Adaptive conditions and safety of the application of Penicillium frequentans as a biocontrol agent on stone fruit

International Journal of Food Microbiology 254 (2017) 25–35

Contents lists available at ScienceDirect

International Journal of Food Microbiology journal homepage: www.elsevier.com/locate/ijfoodmicro

Adaptive conditions and safety of the application of Penicillium frequentans as a biocontrol agent on stone fruit

MARK

Belén Guijarro, Inmaculada Larena, Paloma Melgarejo, Antonieta De Cal⁎ Department of Plant Protection, Phytopathology Fungi Unit, National Institute for Agriculture and Food Research, INIA, Madrid, Spain

A R T I C L E I N F O

A B S T R A C T

Keywords: Stone fruit safety Biological control Risk assessment Mycotoxins Monilinia spp.

Penicillium frequentans (Pf909) reduces brown rot caused by Monilinia spp. in stone fruit. The registration of a microbial biocontrol agent in Europe requires information on the risks and safety of a biological product. This study focused on the impact of the physical environment on Pf909 survival and growth, Pf909 mycotoxin production on fruit surface, and the Pf909 resistance to commercial antifungal compounds used in animal and human medicine. The effect of temperature (4 to 37 °C), water activity (0.999 to 0.900), pH (3 to 11), light intensity (0, 90 and 180 lm) and photoperiod (0/24, 12/12, 16/8, 24/0; light/dark) on mycelial growth and sporulation of Pf909 were monitored for 10 days in vitro on culture medium. Antifungal activity of antifungal compounds on mycelial growth of Pf909 was also measured by a quantitative micro spectrophotometric assay after 72 h of incubation. The presence or absence of four non-volatile mycotoxins (patulin, penicillic acid, ochratoxin A and citrinin) on nectarine surfaces treated with Pf909 was determined by HPLC. Growth rate was significantly influenced by water activity, temperature and light exposure conditions. Pf909 showed maximum growth and sporulation at 22 °C and 25 °C, in wet conditions (0.999 water activity), with a pH 5.6 to 9, and in darkness or a short light photoperiod. Our results showed all antifungal compounds used reduced significantly Pf909 mycelial growth at tested commercial doses. HPLC data analysis showed that 7 days after biofungicide (Pf909) application there were no mycotoxin products on the surface of nectarine. Finally, no phylogenetic relationship has been shown among Pf909 and other species of Penicillium that produce mycotoxins. In conclusion, from an ecological point of view, Pf909 would establish and survive actively over a broad range of climatic conditions. The probability of risks to human and animal health is considered very low.

1. Introduction Today, people have an increased awareness of healthy food and environment. In response to this need, researchers have focused their work to develop alternative measures to synthetic chemicals for controlling plant diseases (Kiewnick, 2007). One alternative measure is biological control, considered ecologically friendly, using microbial antagonists which are also called biological control agents (BCAs). Many microbial antagonists have been reported to possess antagonistic activity against plant fungal pathogens, but only a few have been commercialized as antifungal active compounds (EU Pesticide Database-Active substances Regulation (EC) no 1107/2009) (European Commission, 2009). As a consequence, there is considerable interest in the development and commercialization of BCAs for the control of plant diseases (Khabbaz et al., 2015; Kiewnick, 2007).

In a majority of cases, most microorganisms with significant potential antagonistic activity fail to be developed for practical use (Cartwright and Benson, 1995). Several factors determine the success of an antagonist as a BCA, including the ability to compete with other microorganisms, shelf-life, storage methods, concentration of the antagonist used, timing and method of application, and unfavorable or fluctuating environmental conditions such as temperature, humidity, moisture, light intensity, UV exposure, and photoperiod (Baker and Cook, 1974; Campbell, 1989; Rastogi et al., 2012; Vorholt, 2012). Therefore, more research should be conducted to identify the environmental conditions that are required for the expression of BCA's beneficial effects under field conditions in order to make biological control more reliable. Penicillium frequentans Westling is found commonly on peach twigs and flowers (Melgarejo et al., 1985). Pf909 has been reported to be

⁎ Corresponding author at: Department of Plant Protection, Phytopathology Fungi Unit, National Institute for Agriculture and Food Resources, Ctra. de La Coruña km. 7, 28040 Madrid, Spain.

http://dx.doi.org/10.1016/j.ijfoodmicro.2017.05.004 Received 23 November 2016; Received in revised form 21 April 2017; Accepted 8 May 2017 Available online 08 May 2017 0168-1605/ © 2017 Elsevier B.V. All rights reserved.

International Journal of Food Microbiology 254 (2017) 25–35

B. Guijarro et al.

study the phylogenetic relationship between Penicillium species producers of mycotoxins.

highly effective in reducing brown rot and/or twig blight caused by Monilinia spp. in commercial peach orchards (De Cal et al., 1990; De Cal et al., 2012; Guijarro et al., 2006, 2007b; Melgarejo et al., 1986a). When peaches and nectarines are repeatedly treated with Pf909, the density of the epiphytic P. frequentans population on their surfaces exponentially increases over time (Guijarro et al., 2008). Specifically, the size of the P. frequentans population on the surface of peach blossoms and peaches following repeated applications of Pf909 ranges from 105 to 106 colony forming units (CFUs) per flower or 103–104 CFUs per peach (Guijarro et al., 2008). Competition was shown to be the primary mechanism of biocontrol of Pf909 on Monilinia (Guijarro et al., 2017). There is a significant relationship between the efficacy of Pf909 and conidial viability. Thus, a conidial viability of Pf909 up to 40% was needed for obtaining > 50% biocontrol (Guijarro et al., 2007a, 2007b). However, there are insufficient studies on the effects of physical factors on the growth, sporulation and survival of Pf909 conidia and these are essential before these organisms can be developed into a commercial product. In the EU member states, the introduction of plant protection products on the market is regulated by Regulation No 1107/2009, which updates the existing regulations and replaces Directive No 91/ 414/EEC (European Commission, 1991) and Directive No 2005/25/EC (European Commission, 2005), in order to specify requirements for micro-organisms. Humans and animals are regularly exposed to microorganisms. Most of them have beneficial functions in the environment and some might even function as symbionts (Strauch et al., 2011). However, micro-organisms can produce toxins and antibiotics, which is why it is necessary to perform a risk assessment when these organisms are to be used in biocontrol. The EU emphasizes not only consistent efficacy of microbial plant protection product but also requires information on crop safety and the evaluation of the production of secondary metabolites on fruit surface together with their risk to human health (Directive No 165/2010/EC) (European Commission, 2010). Mycotoxins are secondary metabolic products which have potential toxicologically relevant effects on vertebrates when administered in small doses via a natural route (Sundh et al., 2011; Turner et al., 2015). Mycotoxins from Penicillium species such as patulin, penicillic acid, ochratoxin A and citrinin can be serious contaminants in stored fruit (Cole and Cox, 1981). The toxins which are naturally produced by several plant pathogenic Penicillium species (P. expansum, P. citrinum and P. digitatum) and also by non plant pathogen Penicillium spp., can be formed rapidly during production, transportation and storage of fruit (Dombrink-Kurtzman and Blackburn, 2005). Phylogenetic relationships between Pf909 and producers of mycotoxins within the genus Penicillium need to be clarified. The assessments of risk to human health should also include the study of Pf909 sensitivity to antifungal substances widely used in human or veterinary medicine. The main objective of this paper was to achieve part of the registration requirements necessary for authorization of BCA Pf909 in OECD countries. Thus this work had four major objectives in order to identify areas of research that still need to be addressed to demonstrate that Pf909 is sufficiently stable in field conditions and, that it is crop safe for registration purposes: (i) To study pre- and post-harvest physical conditions (temperature, humidity, light intensity, and photoperiod) on product performance. These conditions can affect the efficacy of Pf909 in brown rot control; (ii) To evaluate the antagonist spectrum of resistance to commercial active compounds used in human or veterinary medicine; (iii) To assess the presence of the main nonvolatile mycotoxins produced by Penicillium spp. (patulin, penicillic acid, ochratoxin A and citrinin) at critical control points during the production process as well as during the interaction process on fruit surface after Pf909 application, in order to improve food safety and to protect consumers from possible harmful contaminants; and (iv) To

2. Materials and methods 2.1. Fungal strain, inoculum preparation, and growth medium A monosporic isolate of P. frequentans (Pf909, ATCC 66108), which was originally obtained from the phyllosphere of peach twigs (Melgarejo and M-Sagasta, 1984), was used for all studies. The isolate was stored at −80 °C in 20% glycerol (long-term storage) and at 4 °C on potato dextrose agar (PDA; Difco, Detroit, MI, USA) slants in the dark (short-term storage). 2.2. Effect of physical properties of Pf909 in vitro on mycelial growth and sporulation The effect of pH, water activity (aw), temperature, light intensity (LI) and the length of photoperiod on the growth and sporulation of Pf909 was studied in vitro in potato dextrose agar (PDA, Difco Laboratories, Detroit, USA). Ten replicate plates were used for each factor studied and each parameter calculated. Each assay was repeated at least twice. For the pH studies, the pH of PDA (pH = 5.6) was adjusted with 1 N HCl or 2 N NaOH to obtain the following levels: 3, 4, 8, 9, 10 and 11. To test the effect of water activity, the aw of PDA (aw = 0.999) was osmotically modified to 0.995, 0.990, 0.980, 0.970, 0.964, 0.930, and 0.900 using a glycerol solution (Magan et al., 2010). Petri plates containing PDA were centrally inoculated with 2 μL of the Pf909 spore suspension (105 conidia/mL) using a previously described protocol (Fustier et al., 1998). The inoculated plates were then sealed and packed to prevent water loss, and in the case of the pH studies, were then incubated for ten days at 22 °C in the dark. For the temperature studies, the inoculated PDA plates were incubated at 4, 10, 15, 22, 25, 32, 36, and 37 °C. For the light intensity studies, the inoculated PDA plates were incubated in the dark (0 W) or under continuous light (24 h a day) from one to two 36 W commercial white fluorescent tubes. To determine the effect of the length of photoperiod, the inoculated PDA plates were incubated under three 36 W white fluorescent tubes with four different light/dark 24-hour cycles, 0/24, 12/12, 16/8, and 24/0. The Pf909 growth rate (cm/day) was calculated by taking two perpendicular colony diameter measurements after 2, 3, 4, 7, and 10day of incubation. The sporulation density of Pf909 (conidia/cm) was calculated at the end of the 10-day incubation period. For this purpose, the colony was washed with water (De Cal et al., 2002) and a spore suspension was prepared. Each suspension was vigorously shaken (250 rpm for 30 s) sonicated for 30 s, shaken again for 30 s, and then passed through a glass wool filter. A 100-μL aliquot of the resultant conidial suspension was counted using a hemocytometer under a light microscope (× 40). 2.3. Sensitivity of Pf909 to antifungal compounds The sensitivity of Pf909 to six commercial antifungal compounds (Table 1) used in human and animal medicine was assessed by an automated quantitative method (Raposo et al., 1995; Broekaert et al., 1989) to establish the dose-response curves. In this method, the fungus is grown in a microplate wells and its growth monitored spectrophotometrically. Absorbance measured in a range of 0.0–0.6 units as a measure of fungal biomass. This technique was successfully used to establish EC50 values (the concentration of fungicide that reduces absorbance by half) to several fungicides in an economical and rapid way (Raposo et al., 1995). Therefore, the automated quantitative assay

E-mail address: [email protected] (A. De Cal).

26

International Journal of Food Microbiology 254 (2017) 25–35

B. Guijarro et al.

Table 1 Commercial antifungal compounds and respective doses used in human and animal medicine. LD50 values for inhibition of mycelial growth of Penicillium frequentans (Pf909). Active antifungal compounds

Chemical formula

Purity (%)

Company

Commercial used

Commercial dose Coa

Regression curve

R2b

LD50 (μg/μl)

Fluocinolone acetonide Dexametazone Fluconazol Ketoconazol Triamcinolone acetonide Triamcinolone

C24H30F2O6 C22H29FO5 C13H12F2N6O C26H28Cl2N4O4 C24H31FO6 C21H27FO6

102.2 98.2 102.2 100 99.2 99.2

Acofarma Ref. Acofarma Acofarma Ref. 531.4 Fragon Ref. 435.5 Fragon Ref. 394.4 Fragon

Medicine, veterinary Medicine Veterinary Medicine Medicine, veterinary Medicine

0.52 μg/gr 0.02 μg/gr 0.05 μg/gr 0.014 μg/gr 0.25 μg/gr 0.36 μg/gr

y = − 18.34x + 1.56 y = − 27.23x + 2.09 y = − 18x + 0.73 y = − 32.03x + 0.80 y = − 21.56x + 1.87 y = − 12.09x + 0.87

0.47 0.45 0.43 0.82 0.52 0.80

0.21 0.19 0.09 0.02 0.22 0.18

a b

Co, Commercial doses used in human and animal medicine. Six replicates were used by antifungal agents; y = absorbance at 492 nm; x = log10 antifungal concentration. R2, the coefficient of determination for lineal regression analysis (Almeida et al., 2002) is the measure of success of predicting the dependent variable from the independent variables.

trols received 5 mL of SDW (sterile distilled water). The surface of the fruit was dried in a flow-cabinet for 2 h. Fruit were then incubated for 7 days at 20 to 25 °C in the dark After the incubation period, there being no damage or colony growth on fruit surface, nectarine peels were lyophilized (Lyophilizer Cryodos 50, Telstar, Spain) for 24 h, and homogenized at a speed of 3.0 mS for 30 s using a FastPrep-24 Instrument (MP Biomedical, Solon, Ohio, U.S.A.). Conidia concentration on dry fruit peel was 3.14 × 106 conidia/g, higher than that used by Aziz and Moussa (2002) where penicillic acid and patulin were detected at levels from 0.1–0.2 μg/g on peach fruit contaminated with 1.8 × 105 Penicillium sp./g. The freeze–dried fruit powder (90 mg) mixture samples containing 2.83 × 105 conidia, were then diluted in 1 mL ethanol and vortexed for 10 min, centrifuged for 10 min at 4000 rpm and the supernatant was analysed by HPLC. For dehydrated conidia (Guijarro et al., 2006) analysis, 15.6 mg were diluted in ethanol and the same procedure as described above was followed. In total, 103 LC-MS measurements were carried out including blanks. The experiments were performed in positive and negative ion mode with a decluttering potential of 175 V and 225 V every sample was measured 3 times in both positive and negative modes. Table 2 shows the mass weight measurements for the protonated and deprotonated molecules that were searched on the total ion chromatograms and on the extracted ion chromatograms. The samples were separated on a Luna 5u NH2 100A 250 × 4.6 mm column and measured on a QExactive LCMS (Orbitrap, Thermo Fisher) with the following separation parameters: Flow: 0.8 mL/min; mobile phases: 0.1% formic acid in water, 0.1% formic acid in acetonitrile. A gradient of 10% organic mobile phase to 80% organic mobile phase (at 35 min) was applied and then returned to original conditions. Positiveand negative modes were measured separately. Exact masses and fragment masses of the selected substances as well as the corresponding spectra were compared with the data available in literature and ChemSpider library (http://www.chemspider.com/ Chemical-Structure.1906.html). These analyses were confirmed twice using a second assay by HPLC chromatography (series 1290 infinity, Agilet Technology, Spain) with mass spectrometry (Agilet 6550 Ifunnel), equipped with a electrospray jet stream source.

offers the opportunity of measuring total fungus biomass inhibition in the presence of antifungal agents, overcoming the disadvantages of conventional method of measuring radial growth (Raposo et al., 1995). The technique uses 100 times less medium than the conventional method of measuring radial growth of mycelium on fungicide amended medium and up to 96 (one microplate) could processed at once. The six commercial antifungal compounds (Table 1) were serially diluted, ranging from 1/2 up to a 1/100 dilution in 1% acetone from the recommended medical dose. In each well of the microtiter plates, 100 μL of each antifungal solution was mixed with 100 μL of the fungal spore suspension at field dose application (2 × 106 conidia/mL) in Czapek Broth (Difco Laboratories, Detroit, USA). Absorbance was measured with a microplate reader (Multiskan Plus PV. 2.01) at 492 nm wavelength. The first measurement was made just after filling the plate (A0). The microplates were then incubated under continuous agitation in the dark at 22 °C for 72 h, with one daily monitoring of absorbance. The assay was repeated at least twice with six wells for each antifungal compound dilution including the blanks. Growth inhibition (Broekaert et al., 1989) was determined based on ΔC − ΔT the equation [ ΔC ] x100 , where Δ C is the corrected absorbance of the blank standard solutions at 492 nm and Δ T is the corrected absorbance of the test microculture. The corrected absorbance values equal the absorbance at measured after 72 h of incubation (A72) minus the absorbance measured before incubation (A0). Half maximal effective concentration (LD50) value, defined as the concentration of an antifungal compounds that inhibited mycelia growth by 50%, was estimated by linear regression of the absorbance OD492 versus the antifungal concentration (Mondal et al., 2005).

2.4. Mycotoxin production 2.4.1. Detection by HPLC the mycotoxins on nectarine surface treated by Pf909 To quantify the presence on fruit of the four main non-volatile mycotoxins (citrinin, patulin, ochratoxin and penicillic acid) (Table 2) that potentially could be produced by Pf909, analysis by HPLC completed with quadruple time-off-flight mass spectrometry (QTOFMS) was used. Nectarines without visible injuries were sprayed with 5 mL of Pf909 (106/mL dry conidia suspension 95% viability). Non-inoculated con-

Table 2 Determination of the presence of mycotoxins in nectarines surface treated with Penicillium frequentans (Pf909). Exact mass measurements for the protonated and deprotonated ions of the four searched mycotoxins. Metabolite agents

Penicillic acid Citrinin Patulin Ochratoxin A a

Formula

C8H10O4 C13H14O5 C7H6O4 C20H18ClNO6

Mass weight (Da)

170.0579 250.0841 154.0266 403.0822

Ions –

Ions +

Samples presencea

(M + H)+

(M + Na)+

(M − H)−

(M + HCOO)−

171.0652 251.0814 155.0339 404.0895

193.0471 273.0723 177.0158 426.0715

169.0506 249.0768 153.0193 402.0750

215.0561 295.0823 199.0248 448.0805

Substance presence in the analysed samples: (+), presence; (−) no presence.

27

– – – –

International Journal of Food Microbiology 254 (2017) 25–35

B. Guijarro et al.

Table 3 Strains used in phylogenetic analysis of thirteen Penicillium species producing the four major mycotoxins in fruit and vegetables, non mycotoxin producing P. glabrum non mycotoxin producers and P. frequentans strain 909 (Pf909). Penicillium species

Mycotoxin

P. aurantiogriseum

Penicillic acid

P. cyclopium

Penicillic acid ochratoxin A patulin

P. chrysogenum

Penicillic acid ochratoxin A patulin

P. citrinum

Citrinin

P. expansum

Citrinin, patulin

P. glandicola

Patulin

P. griseofulvum

Patulin

P. janczewskii

Penicillic acid

P. neoechinulatum

Penicillic acid

P. purpurascens

Ochratoxin A, citrinin

P. roqueforti

Penicillic acid

P. thomii

Penicillic acid

P. viridicatum

Penicillic acid, ochratoxin A, citrinin

P. glabrum

β-Tubulin gene

ID

RPB2

Strain

GenBank accession #

Strain

GenBank accession #

Strain

GenBank accession #

CV0072 CV0048 CBS79295 CBS64295 CECT2264 KACC45909 CBS 14445 CBS 47784 CBS 101136

JX091531.1 JX091501.1 JN097812.1 AY674298.1 AY674297.1 JN112034.1 AY674310.1 AY674309.1 AY674308.1

DTO 102B4 CBS 306.48 CBS 355.48 DTO 87I2 DTO 100G5 KAS2608 ATHUM5101 ATHUM5050 ATHUM3038

JF909959.1 JF909955.1 JF909948.1 JF909946.1 JF909943.1 JN637994.1 FJ004396.1 FJ004395.1 FJ004394.1

ATT085 ATT005 P273_D2_52 QRF372 FH8 CBS 101136 CBS 110331 CBS 110335 CBS 110336 CBS 110338 H09-114 18S FH10 S3-M-3-14 QRF370

HQ607827.1 HQ607795.1 JF311946.1 KP278202.1 EU409810.1 JN942747.1 JN942746.1 JN942745.1 JN942744.1 JN942743.1 KC009826.1 EU409812.1 KP216883.1 KP278201.1

222093185 385842331 358001929 358001931 358001933 358001947 358001949 358001951 358001953 358001955 222093195 222093197 222093255 222093199

FJ004446.1 JN406573.1 JN985374.1 JN985375.1 JN985376.1 JN985383.1 JN985384.1 JN985385.1 JN985386.1 JN985387.1 FJ004451.1 FJ004452.1 FJ004481.1 FJ004453.1

5537 ATHUM5098 ATHUM5086 ATHUM2534 ATHUM3001 CBS33348 CBS49875 CBS111218 NRRL35685 CV0148 CV00069 CV0051 CV0041 CV0078 CBS:413.68 CBS:279.47 CBS:166.81 CBS:744.70 CBS:354.48 CBS16987 CBS110343 CBS101135

KJ527409.1 FJ004407.1 FJ004406.1 FJ004405.1 FJ004413.1 AY674416.1 AY674415.1 AY674414.1 EF198565.1 JX091544.1 JX091543.1 JX091542.1 JX091541.1 JX091502.1 KJ866969.1 KJ866968.1 KJ866967.1 KJ866966.1 KJ866965.1 AY674301.1 AY674300.1 AY674299.1

10t2F S36 HZN13 UFMGCB_518 MSSRF-IS1 16 3920 734

KF285998.1 JF266706.1 KP119605.1 FJ466705.1 HQ232482.1 EU594571.1 FJ008997.1 KT316703.1

372100209 372120825 372123038 372123040 619855959 222093223 222093221 222093239 222093225

JF417416.1 JN121463.1 JN606604.1 JN606605.1 KJ476421.1 FJ004465.1 FJ004464.1 FJ004473.1 FJ004466.1

3001 FRR 2036 39150-R4 39150-R3

FJ004300.1 AY373916.1 KC009364.1 KC009363.1

PRPX-FS14 MKZ31M

KR296884.1 FJ441616.1

356578354 372120797 460841210

JF909924.1 JN121449.1 JX996711.1

CBS CBS CBS CBS

385842409 820944781 820944785 820944787 820944795 CBS 110343 CBS 101472 CBS 101468 CBS 101135

JN406612.1 KP016855.1 KP016857.1 KP016858.1 KP016862.1 JN985409.1 JN985408.1 JN985407.1 JN985406.1

DTO091-D3 DTO091-D2 CBS 366.48 CBS126.64 PTC_PR_20_1 PTX_PR_19_4 PTX_PR_16-1 PTX_PR_6_1 PTX_PR_1_7 CV905 CV2851 CV2850 CV1145 CV1148 CBS 39048 CBS 109826 CBS 101034 NRRL 958 ATHUM5435 CV341 CV341 CV504 CV43 CV4

KM088802.1 KM088801.1 GQ367512.1 GQ367511.1 KM503642.1 KM503640.1 KM503639.1 KM503638.1 KM503637.1 JX271577.1 JX271576.1 JX271575.1 JX271574.1 JX271573.1 AY674295.1 AY674294.1 AY674293.1 FJ004441.1 FJ004440.1 JX271540.1 JX271539.1 JX271538.1 JX271537.1 JX271536.1

T3_10_-3 A4-2 NBPen2013A12 FRR 1151 NBPen2012A10 HSW-12 DTO 091-D2 imi39745 DTO 091-D3 DF11 NS190 IBRC-M 30025

KP016839.1 KP016837.1 KP016838.1 KC411755.1 AY157487.1 KP411588.1 KT876710.1 KM115166.1 AY373911.1 KM115163.1 KJ475812.1 KM189561.1 DQ911125.1 KM189562.1 KC167856.1 DQ068990.1 KP190121.1

DTO091-D3 DTO 091-D2

KM089574.1 KM089573.1

ATHUM 5092 ATHUM 3007 CBS 221.30

NEFU9 PA2_2_Fu Cs/4/1 698

KF944453.1 KT200277.1 JN585937.1 KT266851.1

NSIPV1 CICC 4029 12.29

DQ779779.1 KJ783271.1 KF498542.1

JF-55 15AC2H NRRL 35684 NRRL 35626

JQ342168.1 GU372907.1 EF200097.1 EF200086.1

FJ004490.1 FJ004489.1 JN406611.1 KM656087.1 HG792018.1 JN121501.1 KM089752.1 KM089748.1 KM089600.1 KM089599.1 JN985429.1 JN985428.1 JN985427.1 JN985426.1 JN985425.1 377823887 141452984 141452973 141452968

P. frequentans

28

744.70 279.47 413.68 354.48

FM164 CBS347.59 DTO 205-H3 DTO 202-E5 DTO 105-I6 DTO 105-I5 CBS 390.48 CBS 264.29 CBS 112052 CBS 109826 CBS 101475 JQ342168.1 EF200097.1 EF200086.1 EF200081.1

International Journal of Food Microbiology 254 (2017) 25–35

B. Guijarro et al.

Table 4 The effect of different incubation temperatures (T), pH and water activity (aw) on the rate growth (cm·day− 1) and diameter of colony (cm) of Penicillium frequentans (Pf 909) on potato dextrose agar (PDA) (pH 5.6 and aw 0.999) after a 10-day incubation at 22 °C in the dark, except for the analysis of temperatures where the plates were incubated at eight different temperaturesa. Temperatureb

pHc

Water activityd

T (°C)

Growth (cm·day− 1)

Colony diameter (cm)

pH

Growth (cm·day− 1)

Colony diameter (cm)

aw

Growth (cm·day− 1)

Colony diameter (cm)

4 10 15 22 25 32 36 37 MSEe

0.09 0.11 0.46 0.57 0.44 0.11 0.07 0.00 0.01

0.87 2.46 4.09 8.20 5.85 0.15 0 0 0.03

3 4 5.6 8 9 10 11

0.69 0.84 0.83 0.81 0.82 0.85 0.81

5.51 8.08 8.20 7.81 7.60 7.66 5.73

0.900 0.930 0.964 0.970 0.980 0.990 0.995 0.999

0.21 0.33 0.39 0.52 0.89 0.90 1.00 1.01 0.03

2.63 3.27 3.53 4.58 7.36 7.34 8.18 8.50 0.35

bc c d e d c bc a

b c d f e a a a

a b b b b b b

0.01

a b b b b b a

0.29

a b b c d d e e

a ab ab b c c c c

a Data are the mean of the ten replicate plates. Means followed by different letters in each column are significantly different from each other (p < 0.05) according to the results of the Student-Newman-Keuls multiple range test. b On PDA (pH 5.6 and aw 0.999) at different temperatures of incubation in the dark. c On PDA (pH 5.6 and aw 0.999) amended with either 1 N HCl to acidify the medium or 2 N NaOH to alkalize medium and incubated at 22 °C and darkness. d On PDA (pH 5.6 and aw 0.999) osmotically modified with a glycerol solution and incubated at 22 °C and darkness. e MSE: mean square error.

and BT2 gene sequences were constructed by MEGA7 (Tamura et al., 2007) using the UPGMA method (Sneath and Sokal, 1973). The reliability of the clusters was assessed by bootstrap analysis with 500 replicates (Felsenstein, 1985).

2.5. Phylogenetic relationship among Penicillium species which are common mycotoxin producers and Pf909 The phylogenetic relationships between Pf909, 13 other different Penicillium species representing all those known to produce mycotoxins in fruit and non mycotoxin producers (Table 3), were studied using sequences from three genes: Large subunit and Internal Transcribes Spacer (LSU-ITS) rDNA (partial 18S, ITS1, 5.8S, ITS2 and partial 28S) (ID), RNA polymerase II second largest subunit (RPB2), and partial β-tubulin (BT2) (Houbraken et al., 2014; Serra and Peterson, 2008; Visagie et al., 2014). A representative subset of strains of the mycotoxin producer species was selected for molecular analysis. The complete list of sequenced strains and their GenBank accession numbers are shown in Table 3. Pf909 genomic DNA was extracted according to Drenth et al. (1993) with minor modifications in the lysis step. The tubes containing lyophilized dried tissue (0.2–0.5 mg) and 500 μL of CTAB extraction buffer (5 M NaCl, 50 mM Tris-ClH (pH 8), 10 mM EDTA), were incubated at 60 °C for 30 min and centrifuged at 10,000 rpm in a bench top centrifuge (Eppendorf 5417R, Eppendorf®). The DNA was resuspended into TE (20 mM Tris-HCl pH 7.5, 0.1 mM EDTA) plus 2 μL RNase (10 mg/mL) and stored at − 20 °C. Amplification reactions were carried out using Multiplex PCR Master Mix (Promega). The PCR was set up using SensoQuest Labcycler (SensoQuest) thermocycler. BT2 was amplified with BT2a (5´GTTAACCAAATCGGTGCTGCTTTC3´) and BT2b (5´ACCCTC AGTGTAACCCTTGGC3´) primer pair and 52 °C annealing temperature, resulting in a 540 bp PCR product. The ID sequence was amplified with the primer pairs ITS5 (GGAAGTAAAAGTCGTAACAAGG) and D2R (GGTCCGTGTTTCAAGACG), and 55 °C annealing temperature, resulting in a 1050 bp PCR product. RPB2 was amplified with 5F (GAYGAYMGWGATCAYTTYGG) and 7CR (CCCATRGCTTGY TTRCCCAT) primer pairs and 52 °C annealing temperature, resulting in a 1150 bp PCR product, (Serra and Peterson, 2008; Visagie et al., 2014). The PCR products were purified using Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) according to the manufacturer's instructions, and then sequenced in an automated DNA sequencer (version 3.1; BigDye® Terminator) at the sequencing services of Secugen (www.secugen.es; Madrid, Spain). Multiple alignments of the genes were done using Clustal X (http://www.clustal.org/) (Thompson et al., 1994). Newly obtained sequences were deposited in the Genbank nucleotide sequence database (Table 3). Three dendrograms based on individual data sets of partial ID, RPB2

2.6. Statistical analysis Data was analysed by one-way analysis of variance (ANOVA) using a computerized statistical program (Statgraphics® Centurion XVI version 16.1.03). Prior to analysis, sporulation data were log (x + 1) transformed in order to improve homogeneity of variances. If the results of the F-test were significant (p ≤ 0.05), the means were compared by Student-Newman-Keuls multiple range test (Snedecor and Cochran, 1980). If the results from the second assay were not statistically different from those of the first assay, the results from each assay were pooled and reported. Regression analyses were computed using the linear model regression in Statgraphics CENTURION XVI in order to obtain a standard curve with the highest correlation coefficients between the physical factors (temperature, pH, aw, light intensity and photoperiod values) and the mycelia growth. Model selection was performed on the basis of the significance of the estimated parameters, R2 (coefficient of determination for lineal regression analysis), the adjusted coefficient of determination, the mean absolute error (average of the absolute values of the residuals), and mean square error (Almeida et al., 2002). 3. Results 3.1. Effect of physical properties of Pf909 in vitro on mycelial growth and sporulation The growth and the sporulation of Pf909 were temperature dependent. The optimum growth temperature was 22 °C (Table 4, Fig. 1b) where growth rates (0.57 cm/day) and colony diameters (8.20 cm) were significantly greater (p ≤ 0.05) than at other temperatures tested. The sporulation was significantly greater (p ≤ 0.05) at 25 °C (6810 conidia/cm2) (Fig. 1a) than at other temperatures. Growth and sporulation were reduced to minimum values below 10 °C and above 32 °C and inhibited above 36 °C (Table 4, Fig. 1a and b). The growth and sporulation of Pf909 were dependent on the aw of the growth medium. When aw was decreased below 0.990 and 0.970, growth rate and colony diameter were significantly reduced (p ≤ 0.05) compared to the unmodified medium (PDA; aw 0.999), respectively (Table 4, Fig. 1d). 29

International Journal of Food Microbiology 254 (2017) 25–35

B. Guijarro et al.

Fig. 1. The effect of different incubation temperatures (a, b) on the sporulation (a) and the colony diameter (b) of Penicillium frequentans strain 909 (Pf 909) after a 10-day incubation period in the dark on potato dextrose agar (PDA) (pH 5.6, aw 0.999). The effect of different water activities (aw) (c, d) and pH (e, f) on the sporulation (c, e) and the colony diameter (d, f) of Pf 909 after a 10-day incubation period in the dark at 22 °C on PDA (pH 5.6 and aw 0.999). PDA was osmotically modified with a glycerol solution to obtain different aw. PDA was amended with either 1 N HCl or 2 N NaOH to respectively acidify or alkalize medium. Bars followed by different letters are significantly different from each other (p < 0.05) according to the results of the Student-Newman-Keuls multiple range test. The values in the three column charts are the average value from ten replicate plates. MSE: Mean square error. R2: coefficient of determination for lineal regression analysis correlation (Almeida et al., 2002).

growth were observed. The highest sporulation (3175 conidia/cm2) occurred when the pH of the PDA was 5.6, followed by the sporulation at pH 8–9 (2432 conidia/cm2) (Fig. 1e). Sporulation was significantly (p ≤ 0.05) reduced compared to the unmodified medium (PDA; pH 5.6) when the pH of PDA was 3, 4, 10 and 11 (Fig. 1e). Growth and sporulation of Pf909 were highest when the fungus was grown in darkness or a short light photoperiod (Table 5; Figs. 2a–d).

The highest growth rate occurred at 0.999 and 0.995. Although Pf909 grew more slowly when aw was below 0.995, sporulation of Pf909 was significantly (p ≤ 0.05) reduced compared to the unmodified (PDA; aw 0.999), when aw was between 0.900 and 0.970 (Table 4 and Fig. 1c and d). The highest sporulation (3175 conidia/cm2) occurred at aw 0.999 (Fig. 1c). Growth of Pf909 was less dependent on pH than on aw (Table 4; Fig. 1f). Between the pH range of 4–11, no significant differences in the 30

International Journal of Food Microbiology 254 (2017) 25–35

B. Guijarro et al.

Table 5 The effect of four lengths of the photoperiod (P) and three light intensities (LI) on the growth and colony diameter of Penicillium frequentans (Pf 909) on potato dextrose agar (PDA) (pH 5.6 and aw 0.999) after a 10-day incubation at 22 °Ca. Length of the photoperiodb

Light intensityc

Length of P (light/dark)

Growth (cm·day− 1)

Colony diameter (cm)

LI (lumens)

Growth (cm·day− 1)

Colony diameter (cm)

0/24 12/12 16/8 24/0 MSEd

0.95 0.87 0.66 0.69 0.08

8.13 6.83 6.27 5.64 0.47

0 90 180

1.11 0.93 0.98

8.33 8.13 8.39

b b a a

c b ab a

0.01

c a b

a a a

0.13

a Data are the mean of the ten replicate plates. Means followed by different letters in each column are significantly different from each other (p < 0.05) according to the results of the Student-Newman-Keuls multiple range test. b On PDA (pH 5.6 and aw 0.999) in the dark (0 lm) or under continuous light (24 h a day) from one (90) to two (180 lm) 36 W commercial white fluorescent tubes. c On PDA (pH 5.6 and aw 0.999) under three 36 W white fluorescent tubes (270 lm) with four different light/dark 24-hour cycles, 0/24, 12/12, 16/8, and 24/0. d MSE: mean square error.

Fig. 2. The effect of different lengths of the photoperiod (270 lm of light hours (h)) (a, b) and light intensities (lumens (lm/W)) (c, d) on sporulation (a, c) and colony diameter (b, d) of Penicillium frequentans strain 909 (Pf 909) after a 10-day incubation period on potato dextrose agar (PDA) (pH 5.6, aw 0.999) at 22 °C. Bars followed by different letters are significantly different from each other (p < 0.05) according to the results of the Student-Newman-Keuls multiple range test. The values in the three column charts are the average value from ten replicate plates. MSE: Mean square error. R2: coefficient of determination for lineal regression analysis (Almeida et al., 2002).

any pH and length of illumination studied (Figs. 1f and 2b). The sporulation of Pf909 was maximum when (i) temperature was 25 °C (Fig. 1a), (ii) the aw was 0.999 (Fig. 1c), and (iii) with low LIs and short lengths of photoperiod (Fig. 2a and c).

The growth of Pf909 was faster than 0.5 cm/day at 22° (Fig. 1b), aw > 0.98 (Fig. 1d), photoperiod < 16 h (Fig. 2d), and at any pH and length of illumination studied (Figs. 1f and 2b). However, the growth of Pf909 was < 0.4 cm/day at temperatures higher than 32 °C or < 10 °C (Figs. 1b), aw < 0.97 (Fig. 1d), photoperiod > 16 h (Fig. 2d), and at 31

International Journal of Food Microbiology 254 (2017) 25–35

B. Guijarro et al. Penicillium citrinum Penicillium citrinum Penicillium citrinum Penicillium citrinum

Penicillium janczewskii Penicillium janczewskii Penicillium janczewskii Penicillium janczewskii Penicillium janczewskii Penicillium roqueforti Penicillium roqueforti Penicillium roqueforti Penicillium roqueforti Penicillium roqueforti Penicillium glandicola Penicillium glandicola Penicillium glandicola Penicillium glandicola Penicillium glandicola Penicillium chrysogenum Penicillium chrysogenum Penicillium chrysogenum Penicillium chrysogenum Penicillium chrysogenum Penicillium aurantiogriseum Penicillium aurantiogriseum Penicillium aurantiogriseum Penicillium aurantiogriseum Penicillium aurantiogriseum Penicillium neoechinulatum Penicillium neoechinulatum Penicillium viridicatum Penicillium viridicatum Penicillium viridicatum Penicillium viridicatum Penicillium cyclopium Penicillium cyclopium Penicillium cyclopium Penicillium cyclopium Penicillium expansum Penicillium expansum Penicillium expansum Penicillium expansum Penicillium griseofulvum Penicillium griseofulvum Penicillium griseofulvum Penicillium griseofulvum Penicillium griseofulvum Penicillium thomii Penicillium thomii Penicillium thomii Penicillium thomii Penicillium thomii Penicillium purpurascens Penicillium purpurascens Penicillium purpurascens Penicillium purpurascens Penicillium glabrum Penicillium glabrum Penicillium glabrum Penicillium glabrum Penicillium glabrum

0.02

Fig. 3. Dendrogram of the phylogenetic relationship between Penicillium frequentans strain 909 (Pf909) and the main toxin-producing species of Penicillium on fruit. The dendrogram was based on 58 nucleotide sequences of the partial β-tubulin (BT2) gene with five non mycotoxin producing P. glabrum strains used as an outgroup. It was constructed by MEGA (version 7; [http://www.megasoftware.net/]) using the Maximum Likelihood method and the Tamura-Nei model. Numbers at each node indicate the number of substitutions per site. All positions containing gaps and missing data were eliminated. There were a total of 564 positions in the final dataset. Sequences were retrieved from Gen Bank database.aMycotoxins associated with fruit Penicillium species based on Penicillium mycotoxins (Proceeding of the III International Working Conference on Stored Product Protection).bPenicillium frequentans fungus under study Pf909.

with P. glabrum isolates but did not cluster in the clade of any mycotoxin-producing Penicillium species (Figs. S2, and S3).

3.2. Sensitivity of Pf909 to antifungal compounds All concentrations of the commercial antifungal compounds tested (LD50 < 0.3 μg/mL) were toxic to Pf909, reducing mycelial growth after 72 h on Czapek Broth compared to the control (Table 1).

4. Discussion Our results show that P. frequentans strain 909 (Pf909) could be used as an effective and safe BCA against brown rot caused by Monilinia spp., because it was able to adapt to different environmental conditions such as a broad range of pH, UV rays, photoperiod exposure, low and high temperatures, and wet conditions. Furthermore, Pf909 did not produce mycotoxins on fruit surfaces and multigene phylogenies resolved Pf909 in a clade with other isolates of non mycotoxin producing P. glabrum. Finally, we have shown that Pf909 is susceptible to most of antifungal compounds used in human and veterinary medicine. The dynamics of BCA populations within the epiphytic community are determined by the rates of immigration, emigration, growth, and death. Each of these factors are strongly influenced by the physical environment, chemical treatment, mean air temperature, the relative humidity (RH), the amount of wind and rainfall, and solar radiation (Kinkel, 1997; Vorholt, 2012). Stone fruit grow best in temperate areas at 30 and 40° latitude, with cold winters and warm dry summers, avoiding lack of winter frost which can destroy blossoms or young fruit (Fideghelli, 1993). Thus, the climatic conditions that most favor the development of stone fruit might be the same as the conditions required for the maximum expression of P. frequentans Pf909 activities. Data from designed small-scale laboratory studies will form a vital component of the overall data package provided to registration authorities. Laboratory studies are particularly important for air borne biological products in general. Appropriately, conducted studies provide key supporting information that will reduce the subsequent number of larger scale field studies required, and will assist in the interpretation of field trial data. These studies attempt to clarify the environmental conditions that can affect the effectiveness of the product (e.g. conidial survival, toxicity of pesticides, and human, animal or crop risk) (Kiewnick, 2007). Guijarro et al. (2007b) showed that applications of Pf909 formulations reduced brown rot of peaches when applied as postharvest treatments and significantly reduced the inoculum density of Monilinia spp. at harvest in field trials when it was applied as preharvest treatments. Infections of stone fruit by air-borne conidia of Monilinia

3.3. Mycotoxin production 3.3.1. HPLC detection of mycotoxins on nectarine surface treated with Pf909 After 7 days, Pf909 residues were determined on treated and untreated fruit. No evidence of residual mycotoxins on fruit treated with Pf909, at full field dosage (106 conidia/mL), was detected by chromatographs TIC and EICs in different injections samples for each of the four different mycotoxins studied (penicillic acid, ochratoxin A, citrinin and patulin) (Fig. S1). 3.4. Phylogenetic relationship among Penicillium species producing mycotoxins and Pf909 The BT2 sequence of Pf909 was compared to 61 corresponding sequences from strains representing all known fruit associated Penicillium species producing mycotoxins obtained from Genbank database (Table 3). The sum of branch length of the optimal tree was 1.61 and the dendrogram is shown in Fig. 3. BT2 sequences were excellent species markers, correlating perfectly with mycotoxin producers. Pf909 clustered in one clade with P. glabrum isolates but did not cluster in the clade of any mycotoxin-producing Penicillium species. There was strict consensus support for the gene tree, and bootstrap support for some parts (0.02). The highest differences were observed between Pf909 and P. citrinum (24% differences), followed by those from P. viridicatum (23%), P. expansum (20%), P. digitatum, P. aurantiogriseum, P. cyclopium, P. chrysogenum, P. glandicola, P. griseofulvum, P. janczewskii, P. neoechinulatum and P. roqueforti, (> 10% differences). Pf909 differed from P. thomii and P. purpurascens by 7% and 6%, respectively. There were three groups of Penicillium spp. (P. expansum, P. chrysogenum and P. citrinum) that had particular relevance to the major mycotoxins and showed a close genetic relationship among them and far from P. glabrum clade (genetic distant over 10%). The results of the other genes (ID, and RPB2) studied confirm the general trend observed with BT2 sequence: Pf909 clustered in one clade 32

International Journal of Food Microbiology 254 (2017) 25–35

B. Guijarro et al.

might be of interest in the risk assessment of microbial BCAs. However, it is not feasible to identify and quantify all metabolites produced or potentially produced by a micro-organism. Most of these metabolites are produced in very small amounts. The potential to produce toxins (toxigenicity) of Pf909 was assessed with the major Penicillium mycotoxins associated with fruit and the most studied ones (penicillic acid, ochratoxin, patulin and citrinin) (Barkai-Golan, 2001). P. expansum is major producer of patulin in nature, followed by P. cyclopium and P. chrysogenum (Dombrink-Kurtzman and Blackburn, 2005). Patulin and penicillic acid were detected in Penicillium spp. contaminated peaches (1.8 × 105/g) at levels from 150 to 200 μg/kg and from 100 to 180 μg/ kg (detection limit 0.01–0.1 μg/g) (Aziz and Moussa, 2002). Mycotoxins have potential toxicologically relevant effects on vertebrates if administered in small doses (Turner et al., 2015). The toxic metabolites of fungi are one of the main hurdles in the registration of BCAs. We have shown Pf909 did not produce any mycotoxins, such as described above, on treated fruit. No reports on P. frequentans metabolites entering the food chain are available (Barkai-Golan, 2001). Phylogenetic studies have shown results in general narrow species concept for grouping Penicillium mycotoxin producers (Keith and Levesque, 2004) with adequate correlation between these species and mycotoxin production. Phylogenetic approach from multiple genes (ID, β-tubulin, RPB2 genes) has been used to document the diversity and to develop a molecular identification tool of Penicillium species (Houbraken et al., 2014; Visagie et al., 2014). Molecular studies showed that ITS sequences contained relatively little phylogenetic information to support species concepts based on mycotoxin profiles (Seifert and Lèvesque, 2004). However, phylograms derived from β-tubulin sequences conformed perfectly to the mycotoxin-based species concept (Seifert and Lèvesque, 2004). Our study confirmed that Pf909 clustered in one clade with non mycotoxin producing P. glabrum, far away from the clade where Penicillium species that have particular relevance to the major mycotoxins clustered. Houbraken and Samson (2011) also studied the phylogenetic relationships between Penicillium and other members of the family Trichocomaceae using a combined analysis of four loci (partial RPB1, RPB2 (RNA polymerase II genes), Tsr1 (putative ribosome biogenesis protein) and Cct8 (putative chapronine complex component TCP-1). However, RPB1 and RPB2 were not found among the best performing genes for fungal systematics (Aguileta et al., 2008). P. frequentans was in P. glabrum section (Serra and Peterson, 2008) where the fast growing Penicillia with monoverticillate conidiophores were accommodated (Pitt, 2000). P. glabrum and P. frequentans are phylogenetically and phenotypically closely related, with some differences in morphological characteristics and extrolite data (Houbraken et al., 2014). The extrolite profiles of these two species differ and P. frequentans strains produce 6methylisocoumarin and a compound with the same chromophore as pyranonigrin, whereas P. glabrum isolates are characterised by the production of citromycetin, fulvic acid, asterric acid, bisdechlorgeodin, geodin, sulochrin, and similar polyketides, and isolates of P. spinulosum and P. frequentans produce asperfuran, palitantin and frequentin (Hetherington and Raistrick, 1931; Mahmoodian and Stickings, 1964). Frequentin and palitantin have been reported from different strains of P. frequentans, and thereby strain Pf909, on culture media (Curtis et al., 1951; De Cal et al., 1988). But similarly to the reported by Larena et al. (2002) for Epicoccum nigrum, no antibiotic was produced by Pf909 in the semi-industrial production media in solid state fermentation or when it was applied on peaches (De Cal et al., 2012). Competition was the primary mechanism of biocontrol of Pf909 on Monilinia (Guijarro et al., 2017), and antibiosis only plays a minor role in biocontrol activities of the strain Pf909 (De Cal et al., 1988; De Cal and Melgarejo, 1994). Mycotoxins are usually produced under inducible conditions within or in contact with the host or target. Pf909 germinated on fruit surface (Fig. S4), but Pf909 does not produce any harm to nectarines after seven days storage at 25 °C, and there is no evidence of colony growth on fruit surface after spraying applications

spp. occur mainly before harvest in orchards. Establishment of a BCA before a pathogen arrives may enable early colonization of the fruit surfaces, protecting them from these infections (Ippolito and Nigro, 2000). However, under field conditions, rapid fluctuations in water availability and temperature are both characteristic of this environment and constitute the main factors limiting the development of microbial populations (Teixidó et al., 2009). We have previously reported that the population of Pf909 in the peach phyllosphere grew best during the late spring and summer (De Cal and Melgarejo, 1992; Melgarejo et al., 1986b). For applications of Pf909 on peaches which are administered during the blossoming and preharvest periods, the environmental temperature and relative humidity are the most important factors which can affect the dynamics of Pf909 population. So the environmental temperature and relative humidity accounts for 87% and 63%, respectively, of the observed variability in the number of conidia and CFUs (colony forming units) of Pf909 on the peach surface after its applications (Guijarro et al., 2007b). Therefore, Pf909 should be applied in commercial peach orchards when environmental temperatures are warm (Guijarro et al., 2008). The current in vitro assays show that water activity (aw) and temperature have a strong influence on the Pf909 growth and sporulation. The maximum growth and sporulation of Pf909 occurred when T is 22–25 °C and aw is wet (0.999). Guijarro et al. (2008) also proposed that in order to increase the size of the Pf909 population on fruit so that the population will be greater than that on the flowers Pf909 should be applied during bloom (because the peach blossoms carry low indigenous epiphytic populations) and at preharvest. Applying Pf909 under these conditions encourages the growth and sporulation of the indigenous P. frequentans population and increases the size of its population on the flower and fruit surfaces. Knowledge of the conditions that influence fungal sporulation is very useful as sporulation is the key factor in proliferation and dispersal (Haasum and Nielsen, 1998). Furthermore, microbes can be inactivated by other environmental factors including sunlight, and pH on fruit surface (Ippolito and Nigro, 2000). The relative importance of each of these factors depends on the reason and where a particular product is used. In foliar environments applications (which was the case in this study), solar radiation is probably the most important factor affecting the persistence of microbial fungicides (Filho et al., 2001; Rhodes, 1993). This detrimental effect of light intensity and duration was checked in our laboratory where a major decrease in Pf909 growth and sporulation was observed during higher exposure to light (hours and intensity). Filamentous fungi are able to grow in a wide range of pH from 4.0 to 6.0 with maximal growth rates at acid pH (Lacadena et al., 1995). In the case of Pf909, the range of pH values giving optimal growth on culture medium was wide (from 4.0 to 9.0). Pf909 is a harmless microorganism which is sensitive to commercial antifungal active compounds widely used in human and veterinary medicine. An antifungal is any substance of natural, semisynthetic or synthetic origin that kills or inhibits the growth of fungi while hopefully causing minimal damage to the host. Antimicrobial drugs have been widely used in human and veterinary medicine for > 50 years, with tremendous benefits to both human and animal health. Research data shows that in diverse environments from various regions of the world, there is a wide dispersion of antimicrobial resistance (Cantas et al., 2013). These antimicrobials can reach the environment of human and animal therapeutics, through manure, sewage, agriculture, etc. The development of resistance to this important class of drugs poses a serious public health threat (Cantas et al., 2013). In the Directive 91/414/EEC toxicity assessments with purified relevant metabolites are required. The metabolites can be an important factor involved in the mode of action and some might be toxic to nontarget organisms. Furthermore, different metabolites and different amounts can be produced under different environmental conditions. Therefore, beside the toxicity of the active ingredient in the product, the potential to produce toxins (toxigenicity) of the microorganism 33

International Journal of Food Microbiology 254 (2017) 25–35

B. Guijarro et al.

Council Directive of 15 July 1991 Concerning the Placing of Plant Protection Products on the Market (91/414/EEC). European Union, Brussels, Belgium. European Commission, 2005. European Council Directive 2005/25/EC, 2005 amending Annex VI to Directive 91/414/EEC as regards plant protection products containing micro-organisms. Off. J. Eur. Union 90/1–9034. European Commission, 2009. Commission Regulation (EU) 1107/2009., 2009. Regulation (EC) No 1107/2009 of the European Parliament and of the Council of 21 October 2009 Concerning the Placing of Plant Protection Products on the Market and Repealing Council Directives 79/117/EEC and 91/414/EEC. European Union, Brussels, Belgium. European Commission, 2010. Commission Regulation (EU) No 165/2010. Amending Regulation (EC) no 1881/2006 Setting Maximum Levels for Certain Contaminants in Foodstuffs as Regards Aflatoxins. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Fideghelli, C., 1993. In: Mundi-Prensa (Ed.), The Peach, pp. 152–155 Madrid, Spain. Filho, A.B., Alves, S.B., Augusto, N.T., Pereira, R.M., Alves, L.F.A., 2001. Stability and persistence of two formulations containing Anticarsia gemmatalis nuclear polyhedrovirus (AgMNPV). Neotrop. Entomol. 30, 411–416. Fustier, P., Lafond, A., Champagne, C.P., Lamarche, F., 1998. Effect of inoculation techniques and relative humidity on the growth of moulds on the surfaces on yellow layer cakes. Appl. Environ. Microbiol. 64, 192–196. Guijarro, B., Larena, I., Melgarejo, P., De Cal, A., 2006. Effect of drying on conidial viability of Penicillium frequentans, a biocontrol control agent against peach brown rot disease caused by Monilinia spp. Biocontrol Sci. Tech. 16, 257–269. Guijarro, B., Melgarejo, P., De Cal, A., 2007a. Relationship between shelf-life of Penicillium frequentans, a biological agent against brown rot disease, and its efficacy against peach brown rot. Int. J. Food Microbiol. 113, 117–124. Guijarro, B., Melgarejo, P., Torres, R., Lamarca, N., Usall, J., De Cal, A., 2007b. Effects of different biological formulations of Penicillium frequentans on brown rot of peaches. Biol. Control 42, 86–96. Guijarro, B., Melgarejo, P., Torres, R., Lamarca, N., Usal, J., De Cal, A., 2008. Penicillium frequentans population dynamics on peach fruits after its applications against brown rot in orchards. J. Appl. Microbiol. 104, 659–671. Guijarro, B., Hernandez-Escribano, L., Larena, I., Melgarejo, P., De Cal, A., 2017. Competition is the mechanism of biocontrol of brown rot in stone fruit by Penicillium frequentans. BioControl. http://dx.doi.org/10.1007/s10526-017-9808-x. Haasum, I., Nielsen, P.V., 1998. Ecophysiological characterization of common food-borne fungi in relation to pH and water activity under various atmospheric compositions. J. Appl. Microbiol. 84, 451–460. Hetherington, A.C., Raistrick, H., 1931. Studies in the biochemistry of microorganisms XI. On citromycetin, a new yellow colouring matter produced from glucose by a species of Citromyces. Philos. Trans. R. Soc. Lond. B 220, 209–244. Houbraken, J., Samson, R.A., 2011. Phylogeny of Penicillium and the segregation of Trichocomaceae into three families. Stud. Mycol. 70, 1–51. Houbraken, J., Visagiel, C.M., Meijer, M., Frisvad, J.C., Busby, P.E., Pitt, J.I., Seifert, K.A., Louis-Seize, G., Demirel, R., Yilmaz, N., Jacobs, K., Christensen, M., Samson, R.A., 2014. A taxonomic and phylogenetic revision of Penicillium section Aspergilloides. Stud. Mycol. 78, 373–451. Ippolito, A., Nigro, F., 2000. Impact of preharvest application of biological control agents on postharvest diseases of fresh fruits and vegetables. Crop. Prot. 19, 715–723. Keith, A.S., Levesque, C.A., 2004. Phylogeny and molecular diagnosis of mycotoxigenic fungi. Eur. J. Plant Pathol. 110, 449–471. Khabbaz, S.E., Zhang, L., Cáceres, L.A., Sumarah, M., Wang, A., Abbasi, P.A., 2015. Characterization of antagonistic Bacillus and Pseudomonas strains for biocontrol potential and suppression of damping-off and root rot diseases. Ann. Appl. Biol. 166, 456–471. Kiewnick, S., 2007. Practicalities of developing and registering microbial biological control agents. CAB Rev. 2, 1–11. Kinkel, L.L., 1997. Microbial population dynamics on leaves. Annu. Rev. Phytopathol. 35, 327–347. Lacadena, J., Martínez Del Pozo, A., Gasset, M., Patiño, B., Campos-Olivas, R., Vázquez, C., Martínez-Ruiz, A., Mancheño, M., Oñaderra, J.M., Gavilanes, J.G., 1995. Characterization of the antifungal protein secreted by the mould Aspergillus giganteus. Arch. Biochem. Biophys. 324-2, 273–281. Magan, N., Hope, R., Mitchell, D., 2010. Environmental Factors and Interactions with Mycobiota of Grain and Grapes: Effects on Growth, Deoxynivalenol and Ochratoxin Production by Fusarium culmorum and Aspergillus carbonarius. Toxins 2, 353–366. Mahmoodian, A., Stickings, C.E., 1964. 15 metabolites of Penicillium frequentans Westling, isolation of sulochrin, asterric acid, (+)-bisdecchlorogeodin + 2 new substituted anthraquinones questin + questinol. Biochem. J. 92, 369–378. Melgarejo, P., M-Sagasta, E., 1984. Fungal antagonism in relation to peach. In: Woodbine, M. (Ed.), Antimicrob Agriculture. Butterworths, London, pp. 127–136. Melgarejo, P., Carrillo, R., M-Sagasta, E., 1985. Mycoflora of peach twigs flowers and its possible significance in biological control of Monilinia laxa. Trans. Br. Mycol. Soc. 85, 313–317. Melgarejo, P., Carrillo, R., M-Sagasta, E., 1986a. Study on the epiphytic mycoflora of peach twigs and flowers. Phytopathol. Mediterr. 25, 68–72. Melgarejo, P., Carrillo, R., M-Sagasta, E., 1986b. Potential for biological control of Monilinia laxa in peach twigs. Crop. Prot. 5, 422–426. Mondal, S.N., Bhatia, A., Shilts, T., Timmer, L.W., 2005. Baseline sensitivities of fungal pathogens of fruit and foliage of citrus to azoxystrobin, pyraclostrobin, and fenbuconazol. Plant Dis. 89, 1186–1194. Pitt, J.I., 2000. Integration of Modern Taxonomic Methods for Penicillium and Aspergillus Classification. Harwood Academic Publishers, Amsterdam, pp. 323–355. Raposo, R., Colgan, R., Delcan, J., Melgarejo, P., 1995. Application of an Automated

either preharvest or postharvest (Guijarro et al., 2007b, 2008). Our results indicate that Pf909 is a harmless living microorganism that can be developed into a commercial product by the existing European regulation (Regulation 1107/2009) which requires a rigorous risk assessment to be done to register a biofungicide as a plant protection product and before its introduction into the market. The use of harmless living microorganism to counterbalance another pathogenic microorganism can play an important role in crop protection, especially as a key element in integrated pest management (IPM) programs. Acknowledgements This work was carried out with the financial support from BIOCOMES project (EU FP7 612713). The authors would like to acknowledge Dr. Arieh Bomzon, Consult Writer (www.consulwrite. com) for his editorial assistance in preparing this manuscript. We would also like to thank Dr. Gabrielle Berg from TUG University in Graz (Austria), for providing us with the mycotoxin confirmation analysis and Dr. Sandín from the Department of pesticides, INIA Spain for her valuable advice on analysis of mycotoxin results. Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.ijfoodmicro.2017.05.004. References Aguileta, G., Marthey, S., Chiapello, H., Lebrun, M.H., Rodolphe, F., Fournier, E., Gendrault-Jacquemard, A., Giraud, T., 2008. Assessing the performance of singlecopy genes for recovering robust phylogenies. Syst. Biol. 57, 613–627. Almeida, A., Castel-Branco, M., Falcao, A., 2002. Linear regression for calibration lines revisited: weighting schemes for bioanalytical methods. J. Chromatogr. 774, 215–222. Aziz, N.H., Moussa, L.A.A., 2002. Influence of gamma-radiation on mycotoxin producing moulds and mycotoxins in fruits. Food Control 13, 281–288. Baker, K.F., Cook, R.J., 1974. Biological Control of Plant Pathogens. W.H. Freeman, San Francisco. Barkai-Golan, R., 2001. Postharvest Diseases of Fruits and Vegetables: Development and Control. Elsevier Sciencepp. 322–326. Broekaert, W.F., Van Parijs, J., Leyns, F., Joos, H., Peumans, W.J., 1989. A chitin-binding lectin from stinging nettle rhizomes with antifungal properties. Science 245, 1100–1102. Campbell, R., 1989. Biological Control of Microbial Plant Pathogens. Cambridge University Press, Cambridge, pp. 218. Cantas, L., Shah, S.Q.A., Cavaco, L.M., Manaia, C.M., Walsh, F., Popowska, M., Garelick, H., Bürgmann, H., Sørum, H., 2013. A brief multi-disciplinary review on antimicrobial resistance in medicine and its linkage to the global environmental microbiota. Front. Microbiol. 4, 1–13. Cartwright, K.D., Benson, D.M., 1995. Optimization of biological control of Rhizoctonia stem rot of poinsettia by Paecilomyces lilacinus and Pseudomonas cepacia. Plant Dis. 79, 301–307. Cole, R.J., Cox, R.H., 1981. Handbook of Toxic Fungal Metabolites. Academic Press, New York, N.Y, pp. 823–830. Curtis, P.J., Hemming, H.G., Smith, W.K., 1951. Frequentin: an antibiotic produced by some strains of Penicillium frequentans Westling. Nature (London) 167, 557. De Cal, A., Melgarejo, P., 1992. Interactions of pesticides and mycoflora on peach twigs. Mycol. Res. 96, 1105–1113. De Cal, A., Melgarejo, P., 1994. Effects of Penicillium frequentans and its antibiotics on unmelanized hyphae of Monilinia laxa. Phytopathology 84, 1010–1014. De Cal, A., M-Sagasta, E., Melgarejo, P., 1988. Antifungal substances produced by Penicillium frequentans and their relationship to the biocontrol of Monilinia laxa. Phytopathology 78, 888–893. De Cal, A., M-Sagasta, E., Melgarejo, P., 1990. Biological control of peach twig blight (Monilinia laxa) with Penicillium frequentans. Plant Pathol. 39, 612–618. De Cal, A., Larena, I., Guijarro, B., Melgarejo, P., 2002. Solid state fermentation to produce conidia of Penicillium frequentans, a biocontrol agent against brown rot on stone fruits. Biocontrol Sci. Tech. 12, 715–725. De Cal, A., Larena, I., Guijarro, B., Melgarejo, P., 2012. The use of biofungicides for controlling plant diseases to improve food availability. Agriculture 2, 109–124. Dombrink-Kurtzman, M.A., Blackburn, J.A., 2005. Evaluation of several culture media for production of patulin by Penicillium species. Int. J. Food Microbiol. 98, 241–248. Drenth, A., Goodwin, S.B., Fry, W.E., Davidse, L.C., 1993. Genotypic diversity of Phytophthora infestans in the Netherlands revealed by DNA polymorphisms. Phytopathology 83, 1087–1092. European Commission, 1991. European Commission Directive 91/414/EEC., 1991.

34

International Journal of Food Microbiology 254 (2017) 25–35

B. Guijarro et al.

biocontrol and plant growth-promoting pseudomonads useful in crop production. Ann. Appl. Biol. 159, 291–301. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis. Mol. Biol. Evol. 24 (8), 1596–1599. Teixidó, N., Usall, J., Nunes, C., Torres, R., Abadias, M., Viñas, I., 2009. Preharvest strategies to control postharvest diseases in fruits. Postharvest Pathog. 2–7, 89–106. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1994. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Turner, N.W., Bramhmbhatt, H., Szabo-Vezse, M., Poma, A., Coker, R., Piletsky, S.A., 2015. Analytical methods for determination of mycotoxins: an update (2009–2014). Anal. Chim. Acta 901, 12–33. Visagie, C.M., Houbraken, J., Frisvad, J.C., Hong, S.-B., Klaassen, C.H.W., Perrone, G., Seifert, K.A., Varga, J., Yaguchi, T., Samson, R.A., 2014. Identification and nomenclature of the genus Penicillium. Stud. Mycol. 78, 343–371. Vorholt, J.A., 2012. Microbial life in the phyllosphere. Nat. Rev. Microbiol. 10, 828–840. Larena, I., Liñán, M., Melgarejo, P., 2002. Antibiotic production of the biocontrol agents Epicoccum nigrum and Candida sake. Plant Prot. Sci. 38, 205–208.

Quantitative Method to Determine Fungicide Resistance in Botrytis cinerea. 79. Pl. Dis.pp. 294–296. Rastogi, G., Coaker, G.L., Leveau, J.H.J., 2012. New insights into the structure and function of phyllosphere microbiota through high-throughput molecular approaches. FEMS Microbiol. Lett. 348, 1–10. Rhodes, D.J., 1993. Formulation of biological control agents. In: Jones, D.G. (Ed.), Explotation of Microorganisms. Chapman and Hall, London, pp. 411–439. Seifert, K.A., Lèvesque, C.A., 2004. Phylogeny and molecular diagnosis of mycotoxigenis fungi. Eur. J. Plant Pathol. 110, 119–471. Serra, R., Peterson, S., 2008. Multilocus sequence identification of Penicillium species in cork bark during plank preparation for the manufacture of stoppers. Res. Microbiol. 159, 178–186. Sneath, P.H.A., Sokal, R.R., 1973. Numerical Taxonomy. Freeman, San Francisco. Snedecor, G.W., Cochran, W.G., 1980. Statistical Methods, seventh ed. Ames: Iowa State University Press, University Press, Iowa State, USA, pp. 507. Strauch, O., Hermann, S., Hauschild, R., Ehlers, R.U., 2011. Proposals of bacterial and fungal biocontrol Agents. In: Ehlers, R.-U. (Ed.), Regulation of Biological Control Agents. Springer Science & Business Media, pp. 268–274. Sundh, S.I., Hökeberg, M., Levenfors, J.J., Nilsson, A.I., 2011. Safety assessment of

35