Adaptation to Blockade of Human Immunodeficiency Virus Type 1 Entry Imposed by the Anti-CCR5 Monoclonal Antibody 2D7

Virology 287, 382–390 (2001) doi:10.1006/viro.2001.1046, available online at http://www.idealibrary.com on

Adaptation to Blockade of Human Immunodeficiency Virus Type 1 Entry Imposed by the Anti-CCR5 Monoclonal Antibody 2D7 Emma J. Aarons,* ,1 Simon Beddows,† Tim Willingham,* Lijun Wu,‡ and Richard A. Koup* ,2 *Department of Medicine, Division of Infectious Disease, University of Texas Southwestern Medical Center, Dallas, Texas 75390; †Department of GU Medicine and Communicable Diseases, Imperial College School of Medicine at St Mary’s, London, W2 1PG, United Kingdom; and ‡Millenium Pharmaceuticals, Inc., Cambridge, Massachusetts 02139 Received November 9, 2000; returned to author for revision December 15, 2000; accepted June 6, 2001; published online August 3, 2001 The second extracellular loop (ECL2) domain of CC-chemokine receptor 5 (CCR5) has been proposed as a specific target site for therapeutic agents aimed at blocking CCR5-dependent entry by human immunodeficiency virus type I (HIV-1). We have adapted two CCR5-using HIV-1 isolates, prototypic JR-CSF, and a primary isolate, 11-121, to replicate in vitro in the presence of high concentrations of a monoclonal antibody (MAb 2D7) specific for the CCR5 ECL2 domain. The 75% inhibitory concentrations (IC 75) for the two 2D7-adapted isolates were approximately 100-fold higher than those for corresponding control isolates passaged without the MAb. Adapted isolates did not acquire the ability to use CXCR4, CCR3, or CCR1. Env clones derived from MAb 2D7-adapted JR-CSF showed several gp120 mutations that were not found in any of the control JR-CSF clones. The in vitro observations suggest that CCR5-using HIV-1 strains might also be able to adapt in vivo to evade an ECL2-blocking therapeutic agent. © 2001 Academic Press Key Words: HIV-1; CCR5; gp120; coreceptor; monoclonal antibody.

INTRODUCTION

incomplete, protection against acquisition of HIV infection (Balotta et al., 1997; Biti et al., 1997; O’Brien et al., 1997; Theodorou et al., 1997). This protection is manifest among Caucasians as an underrepresentation of ⌬32ccr5 homozygotes in HIV seropositive populations (Dean et al., 1996; Huang et al., 1996), and an overrepresentation of these individuals among HIV-exposed but uninfected people (Dean et al., 1996; Liu et al., 1996; Paxton et al., 1996; Samson et al., 1996; Aarons et al., 1997). Second, the ⌬32ccr5 allele is highly prevalent among Caucasians such that approximately 1 in 100 are ⌬32ccr5 homozygous (Martinson et al., 1997; Lucotte and Mercier, 1998), yet this genotype appears to confer no significant adverse phenotype (Nguyen et al., 1999). Thus, it seems that this chemokine receptor is dispensable to human health. Finally, compared to individuals homozygous for wild-type ccr5, individuals who are heterozygous for ⌬32ccr5 have reduced cell surface expression of CCR5 (Wu et al., 1997b; de Roda Husman et al., 1999a; Ometto et al., 1999), reduced susceptibility to infection with R5 HIV-1 in a hu-PBL-SCID mouse model (Picchio et al., 1997), reduced in vitro infectability of CD4 ⫹ cells with R5 isolates (Wu et al., 1997b; Paxton et al., 1998; Ometto et al., 1999), and progress to AIDS more slowly (Dean et al., 1996; de Roda Husman et al., 1997b; Huang et al., 1996). HIV-1 has a remarkable ability to evolve in response to immune and other pressures. The envelope glycoprotein is the most variable of the structural proteins of HIV-1, and single or dual amino acid changes at certain sites,

CCR5, the seven-transmembrane domain, G-coupled receptor for chemokines RANTES, MIP-1␣, and MIP-1␤, is the principal coreceptor for the nonsyncytium-inducing (NSI), macrophage-tropic (M-tropic) strains of human immunodeficiency virus type I (HIV-1), irrespective of env genetic subtype (Alkhatib et al., 1996; Choe et al., 1996; Deng et al., 1996; Doranz et al., 1996; Dragic et al., 1996; Zhang et al., 1996). It is these strains that are usually associated with transmission of infection and early disease. There are three sets of observations that, together, indicate that CCR5 would be a highly suitable target against which to develop inhibitors of the CCR5/HIV-1 interaction to block entry and thereby treat and/or prevent HIV-1 infection. First, the absence of cell surface CCR5 expression caused by homozygosity for the naturally occurring ⌬32ccr5 allele (Liu et al., 1996; Wu et al., 1997b) is associated with resistance to in vitro infection of CD4 ⫹ cells with CCR5-using (R5) HIV-1 (Dragic et al., 1996; Paxton et al., 1996; Aarons et al., 1997). Moreover, ⌬32ccr5 homozygosity confers considerable, although

1 Current address: Department of Microbiology, John Radcliffe Hospital, Headley Way, Oxford, OX3 9DU, U.K. 2 To whom correspondence and reprint requests should be addressed at Immunology Laboratory, NIH Vaccine Research Center, Building 40, Room 3502, 40 Convent Drive, Bethesda, MD 20892. Fax: (301) 480-2565. E-mail: [email protected].

0042-6822/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.

382

ADAPTATION OF HIV-1 REPLICATION TO CCR5 BLOCKADE

383

notably within the third variable (V3) loop, have been associated with differences in coreceptor use (Speck et al., 1997). Evidence suggests that the gp120/CCR5 interaction involves multiple CCR5 domains (Atcheson et al., 1996; Bieniasz et al., 1997; Rucker et al., 1996; Picard et al., 1997) and that the amino-terminus (Nt) and second extracellular loop (ECL2) are particularly important (Wu et al., 1997a; Dragic et al., 1998; Farzan et al., 1998). A monoclonal antibody (MAb), 2D7, which binds to a determinant in the first half of CCR5 ECL2, acts as a receptor antagonist and effectively blocks both chemokine binding and HIV coreceptor activity (Wu et al., 1997a; Lee et al., 1999). Therefore, the epitope recognized by this antibody has been proposed as a particularly attractive target for therapeutic agents aimed at disrupting the gp120/CCR5 interaction (Wu et al., 1997a; Lee et al., 1999). We have investigated whether, to overcome a block to entry imposed by the presence of MAb 2D7, envelopes from two different isolates will adapt to use other regions of CCR5 for viral entry. We observed that, in vitro, blockade of the CCR5 ECL2 resulted in reduced sensitivity to infection inhibition by MAb 2D7. This adaptation was associated with the presence of mutations disrupting a potential N-linked glycosylation site in the gp120 V4 domain. Our observations indicate that HIV-1 is able to evade the inhibition of viral entry mediated by ECL2 blockade of CCR5, without acquiring the ability to use other chemokine receptors. RESULTS Sensitivity of isolates to inhibition by MAb 2D7 MAb 2D7-adapted strains of HIV-1 JR-CSF and primary isolate HIV-1 11-121 (designated JR-CSFad and 11-121ad) were generated by serial passage in U87-CD4-CCR5 cells, in the presence of increasing concentrations of the antibody (up to 90 and 75 ␮g/ml, respectively). Control isolates, designated JR-CSFcon and 11-121con, were generated by serial passage in the absence of antibody. Both adapted isolates were considerably less inhibitable by MAb 2D7 than their respective control isolates (Fig. 1). One hundred percent inhibition was not achieved for either of the 2D7-adapted isolates. For both control isolates, the 75% inhibitory concentration (IC 75) of MAb 2D7 was approximately 1 ␮g/ml, whereas for 11-121ad the value approached 100 ␮g/ml. No significant inhibition of JR-CSFad by MAb 2D7 could be demonstrated in either of the two experiments using up to 100 ␮g/ml of the antibody. Although the adapted viral stocks might have been expected to contain residual antibody, the calculated maximum possible concentrations of MAb 2D7 (assuming no prior cellular absorption) in the assay wells during the infection–inhibition experiments (0.6 ␮g/ml for JR-CSFad and 0.24 ␮g/ml for 11-121ad) were within the ranges at which the control isolates remain uninhibited.

FIG. 1. Inhibition of control and monoclonal antibody (MAb) 2D7adapted JR-CSF and 11-121 HIV-1 isolates by MAb 2D7, which is specific for the second extracellular loop of CCR5. The production of p24 antigen was measured 5 days after infection (700 TCID 50) of duplicate cultures in the presence of a range of MAb 2D7 concentrations. A shows the inhibition data for JR-CSFcon (closed circles) and JR-CSFad (open circles). B shows the corresponding results for 11121con (closed squares) and 11-121ad (open squares).

Coreceptor usage by control and adapted isolates The capacity of the control and MAb 2D7-adapted isolates to use different chemokine receptors as coreceptors for viral entry was assessed by measurement of p24 production following infection of U87-CD4 cells expressing different chemokine receptor molecules. All JRCSF and 11-121 control and 2D7-adapted isolates used CCR5, but not CCR1, CCR3, or CXCR4 (data not shown). Sequencing of full-length env and accessory genes vif, vpr, and vpu To identify any highly prevalent Env mutation(s) in the adapted JR-CSF isolate, as compared with the control JR-CSF isolate, the full-length env genes, together with the accessory genes vif, vpr, and vpu, were fully se-

384

AARONS ET AL.

quenced for both of these isolates. In each case, both viral cDNA and proviral DNA were sequenced and the results obtained were identical. The env, vif, vpr, and vpu predicted amino acid sequences for JR-CSFcon were identical to those of JR-CSF in the GenBank database (Accession No. M38429) except for D164N in V2, and three mutations in gp41: R525A, R549K, and G666D. These four substitutions, and no others, were also present in the predicted amino acid sequences for JRCSFad. Proviral env DNA samples derived from the two 11-121 isolates were similarly sequenced, but the extensive sequence diversity of each (reflecting multiple component pseudospecies) precluded any useful comparison. Limiting dilution PCR was not performed. JR-CSF env clone gp120 [C1 to C5] sequences Complete env genes were amplified from JR-CSF cDNA or proviral DNA by PCR and cloned into an expression vector. The functionality of each Env protein was assessed in a cell-fusion assay. Figure 2 shows the predicted C1–C5 amino acid sequence data for 10 functional JR-CSF env clones aligned with the sequence for JR-CSF in the GenBank database (Accession No. M38429). All functional JR-CSF clones sequenced, including one derived from the original peripheral blood mononuclear cells (PBMC) isolate (not shown), featured a D164N mutation in the V2 domain. Among the seven adapted clones, there were two pairs having identical C1–C5 sequences: clones ad2.7 and ad3.2 showed no mutations other than the D164N already noted, and clones ad2.2 and ad4.10 (the other identical pair, referred to as ad2.2[4.10] hereafter) had additional mutations in C1, V2, C2 (disrupting a potential N-linked glycosylation site), V4 (disrupting a further potential N-linked glycosylation site), and C4. Strikingly, although no consistent difference(s) from the database/original/control sequences was seen in the five different gp120[C1–C5] 2D7-adapted sequences, four of five (clones ad2.1, ad2.2[4.10], ad3.5, and ad3.9) showed disruption of a potential N-linked glycosylation site in V4 (N403D or T405I). Neither of these mutations was found in any of six control clones (including three clones that were nonfunctional in the cell-fusion assay, but which are also shown in Fig. 2). Analysis of gp120/p24 antigen ratios on control and adapted JR-CSF and 11–121 isolates To investigate the possibility that control and adapted viruses differ in terms of expression levels of gp120, mean gp120/p24 antigen ratios were measured for each of the four isolates. Mean gp120/p24 antigen ratios obtained were similar to those previously reported for molecularly cloned HIV-1 viruses cultured in PBMC (O’Brien et al., 1994). The mean (SD) gp120/p24 antigen ratios for JR-CSFcon and JR-CSFad were 0.2026 (0.054) and 0.1001

(0.023), respectively. The corresponding values for 11121con and 11-121ad were 0.4439 (0.013) and 0.2214 (0.021). Thus, the values for the two 2D7-adapted isolates were approximately twofold lower than the ratios for their respective control isolates. A difference of this magnitude is thought unlikely to be of biological significance. DISCUSSION The propensity for drug-resistant viral escape mutants to arise is well recognized both in vivo (Condra et al., 1995) and in vitro (Gao et al., 1992). Similarly, HIV adapts to replication in the presence of neutralizing antibodies in vivo (Albert et al., 1990) and in vitro. In vitro, adaptation has been clearly demonstrated for neutralizing sera (Reitz et al., 1988; McKeating et al., 1993) and for MAbs specific for the V3 loop domain (McKeating et al., 1989; Masuda et al., 1990; Sirko and Ehrlich, 1996; Yoshida et al., 1997), the V2 loop (Yoshiyama et al., 1994), and the CD4-binding site (Mo et al., 1997). In addition, there is increasing evidence that HIV evades the CTL response in vivo by accumulating amino acid replacements within CTL epitopes (Goulder et al., 1997). Thus, HIV is extremely adaptable in the face of selection pressures. The interaction between envelope gp120 and the cell surface coreceptors that mediate viral entry is a target for drug development, and consequently the possibility of HIV adaptation to this mode of inhibition should be anticipated. De Vreese et al. (1996) have demonstrated in vitro adaptation of the CXCR4-using (X4) HIV-1 NL4–3 molecular clone to blockade of CXCR4 by members of the bicyclam class of antiviral compounds, and recombination experiments with overlapping parts of the envelope gene indicated that multiple mutations in gp120 were necessary to confer the bicyclam-resistant phenotype. In a similar study, adaptation of HIV-1 NL4–3 to the natural ligand of CXCR4, stromal cell derived factor (SDF)-1␣, was associated with several mutations in gp120, but the mechanism of this adaptation was not investigated further (Schols et al., 1998). Thus, in vitro adaptation of X4 isolates to CXCR4 blockade occurs and appears to be env mediated, but the phenomenon is of limited significance in that most of the primary isolates associated with person-to-person transmission of infection and early disease use CCR5 rather than CXCR4. Acquisition of a syncytium-inducing phenotype (corresponding to CXCR4 usage) by a CCR5-using (R5) molecular clone, 168.1, in the absence of any drug or exogenous blocker of the gp120/coreceptor interaction has been demonstrated after prolonged culture in lymphoid cells (Este et al., 1999). Meanwhile, Mosier et al. (1999) have reported on a study in which hu-PBL-SCID mice were infused with highly potent RANTES analogues AOP-RANTES or NNY-RANTES and challenged with a R5 HIV-1 242H molecular clone (Mosier et al., 1999). This R5

ADAPTATION OF HIV-1 REPLICATION TO CCR5 BLOCKADE

385

FIG. 2. Predicted gp120 C1–C5 envelope amino acid sequences of control and MAb 2D7-adapted HIV-1 JR-CSF env clones. (Clones represented in italics were nonfunctional in a cell–cell fusion assay and were sequenced only across V3 to V5.) Residue positions corresponding to those in HIV-1 HXB2 that are involved in direct contact with CD4 are denoted by [¥] (Kwong et al., 1998). Those positions that affect HIV-1 YU2 gp120 binding to CCR5 by ⬎90% without significantly affecting (⬍50%) sCD4 binding are denoted by § (Rizzuto et al., 1998). Positions shown as NxS or NxT are potential N-linked glycosylation sites.

isolate needs only a single amino acid substitution to become R5X4, and only three changes to become X4. In four of four experimental animals given AOP-RANTES, the viral load was reduced but HIV-1 infection nevertheless supervened, while NNY-RANTES prevented HIV-1 infection in 6 of 10 animals. The coreceptor usage of viruses recovered from the mice that became infected was tested and the V3 domains of these isolates were

sequenced. NNY-RANTES, but not AOP-RANTES, was found to select for coreceptor switch variants, and the acquisition of CXCR4 usage was associated with three V3 loop amino acid substitutions. Neither cloning nor site-directed mutagenesis studies were carried out to confirm the phenotype conferred by these V3 loop mutations. Although these two studies indicate that R5 isolates can acquire env-mediated CXCR4 usage in vitro

386

AARONS ET AL.

and in the hu-SCID mouse model, the significance of these observations is uncertain as there are as yet undefined counterselective pressures that tend to favor CCR5 usage by viruses in vivo and prevent outgrowth of CXCR4-using viruses. In the present study, we report on the adaptation of R5 HIV-1 to the blockade of viral entry imposed by a monoclonal antibody directed against the second extracellular loop of the coreceptor CCR5, MAb 2D7, in the absence of any other chemokine molecule that might serve as a coreceptor. Thus, the experimental conditions were set so as to examine whether MAb 2D7 adaptation could occur in the absence of switching coreceptor usage. The median inhibitory concentrations (IC 50) for the two 2D7adapted isolates were approximately 100-fold higher than those for the corresponding control isolates, one of which was a primary clinical isolate rather than a prototypic molecular clone, but there was no acquisition of CXCR4 or CCR3 usage. Maeda et al. (2000) have demonstrated adaptation of R5 JR-FL to growth in the presence of CCR5 ligand MIP-1␣. No acquisition of CXCR4 usage was observed, but the MIP-1␣ IC 50 for the adapted JR-FL isolate was only fourfold higher than that of the wild-type isolate. The reduced sensitivity to ␤-chemokines was conferred by a V166M mutation in the V2 region of gp120, together with another mutation, S303G, in the V3 loop. The crystal structure of a ternary complex comprising HIV-1 gp120 core, a two-domain fragment of CD4, and 17b Fab (which recognizes a CD4-induced epitope) having recently been solved, a highly conserved gp120 structure, has been proposed to be critical for binding of R5 HIV-1 to CCR5 (Rizzuto et al., 1998). However, the interaction between the HIV-1 envelope oligomers, CD4, and coreceptor molecules is dependent on cooperation between multiple gp120 and gp41 domains, including regions not generally considered typical tropism determinants. Consequently, while the adaptation of HIV-1 isolates to blockade of CCR5 ECL2 observed in the current study is highly likely to be env mediated, verification of this will require analysis of the MAb 2D7 sensitivity of Env-pseudotyped reporter viruses. The mechanism of MAb 2D7 adaptation has not been elucidated in this study. It could involve reduced CD4 dependence, altered CCR5 domain use, or increased affinity of gp120/CCR5 interaction. It is unlikely to be explained by a higher gp120 spike density on the putatively 2D7-adapted virions enhancing the avidity of the virus/cell-surface interaction, as measured spike densities were approximately twofold lower for the 2D7adapted isolates than with the control isolates, and this small magnitude of difference is unlikely to be of biological significance. Nevertheless, the observation of adaptation to blockade of CCR5 ECL2 in itself has implications for development of antiretroviral therapeutic agents

that block CCR5: it will be important to ascertain whether these compounds also provoke HIV adaptation. MATERIALS AND METHODS Viruses and antibodies Two R5 HIV-1 isolates were studied. Stocks of 11-121, a primary isolate from the Ariel Project for the prevention of HIV transmission from mother to infant (Cao et al., 1997), and JR-CSF, a prototypic R5 strain, were expanded by single passage on double-batched phytohemagglutinin/IL2-stimulated PBMC. Murine anti-human CCR5 MAbs 2D7 and 3A9 were generated and characterized as previously described (Wu et al., 1997a). The anti-CCR1 MAb 2D4 was a kind gift of Dr. Charles Mackay and Dr. Shixin Qin at Millenium Pharmaceuticals, Inc. Cell lines Human glial U87 cells stably transfected with human CD4 alone or together with human CCR5, CCR1, CCR3, or CXCR4 (a gift of Dr. Daniel Littman, New York University Medical Center) were maintained in Dulbecco’s minimal essential medium (DMEM) containing 10% fetal calf serum (FCS), L-glutamine, antibiotics, neomycin (G418; 500 ␮g/ml; Sigma), and (except for the U87-CD4 cells, which express CD4 alone) puromycin (1 ␮g/ml; Sigma) and were split by trypsinization twice a week (Deng et al., 1996). Flow cytometry showed that the U87-CD4-CCR5 cell line comprises a homogeneous population of cells expressing high levels of both CD4 and CCR5, but no CXCR4 (data not shown). Moreover, these cells were not infectable with CXCR4-using (X4) isolate NL4-3. Flow cytometry following indirect staining with MAb 2D7 at 37°C as compared with 4°C demonstrated that binding of this antibody does not result in internalization of the receptor (data not shown). Adaptation of viral isolates to MAb 2D7 Adaptation to MAb 2D7 was performed by serial passage of the viral isolates in U87-CD4-CCR5 cells, in the presence of increasing concentrations of the antibody. At each passage, a pair of U87-CD4-CCR5 monolayers (2 ⫻ 10 4 cells/well seeded 18–24 h earlier in 24-well tissue culture plates) were inoculated with the putatively adapted isolate from the previous passage in the presence (2D7⫹) or absence (2D7⫺) of antibody. To ascertain the volume of culture supernatant for inoculating these two fresh cultures, the extent of cytopathic effect at day 5 in the 2D7⫹ culture of the previous passage was used. To determine whether to maintain or increase (by 2–5 ␮g/ml) the MAb 2D7 concentration in the new 2D7⫹ culture, the difference in cytopathic effect between the previous 2D7⫹ and control 2D7⫺ cultures at day 5 was evaluated. Cells were incubated with antibody (at twice the desired final concentration) for 30 min at 37°C prior

ADAPTATION OF HIV-1 REPLICATION TO CCR5 BLOCKADE

to addition of virus and, following addition of virus, the culture volume was made up to 1 ml. One day later, the monolayers were washed twice with 1 ml PBS/2% FCS and the supernatant replaced with 1 ml fresh growth medium. Owing to the limited availability of MAb 2D7, the replacement growth medium was supplemented with MAb 2D7 (at the appropriate concentration) only every third or fourth passage. The concentration of MAb 2D7 used for the first passage was 5 ␮g/ml. At the twentythird passage, for which the treatment concentrations of 2D7 for JR-CSF and 11-121 were 90 and 75 ␮g/ml, respectively, the culture volume was scaled up fivefold to 5 ml cultures in six-well plates. Culture supernatants were harvested on day 4, and aliquots of the putatively adapted isolates, designated JR-CSFad and 11-121ad, were stored at ⫺80°C. Control isolates were generated by 10 serial passages of the original JR-CSF and 11-121 stocks in U87-CD4-CCR5 cells, in the absence of MAb 2D7. These control isolates were designated JR-CSFcon and 11-121con. Titration of control and MAb 2D7-adapted isolates on U87-CD4-CCR5 cells U87-CD4-CCR5 cells were seeded in 48-well trays at 10 4 cells per well in 500 ␮l culture medium. Growth medium without puromycin or neomycin was used thereafter. The following day, culture supernatants were replaced with medium containing each of the viral stocks in serial, six-replicate fivefold dilutions. A day later, the cells were washed twice (1 ml growth medium) and their supernatants replaced with 500 ␮l fresh medium. Cultures were then incubated a further 4 days at 37°C. Following two washes in PBS/2% FCS, monolayers were fixed in ice-cold 1:1 acetone:methanol. HIV-1-infected cells were detected by the addition of a murine MAb directed against HIV-1 p24 antigen (culture supernatant of hybridoma 183-H12-5C: NIH AIDS Reagent Program) at 1:4 dilution; alkaline phosphatase-conjugated F(ab⬘) 2 fragment donkey anti-mouse IgG (Jackson) at 1:200 dilution; and Fast Red alkaline phosphatase substrate (Sigma). Monolayers were scored positive or negative according to the presence or absence of stained foci, and the median tissue culture infectious dose (TCID 50) of each isolate was calculated using the Spearman–Karber formula. Sensitivity of isolates to inhibition by MAb 2D7 U87-CD4-CCR5 cells were seeded in 48-well trays at 10 4 cells per well in 500 ␮l of growth medium. The following day, after 30 min preincubation with a range of MAb 2D7 concentrations at 37°C, duplicate cultures were inoculated with 700 TCID 50 (approximately 3000 focus forming units) of each isolate. The monolayers were washed 24 h after infection with PBS/2% FCS, and the appropriate concentration of antibody replaced in

387

fresh growth medium. The production of p24 antigen 5 days after infection was measured by ELISA (NIH AIDS Vaccine Program). Coreceptor usage by control and adapted isolates The panel of U87-CD4 cells expressing different chemokine receptors (CCR1, CCR5, CCR3, CXCR4) and a high CD4-expressing U87-CD4 clone were seeded in duplicate at 10 4 cells/well in 500 ␮l growth medium. Monolayers were infected with 700 TCID 50 each of the JR-CSF/11-121 control or 2D7-adapted isolates. The monolayers were washed and the medium containing input virus replaced with fresh growth medium 24 h after infection. The p24 antigen content of culture supernatants was measured by ELISA 5 days after infection. Generation of viral cDNA and proviral DNA Viral RNA was obtained from viral stocks using Trizol Reagent (Gibco) according to the manufacturer’s instructions, and cDNA was produced using ThermoScript reverse transcriptase (Gibco-BRL) and the primer RC-11aR 5⬘TAGCTGCTGTATTGCTACTTGTGA. To generate proviral DNA, U87-CD4-CCR5 cells were infected with the control, adapted, and original PBMC-cultured 11-121 and JR-CSF isolates at a high multiplicity of infection. Eighteen hours later, the cells were washed and harvested by trypsinization. Proviral DNA was then extracted and purified using a DNA/RNA isolation kit (Amersham International) according to the manufacturer’s instructions. Sequencing of full-length env and of accessory genes vif, vpr, and vpu Full-length env genes of JR-CSFcon and JR-CSFad, together with the accessory genes vif, vpr, and vpu, were sequenced. Viral cDNA and proviral DNA samples were amplified independently by nested PCR. In each case, platinum Taq DNA polymerase high fidelity (Gibco-BRL) was used for the first round and non-high-fidelity platinum Taq DNA polymerase (Gibco-BRL) was used for the second round. For env amplification, the outer primer pair was RC-10F 5⬘TGCTATTGTAAAAAGTGTTGC and RC-11aR (as above), and the inner primer pair was RC12F 5⬘TATGGCAGGAAGAATTCGAGACAGCGA and RC9R 5⬘ATGTTTTTCTAGGTCTCGAGATACTGCTCC (Connor et al., 1996). Automated sequencing was performed using each of the following five primers: RC-12F (as above); M2AF (5⬘TGGGCCACACATGCCTGTGTACC); ARP826F (5⬘CGCTAGGAATTCGGCCAGTAG - TATCAACTCAA); JRSEQ1F (5⬘ATCTTCAGACCTGGAGGAGGAGACATG), and RC-9R (as above). Nested primers (Zhang et al., 1997) were used for amplification of vif, vpr, and vpu (outer pair: AccoutF 5⬘TTAAAAGAAAAGGGGGGATTGGGGG, AccoutR 5⬘ATTCCAT-GTGTACATTGTACT; inner pair: AccinF 5⬘AGATAATAGTGACATAAAAGTAGTGCCAAGAAG, AccinR 5⬘CCATAATAGACTGTGACCCA-

388

AARONS ET AL.

CAA). The same two inner primers, AccinF and AccinR, were then used singly for sequencing. Predicted amino acid sequences were derived using Editseq (v3.73, DNASTAR Inc.) and aligned using MegAlign (v1.02, DNASTAR Inc.). Cloning and sequencing of JR-CSF isolates Complete env genes were amplified from viral cDNA or proviral DNA by PCR, using platinum Taq DNA polymerase high fidelity (Gibco-BRL) and the primers RC-12F and RC-9R (as above), which contain restriction sites for EcoRI and XhoI, respectively (Connor et al., 1996). Env genes were ligated into the mammalian expression vector pcDNA3.1zeo(⫹) (Invitrogen) and transfected into 293T cells using LipofectAmine (Gibco-BRL). It was not possible to use the same strategy for cloning of 11-121 env as the viral sequence contained an internal EcoRI site. Expression of functional Env was assessed by coculture of the 293T transfectants with U87-CD4-CCR5 cells followed by fixation and staining of the monolayers using the in-house focal immunoassay described above with modification: the detection antibody was pooled HIV-1 seropositive human sera (1:200 dilution) and the conjugate was alkaline phosphatase conjugated F(ab⬘) 2 fragment donkey anti-human IgG⫹IgM (Jackson). Functionality of Env was indicated by the presence of stained syncytia. Three functional JR-CSFcon and seven functional JR-CSFad clones were sequenced (gp120[C1–C5]) using primers M2AF and ARP826F (as above). Analysis of gp120/p24 antigen ratios on control and adapted JR-CSF and 11-121 isolates Mean gp120/p24 antigen ratios were measured for each of the four isolates (Moore et al., 1990). Briefly, intact viral particles were separated from soluble viral antigens by S1000 gel fractionation and, following lysis with a nonionic detergent (Igepal: Sigma), the gp120 content (Moore and Jarrett, 1988) and p24 antigen content (NIH AIDS Vaccine Program ELISA) of each fraction was assayed. Determinations on each 2D7-adapted and corresponding control isolate pair were performed simultaneously. ACKNOWLEDGMENTS This work was supported by NIH grants ROI-AI-42397, R37-AI-35522, and R21-AI-42630, and E.J.A. was funded by a Travelling Fellowship from the Medical Research Council (U.K.). SB was funded by The Wellcome Trust, U.K.

REFERENCES Aarons, E., Fernandez, M., Rees, A., McClure, M., and Weber, J. (1997). CC-chemokine receptor 5 genotypes and in vitro susceptibility to HIV-1 of a cohort of British HIV exposed-uninfected homosexuals. AIDS 11, 688–689. Albert, J., Abrahamsson, B., Nagy, K., Aurelius, E., Gaines, H., Nystrom,

G., and Fenyo, E. M. (1990). Rapid development of isolate-specific neutralizing antibodies after primary HIV-1 infection and consequent emergence of virus variants which resist neutralization by autologous sera. AIDS 4, 107–112. Alkhatib, G., Combadiere, C., Broder, C. C., Feng, Y., Kennedy, P. E., Murphy, P. M., and Berger, E. A. (1996). CC CKR5: A RANTES, MIP1alpha, MIP-1beta receptor as a fusion cofactor for macrophagetropic HIV-1. Science 272, 1955–1958. Atcheson, R. E., Gosling, J., Monteclaro, F. S., Franci, C., Digilio, L., Charo, I. F., and Goldsmith, M. A. (1996). Multiple extracellular elements of CCR5 and HIV-1 entry: Dissociation from response to chemokines. Science 274, 1924–1926. Balotta, C., Bagnarelli, P., Violin, M., Ridolfo, A., Zhou, D., Berlusconi, M., Corvasce, S., Corbellino, M., Clementi, M., Clerici, M., Moroni, M., and Galli, M. (1997). Homozygous D 32 deletion of the CCR-5 chemokine receptor gene in an HIV-1-infected patient. AIDS 11, F67–F71. Bieniasz, P. D., Friedell, R. A., Aramori, I., Ferguson, S. S. G., Caron, M. G., and Cullen, B. R. (1997). HIV-1-induced cell fusion is mediated by multiple regions within both the viral envelope and the CCR-5 co-receptor. EMBO J. 16, 2599–2609. Biti, R., Ffrench, R., Young, J., Bennetts, B., and Stewart, G. (1997). HIV-1 infection in an individual homozygous for the CCR5 deletion allele. Nat. Med. 3, 252–253. Cao, Y., Krogstad, P., Korber, B. T., Koup, R. A., Muldoon, M., Macken, C., Song, J. L., Jin, Z., Zhao, J. Q., Clapp, S., Chen, I. S., Ho, D. D., and Ammann, A. J. (1997). Maternal HIV-1 viral load and vertical transmission of infection: The Ariel Project for the prevention of HIV transmission from mother to infant. Nat. Med. 3, 549–552. Choe, H., Farzan, M., Sun, Y., Sullivan, N., Rollins, B., Ponath, P. D., Wu, L., Mackay, C. R., LaRosa, G., Newman, W., Gerard, N., Gerard, C., and Sodroski, J. (1996). The beta-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates. Cell 85, 1135– 1148. Condra, J. H., Schleif, W. A., Blahy, O. M., Gabryelski, L. J., Graham, D. J., Quintero, J. C., Rhodes, A., Robbins, H. L., Roth, E., and Shivaprakash, M. (1995). In vivo emergence of HIV-1 variants resistant to multiple protease inhibitors. Nature 374, 569–571. Connor, R. I., Sheridan, K. E., Lai, C., Zhang, L., and Ho, D. D. (1996). Characterization of the functional properties of env genes from longterm survivors of human immunodeficiency virus type 1 infection. J. Virol. 70, 5306–5311. de Roda Husman, A M., Blaak, H., Brouwer, M., and Schuitemaker, H. (1999a). CC chemokine receptor 5 cell-surface expression in relation to CC chemokine receptor 5 genotype and the clinical course of HIV-1 infection. J. Immunol. 163, 4597–4603. de Roda Husman, A M., Cornelissen, M., Keet, I. P., Brouwer, M., Broersen, S. M., Bakker, M., Roos, M. T., Prins, M., de Wolf, F., Coutinho, R. A., Miedema, F., Goudsmit, J., and Schuitemaker, H. (1997b). Association between CCR5 genotype and the clinical course of HIV-1 infection. Ann. Intern. Med. 127, 882–890. De Vreese, K., Kofler-Mongold, V., Leutgeb, C., Weber, V., Vermeire, K., Schacht, S., Anne, J., De Clercq, E., Datema, R., and Werner, G. (1996). The molecular target of bicyclams, potent inhibitors of human immunodeficiency virus replication. J. Virol. 70, 689–696. Dean, M., Carrington, M., Winkler, C., Huttley, G. A., Smith, M. W., Allikmets, R., Goedert, J. J., Buchbinder, S. P., Vittinghoff, E., Gomperts, E., Donfield, S., Vlahov, D., Kaslow, R., Saah, A., Rinaldo, C., Detels, R., and O’Brien, S. J. (1996). Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5 structural gene. Hemophilia Growth and Development Study, Multicenter AIDS Cohort Study, Multicenter Hemophilia Cohort Study, San Francisco City Cohort, ALIVE Study. Science 273, 1856–1862. Deng, H., Liu, R., Ellmeier, W., Choe, S., Unutmaz, D., Burkhart, M., Di Marzio, P., Marmon, S., Sutton, R. E., Hill, C. M., Davis, C. B., Peiper, S. C., Schall, T. J., Littman, D. R., and Landau, N. R. (1996). Identification of a major co-receptor for primary isolates of HIV-1. Nature 381, 661–666.

ADAPTATION OF HIV-1 REPLICATION TO CCR5 BLOCKADE Doranz, B. J., Rucker, J., Yi, Y., Smyth, R. J., Samson, M., Peiper, S. C., Parmentier, M., Collman, R. G., and Doms, R. W. (1996). A dual-tropic primary HIV-1 isolate that uses fusin and the beta-chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors. Cell 85, 1149– 1158. Dragic, T., Litwin, V., Allaway, G. P., Martin, S. R., Huang, Y., Nagashima, K. A., Cayanan, C., Maddon, P. J., Koup, R. A., Moore, J. P., and Paxton, W. A. (1996). HIV-1 entry into CD4⫹ cells is mediated by the chemokine receptor CC-CKR-5. Nature 381, 667–673. Dragic, T., Trkola, A., Lin, S. W., Nagashima, K. A., Kajumo, F., Zhao, L., Olson, W. C., Wu, L., Mackay, C. R., Allaway, G. P., Sakmar, T. P., Moore, J. P., and Maddon, P. J. (1998). Amino-terminal substitutions in the CCR5 coreceptor impair gp120 binding and human immunodeficiency virus type 1 entry. J. Virol. 72, 279–285. Este, J. A., Cabrera, C., Blanco, J., Gutierrez, A., Bridger, G., Henson, G., Clotet, B., Schols, D., and De Clercq, E. (1999). Shift of clinical human immunodeficiency virus type 1 isolates from X4 to R5 and prevention of emergence of the syncytium-inducing phenotype by blockade of CXCR4. J. Virol. 73, 5577–5585. Farzan, M., Choe, H., Vaca, L., Martin, K., Sun, Y., Desjardins, E., Ruffing, N., Wu, L., Wyatt, R., Gerard, N., Gerard, C., and Sodroski, J. (1998). A tyrosine-rich region in the N terminus of CCR5 is important for human immunodeficiency virus type 1 entry and mediates an association between gp120 and CCR5. J. Virol. 78, 1160–1164. Gao, Q., Gu, Z. X., Parniak, M. A. Li, X. G., and Wainberg, M. A. (1992). In vitro selection of variants of human immunodeficiency virus type 1 resistant to 3⬘-azido-3⬘-deoxythymidine and 2⬘,3⬘-dideoxyinosine. J. Virol. 66, 12–19. Goulder, P. J., Phillips, R. E., Colbert, R. A., McAdam, S., Ogg, G., Nowak, M. A., Giangrande, P., Luzzi, G., Morgan, B., Edwards, A., McMichael, A. J., and Rowland-Jones, S. (1997). Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nat. Med. 3, 212–217. Huang, Y., Paxton, W. A., Wolinsky, S. M., Neumann, A. U., Zhang, L., He, T., Kang, S., Ceradini, D., Jin, Z., Yazdanbakhsh, K., Kunstman, K., Erickson, D., Dragon, E., Landau, N. R., Phair, J., Ho, D. D., and Koup, R. A. (1996). The role of a mutant CCR5 allele in HIV-1 transmission and disease progression. Nat. Med. 2, 1240–1243. Kwong, P. D., Wyatt, R., Robinson, J., Sweet, R. W., Sodroski, J., and Hendrickson, W. A. (1998). Structure of an HIV gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody. Nature 393, 648–659. Lee, B., Sharron, M., Blanpain, C., Doranz, B. J., Valili, J., Setoh, P., Berg, E., Liu, G., Guy, H. R., Durell, S. R., Parmentier, M., Chang, C. N., Price, K., Tsang, M., and Doms, R. W. (1999). Epitope mapping of CCR5 reveals multiple conformational states and distinct but overlapping structures involved in chemokine and coreceptor function. J. Biol. Chem. 274, 9617–9626. Liu, R., Paxton, W. A., Choe, S., Ceradini, D., Martin, S. R., Horuk, R., MacDonald, M. E., Stuhlmann, H., Koup, R. A., and Landau, N. R. (1996). Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell 86, 367–377. Lucotte, G., and Mercier, G. (1998). Distribution of the CCR5 gene 32-bp deletion in Europe. JAIDS Hum. Retrovirol. 19, 174–177. Maeda, Y., Foda, M., Matsushita, S., and Harada, S. (2000). Involvement of both the V2 and V3 regions of the CCR5-tropic human immunodeficiency virus type 1 envelope in reduced sensitivity to macrophage inflammatory protein 1alpha. J. Virol. 74, 1787–1793. Martinson, J. J., Chapman, N. H., Rees, D. C., Liu, Y.-T., and Clegg, J. B. (1997). Global distribution of the CCR5 gene 32-basepair deletion. Nat. Genet. 16, 100–103. Masuda, T., Matsushita, S., Kuroda, M. J., Kannagi, M., Takatsuki, K., and Harada, S. (1990). Generation of neutralization-resistant HIV-1 in vitro due to amino acid interchanges of third hypervariable env region. J. Immunol. 145, 3240–3246. McKeating, J. A., Bennett, J., Zolla-Pazner, S., Schutten, M., Ashelford, S.,

389

Brown, A. L., and Balfe, P. (1993). Resistance of a human serumselected human immunodeficiency virus type 1 escape mutant to neutralization by CD4 binding site monoclonal antibodies is conferred by a single amino acid change in gp120. J. Virol. 67, 5216–5225. McKeating, J. A., Gow, J., Goudsmit, J., Pearl, L. H., Mulder, C., and Weiss, R. A. (1989). Characterization of HIV-1 neutralization escape mutants. AIDS 3, 777–784. Mo, H., Stamatatos, L., Ip, J. E., Barbas, C. F., Parren, P. W., Burton, D. R., Moore, J. P., and Ho, D. D. (1997). Human immunodeficiency virus type 1 mutants that escape neutralization by human monoclonal antibody IgG1b12. J. Virol. 71, 6869–6874. Moore, J. M., and Jarrett, R. F. (1988). Sensitive ELISA for the gp120 and gp160 glycoproteins of HIV-1. AIDS Res. Hum. Retroviruses 4, 369– 387. Moore, J. P., McKeating, J. A., Weiss, R. A., and Sattentau, Q. J. (1990). Dissociation of gp120 from HIV-1 virions induced by soluble CD4. Science 250, 1139–1142. Mosier, D. E., Picchio, G. R., Gulizia, R. J., Sabbe, R., Poignard, P., Picard, L., Offord, R. E., Thompson, D. A., and Wilken, J. (1999). Highly potent RANTES analogues either prevent CCR5-using human immunodeficiency virus type 1 infection in vivo or rapidly select for CXCR4-using variants. J. Virol. 73, 3544–3550. Nguyen, G., Carrington, M., Beeler, J., Dean, M., Aledort, L., Blatt, P., Cohen, A., DiMichele, D., Eyster, M., Kessler, C., Konkle, B., Leissinger, C., Luban, N., O’Brien, S., Goedert, J., and O’Brien, T. (1999). Phenotypic expressions of CCR5-delta32/delta32 homozygosity. JAIDS 22, 75–82. O’Brien, T. R., Winkler, C., Dean, M., Nelson, J. A. E., Carrington, M., Michael, N. L., and White II, G. C. (1997). HIV-1 infection in a man homozygous for CCR5 ⌬32. Lancet 349, 1219. O’Brien, W. A., Mao, S.-H., Cao, Y., and Moore, J. P. (1994). Macrophagetropic and T-cell line-adapted chimeric strains of human immunodeficiency virus type 1 differ in their susceptibilities to neutralization by soluble CD4 at different temperatures. J. Virol. 68, 5264–5269. Ometto, L., Zanchetta, M., Cabrelle, A., Esposito, G., Mainardi, M., Chieco-Bianchi, L., and De Rossi, A. (1999). Restriction of HIV type 1 infection in macrophages heterozygous for a deletion in the CCchemokine receptor 5 gene. AIDS Res. Hum. Retroviruses 15, 1441– 1452. Paxton, W. A., Liu, R., Kang, S., Wu, L., Gingeras, T. R., Landau, N. R., Mackay, C. R., and Koup, R. A. (1998). Reduced HIV-1 infectability of CD4⫹ lymphocytes from exposed-uninfected individuals: Association with low expression of CCR5 and high production of betachemokines. Virology 244, 66–73. Paxton, W. A., Martin, S. R., Tse, D., O’Brien, T. R., Skurnick, J., VanDevanter, N. L., Padian, N., Braun, J. F., Kotler, D. P., Wolinsky, S. M., and Koup, R. A. (1996). Relative resistance to HIV-1 infection of CD4 lymphocytes from persons who remain uninfected despite multiple high-risk sexual exposure. Nat. Med. 2, 412–417. Picard, L., Simmons, G., Power, C. A., Meyer, A., Weiss, R. A., and Clapham, P. R. (1997). Multiple extracellular domains of CCR-5 contribute to human immunodeficiency virus type 1 entry and fusion. J. Virol. 71, 5003–5011. Picchio, G., Gulizia, R., and Mosier, D. (1997). Chemokine receptor CCR5 genotype influences the kinetics of human immunodeficiency virus type 1 infection in human PBL-SCID mice. J. Virol. 71, 7124–7127. Reitz, M. S., Wilson, C., Naugle, C., Gallo, R. C., and Robert-Guroff, M. (1988). Generation of a neutralization-resistant variant of HIV-1 is due to selection for a point mutation in the envelope gene. Cell 54, 57–63. Rizzuto, C. D., Wyatt, R., Hernandez-Ramos, N., Sun, Y., Kwong, P. D., Hendrickson, W. A., and Sodroski, J. (1998). A conserved HIV gp120 glycoprotein structure involved in chemokine receptor binding. Science 280, 1949–1953. Rucker, J., Samson, M., Doranz, B. J., Libert, F., Berson, J. F., Yi, Y., Smyth, R. J., Collman, R. G., Broder, C. C., Vassart, G., Doms, R. W., and Parmentier, M. (1996). Regions in b-chemokine receptors CCR5 and CCR2b that determine HIV-1 cofactor specificity. Cell 87, 437–446.

390

AARONS ET AL.

Samson, M., Libert, F., Doranz, B. J., Rucker, J., Liesnard, C., Farber, C. M., Saragosti, S., Lapoumeroulie, C., Cognaux, J., Forceille, C., Muyldermans, G., Verhofstede, C., Burtonboy, G., Georges, M., Imai, T., Rana, S., Yi, Y., Smyth, R. J., Collman, R. G., Doms, R. W., Vassart, G., and Parmentier, M. (1996). Resistance to HIV-1 infection in Caucasian individuals bearing mutant alleles of the CCR-5 chemokine receptor gene. Nature 382, 722–725. Schols, D., Este, J. A., Cabrera, C., and De Clercq, E. (1998). T-cell-linetropic human immunodeficiency virus type 1 that is made resistant to stromal cell-derived factor 1alpha contains mutations in the envelope gp120 but does not show a switch in coreceptor use. J. Virol. 72, 4032–4037. Sirko, D. A., and Ehrlich, G. D. (1996). Genotypic and phenotypic characterization of a neutralization-resistant breakthrough population of HIV-1. Virology 218, 238–242. Speck, R. F., Wehrly, K., Platt, E. J., Atchison, R. E., Charo, I. F., Kabat, D., Chesebro, B., and Goldsmith, M. A. (1997). Selective employment of chemokine receptors as human immunodeficiency virus type 1 coreceptors determined by individual amino acids within the envelope V3 loop. J. Virol. 71, 7136–7139. Theodorou, I., Meyer, L., Magierowska, M., Katlama, C., Rouzioux, C., and Group, S. S. (1997). HIV-1 infection in an individual homozygous for CCR5 ⌬32. Lancet 349, 1219–1220.

Wu, L., LaRosa, G., Kassam, N., Gordon, C. J., Heath, H., Ruffing, N., Chen, H., Humblias, J., Samson, M., Parmentier, M., Moore, J. P., and Mackay, C. R. (1997a). Interaction of chemokine receptor CCR5 with its ligands: Multiple domains for HIV-1 gp120 binding and a single domain for chemokine binding. J. Exp. Med. 186, 1373–1381. Wu, L., Paxton, W. A., Kassam, N., Ruffing, N., Rottman, J. B., Sullivan, N., Choe, H., Sodroski, J., Newman, W., Koup, R. A., and Mackay, C. R. (1997b). CCR5 levels and expression pattern correlate with infectability by macrophage-tropic HIV-1, in vitro. J. Exp. Med. 185, 1681– 1691. Yoshida, K., Nakamura, M., and Ohno, T. (1997). Mutations of the HIV type 1 V3 loop under selection pressure with neutralizing monoclonal antibody NM-01. AIDS Res. Hum. Retroviruses 13, 1283–1290. Yoshiyama, H., Mo, H., Moore, J. P., and Ho, D. D. (1994). Characterization of mutants of human immunodeficiency virus type 1 that have escaped neutralization by a monoclonal antibody to the gp120 V2 loop. J. Virol. 68, 974–978. Zhang, L., Huang, Y., Hannah, Y., Tuttleton, S., and Ho, D. D. (1997). Genetic characteristics of vif, vpr, and vpu sequences from long-term survivors of human immunodeficiency virus type 1 infection. Virology 228, 340–349. Zhang, L., Huang, Y., He, T., Cao, Y., and Ho, D. D. (1996). HIV-1 subtype and second-receptor use. Nature 383, 768.