Adapter-Directed Display: A Modular Design for Shuttling Display on Phage Surfaces

doi:10.1016/j.jmb.2009.11.068

J. Mol. Biol. (2010) 395, 1088–1101

Available online at www.sciencedirect.com

Adapter-Directed Display: A Modular Design for Shuttling Display on Phage Surfaces Kevin Caili Wang⁎, Xinwei Wang, Pingyu Zhong and Peter Peizhi Luo⁎ Abmaxis Inc., a wholly owned subsidiary of Merck & Co., Inc., WP26-413, 770 Sumneytown Pike, West Point, PA 19486, USA Department of Biologics Research, Merck Research Laboratories, Merck & Co., Inc., WP26-413, 770 Sumneytown Pike, West Point, PA 19486, USA Received 24 August 2009; received in revised form 20 November 2009; accepted 30 November 2009 Available online 4 December 2009

A novel adapter-directed phage display system was developed with modular features. In this system, the target protein is expressed as a fusion protein consisting of adapter GR1 from the phagemid vector, while the recombinant phage coat protein is expressed as a fusion protein consisting of adapter GR2 in the helper phage vector. Surface display of the target protein is accomplished through specific heterodimerization of GR1 and GR2 adapters, followed by incorporation of the heterodimers into phage particles. A series of engineered helper phages were constructed to facilitate both display valency and formats, based on various phage coat proteins. As the target protein is independent of a specific phage coat protein, this modular system allows the target protein to be displayed on any given phage coat protein and allows various display formats from the same vector without the need for reengineering. Here, we demonstrate the shuttling display of a single-chain Fv antibody on phage surfaces between multivalent and monovalent formats, as well as the shuttling display of an antigen-binding fragment molecule on phage coat proteins pIII, pVII, and pVIII using the same phagemid vectors combined with different helper phage vectors. This adapterdirected display concept has been applied to eukaryotic yeast surface display and to a novel cross-species display that can shuttle between prokaryotic phage and eukaryotic yeast systems. © 2009 Elsevier Ltd. All rights reserved.

Edited by J. Karn

Keywords: phage display; shuttling display; coiled-coil adapters; antibody; phage coat proteins

Introduction Phage display is a core technology platform for the construction and screening of peptide and protein libraries. It is suited to these purposes due to its numerous practical advantages including the availability of various genetic tools, the convenience of manipulation, and the high transformation efficiency of Escherichia coli cells. The abilities to *Corresponding authors. E-mail addresses: [email protected]; [email protected]. Abbreviations used: scFv, single-chain Fv; Fab, antigenbinding fragment; VEGF, vascular endothelial growth factor; IL-13, interleukin 13; PBS, phosphate-buffered saline; HRP, horseradish peroxidase; PEG/NaCl, polyethylene glycol/sodium chloride; ABTS, 2,2′-azinobis(3-ethylbenzthiazoline-6-sulfonic acid); AP, alkaline phosphatase; FACS, fluorescence-activated cell sorting; pfu, plaque-forming unit; PBS-T, PBS containing Tween 20; MPBS, milk/PBS.

construct libraries of enormous molecular diversity (up to 1011) and to select molecules with desired properties have made this technology particularly applicable for the screening and discovery of monoclonal antibodies. Today, combinatorial antibody libraries displayed on phages are routinely used for the generation of antibodies against any given antigen, thereby obviating the need for animals and the use of traditional hybridoma technology.1–8 The filamentous M13 bacteriophage has a singlestranded DNA genome encased in a long protein cylinder consisting of approximately 2700 subunits of major coat protein pVIII. The ends of a phage particle are capped by four minor coat proteins (approximately five copies of each per phage), with pIII and pVI at one end and pVII and pIX located at the opposite end. For phage surface display, exogenous genetic sequences are inserted into the entire phage genome and fused in-frame to the amino-terminus of either minor coat protein pIII9–13 or major coat protein pVIII.14–16 Viral genome-based

0022-2836/$ - see front matter © 2009 Elsevier Ltd. All rights reserved.

1089

Adapter-Directed Display System

multivalent display provides potential advantages in antibody library selection. It has been reported that the presence of multiple copies of the singlechain Fv (scFv) antibody per phage significantly improves the selection efficiency of a naïve phage antibody library using a pIII-based viral vector.13 Phagemid vector systems offer several distinct advantages for the display of large proteins. Due to competition with the wild-type coat protein, the incorporation of pIII fusions into phage particles is limited, on average, to less than one copy per phage.17–19 Such a method of pIII-based monovalent display is widely used for the display of antibody libraries [either scFv or antigen-binding fragment (Fab)] for the selection of high-affinity binding molecules.3–5,7 A multivalent display phagemid system was also described using a gene III deleted helper phage20–22 or bacterial package cell23 to avoid competition with wild-type pIII coat protein. In addition to the most commonly used pIII display, other coat proteins, including pVIII, pVI, pVII, and pIX, have also been reported for phagemid vector systems for peptide and protein display.24–30 For most applications, the target protein is directly fused to the amino-terminus of a phage coat protein, with the exception of coat protein pVI. Due to its carboxy-terminus surface exposure, phage coat protein pVI has been used for the display of cDNA libraries.27,28 More recently, phage coat proteins pIII and pVIII were also described for such applications by adding an optimized linker of 8 to 10 amino acids between phage coat protein pIII and the target protein or by using an artificial major coat protein with C-terminus surface exposure.31–33 As an alternative to C-terminus fusion approaches, a modified phagemid vector, pJuFo, was developed to display cDNA products.34 This phagemid vector allows the simultaneous production of two recombinant proteins: phage coat protein pIII fused at its Nterminus to the Jun leucine zipper domain and the cDNA product fused at its N-terminus to the Fos leucine zipper domain. Another variant of the pJuFo vector is the “CysDisplay” system.8 In this system, the phagemid vector expresses two recombinant proteins with free cysteines: phage coat protein pIII with a free cysteine at its N-terminus and an antibody fragment with a C-terminal free cysteine. The display of an antibody fragment is mediated by the formation of a disulfide bond with a coat protein in the bacterial periplasmic space. Similar to fusion-based phagemid displays, both modified phagemid vectors described above still contain one copy of phage gene III, which encodes a recombinant phage coat protein and thus belongs to the monovalent display format. Here, we report a modular adapter-directed display system. In contrast to the phagemid display vectors described above, the coding sequence for a phage coat protein was not included in the construction of the display vector, making it totally coat protein independent. For display purposes, the target protein was fused in-frame with the small adapter GR1 in the phagemid vector. Meanwhile, a counterpart adapter GR2, which can form a pairwise

heterodimer with GR1, was genetically engineered into the helper phage genome to be expressed as a fusion protein with one of the phage coat proteins. The ability to fuse GR2 to any given phage coat protein in the helper phage allows flexibility in displaying target proteins on different coat proteins, allowing the shuttling display of the target protein between various display formats without the need for reengineering the phagemid vector. In this report, we show the shuttling display of an scFv antibody between multivalent and monovalent display formats, as well as the shuttling display of a Fab fragment between phage coat proteins pIII, pVII, and pVIII using the same phagemid display vector. In addition, we also demonstrate the shuttling display of an scFv antibody between phage and yeast surfaces without changing the display vector.

Results The design of an adapter-directed phage display system The modular design of the adapter-directed phage display system is illustrated in Fig. 1. This system is composed of two components: a phagemid vector without any phage coat protein sequences and a helper phage with one copy of recombinant coat protein. In the phagemid vector, the target gene is fused in-frame with the coding sequences for adapter 1 and an HA-tag (for detection) and then expressed as a secretory protein with a small adapter 1 sequence (left panel in Fig. 1a). Diverse DNA sequences can be inserted into this vector to construct an expression library. In the engineered helper phage genome, adapter 2, which can form a pairwise heterodimer with adapter 1, is fused inframe with one of the phage coat proteins. For detection purposes, a Myc-tag sequence is placed between adapter 2 and the coat protein. Both adapter fusions are transported into the periplasm, where the adapters form stable heterodimers through a disulfide bond. The incorporation of the heterodimer into the phage particle leads to the display of the target protein on the phage surface (right panel in Fig. 1a). We chose two coiled-coil sequences derived from the intracellular C-terminus of gamma-aminobutyric acid receptors GABAB-R1 and GABAB-R2, as the adapters in this study. The adapter sequences, termed GR1 and GR2, respectively, are shown in Fig. 1b. A previous study demonstrated that these sequences preferentially form parallel coiled-coil heterodimers under physiological buffer and temperature conditions.35 The coiled-coil peptides from GABAB-R1 folded into relatively unstable homodimers, whereas the coiled-coil peptides from GABAB-R2 were largely unstructured and could not form any homodimers. To further stabilize the heterodimers on the adapter-directed phage surface, we introduced a spacer sequence (ValGlyGlyCys)

1090

Adapter-Directed Display System

Fig. 1. (a) A schematic representation of the experimental design of the adapter-directed display systems. The system has two components: a phagemid vector without any phage coat protein sequence and an engineered helper phage vector. Introduction of the phagemid vector alone into E. coli host cells leads to the secretion of soluble protein, which is fused in-frame with adapter 1 (GR1, left panel). Superinfection of the bacterial cells bearing the phagemid vector, with the helper phage that carries a phage coat protein fused in-frame with adapter 2 (GR2), permits the display of the protein of interest on the phage surface via pairwise interaction between the two adapters. With a multivalent helper phage, the protein can be displayed in a multivalent format (right panel). With the use of the same phagemid vector plus monovalent helper phage vector, monovalent display can be achieved. Furthermore, with different helper phage vectors, the protein can be displayed on different coat proteins such as pIII, pVII, and pVIII. (b) The amino acid sequences of adapter 1 (GR1) and adapter 2 (GR2).

after each coiled-coil sequence to lock the heterodimeric coiled-coil pair via a disulfide bond between the cysteine residues. For the purpose of multivalent display, the adapter GR2 sequence was fused directly in-frame with the original phage gene III in the helper phage genome. This in-frame insertion ensured that all pIII coat proteins were expressed as GR2 fusions and were able to dimerize with the adapter GR1 fusions for the multivalent display (GM helper phage in Fig. 2a). In the case of monovalent display, an additional copy of the coat protein gene fused to the GR2 sequence was inserted into the helper phage genome (e.g., GMCT helper phage in Fig. 2a). The competition between the fusions and wild-type coat proteins for phage particle assembly resulted in monovalent display. The fusion of GR2 sequence to different phage coat proteins in the helper phage genome allowed us to display the target protein through any given phage coat protein. With this unique feature, it became possible to have shuttling display of the target protein between different phage

coat proteins and display formats without having to reengineer the display vector (right panel in Fig. 1a). Multivalent display helper phage The GM helper phage vector (Fig. 2a) was constructed from the M13KO7 helper phage genome through the insertion of GR2 and Myc-tag sequences at the 5′ end of gene III. Therefore, all pIII proteins assembled in helper phage particles were GR2 fusions. The GM helper phages were produced from TG1 cells harboring the GM helper vector and purified from the culture supernatant by two polyethylene glycol/sodium chloride (PEG/NaCl) precipitations. To verify the assembly of GR2-MycpIII fusions in viral particles, we subjected the denatured phage samples for four clones of the GM helper phage and the control M13KO7 helper phage to SDS-PAGE followed by anti-Myc-tag Western blot to detect the Myc-tagged pIII fusions in phage particles. The presence of Myc-tagged GR2-pIII fusions in all four clones of GM phage samples

Adapter-Directed Display System

1091

Fig. 2. Helper phage and phagemid vectors in adapter-directed display systems. (a) A schematic representation of recombinant coat proteins in engineered helper phage vectors. All helper phage vectors express at least one copy of coat protein fused in-frame with adapter GR2 and a Myc-tag (for detection). GM helper phage vector is a multivalent helper vector, in which GR2 and Myc-tag sequences were fused in-frame with the original gene III with the original pIII leader sequence at the 5′ end. All other helper vectors are monovalent helper phage vectors, in which an additional copy of the recombinant coat protein fusion gene with pIII or OmpA leader sequences at the 5′ end was inserted into the wild-type M13KO7 helper phage genome. GMCT and GMp3 were used for display on the pIII coat protein, KGp7 was used for display on coat protein pVII, and KGp8 was used for display on coat protein pVIII. (b) A schematic representation of phagemid vectors. The pABMX14 vector expresses an scFv protein fused in-frame with HA-tag, His-tag, and adapter GR1, under the control of a lac promoter, the ribosomal binding site (S/D), and the pelB leader. The control vector, pCANTAB-scFv, expresses an scFv-pIII fusion, driven by a lac promoter, the ribosomal binding site (S/D), and the M13 pIII leader (p3L). In pABMX492, the Fab antibody heavy chain including VH and CH1 (human IgG1) and light chain including Vk and Ck (human) are driven by a single lac promoter with the ribosomal binding site (S/D) and M13 pVIII leader (p8L) at the 5′ end of the heavy chain and the ribosomal binding site (S/D) and M13 pIII leader (p3L) at the 5′ end of the light chain. Only the light chain expresses as adapter GR1 fusion with an HA- and His6-tag. The pMAT14 vector expresses an scFv-HA/His tag-GR1 fusion protein, under the control of a yeast GAL10/bacterial lac hybrid promoter and yeast ADH1 terminator (ADH1 TT). The secretion of the scFv fusion protein is driven by a leader sequence from the yeast endo-β-1,3-glucanase protein Bgl2p that functions in bacterial systems as well.

1092

Adapter-Directed Display System

Fig. 3. Incorporation of GR2-Myc tag-pIII fusion into GM helper phage. (a) Anti-Myc-tag and anti-pIII Western blot of GM helper phages. In the left panel, phage samples of four clones of GM and control wild-type M13KO7 were subjected to 10% SDS-PAGE under reducing condition, followed by anti-Myc blot. Only GM helper phages had Myc-tagged recombinant pIII fusion proteins. In the right panel, phage samples of GM clone #6 and control M13KO7 were run in 4– 12% gradient SDS-PAGE under reducing conditions, followed by an anti-M13 pIII blot. GR2-Myc-modified pIII in the GM helper phage had a slower electrophoretic mobility than wild-type pIII in M13KO7. (b) Cleavage of GR2-Myc domains from the GM phage surface. Immobilized anti-Myc antibody was used to capture phages after trypsin treatment. The captured phages were detected by HRP-conjugated anti-M13 antibody in an ELISA. Trypsin cleavage allows the release of antigen-bound phages during the phage panning process. Data are means ± SD from three experiments.

was observed (Fig. 3a, left panel). The Myc-tagged protein was not detected in the M13KO7 control phage. In addition, a Western blot of anti-phage coat protein pIII was performed to verify that every pIII in the GM helper phage contained the GR2 adapter. The data illustrated in the right panel of Fig. 3a show that all pIII proteins in the GM helper phage particles had slower electrophoretic mobility than wild-type pIII in M13KO7. This change in mobility indicated that all pIII proteins in the GM helper phage were recombinant pIII with GR2 adapter. Taken together, these results confirmed the assembly of GR2-pIII fusions into GM helper phage particles, as expected. Next, we examined the effect of the GR2 sequence on the assembly of viral particles. The viral yield of

GM and M13KO7 helper phages in the TG1 culture supernatants was measured. The culture supernatants of GM helper phage contained 2 × 1011 phage particles/ml, which was approximately 5 times lower than that of wild-type M13KO7 phage. These data suggest that the GR2-Myc domain fused at the N-terminus of pIII affects the efficiency of phage assembly, thereby decreasing phage production. However, the yield of the GM helper phage was still within the workable range. There are seven putative trypsin cleavage sites in the GR2-Myc domain. To test the possibility of removal of the phage surface GR2-Myc domain by trypsinization, we exposed the purified GM helper phages to different concentrations of trypsin for 30 min at 37 °C. An anti-Myc-tag ELISA was

1093

Adapter-Directed Display System

performed to detect the residual Myc-tag on the GM helper phage surface. The result shown in Fig. 3b indicates that the Myc-tag was removed to a nondetectable level by trypsin treatment at the concentration equal to or greater than 5 μg/ml. These cleavage sites allow the elution of antigen-bound phages by trypsinization during phage panning, since the wild-type M13 phage is resistant to trypsin treatment.36 To determine the impact of the GR2-Myc domain at the N-terminus of pIII on helper phage infectivity, we carried out the phage plaque formation assay for both GM and M13KO7 helper phages. The data in Table 1 show that 1 ml of 1 OD268 GM phage particles gave 5.5 × 1011 plaque-forming units (pfu), which was 3.5-fold lower than that for wild-type M13KO7 helper phages (1.9 × 1012 pfu). However, the infectivity of the GM helper phage could be restored to a level similar to M13KO7 by removing the surface GR2-Myc domain. After 30 min of trypsinization, the infectivity of the GM helper phage was increased by 2-fold to 1.1 × 1012 pfu. Additionally, both GM and M13KO7 helper phages were heated to 80 °C for 10 min to determine thermostability. After heating, the infectivity of wild-type M13KO7 decreased 5-fold, while the GM helper phage had a 2.5-fold decrease in its infectivity (Table 1). These data conclude that the GM and M13KO7 helper phages had similar thermostabilities, and the insertion of the GR2-Myc domain did not change phage stability. Multivalent display of an scFv antibody on the phage surface In order to demonstrate that a protein can be functionally displayed using the adapter-directed display system, we constructed the phagemid vector pABMX14 to express an anti-vascular endothelial growth factor (VEGF) scFv antibody fused in-frame with the adapter GR1 and an HA-tag (Fig. 2b). TG1 cells harboring the pMAX14 phagemid vector were superinfected with the GM or M13KO7 helper phage (negative control). Phage particles were generated and purified from culture supernatants as described in Materials and Methods. The production yield of the adapter-display phage generated by the GM helper phage was approximately 10– 30 times lower than that of the M13KO7 control helper phage (data not shown). This low yield was possibly due to the low assembly efficiency of multiple copies of scFv-GR1/GR2-pIII dimers into the phage particle. This result is consistent with observations in other pIII fusion-based multivalent display platforms.14,20 The phage particles generated from pMAX14 and GM helper phage vectors were analyzed by Western blotting using anti-HA antibodies (Fig. 4a, right panel). HA-tagged scFv antibody was detected in the adapter-display phage (pMAX14/GM) but not in the control phage generated from M13KO7 helper phages (pMAX14/M13KO7). This result indicated the successful assembly of scFv into phage particles

Table 1. Infectivity of helper phages Helper phages M13KO7 M13KO7 GM GM GM

Treatments 80 °C/10 min 80 °C/10 min Trypsin/30 min

Pfu/ OD268/ml

Fold difference (treated/untreated)

1.9 × 1012 3.9 × 1011 5.5 × 1011 2.2 × 1011 1.1 × 1012

1a 0.2a 1b 0.4b 2b

Data represent the average of three experiments. a Compared with M13KO7. b Compared with GM.

through the adapter-directed mechanism. Since all pIII coat proteins were tagged with a Myc-tag, the quantitative analysis of Myc-tagged pIII fusions in the free and scFv-linked heterodimer status allowed us to estimate display valency. As shown in the left panel of Fig. 4a, the anti-Myc blot analysis revealed that the amount of scFv-GR1-HA/GR2-Myc-pIII dimers assembled in adapter-display phage particles was approximately twice that of free GR2-MycpIII. Considering that each phage particle contains about five copies of pIII coat protein, we estimated that each adapter-display phage particle generated by the GM helper phage on average carried approximately three copies of the scFv-GR1 fusion. The functionality of the scFv antibody displayed on the phage surface was measured by its antigenbinding activity using a phage ELISA against VEGF antigen coated on a microtiter plate. The results in Fig. 4b show the antigen-specific, concentrationdependent binding of the adapter-directed phage (pAMX14/GM), indicating the functional display of the anti-VEGF scFv antibody on the phage surface. Antigen-binding saturation was reached at a concentration of 1012 phage/ml, whereas the negative control phage (pABMX14/M13KO7) did not bind to the antigen even at a concentration of 1013 phage/ ml. Another set of control phages was also generated from the pIII fusion-based phagemid vector pCANTAB-scFv (Fig. 2b) and tested in phage ELISA to measure antigen-binding activity. The adapterdisplay phages (pAMX14/GM) showed much higher binding activity, which was 1 order of magnitude higher than that of control phages (pCANTAB-scFv/M13KO7) due to the higher display valency. These data were consistent with the results from the Western blot analysis described above. Taken together, our data demonstrate the multivalent display of the anti-VEGF scFv antibody on the phage surface using the GM helper phage. Monovalent display using GMCT helper phage The GMCT helper phage vector (Fig. 2a) was created by inserting an additional copy of recombinant gene III into the KO7kpn helper phage genome, resulting in two copies of gene III in the new helper phage. The recombinant gene III encodes a fusion of the GR2-Myc sequence with the C-terminal domain of pIII (amino acids 217 to 406), which is essential for phage assembly. This recombinant C-terminal pIII

1094

Adapter-Directed Display System

Fig. 4. Multivalent display of scFv antibody on phage surface. (a) Anti-HA and Myc-tag Western blot of the adapterdisplay phages generated by GM helper phage. Phage samples were subjected to 10% SDS-PAGE under non-reducing condition, followed by anti-Myc and anti-HA blots. GM helper phage and phage generated by M13KO7 served as controls. In the right panel, anti-HA blot confirmed the presence of the scFv-HA-GR1/GR2-Myc-pIII dimer in the adapterdisplay phages (pAMX14/GM helper phage). In the left panel, the scFv-HA-GR1/GR2-Myc-pIII dimer and free GR2Myc-pIII assembled in adapter-display phages were detected by an anti-Myc blot. Each adapter-display phage particle generated by GM helper phage carried approximately three copies of the scFv-GR1 fusion on average. (b) The antigenbinding activity of scFv antibody on phage surface. Phage samples with serial 1:10 dilutions were subjected to ELISA against immobilized VEGF antigen. Adapter-display phages generated from pMAX14/GM helper phage (diamonds) showed 1 order of magnitude higher binding activity than that of conventional pCANTAB monovalent display phages (circles); phages from pMAX14/M13KO7 helper phage were used as negative control (squares). Phage concentrations were determined by OD268. Data are means ± SD from three experiments.

will compete with wild-type pIII for assembly into phage particles. An anti-Myc-tag Western blot confirmed the presence of Myc-tagged C-terminal pIII in GMCT helper phage particles (Fig. 5a, right panel). Furthermore, Western blotting with an antiphage pIII antibody showed that the amount of recombinant C-terminal pIII assembled in GMCT helper phage particles was much lower than that of wild-type pIII proteins. Indeed, it was a fraction of total pIII protein (Fig. 5a, left panel). These data suggest that the display level with the GMCT helper phage is lower than that of GM helper phage and, therefore, suitable for adapter-directed monovalent display. The phage yield of the GMCT helper phage was approximately 8 × 1011 phage/ml in the culture

supernatant, which was similar to that of the M13KO7 helper phage. We concluded that adding a copy of recombinant pIII did not significantly affect phage particle assembly. The phagemid vector pMAX14, used for multivalent display as described above, was utilized for scFv antibody display using the GMCT helper phage. The resulting adapter-display phage in the culture supernatant was purified by PEG/NaCl precipitation and characterized by SDS-PAGE followed by Western blot analysis. Western blotting with both anti-Myc-tag and HA-tag antibodies confirmed the presence of scFv protein in the adapter-display phage (pABMX14/GMCT) but not in the control phages (GMCT and pABMX14/

Adapter-Directed Display System

1095

Fig. 5. Monovalent display by GMCT helper phage. (a) Western blot of GMCT helper phage and adapter-display phage. In the left panel, samples of GMCT and M13KO7 helper phage were subjected to 4–12% gradient SDS-PAGE under reducing conditions, followed by an anti-M13 pIII blot. The data confirmed that the GR2 adapter-modified recombinant C-terminal pIII was only a fraction of the total pIII protein in the GMCT helper phage particle. In the right panel, phage samples were subjected to 10% SDS-PAGE under non-reducing condition, followed by anti-Myc and anti-HA tag Western blot. The scFv-HA-GR1/GR2-Myc-pIII (CT) dimer was detected in pABMX14/GMCT phage, and free GR2-pIII (CT) was detected in the GMCT control phage using the anti-Myc antibody. Anti-HA blot confirmed the presence of scFv-HAGR1/GR2-Myc-pIII (CT) dimer in adapter-display phage (pABMX14/GMCT). The nonspecific bands that showed up on the Western blot were due to a longer time of development with AP substrate for detecting low copy of scFv on phages. (b) The antigen-binding activity of scFv antibody on phage surface. Phage samples with serial 1:5 dilutions were subjected to ELISA against immobilized antigen. Adapter-display phages generated from pMAX14/GMCT helper phage (open triangles) showed similar binding activity as conventional pCANTAB monovalent display phages (open circles); phages from pUC19/M13KO7helper phage served as negative control (squares). Phage concentrations were determined by OD268. Data are means ± SD from three experiments.

M13KO7) (Fig. 5a, right panel). The single-chain antibody displayed on the phage surface was subjected to phage ELISA to measure the antigenbinding activity. The result is illustrated in Fig. 5b and shows the specific binding of adapter-display phage to VEGF antigen in a concentrationdependent manner, thus confirming the functional display of scFv by GMCT helper phage. The antigen-binding levels of pABMX14/GMCT phage were similar to that of monovalent pCANTAB-scFv phage (as a control) in all tested concentrations. Moreover, the antigen-binding curves of both pABMX14/GMCT and pCANTAB-scFv phages overlapped closely. These data demonstrate the adapter-directed monovalent display of scFv antibody using the GMCT helper phage.

Phage surface display of a Fab molecule via coat protein pIII To test the adapter-directed display of a protein with multiple chains, we constructed phagemid vector pABMX492 to display an anti-interleukin 13 (IL-13) receptor (IL-13R) Fab fragment. In the pABMX492 vector, the expression of the antibody heavy chain and light chain is driven by a single lac promoter, and only the light chain is fused with the GR1 adapter (Fig. 2b). Two engineered helper phage vectors were employed for Fab phage display via phage coat protein pIII. One was the GMCT helper phage with a copy of a recombinant C-terminal pIII domain fused with adapter GR2 for display. The other was

1096

Adapter-Directed Display System

the GMp3 helper phage with a copy of full-length recombinant pIII fused to the GR2 adapter as its display carrier. The GMp3 helper phage vector was constructed from GMCT by replacing the C-terminal gene III fusion with a full-length gene III fusion. The full-length recombinant pIII fusion competes with wild-type pIII for phage assembly (Fig. 2a). The Fab display experiments were carried out by infection of TG1 cells harboring a pABMX492 vector with either the GMCT or GMp3 helper phage. The adapter-display phages generated from both helper phages were used in a phage ELISA to detect the antigen-binding activity of the Fabs on the phage surface (Fig. 6a). Both adapter-display phages showed concentration-dependent binding activities to IL-13R antigen and exhibited closely overlapping antigen-binding curves with binding saturation at around 1013 phage/ml. These results indicated the same level of display for Fab fragments on the adapter-display phages generated by GMCT and GMp3 helper phages and confirmed the functional equivalency of the C-terminal domain and the fulllength pIII as GR2 fusions for adapter-directed display. Phage surface display of a Fab molecule via coat protein pVII Using the same display vector, pABMX492, we examined the display of an anti-IL-13R Fab antibody on coat protein pVII. For this purpose, the KGp7 helper phage vector was constructed from the KO7kpn helper phage genome by inserting one copy of recombinant gene VII, encoding the GR2Myc-pVII fusion, immediately after the kanamycinresistant gene (Fig. 2a). The resulting helper phage vector carried two copies of the phage coat protein pVII gene. The expression of wild-type pVII was driven by its original phage promoter, and the recombinant pVII was controlled by the promoter for the kanamycin-resistant gene. The Fab-display phages were generated from TG1 cells harboring both pABMX492 and KGp7 vectors and then subjected to a phage antigen-binding assay. Phage ELISA results showed that the Fab antibody displayed on the phage surface bound to IL-13R in a concentration-dependent manner (Fig. 6a), indicating the functional display of the Fab antibody through the pVII coat protein by the KGp7 helper phage. The phage-binding activity was more than 1 order in magnitude lower than that of the pIII-based adapter-display phage described above, indicating a lower level of scFv antibody display through the pVII-based platform. This lower-level display was due to lower incorporation of GR2 adapter-modified pVII proteins in the KGp7 helper phage as compared with the GMCT helper phage (Fig. 6b). Phage surface display of a Fab molecule via coat protein pVIII To construct a pVIII-based helper phage, we chose a pVIII mutant P8 (f2), which was previously

Fig. 6. Fab display on coat proteins pIII, pIII-CT, pVII, and pVIII using the same phagemid vector pABMX492. (a) Display was measured by phage ELISA against antigen IL-13R coated on the plate. In comparison, display levels through coat protein pIII (triangles) and pIII-CT (open squares) are favorably higher than display levels through coat protein pVII (diamonds) and pVIII (open circles). Phages generated by M13KO7 served as negative control (cross). Phage concentrations were determined by OD268. Data are means ± SD from three experiments. (b) GR2-Myc modified phage coat proteins in GMCT, KGp7, and KGp8 helper phages. The same amount of phage particles was subjected to 4–12% gradient SDS-PAGE under reducing conditions, followed by anti-Myc tag Western blot. The incorporation level of adapter GR2-modified pVIII in KGp8 was significantly higher (more than 1 order of magnitude) than that in GMCT and KGp7.

reported to produce high-copy display of hGH proteins.26 The KGp8 helper phage vector was generated by inserting one copy of the recombinant gene VIII, encoding a GR2-pVIII fusion, immediately downstream of the kanamycin-resistant gene in the KO7kpn helper phage genome (Fig. 2a). A phage ELISA was conducted on the adapter-display phage generated from the pABMX492 vector and the KGp8 helper phage. We observed that Fab molecules were functionally displayed on the phage surface through the pVIII coat protein (Fig. 6a) as expected. However, the display level was low and did not

Adapter-Directed Display System

1097

reach the display valency provided by the pIII-based display. The phage-binding activity to the IL-13R antigen was similar to that of the pVII-based phage, and both the pVII- and pVIII-based phage binding curves were closely overlapped, indicating a similar level of Fab display on phages generated by KGp7 and KGp8 helper phages. This low level of Fab display with KGp8 helper phage may be due to the low tolerance of pVIII to large protein insertions, although the incorporation levels of GR2 adapter-modified coat protein in the KGp8 helper phage were significantly higher (more than 1 order of magnitude) than that in both KGp7 and GMCT (Fig. 6b).

Discussion The adapter-directed display system was designed with modularity to combine the advantages of all existing display formats to accommodate various applications. A series of helper phage vectors were constructed for display on various phage coat proteins with different display formats. By switching helper phage modules, this system allows flexibility in choosing the phage coat protein for display. The system also allows for shuttling display, the transfer of one display format to another using the different helper phages, without the need for reengineering the display vector. Using the scFv antibody display as an example, we demonstrated shuttling between multivalent and monovalent display by utilizing the same display vector and two helper phages, GM and GMCT. In practice, this display format shuttling has significant implications for antibody selection and engineering. With multivalent and monovalent helper phages, a large size antibody library, for example, can be displayed and selected in a multivalent format at the beginning to obtain maximal enrichment of diverse antibody sequences and subsequently be displayed in a monovalent format to select for higher affinity binders. We also report another type of shuttling display that occurs between different coat proteins. Using the same display vector with GMp3/GMCT, KGp7 and KGp8 helper phages, we demonstrated the successful display of a Fab antibody on phage coat proteins pIII, pVII, and pVIII, respectively. pVIII has been widely used for the display of peptides due to its low tolerance to larger protein insertions. Similarly, our data show a lower display level of the Fab molecule on pVIII than that on pIII. However, the significantly higher (more than 1 order of magnitude) level of GR2 adapter incorporation in KGp8 helper phages over GMCT helper phages suggests that KGp8 could be used for the multivalent display of peptides. Therefore, switching from pVIII-based multivalent to pIII-based monovalent display may be beneficial for peptide library selection. This adapter-directed display concept has been applied to yeast surface display using the same set

Fig. 7. scFv display on phage and yeast surfaces using the same display vector. (a) scFv display on phage surface using pMAT14 vector and GMCT helper phage. The phages generated from the pMAT14/GMCT showed an antigen-specific, concentration-dependent binding in a phage ELISA (open diamonds). Phages generated from pUC19/GMCT served as negative control (squares). Phage concentrations were determined by OD268. Data are means ± SD from three experiments. (b) Yeast surface display with pMAT14 display vector. pMAT14 was transformed into an engineered yeast strain KQP600 that expressed a cell wall protein Cwp2 fused with the adapter GR2. The flow cytometry analysis showed that more than 50% of individual cells bound specifically to VEGF antigen after 20 h galactose induction. Non-induced cells were used as negative control.

of adapters (data submitted for publication). Compared to phage display, yeast surface display provides some unique advantages associated with eukaryotic cell expression and selection methods. With the same set of adapters and two speciesspecific helper vectors, we created a cross-species display system for shuttling display of proteins of interest between phage and yeast surfaces. As shown in Fig. 2b, the dual display vector pMAT14 was constructed to express an anti-VEGF scFv fused to adapter GR1 in both E. coli and yeast Saccharomyces cerevisiae cells. The phages generated from the TG1 cells harboring both pMAT14 and GMCT vectors showed antigen-specific, concentrationdependent binding in a phage ELISA (Fig. 7a). For yeast surface display, the same display vector was transformed into an engineered yeast strain

1098 (KQP600) that expresses a cell wall protein Cwp2 fused to GR2. Flow cytometry analysis showed that 50% of individual cells within the tested population displayed scFv and bound specifically to VEGF antigen (Fig. 7b). This unique feature cannot be realized with conventional phage display systems, in which the protein of interest is fused to a phagespecific surface anchoring sequence that is not functional in other species such as yeast. We expect that the adapter-directed multi-species and crossspecies display systems have significant implications for future protein engineering applications.

Materials and Methods Phagemid display vector construction The basic phagemid vectors were derived from pBluescript SK(+) (Stratagene). A unique AgeI restriction site was introduced immediately after the lac promoter by PCRbased site-directed mutagenesis, with the following primers: pBS-Ska: 5′-GGAATTGTGAGCGGATAACAATTTACCGGTCACACAGGAAACAGCTATGACCATG-3′ and pBS-SKb: 5′-CATGGTCATAGCTGTTTCCTGTGTGACCGGTAAATTGTTATCCGCTCACAAT TCC-3′. The XhoI and KpnI sites were then deleted by digestion and blunt-end ligation. The synthetic DNA fragment flanked by an AgeI site at the 5′ end and a SalI site at the 3′ end, containing ribosome-binding sequence S/D, secretion leader sequence, and coding sequences for adapter GR1 and HA-(His)6-tag (referred to as DH tag), was cloned into the engineered pBluescript SK(+). Two versions of the basic vector were generated: one with and the other without an amber stop codon between the DH tag and GR1 adapter. A synthetic anti-VEGF scFv gene was cloned into the basic display vector without an amber stop codon using the NcoI and NotI sites. The resulting vector pABMX14 expressed and secreted soluble scFv antibody with a small GR1 adapter (Fig. 2b). For the purpose of comparison, this scFv gene was also cloned into the pCANTAB 5E vector using SfiI and NotI sites (pCANTAB-scFv, Fig. 2b). For the display of the anti-IL-13R Fab fragment, the synthetic sequence of two cistrons, one for the heavy chain and the other for the light chain, was cloned into the basic vector with an amber stop codon using HindIII and NotI sites. In the resulting vector pABMX492 (Fig. 2b), the first cistron contained the M13 phage gene VIII leader sequence, VH and CH1 sequences. The second cistron included the M13 phage gene III leader sequence, VL and Ck sequences. Only the light chain was expressed as a GR1 adapter fusion. pMAT14 vector (Fig. 2b) was derived from yeast episomal vector pESC-TRP (Stratagene). A yeast intron sequence containing the lac promoter was inserted after the galactose-inducible GAL10 promoter using EcoRI and NotI sites. Downstream of the hybrid promoter, a fully synthetic DNA fragment encoding a bacterial and yeast dual functional signal sequence from yeast endo-β-1,3glucanase protein Bgl2p and the anti-VEGF scFv-adapter GR1 fusion was inserted with SacI and SpeI sites.

Adapter-Directed Display System vector by PCR-based site-directed silent mutagenesis. The KO7 genome was amplified by PCR using the following primers containing KpnI sites: p3KN1: 5′-TTTAGTGGTACCTTTCTATTCTCACTCCGCT G-3′and p3KN2: 5′TAGAAAGGTACCACTAAAGGAATTGCGAATAA-3′. The PCR products were gel purified, cut with KpnI and ligated, and then transformed into TG1 cells by electroporation. The kanamycin-resistant colonies were grown overnight in 96-well microtiter plates in 2 × YT medium with 70 μg/ml kanamycin. The supernatants were directly employed to phage ELISA for phage production screening to eliminate loss-of-function mutants caused by PCR errors. The presence of the KpnI site in phage-positive clones was further confirmed by KpnI digestion and sequencing. The clone KO7kpn-B9 was used for subsequent helper phage vector construction. The GM helper phage vector was constructed by replacing the KpnI-BamHI fragment of gene III in KO7kpn-B9 with a synthetic DNA fragment encoding a partial pIII leader (amino acid residues 11–19), the adapter GR2, and partial pIII sequences (amino acid residues 1– 197). The resulting GM helper phage vector (Fig. 2a) comprised an engineered gene III fusion in which a GR2 domain and a Myc-tag sequence (for the detection of engineered pIII protein) were fused in-frame with gene III. The strategy for construction of GMCT helper phage vector was similar to that of the construction of the GM helper vector, except that the fusion gene replaced the KpnI-BamHI fragment. Immediately after the gene III leader sequence, the GR2 coding sequence and the Myc-tag sequence were fused to the pIII C-terminus domain (amino acids 217 to 405) sequence. Farther downstream, a ribosome binding sequence (S/D) and the bacterial protein OmpA leader sequence were fused to wild-type gene III. Both the engineered and wild-type gene III were under the control of the original gene III promoter (shown in Fig. 2a). The construction approach for the GMp3 helper phage vector was also similar to that of the GMCT vector, except that the synthetic KpnI-BamHI fragment contained a fulllength pIII fused with GR2 adapter. Therefore, there were two copies of full-length gene III in the GMp3 vector: one was an engineered gene III with a Myc-tag/GR2 adapter and the other was a wild-type gene III (Fig. 2a). The KGp7 helper vector was constructed by inserting a copy of engineered gene VII immediately after the kanamycin-resistant gene in the KO7kpn helper phage genome. The HindIII-SacI fragment in the KO7kpn helper phage genome was replaced with a synthetic DNA fragment containing sequences encoding the last 88 amino acids of the kanamycin-resistant gene product, followed by S/D and an engineered gene VII. The engineered gene VII was a fusion gene with an OmpA leader, GR2, and Myc sequence at its 5′ end (Fig. 2a). The resulting KGp7 helper phage genome had two copies of gene VII, and one of them was a gene fusion with the GR2 adapter. KGp8 construction was similar to that of KGp7, except that a copy of engineered phage gene VIII was inserted immediately after the kanamycin-resistant gene (Fig. 2a). Gene VIII mutant (P8-2f) was selected from a design library for high-copy display of a large protein on pVIII.26 The KGp8 helper phage genome had two copies of gene VIII: one was wild type while the other was a gene VIII mutant fused to a GR2 adapter.

Helper phage vector construction Helper phage generation The KO7kpn vector was constructed by modifying a well-characterized helper phage genome M13KO7 (GE Healthcare). A unique KpnI site was introduced into the gene III leader sequence of the M13KO7 helper phage

The TG1 supernatant containing helper phage virus was streaked on a 2 × YT agar plate. Soft agar (4 ml) was mixed with 0.5 ml of TG1 culture (OD600 = 0.5) and poured onto

1099

Adapter-Directed Display System the plate. Phage plaques were formed after an overnight incubation at 37 °C. A single phage plaque was picked and used to inoculate 10 ml 2 × YT culture with 70 μg/ml kanamycin. After incubation at 37 °C for 2 h with constant shaking at 250 rpm, the culture was transferred to a 2l flask containing 500 ml 2 × YT with 70 μg/ml kanamycin and incubated overnight with constant shaking at 250 rpm. Phage particles in the supernatants were then precipitated using PEG/NaCl followed by 10,000 rpm centrifugation and resuspended in phosphate-buffered saline (PBS). PEG precipitation was repeated once. The phage concentration was determined by OD268 measurement, assuming 1 unit at OD268 is approximately 5 × 1012 phage particles/ml.

antibody was washed away with PBS-T and PBS, and ABTS substrate was added to the wells to measure HRP activity. In the trypsin treatment experiment, PEG-precipitated phages were resuspended in PBS and incubated with trypsin (Sigma) at concentrations from 1 to 50 μg/ml at 37 °C for 30 min, followed by the addition of trypsin inhibitor (Sigma) to stop the reaction. The trypsinized phages (1011 particles/100 μl) were added to 96-well ELISA plate coated with 0.2 μg/well of anti-Myc antibody 9E10 (in pH 9.6, 0.1 M sodium bicarbonate buffer) for a 2h incubation at room temperature. The phages captured by 9E10 antibody were then detected by the HRPconjugated anti-M13 antibody and the substrate ABTS as described above.

Phage plaque formation assay Phage antibody binding activity The helper phages at concentrations of ∼ 1013/ml (determined by OD268 measurement) were diluted multiple times to 1000 phages/ml. One hundred microliters of diluted phage sample was mixed with 200 μl of XL1 blue culture (OD600 ∼ 1) and 4 ml of soft agar at 55 °C and then poured on to a 2YT plate. Phage plaques were formed after an overnight incubation at 37 °C. Display of antibody using adapter-directed phage display system The phagemid vector was transformed into TG1 cells. The transformed cells were superinfected with engineered helper phages with a multiplicity of infection of 5–10. After overnight culture at 30 °C with 100 μg/ml carbenicillin and 35 μg/ml kanamycin, phage particles were purified by PEG precipitation from culture supernatants and titered by OD268 measurement. The antibody displayed on the phage surface was detected by phage ELISA using plates coated with the corresponding antigens or by phage Western blot. Phage ELISA The phage ELISA for phage production screening in the KO7kpn helper phage construction was conducted as follows: 100 μl of culture supernatant containing phage particles was used to coat the wells of ELISA plates at 4 °C overnight. The wells were washed 3 times with PBS buffer containing 0.05% Tween 20 (PBS-T) and then blocked with 5% milk in PBS (MPBS) buffer for 30 min at room temperature. The horseradish peroxidase (HRP)-conjugated anti-M13 antibody (1:3000 dilution in 2% MPBS) (GE Healthcare) was added to the ELISA wells and incubated for 2 h at room temperature. After washing away unbound HRP conjugates with PBS-T, ABTS [2,2′-azinobis(3-ethylbenzthiazoline-6-sulfonic acid)] substrate solution (Thermofisher Scientific) was added to measure HRP activity at OD405 using a SpectraMax microtiter plate reader (Molecular Devices). Culture supernatant containing phage particles was directly coated on the wells of an ELISA plate at 4 °C overnight to detect the presence of a Myc-tag on the phage surface. After blocking with MPBS, the mouse monoclonal anti-Myc antibody 9E10 (Santa Cruz Biotech), at a 1:1000 dilution in 2% MPBS, was added into ELISA wells for a 2h incubation. The wells were washed 3 times with PBS-T and 3 times with PBS and then incubated with HRPconjugated anti-mouse antibody (Sigma) in 2% MPBS at 1:2000 dilution, for 1 h. The unbound HRP-conjugated

To measure the phage-displayed antibody activity, ELISA plates were coated with 0.2 μg antigen/well in pH 9.6 coating buffer (0.1 M sodium bicarbonate) at 4 °C overnight. After 5% MPBS blocking, serial dilutions of phage in 2% MPBS at a concentration of 1011 to 1014/ml were placed into the wells of the ELISA plate for 1 h. The wells were washed 3 times with PBS-T and PBS, and the phage bound to antigen was detected by incubation with HRP-conjugated anti-M13 antibody for 1 h at room temperature. After washing away unbound HRP conjugates, the substrate ABTS was added to the wells to measure HRP activity. Phage Western blot Approximately 1–4 × 1011 phage particles were heated for 10 min in SDS sample buffer (2% SDS, 10% glycerol, and 0.67 M Tris–HCl, pH 6.8). The denatured phage samples were subjected to 10% SDS-PAGE. The proteins in the SDS gel were then transferred to a polyvinylidene fluoride membrane. For detection of Myc-tagged pIII protein or its complexes, the membrane was probed first with 2 μg/ml mouse monoclonal antibody 9E10 in 5% MPBS and detected by anti-mouse antibody–alkaline phosphatase (AP) conjugate and BCIP/NBT AP substrate (Sigma). For detection of HA-tagged antibody, the mouse monoclonal antibody HA probe F-7 (Santa Cruz Biotech) at 1:200 dilution was used as the probe antibody. For detection of phage coat protein pIII, the mouse anti-M13 pIII monoclonal antibody (New England BioLabs) at 1:1000 dilution was used. Display of antibody on the surface of yeast The display vector pMAT14 was transformed into the KQP600 yeast S. cerevisiae strain using the Frozen-EZ Yeast Transformation II Kit (Zymo Research). Cells from a single colony on SD minus TRP & URA plates (Teknova) were grown in the 50-ml SD-CAA-minus TRP & URA medium overnight at 30 °C with continuous shaking at 250 rpm and then transferred to 50 ml SG-CAA-minus TRP & URA medium with a starting OD600 of 1–3 for 20 h galactose incubation at 20 °C with continuous shaking. Cells were harvested, washed with wash buffer (1% bovine serum albumin–PBS), and incubated for 1 h at room temperature with 10 μg/ml of recombinant human VEGF that was biotinylated using Biotin-XX Microscale Protein Labeling Kit (Invitrogen), followed by incubation with 40 μg/ml streptavidin labeled with AlexaFluor 488

1100 dye in 500 μl wash buffer for 1 h at room temperature. Cells were washed twice with ice-cold wash buffer and then resuspended in wash buffer. Stained yeast cells were kept on ice until fluorescence-activated cell sorting (FACS) analysis.

Adapter-Directed Display System

9. 10.

FACS analysis Cell fluorescence was measured in the FACSAria (BD Biosciences). The gate was set to encompass the singlet events on the FSC versus SSC plot. AlexaFluor-488-labeled scFv displayed on the yeast surface was detected using a PMT with a 530/30-nm bandpass filter (detector for fluorescein isothiocyanate conjugates). Data were acquired and analyzed using BD FACSDiva 6.1 software (BD Biosciences) and WinMDI2.9 software. Unstained cells were used to define background level.

11.

12. 13.

14.

Acknowledgements We thank Dr. Mark Hsieh for helpful discussions and critical reading of the manuscript and Chirag Patel and Jinqing Wang for the FACS analysis.

15.

16.

References 1. Bradbury, A. R. & Marks, J. D. (2004). Antibodies from phage antibody libraries. J. Immunol. Methods, 290, 29–49. 2. Hoogenboom, H. R. (2005). Selecting and screening recombinant antibody libraries. Nat. Biotechnol. 23, 1105–1116. 3. Vaughan, T. J., Williams, A. J., Pritchard, K., Osbourn, J. K., Pope, A. R., Earnshaw, J. C. et al. (1996). Human antibodies with sub-nanomolar affinities isolated from a large non-immunized phage display library. Nat. Biotechnol. 14, 309–314. 4. Sheets, M. D., Amersdorfer, P., Finnern, R., Sargent, P., Lindquist, E., Schier, R. et al. (1998). Efficient construction of a large nonimmune phage antibody library: the production of high-affinity human singlechain antibodies to protein antigens. Proc. Natl Acad. Sci. USA, 95, 6157–6162. 5. de Haard, H. J., van Neer, N., Reurs, A., Hufton, S. E., Roovers, R. C., Henderikx, P. et al. (1999). A large nonimmunized human Fab fragment phage library that permits rapid isolation and kinetic analysis of high affinity antibodies. J. Biol. Chem. 274, 18218–18230. 6. Knappik, A., Ge, L., Honegger, A., Pack, P., Fischer, M., Wellnhofer, G. et al. (2000). Fully synthetic human combinatorial antibody libraries (HuCAL) based on modular consensus frameworks and CDRs randomized with trinucleotides. J. Mol. Biol. 296, 57–86. 7. Fellouse, F. A., Esaki, K., Birtalan, S., Raptis, D., Cancasci, V. J., Koide, A. et al. (2007). High-throughput generation of synthetic antibodies from highly functional minimalist phage-displayed libraries. J. Mol. Biol. 373, 924–940. 8. Rothe, C., Urlinger, S., Löhning, C., Prassler, J., Stark, Y., Jäger, U., Hubner, B. et al. (2008). The human combinatorial antibody library HuCAL GOLD combines diversification of all six CDRs according to the natural immune system with a novel display method

17. 18.

19.

20.

21.

22. 23. 24.

25.

for efficient selection of high-affinity antibodies. J. Mol. Biol. 376, 1182–1200. Smith, G. P. (1985). Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science, 228, 1315–1317. Scott, J. K. & Smith, G. P. (1990). Searching for peptide ligands with an epitope library. Science, 249, 386–390. McCafferty, J., Griffiths, A. D., Winter, G. & Chiswell, D. J. (1990). Phage antibodies: filamentous phage displaying antibody variable domains. Nature, 34, 552–554. McConnell, S. J. & Hoess, R. H. (1995). Tendamistat as a scaffold for conformationally constrained phage peptide libraries. J. Mol. Biol. 250, 460–470. O'Connell, D., Becerril, B., Roy-Burman, A., Daws, M. & Marks, J. D. (2002). Phage versus phagemid libraries for generation of human monoclonal antibodies. J. Mol. Biol. 321, 49–56. Greenwood, J., Willis, A. E. & Perham, R. N. (1991). Multiple display of foreign peptides on a filamentous bacteriophage. Peptides from Plasmodium falciparum circumsporozoite protein as antigens. J. Mol. Biol. 220, 821–827. Iannolo, G., Minenkova, O., Petruzzelli, R. & Cesareni, G. (1995). Modifying filamentous phage capsid: limits in the size of the major capsid protein. J. Mol. Biol. 248, 835–844. Malik, P., Terry, T. D., Gowda, L. R., Langara, A., Petukhov, S. A., Symmons, M. F. et al. (1996). Role of capsid structure and membrane protein processing in determining the size and copy number of peptides displayed on the major coat protein of filamentous bacteriophage. J. Mol. Biol. 260, 9–21. Lowman, H. B. & Wells, J. A. (1993). Affinity maturation of human growth hormone by monovalent phage display. J. Mol. Biol. 234, 564–578. Barbas, C. F., Kang, A. S., Lerner, R. A. & Benkovic, S. J. (1991). Assembly of combinatorial antibody libraries on phage surfaces: the gene III site. Proc. Natl Acad. Sci. USA, 88, 7978–7982. Hoogenboom, H. R., Griffiths, A. D., Johnson, K. S., Chiswell, D. J., Hudson, P. & Winter, G. (1991). Multisubunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucleic Acids Res. 19, 4133–4137. Rondot, S., Koch, J., Breitling, F. & Dübel, S. (2001). A helper phage to improve single-chain antibody presentation in phage display. Nat. Biotechnol. 19, 75–78. Rakonjac, J., Jovanovic, G. & Model, P. (1997). Filamentous phage infection-mediated gene expression: construction and propagation of gIII deleted mutant helper phage R408d3. Gene, 198, 99–103. Oh, M., Joo, H., Hur, B., Jeong, Y. & Cha, S. (2007). Enhancing phage display of antibody fragments using gIII-amber suppression. Gene, 386, 81–89. Chasteen, L., Ayriss, J., Pavlik, P. & Bradbury, A. R. M. (2006). Eliminating helper phage from phage display. Nucleic Acids Res. 34, e145. Kretzschmar, T. & Geiser, M. (1995). Evaluation of antibodies fused to minor coat protein III and major coat protein VIII of bacteriophage M13. Gene, 155, 61–65. Wang, L., Radic, M. Z., Siegel, D., Chang, T., Bracy, J. & Galili, U. (1997). Cloning of anti-Gal Fabs from combinatorial phage display libraries: structural analysis and comparison of Fab expression in pComb3H and pComb8 phage. Mol. Immunol. 34, 609–618.

1101

Adapter-Directed Display System 26. Sidhu, S. S., Weiss, G. A. & Wells, J. A. (2000). High copy display of large proteins on phage for functional selections. J. Mol. Biol. 296, 487–495. 27. Jespers, L. S., Messens, J. H., De Keyser, A., Eeckhout, D., Van den Brande, I., Gansemans, Y. G. et al. (1995). Surface expression and ligand-based selection of cDNAs fused to filamentous phage gene VI. Biotechnology (NY), 13, 378–382. 28. Hufton, S. E., Moerkerk, P. T., Meulemans, E. V., de Bruïne, A., Arends, J. W. & Hoogenboom, H. R. (1999). Phage display of cDNA repertoires: the pVI display system and its applications for the selection of immunogenic ligands. J. Immunol. Methods, 231, 39–51. 29. Gao, C., Mao, S., Lo, C. H., Wirsching, P., Lerner, R. A. & Janda, K. D. (1999). Making artificial antibodies: a format for phage display of combinatorial heterodimeric arrays. Proc. Natl Acad. Sci. USA, 96, 6025–6030. 30. Gao, C., Mao, S., Kaufmann, G., Wirsching, P., Lerner, R. A. & Janda, K. D. (2002). A method for the generation of combinatorial antibody libraries using pIX phage display. Proc. Natl Acad. Sci. USA, 99, 12612–12616. 31. Fuh, G. & Sidhu, S. S. (2000). Efficient phage display of polypeptides fused to the carboxy-terminus of

32.

33. 34.

35.

36.

the M13 gene-3 minor coat protein. FEBS Lett. 480, 231–234. Fuh, G., Pisabarro, M. T., Li, Y., Quan, C., Lasky, L. A. & Sidhu, S. S. (2000). Analysis of PDZ domain–ligand interactions using carboxyl-terminal phage display. J. Biol. Chem. 275, 21486–21491. Weiss, G. A. & Sidhu, S. S. (2000). Design and evolution of artificial M13 coat proteins. J. Mol. Biol. 300, 213–219. Crameri, R. & Suter, M. (1993). Display of biologically active proteins on the surface of filamentous phages: a cDNA cloning system for selection of functional gene products linked to the genetic information responsible for their production. Gene, 137, 69–75. Kammerer, R. A., Frank, S., Schulthess, T., Landwehr, R., Lustig, A. & Engel, J. (1999). Heterodimerization of a functional GABAB receptor is mediated by parallel coiled-coil alpha-helices. Biochemistry, 38, 13263–13269. Goletz, S., Christensen, P. A., Kristensen, P., Blohm, D., Tomlinson, I., Winter, G. & Karsten, U. (2002). Selection of large diversities of antiidiotypic antibody fragments by phage display. J. Mol. Biol. 315, 1087–1097.