworm Bombyx mori. Comp. Biochem. Physiol., B 149, 507–516. Maglich, J.M., Sluder, A., Guan, X., Shi, Y., McKee, D.D., Carrick, K., Kamdar, K., Willson, T.M., Moore, J.T., 2001. Comparison of complete nuclear receptor sets from the human, Caenorhabditis elegans and Drosophila genomes. Genome Biol. 2 29.1–29.7. Marcial, H.S., Hagiwara, A., 2007. Multigenerational effects of 17b-estradiol and nonylphenol on euryhaline cladoceran Diaphanosoma celebensis. Fish. Sci. 73, 324–330. Martin, D., Wang, S.-F., Raikhel, A.S., 2001. The vitellogenin gene of the mosquito Aedes aegypti is a direct target of ecdysteroid receptor. Mol. Cell. Endocrinol. 173, 75–86. Martin-Creuzburg, D., Westerlund, S.A., Hoffmann, K.H., 2007. Ecdysteroid levels in Daphnia magna during a molt cycle: determination by radioimmunoassay (RIA) and

liquid chromatography-mass spectrometry (LC-MS). Gen. Comp. Endocrinol. 151, 66–71. Morales, M., Martínez-Paz, P., Martín, R., Planelló, R., Urien, J., Martínez-Guitarte, J.L., Morcillo, G., 2014. Transcriptional changes induced by in vivo exposure to pentachlorophenol (PCP) in Chironomus riparius (Diptera) aquatic larvae. Aquat. Toxicol. 157, 1–9. Mu, X., Rider, C.V., Hwang, G.P., Hoy, H., LeBlanc, G.A., 2005. Covert signal disruption: anti-ecdysteroidal activity of bisphenol A involves cross-talk between signaling pathways. Environ. Toxicol. Chem. 24, 146–152. Mykles, D.L., 2011. Ecdysteroid metabolism in crustaceans. J. Steroid Biochem. Mol. Biol. 127, 196–203. Naderi, M., Wong, M.Y., Gholami, F., 2014. Developmental exposure of zebrafish (Danio rerio) to bisphenol-S impairs subsequent reproduction potential and hormonal balance in adults. Aquat. Toxicol. 148, 195–203. Nagabhushanam, R., Kulkarni, G.K., 1981. Effect of exogenous testosterone on the androgenic gland and testis of a marine penaeid prawn Parapenaeopsis hardwickii (Miers) (Crustacea Decapoda Peneaidae). Aquaculture 23, 19–27. Nair, P.M.G., Choi, J., 2012. Modulation in the mRNA expression of ecdysone receptor gene in aquatic midge, Chironomus riparius upon exposure to nonylphenol and silver nanoparticles. Environ. Toxicol. Pharmacol. 33, 98–106. Nakagawa, Y., Henrich, V.C., 2009. Arthropod nuclear receptors and their role in molting. FEBS J. 276, 6128–6157. OECD, 2004. OECD Guidelines for the Testing of Chemicals. Section 2: Effects on Biotic Systems: Test No. 202: Daphnia Sp. Acute Immobilization Test. OECD publishing. Park, J.C., Lee, M.C., Yoon, D.S., Han, J., Kim, M., Hwang, U.K., Jung, J.H., Lee, J.S., 2018. Effects of bisphenol A and its analogs bisphenol F and S on life parameters, antioxidant system, and response of defensome in the marine rotifer Brachionus koreanus. Aquat. Toxicol. 199, 21–29. Park, K., Kwak, I.S., 2010. Molecular effects of endocrine-disrupting chemicals on the Chironomus riparius estrogen-related receptor gene. Chemosphere 79, 934–941. Planelló, R., Martínez-Guitarte, Morcillo, G., 2008. The endocrine disruptor bisphenol A increases the expression of HSP70 and ecdysone receptor genes in the aquatic larvae of Chironomus riparius. Chemosphere 71, 1870–1876. Puthumana, J., Lee, M.C., Han, J., Kim, H.S., Hwang, D.S., Lee, J.S., 2017. Ecdysone receptor (EcR) and ultraspiracle (USP) genes from the cyclopoid copepod Paracyclopina nana: identification and expression in response to water accommodated fractions (WAFs). Comp. Biochem. Physiol., C 192, 7–15. Rochester, J.R., Bolden, A.L., 2015. Bispehnol S and F: a systematic review and comparison of the hormonal activity of bisphenol A substitutes. Environ. Health Perspect. 123, 643–650. Rosenmai, A.K., Dybdahl, M., Pedersen, M., van Vugt-Lussenburg, B.M., Wedebye, E.B., Taxvig, C., Vinggaard, A.M., 2014. Are structural analogues to bisphenol A safe alternatives? Toxicol. Sci. 139, 35–47. Sarojini, S., 1963. Comparison of the effects of androgenic hormone and testosterone propionate on the female ocypod crab. Curr. Sci. 33, 55–56. Segawa, S., Yang, W.T., 1990. Growth, moult, reproduction and filtering rate of an estuarine cladoceran, Diaphanosoma celebensis, in laboratory culture. Bull. Plankton Soc. Jpn. 37, 145–155. Segner, H., Caroll, K., Genske, M., Janssen, C.R., Maack, G., Pascoe, D., Schäfers, C., Vandenbergh, G.F., Watts, M., Wenzel, A., 2003. Identification of endocrine-disrupting effects in aquatic vertebrates and invertebrates: report from the European IDEA project. Ecotoxicol. Environ. Saf. 54, 302–314. Suzuki, T., Nakagawa, Y., Takano, I., Yaguchi, K., Yasuda, K., 2004. Environmental fate of bisphenol A and its biological metabolites in river water and their xenoestrogenic activity. Environ. Sci. Technol. 38, 2389–2396. Takayanagi, S., Tokunaga, T., Liu, X., Okada, H., Matsushima, A., Shimohigashi, Y., 2006. Endocrine disruptor bisphenol A strongly binds to human estrogen related receptor gamma (ERRgamma) with high constitutive activity. Toxicol. Lett. 167, 95–105. Talbot, W.S., Swyryd, E.A., Hogness, D.S., 1993. Drosophila tissues with different metamorphic responses to ecdysone express different ecdysone receptor isoforms. Cell 73, 1323–1337. Tarrant, A.M., Behrendt, L., Stegeman, J.J., Verslycke, T., 2011. Ecdysteroid receptor from the American lobster Homarus americanus: EcR/RXR isoform cloning and ligandbinding properties. Gen. Comp. Endocrinol. 173, 346–355. Thornton, J.W., 2003. Nonmammalian nuclear receptors: evolution and endocrine disruption. Pure Appl. Chem. 75, 1827–1839. Vandenberg, L.N., 2014. Non-monotonic dose responses in studies of endocrine disrupting chemicals: bisphenol A as a case study. Dose-Response 12, 259–276. Vandenberg, L.N., Colborn, T., Hayes, T.B., Heindel, J.J., Jacobs Jr., D.R., Lee, D.H., Shioda, T., Soto, A.M., vom Saal, F.S., Welshons, W.V., Zoeller, R.T., Myers, J.P., 2012. Hormones and endocrine-disrupting chemicals: Low-dose effects and nonmonotonic dose responses. Endocr. Rev. 33, 378–455. Zhang, T., Sun, H., Kannan, K., 2013. Blood and urinary bisphenol A concentrations in children, adults, and pregnant women from China: partitioning between blood and urine and maternal and fetal cord blood. Environ. Sci. Technol. 47, 4686–4694. Zoeller, R.T., 2007. Environmental chemicals impacting the thyroid: targets and consequences. Thyroid 17, 811–817.

317