Adaptive laboratory evolution of stable insect cell lines for improved HIV-Gag VLPs production

Journal Pre-proof Adaptive laboratory evolution of stable insect cell lines for improved HIV-Gag VLPs production ´ ˜ Vidigal, Ricardo Correia, Manuel J.T. Barbara Fernandes, Joao ´ ˜ Carrondo, Paula M. Alves, Ana P. Teixeira, Antonio Roldao

PII:

S0168-1656(19)30884-3

DOI:

https://doi.org/10.1016/j.jbiotec.2019.10.004

Reference:

BIOTEC 8521

To appear in:

Journal of Biotechnology

Received Date:

17 August 2019

Revised Date:

1 October 2019

Accepted Date:

1 October 2019

Please cite this article as: Fernandes B, Vidigal J, Correia R, Carrondo MJT, Alves PM, ˜ A, Adaptive laboratory evolution of stable insect cell lines for improved Teixeira AP, Roldao HIV-Gag VLPs production, Journal of Biotechnology (2019), doi: https://doi.org/10.1016/j.jbiotec.2019.10.004

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Adaptive laboratory evolution of stable insect cell lines for improved HIV-Gag VLPs production

Bárbara Fernandes1,2, João Vidigal1,2, Ricardo Correia1,2, Manuel JT Carrondo1, Paula M Alves1,2, Ana P Teixeira1,2,#, António Roldão1,2,*

1

IBET, Instituto de Biologia Experimental e Tecnológica, Apartado 12, 2780-901 Oeiras,

2

ITQB NOVA, Instituto de Tecnologia Química e Biológica António Xavier, Universidade

Nova de Lisboa, Av. da República, 2780-157 Oeiras, Portugal

Present address: ETH Zurich, Department of Biosystems Science and Engineering,

Mattenstrasse 26, 4058 - Basel, Switzerland

-p

#

ro of

Portugal

Highlights 

Adaptive laboratory evolution (ALE) of stable insect cell lines to hypothermic culture

ur na

conditions 

lP

re

* Corresponding author: [email protected] (+351214469418)

Adapted cells express up to 26-fold more Gag-VLPs than non-adapted cells cultured at standard conditions



Addition of productivity enhancers optimize production of Gag-VLPs in non-adapted cells but not in adapted cell lines

Production of Gag-VLPs in adapted, stable insect Sf-9 cells successfully demonstrated at

Jo



bioreactor scale



ALE is a powerful method for improving yields in stable insect cell lines producing VLPs

1

Abstract Adaptive laboratory evolution (ALE) has been extensively used to modulate the phenotype of industrial model organisms (e.g. E.coli and S.cerevisae) towards a specific trait. Nevertheless, its application to animal cells, and in particular to insect cell lines, has been very limited. In this study, we describe employing an ALE method to improve the production of HIV-Gag virus-like particles (VLPs) in stable Sf-9 and High Five cell lines. Serial batch transfer was

ro of

used for evolution experiments. During the ALE process, cells were cultured under controlled hypothermic conditions (22 ºC instead of standard 27 ºC) for a prolonged period of time (over 3 months), which allowed the selection of a population of cells with improved

-p

phenotype. Adapted cells expressed up to 26-fold (Sf-9 cells) and 10-fold (High Five cells) more Gag-VLPs than non-adapted cells cultured at standard conditions. The production of

re

HIV Gag-VLPs in adapted, stable insect Sf-9 cell lines was successfully demonstrated at

lP

bioreactor scale. The Gag-VLPs produced at 22ºC and 27ºC were comparable, both in size and morphology, thus confirming the null impact of adaptation process and hypothermic culture conditions on VLP’s quality.

ur na

This work demonstrates the suitability of ALE as a powerful method for improving yields in stable insect cell lines producing VLPs

Jo

Keywords: Adaptive laboratory evolution; Hypothermic culture conditions; Insect Sf-9 and High Five cells; HIV-Gag VLPs; Productivity enhancers (NaBu and DMSO).

2

1. Introduction Virus-like particles (VLPs) are self-assembling complexes of capsid proteins that mimic the conformation of the native virus, but are devoid of viral genetic material (Fernandes, Teixeira, Carinhas, Carrondo, & Alves, 2013; Kushnir, Streatfield, & Yusibov, 2012). Enveloped VLPs can function as scaffolds for displaying proteins in their native structural conformation, a feature of particular relevance when difficult to express proteins (e.g. membrane proteins) are desired. The viral core protein will trigger VLP budding and release

ro of

from lipid raft regions of the plasma membrane, taking along the anchored target protein (Willis et al., 2008). The main structural protein of the Retroviridae virus family, Gag, has been widely used to produce VLPs. It has been shown that Gag assembles even in the

-p

absence of any other viral factor in the lipid raft regions of transduced/transfected cells, and leads to the budding of VLPs into the culture supernatant (Weldon, Erdie, Oliver & Wills,

re

1990).

lP

Insect cells emerged as a powerful and versatile platform for VLPs production, mostly using the lytic baculovirus expression vector system (BEVS) (Baumert, Ito, Wong, & Liang, 1998; Deschuyteneer et al., 2010; Pushko et al., 2017; Ye et al., 2006). Disadvantages for this

ur na

system include the presence of proteases in culture medium at time of harvest (van Oers, 2011), residual contamination of final product with baculovirus (Merrihew et al., 2001), low quality of some proteins requiring complex processing (Fernandes et al., 2012), and still,

Jo

existing difficulties in continuous bioprocessing due to the lytic nature of the viral infection process (Schmidt, 2004) despite recent efforts made in that direction (Tapia, VázquezRamírez, Genzel, & Reichl, 2016). Stable expression in insect cells has been increasingly explored to circumvent BEVS-related drawbacks (Fernandes et al., 2014, 2012; McCarroll & King, 1997), however the single or low copy number of stably integrated DNA results in

3

lower level of protein expression. Improved producer cells and bioprocess intensification strategies are therefore necessary to increase productivities. In the last couple of decades, substantial effort has been committed to optimizing the stable expression system in order to enhance recombinant protein production, mostly by revamping the bioprocess (e.g. operation mode, culture medium), the cell line development process (e.g. clone selection, transfection technologies) and the cell line. Regarding the latter, cell cycle inhibition based approaches (e.g. temperature shift and chemical additives) (Bollati-Fogolín

ro of

et al., 2008; Fox, Yap, & Wang, 2004; Hwa Chang et al., 2002; Lamotte et al., 1999; Ling et al., 2003; Rossi et al., 2012) have been extensively used as they are easy to implement and can lead to a significant increase in specific productivity.

-p

Addition of chemicals such as sodium butyrate (NaBu) and dimethyl sulfoxide (DMSO) to cell cultures has become a frequently used strategy to enhance protein expression (Hwa

re

Chang et al., 2002; Lamotte et al., 1999). NaBu is known to cause cell blockage at G1-phase

lP

of the cell cycle as well as inhibition of histone deacetylases (Kumar, Gammell, & Clynes, 2007). Hyperacetylation of histones through the inhibition of histone deacetylases has been found to up-regulate transcription by opening up nucleosome structures. Together, these

ur na

modifications make the recombinant gene more accessible to the transcription machinery thus increasing its transcription rate (Kumar et al., 2007; Sunley & Butler, 2010). DMSO, on the other hand, is a stabilizing agent during protein folding and aids the release of

Jo

intracellular products (Hwa Chang et al., 2002; Swiech, Rossi, Astray, & Suazo, 2008). Independently of their mode of action, both chemicals have an extensive impact on gene expression causing cell growth arrest, preventing apoptosis and promoting protein production (Kumar et al., 2007; Rodriguez, Spearman, Huzel & Butler, 2008). For example, the supplementation of Drosophila melanogaster derived S2 cells cultures with DMSO induced a 3.6-fold increase in the production of rRVGP (Swiech et al., 2008) . Likewise, the 4

addition of NaBu to hybridoma cell cultures enhanced the production of a monoclonal antibody by 2.3-fold (Mimura et al., 2001) and in CHO cells for recombinant interferongamma production by 2-fold (Lamotte et al., 1999). Shifting temperature to conditions of mild hypothermia during cell culture has been shown to increase specific productivities for a wide variety of recombinant proteins. For example, S2 cells, when cultured at 22 ºC, express up to 10-fold more recombinant rabies virus glycoprotein (rRVGP) than when cultured under standard 27 ºC (Swiech et al., 2008). In

ro of

CHO cells, lowering the culture temperature from standard 37 ºC to 31 ºC during late exponential growth phase induced a 6-fold increase in product titer (Bollati-Fogolín et al., 2008). An alternative process optimization strategy to directed temperature shifting is

-p

adaptive laboratory evolution (ALE). Although ALE has been extensively used to modulate the phenotype of microbial cells towards a specific trait (Caspeta & Nielsen, 2015), its

re

application to animal cells has been limited (Yoon et al., 2006). Specifically for insect cells,

lP

the only example is a study showing improved production of Chikungunya VLPs in Sf-21 cells upon ALE to high pH (Wagner et al., 2014).

In this work, aiming to improve yields in insect Sf-9 and High Five cell lines stably

ur na

producing VLPs, two bioprocess engineering schemes were evaluated (either individually or in combination): (i) ALE of insect cells to hypothermic culture conditions, and (ii)

Jo

supplementation of insect cell cultures with the productivity enhancers NaBu and DMSO.

5

2. Materials and methods 2.1.Cell lines and culture media Stable insect Sf-9 and High Five cell populations expressing Gag-VLPs (from now on named “Sf9-Gag” and “Hi5-Gag”), previously established in our lab (Vidigal et al., 2017), were routinely sub-cultured to 0.3-0.5x106 cell/mL every 3-4 days when cell density reached 23x106 cell/mL in 125 or 500 mL shake flasks (10 % working volume, wv) in a Innova 44R incubator (orbital motion diameter of 2.54 cm- Eppendorf) at 27 °C and 100 rpm. Insect-

ro of

XPRESSTM (Sartorius) and Sf-900TM II SFM (Thermo Fisher Scientific) media were used to culture Sf9-Gag and Hi5-Gag cells, respectively. Hygromycin B solution at 0.1 mg/mL

-p

(Invivogen) was used as selection antibiotic.

2.2.Adaptation of stable insect cell lines to hypothermic culture conditions

re

Sf9-Gag and Hi5-Gag cells were grown in 500 mL shake flasks (10 % wv) in a Innova 44R

lP

incubator (100 rpm) at 27 oC until stationary phase. Cells were then serially transferred to fresh media for approx. 50-60 times under hypothermic culture conditions - the initial 6-9 at 24 oC and the remaining at 22 oC - after which no increase in cell growth rate was observed.

ur na

During the adaptation process, cells were routinely sub-cultured to 0.6-1x106 cell/mL every 5-6 days when cell density reached 2-3x106 cell/mL in a Multitron Pro incubator (orbital motion diameter 5.0 cm- Infors HT) at 100 rpm in the same medium as in section 2.1. As

Jo

control cultures, Sf9-Gag and Hi5-Gag cells were cultured at 27 ºC for the same number of generations as adapted cells.

2.3.Production of Gag-VLPs The production of Gag-VLPs in non-adapted or adapted Sf9-Gag and Hi5-Gag cells was performed in 250 or 500 mL shake flasks (10 % wv) and in 0.5 L stirred tank bioreactors 6

(STB). In shake flasks, cells were seeded at 1x106 cell/mL (Sf9-Gag cells) or 0.3x106 cell/mL (Hi5Gag cells) and kept in culture as described above until cell viabilities dropped below 90 %, time of harvest (TOH). Specifically, for the productivity enhancers study (in shake flasks), when cell concentrations reached 2x106 cell/mL, the culture medium was supplemented with 1 mM NaBu (Merck) and/or 1 % (v/v) DMSO (Merck). Bioreactor cultures were performed in a computer-controlled BIOSTAT Qplus DCU-3 0.5

ro of

L vessel (Sartorius) equipped with one Rushton impeller and a ring-sparger for gas supply. pH was monitored (not controlled) along culture time. The pO2 was set to 30 % of air saturation and was maintained by varying the percentage of O2 in the gas mixture from 0 to

-p

100 %. Agitation was set to 90 rpm to ensure that Kolmogorov eddy length scale (KES, 77 m) was higher than the cells’ average diameter (≈ 17 m), thus limiting the impact of flow

re

shear on cells viability. pH was monitored The gas flow rate was set to 0.01 vvm and

lP

temperature was kept at 27 °C or 22 °C. The working volume was 0.5 L. Specifically, for the productivity enhancers study, supplementation was performed as described above: Sf9-Gag

ur na

cells were seeded at 1x106 cell/mL and kept in culture until cell viabilities dropped below 90 %. Cell culture bulk was harvested and clarified by centrifugation, first at 200×g, 4 oC, 10 min, for cells removal, and second at 2000×g, 4 oC, 20 min for removal of cellular debris. For concentration of Gag-VLPs, a two-step ultracentrifugation procedure was used: 40

Jo

000×g, 4 ºC for 3 h in a 45Ti Beckman rotor followed by 60 000×g, 4 ºC for 3 h in a 90Ti Beckman rotor on a layer of 20 % (v/v) sucrose (Merck) in PBS (Gibco). Polycarbonate bottle assembly with aluminum caps tubes (Becknan Coulter) were used. The pellet containing Gag-VLPs was collected and stored at -80 ºC (long-term storage) or at 4 ºC (short-term storage) in 1mL of HEPES buffer (50 mM) containing NaCl (30 mM), trehalose (15 % w/v) and pH 7.4. 7

2.4. Analytics 2.4.1. Cell concentration and viability Cell concentration and viability were analysed in the samples collected by trypan blue exclusion method daily. Cell counting was performed in a Fuchs-Rosenthal hemocytometer chamber (Brand, Wertheim, Germany) or in the Cedex HiRes Analyzer (Roche, Germany).

ro of

2.4.2. Metabolite analysis Cell culture samples were centrifuged at 200 ×g, 4 °C for 10 min and supernatants collected for metabolite analysis. Metabolite (glucose, glutamine and lactate) quantification was

-p

performed using YSI biochemistry analyzer 7100 (Xylem, USA).

re

2.4.3. Enzyme-Linked Immunosorbent Assay (ELISA)

lP

The concentration of p24 protein was assessed using the Lenti-X p24 Rapid Titer Kit (Clontech, USA) according to manufacturer’s instruction. In this study, all culture supernatant samples analysed by ELISA were collected at cell viabilities above 90 %, thus

ur na

theoretically ensuring that most Gag protein accumulated in the culture supernatant are assembled as VLP and not as monomeric Gag molecules (Gutiérrez-Granados, Cervera, Segura, Wölfel & Gòdia, 2015). To access intracellular p24 protein content the pellet

Jo

samples were lysed using I-PER Insect cell protein extraction reagent (Thermo Scientific, USA) according to manufacturer’s instruction.

2.4.4. Nanoparticle tracking analysis The concentration of Gag-VLPs was also assessed using the NanoSight NS500 NTA equipment (NanoSight). Briefly, concentrated Gag-VLPs were serially diluted in particle8

free water to obtain a suitable particle concentration for analysis. Videos of three dilution steps for each sample were captured for 60 seconds and were analyzed and evaluated by NTA software. All steps were carried out at room temperature. The camera level and analysis parameters were adjusted manually and were kept constant during all measurements. Particles with a diameter between 100-200 nm were considered Gag-VLPs (Steppert et al., 2016).

ro of

2.4.5. Transmission electron microscopy Negative staining transmission electron microscopy was used to assess the conformation and size of Gag-VLPs. Briefly, 10 μl of purified VLP sample was fixed for 1 min in a copper

-p

grid coated with Formvar-carbon (Electron Microscopy Sciences, Hatfield). Grids were washed with H2O and then stained with 1 % (v/v) uranyl acetate for 2 min and left to air dry.

re

Samples were then observed in a Hitachi H-7650 Transmission Electron Microscope (JEOL,

lP

USA).

2.4.6. Real time quantitative PCR

ur na

Real time quantitative PCR (qPCR) was used to evaluate Gag gene expression. Briefly, RNA was extracted from 10x106 cells using the RNeasy kit (Qiagen) according to manufacturer’s instructions and then quantified using Nanodrop ND-2000c spectrophotometer (Thermo

Jo

Scientific). cDNA was synthesized with Transcriptor High Fidelity cDNA Synthesis Kit (Roche Applied Science, Germany), using Anchored-oligo(dT)18 Primer (Roche). Forward and reverse primer sequences for Gag (CATGATGATAAACAATGTATGGTGC and GGGGAGGCCACCGAGTATAA)

and

18S

(AGGGTGTTGGACGCAGATAC

and

CTTCTGCCTGTTGAGGAACC) were designed. qPCR was performed using LightCycler 480 SYBR Green I Master Kit (Roche) according to manufacturer’s instructions. Cycles 9

threshold (Ct’s) and melting curves were determined using LightCycler 480 Software version 1.5 (Roche). All data was analyzed using the 2-ΔΔCt method for relative gene expression analysis (Livak and Schmittgen, 2001). Changes in Gag gene expression were normalized using the housekeeping gene 18S rRNA (18S ribosomal RNA) as internal control for Sf9-Gag.

2.5.Mathematical equations

ro of

Mathematical equations for estimation of reaction rates – cell specific growth rate (), yield coefficients (Yi,j , mass of j formed or consumed per mass of i formed or consumed), specific rates of product j formed (𝑟𝑃𝑗 ) and of substrate j consumed (𝑟S𝑗 ) – and for estimation of VLP

-p

titer are given in “Supplementary information - Materials and Methods” section.

re

2.6.Statistical analysis

lP

Data were expressed as mean ± standard deviation. Differences were tested by One-Way ANOVA with post-hoc Tukey’s multiple comparison analysis method (adjusted p-value  <

ur na

 0.05 was considered statistically significant). Unsupervised hierarchical clustering analysis, using Ward’s method for distance calculation, was performed to assess the impact of productivity enhancers on p24 protein expression and cell growth kinetics. Pearson’s correlation (r) was used to analyse the association between shake flask and stirred-tank

Jo

bioreactor in terms of cell growth kinetics (p-value < 0.05 was considered statistically significant).

10

3. Results 3.1. Establishment of stable insect cell lines adapted to hypothermic culture conditions Sf-9 and High Five cell populations expressing Gag-VLPs (Sf9-Gag and Hi5-Gag) have been previously established in our lab (Vidigal et al., 2017). However, their potential has been hampered by low productivities. Aiming at improving their performance, Sf9-Gag and Hi5Gag cells were serially adapted to grow under hypothermic culture conditions (22 ºC instead of standard 27 ºC).

ro of

For adaptation cells were cultured in repeated batch mode for more than 50 generations in the case of Sf9-Gag cells (Fig. 1A) and 60 generations in the case of Hi5-Gag cells (Fig. 1B), after which no increase in cell growth rate () was observed. Cell growth rates (and

-p

viabilities, data not shown) reduced upon culture temperature decrease, irrespective of the cell line. Upon shifting the temperature to 22 ºC, Sf9-Gag cells increased their growth rate to

re

 = 0.010 h-1 within a period of  150 days, whereas Hi5-Gag cells required  90 days to

lP

reach their maximum  = 0.023 h-1. Compared to control cultures ( = 0.030 h-1 for Sf9 cells and  = 0.042 h-1 for High Five cells), these growth rates are considerably lower.

ur na

The expression of p24 protein (as proxy for Gag-VLPs) in adapted Sf9-Gag and Hi5-Gag cells was assessed by ELISA over three passages spaced in time and no significant differences could be observed in titers (p24, ng/mL) or specific production rates (rp24, ng/cell.h), confirming the stability of p24 expression along cell passages (Fig. 1). Non-

Jo

adapted Sf9-Gag and Hi5-Gag cells were maintained in culture at 27 ºC for approximate number of generations as adapted cells, showing similar specific productivity over three passages spaced in time (Supplementary Fig. S1).

3.2. Serial adaptation improves p24 protein expression To investigate the ALE impact the growth kinetics and p24 protein expression of non11

adapted Sf9-Gag and Hi5-Gag cells cultured at 22 ºC were assessed and compared to those of adapted cells (Fig. 2). Non-adapted cells cultured at 27 ºC (standard condition) were used as control. Growth profiles of Sf9-Gag and Hi5-Gag cells are shown in Fig. 2A and 2B, respectively, and results show that (i) cell growth rate decreases proportionally with temperature ( 22 C <  27 C), (ii) adapted and non-adapted cells cultured at 22 ºC have similar growth rates ( adapted ≈  non-adapted), and (iii) onset of cell viability decrease occurs later in time for adapted cells

ro of

(td, adapted > td, non-adapted), irrespective of the cell line.

The p24 protein titer (p24, ng/ml) and specific production rate (rp24, ng/cell.h) achieved in Sf9-Gag and Hi5-Gag cells are depicted in Fig. 2A and 2B, respectively. Results show that

-p

(i) temperature reduction promotes an increase in p24 specific production rate (rp24,22

C

>

non-adapted),

irrespective of the cell line.

re

rp24,27 C), and (ii) adaptation process is required to maximize p24 expression (p24 adapted > p24

lP

The consumption of glucose (Glc) and glutamine (Gln), and the production of lactate (Lac) were followed throughout the culture, and their specific consumption (𝑟S𝐺𝑙𝑐 and 𝑟S𝐺𝑙𝑛 ) or

ur na

production (𝑟P𝐿𝑎𝑐 ) rates estimated accordingly (Supplementary Fig. S2). The low 𝑟S𝐺𝑙𝑐 and 𝑟S𝐺𝑙𝑛 observed in adapted cells reflect the impact of the adaptation process on cellular metabolic function. This is more evident for adapted Sf9-Gag cells, with a 2.80.7 and 30.5-fold decrease in 𝑟S𝐺𝑙𝑐 and 𝑟S𝐺𝑙𝑛 , respectively, when compared to non-adapted cells

Jo

cultured at 27 ºC. These changes in cell metabolism reflect a more efficient utilization of carbon and nitrogen sources for product formation as suggested by the higher yields (Pp24/SGlc or Pp24/SGln) obtained. Overall, adapted cells cultured under hypothermic culture conditions expressed up to 26-fold (Sf9 cells) and 10-fold (High Five cells) more p24 protein (ng/ml) than non-adapted cells

12

cultured at standard conditions (27 ºC). In terms of insect cell line, results suggest that adapted Sf9-Gag cells perform better than Hi5-Gag cells for p24 protein expression.

3.3. Effect of productivity enhancers on cell growth and p24 protein production Aiming at further increasing p24 protein expression, supplementation strategies with key compounds (NaBu and/or DMSO) previously identified as potential enhancers of recombinant protein production (Hwa Chang et al., 2002; Lamotte et al., 1999; Ling et al.,

ro of

2003) were explored in small-scale shake flasks. First, a dose escalation study was performed to identify (i) the optimal concentration of NaBu and DMSO to use and (ii) the ideal time for their addition to culture medium (i.e. cell

-p

concentration) (Fig. 3). These experiments were performed with non-adapted Sf9-Gag and Hi5-Gag cells cultured at 27 ºC (standard condition). Supplementing cultures with 1mM

re

NaBu or with 1 % (v/v) DMSO at a cell concentration of 2106 cell/mL was the ideal setup,

on cell growth.

lP

as it promotes the highest increase in p24 protein expression, while having the lowest impact

ur na

Upon identification of lead conditions, the next step was to investigate the impact of the two productivity enhancers on growth kinetics and p24 production of adapted Sf9-Gag and Hi5Gag cells cultured at 22 ºC. Non-adapted cells cultured at 27 ºC (standard condition) were used as control.

Jo

Data presented in Table 1 confirm that addition of NaBu and/or DMSO negatively impacts on cell growth, irrespective of the cell line and culture temperature. The p24 protein titer (p24, ng.mL-1) and specific production rate (𝑟𝑃𝑝24 , ng.109cell-1.mL-1) are depicted in Fig. 4. For non-adapted cells cultured at 27 ºC, supplementation strategies with NaBu and/or DMSO seem to impact positively on cells productivity, with titers and rates being up to 8(3)-fold (for p24) and 13(6)-fold (for 𝑟𝑃𝑝24 ) higher than those obtained in control cultures 13

(without supplementation). On the contrary, in adapted cell cultures supplemented with NaBu and/or DMSO, a reduction of up to 4(1)-fold (for p24) and 3(1)-fold (for 𝑟𝑃𝑝24 ) was observed when compared to control cultures (without supplementation). This data suggests that addition of productivity enhancers constitute a simple way to optimize production of Gag-VLPs in non-adapted cells but not in adapted cell lines. Overall, although non-adapted cells’ productivity could be enhanced upon supplementation with NaBu and DMSO, adapted Sf9-Gag and Hi5-Gag cells cultured at 22 ºC without

ro of

supplementation is the best condition for Gag-VLPs production. In addition, comparing both adapted insect cell lines in terms of Gag-VLPs production, confirms that adapted Sf9-Gag cells outperforms adapted Hi5-Gag cells, and thus used as proof-of-concept at bioreactor

re

3.4. Proof-of-concept at bioreactor scale

-p

scale.

lP

The feasibility of the strategy herein proposed for production of Gag-VLPs in stable insect cell lines was demonstrated in 0.5 L stirred-tank bioreactors (STB). Adapted Sf9-Gag cells

ur na

were cultured at 22 ºC (correspond to “AC-22C cultures”) in STB and shake-flasks (SF), and their performance in terms of cell growth kinetics and p24 protein production compared. Equal assessment was made with non-adapted cells cultured at 27 ºC (correspond to “NC27C cultures”) (standard condition). All cultures where performed without NaBu or DMSO

Jo

supplementation.

Cell growth kinetics in STB and SF were similar, with estimated regression coefficients (b) and Pearson’s correlations (r) close to 1 (Fig. 5A, left panel). Cell growth rate in AC-22C cultures was lower than in NC-27C cultures irrespective of the culture system (STB or SF), thus confirming the growth evolutionary trade-off endured by adapted cells. In addition, no

14

apparent differences were observed in the cell viability profiles of AC-22C and NC-27C cultures performed in STB and SF (Fig. 5A, right panel). The fold-change in p24 protein titer and specific p24 production rate between AC-22C and NC-27C cultures are shown in Fig. 5B, and there is no statistically significant difference between the estimated values for STB and SF. Real time PCR data confirms that Gag gene expression is higher in AC-22C cultures than in NC-27C cultures; this higher Gag mRNA level is translated into higher intracellular p24 protein content (Fig. 5C). The specific

ro of

consumption rates of Glc and Gln obtained in STB were estimated, and the values compared to SF cultures (Supplementary Fig. S3). Although statistically significant differences have been observed (in particular for AC-22C cultures), these seemed to have negligible impact

-p

on cell growth and p24 expression (titer and specific production rate) as highlighted above.

Gag-VLPs from AC-22C and NC-27C cultures performed in STB were concentrated and

re

further analysed by nanoparticle tracking analysis (Fig. 5D) and negative staining TEM (Fig.

lP

5E). The normalized frequency distribution histograms of particles obtained from AC-22C and NC-27C cultures are comparable (Fig. 5D). In addition, TEM images confirmed the presence of particles resembling Gag-VLPs, both in size (diameter of 100-250 nm) and

ur na

morphology (spherical shape) (Fig. 5E). The results obtained confirm the scalability of the strategy herein proposed (i.e. stable insect cell lines adapted to hypothermic culture

Jo

conditions) for production of Gag-VLPs.

15

4. Discussion In this study, we describe employing an ALE method to improve the production of HIV-Gag virus-like particles (VLPs) in stable Sf-9 and High Five cell lines. Sf9-Gag and Hi5-Gag cells were cultured at 22 ºC (instead of standard 27 ºC) for a prolonged period of time (over 3 months) (Fig. 1), which allowed the selection of cells with an improved phenotype able to growth in hypothermic conditions. Sf9-Gag and Hi5-Gag cells were kept in culture at 27 ºC for the same time as adapted cells, showing the same specific productivity along different

ro of

generations. Under these conditions, adapted cells expressed up to 26-fold (Sf9-Gag cells) and 10-fold (Hi5-Gag cells) more p24 protein than non-adapted cells cultured at standard conditions (Fig. 2, AC-22C vs NC-27C cultures). These results suggest that the higher

-p

specific productivity of cells cultured at 22 ºC (instead of standard 27 ºC) results from the adaptation process rather than of selective pressure through an extended culture time.

re

Notably, the element driving such increase in productivity is the adaptation process and not

lP

the temperature shift as the later alone led to lower production yields (Fig. 2, AC-22C vs NC-22C cultures). Adapted cells have a reduced growth rate when compared to non-adapted cells, an evolutionary trade-off common to many adaptation processes (Caspeta & Nielsen,

ur na

2015). These slower growth kinetics are paralleled by a reduction in the specific consumption rates (Supplementary Fig. S2), thus suggesting a more balanced utilization of these sources for product formation by adapted cells. Overall, to our knowledge, this is the

Jo

first time ALE was successfully undertaken in stable insect Sf-9 or High Five cells and, more importantly, has led to significant improvement in recombinant protein expression. In order to enhance recombinant protein production in stable expression systems, substantial effort has been committed to optimizing the bioprocess, the cell line development process and the cell line per se (Fernandes, Teixeira, Carinhas, Carrondo & Alves, 2013; Jostock & Knopf, 2012). Regarding the latter, supplementation of cultures with small molecules as 16

productivity enhancers is a frequently used strategy. In our work, the impact of NaBu and DMSO, either individually or in combination, on growth kinetics and p24 production of insect Sf9-Gag and Hi5-Gag cells was investigated (Fig. 4). In non-adapted cell cultures, supplementation strategies with NaBu and/or DMSO impacted positively on cell performance, with improvements in protein titers similar to those achieved in other cell lines (Hwa Chang et al., 2002; Lamotte et al., 1999; Mimura et al., 2001; Park, Chang, Lee, Lee, & Chung, 2001; Swiech et al., 2008). The opposite occurs in adapted cell cultures, with a

ro of

reduction of up to 4-fold in p24 protein titer and up to 3-fold in specific p24 production rate when cultures are supplemented with NaBu and/or DMSO. These findings suggest that any beneficial impact fostered by the ALE process to insect Sf9-Gag or Hi5-Gag cells was

-p

undermined by the action of NaBu or DMSO. Further studies addressing supplementation of AC-22C with different concentrations of NaBu and DMSO, similarly to what has been made

re

with NC-27C, would provide valuable information on whether this phenomenon is dose

lP

dependent or not. Overall, although non-adapted cell performance could be significantly enhanced upon supplementation with NaBu and DMSO, the p24 protein titers were still modest when compared to those achieved in adapted cells cultured at 22 ºC without

ur na

supplementation. For that reason, the proof-of-concept (PoC) study in stirred-tank bioreactors (STB) was performed with adapted cells cultured at 22 ºC without NaBu and/or DMSO supplementation.

Jo

The production of Gag-VLPs in stable Sf-9 cells was scaled-up from SF to 0.5 L STB. Cell growth and viability profiles (Fig. 5A) are similar between STB and SF. Fold-change in p24 protein titer and specific p24 production rate were estimated (Fig. 5B), and there is no statistically significant difference between the estimated values for STB and SF. Notably, the titers and productivities achieved in STB and SF with adapted, stable Sf9-Gag are within the ranges reported in the literature for insect (e.g. Sf-9, High Five, T.ni) and mammalian cell 17

lines (e.g. CAP-T, HEK293) or yeast (e.g. S. cerevisiae), using both transient (e.g. IC-BEVS, transfection) and stable (e.g. RMCE technology) expression systems (Supplementary Table S1) (Cervera et al., 2015; Cervera, González-Domínguez, Segura, & Gòdia, 2017; Cervera et al., 2013; Fuenmayor, Cervera, Gòdia, & Kamen, 2018; Fuenmayor, Cervera, GutiérrezGranados, & Gòdia, 2018; Gutiérrez-Granados, Cervera, Segura, Wölfel, & Gòdia, 2015; Gutiérrez-Granados et al., 2017; Pillay, Meyers, Williamson, & Rybicki, 2009; Sakuragi, Goto, Sano, & Morikawa, 2002; Tagliamonte et al., 2010). The Gag-VLPs produced in STB

ro of

from AC-22C and NC-27C cultures were comparable, both in size (diameter of 100-250 nm) and morphology (spherical shape) (Fig. 5E and Fig. 5F), thus confirming (i) the null impact of the adaptation process and hypothermic culture conditions on the quality of Gag-VLPs

-p

produced, and (ii) the scalability of the strategy herein proposed (i.e. stable Sf-9 and High

Jo

ur na

lP

re

Five cell lines adapted to hypothermic culture conditions) for production of Gag-VLPs.

18

5. Conclusion This work demonstrates the suitability of ALE as a powerful method for improving yields in stable insect cell lines producing VLPs. Temperature shift and supplementation of cell cultures with productivity enhancers also allowed for an increase expression of VLPs but the yields achieved were modest when compared to those obtained through ALE. Our lowtemperature adapted Sf9-Gag and Hi5-Gag producer cells are expected to perform better than non-adapted cells also when used to produce pseudo-typed Gag-VLPs with different

ro of

target membrane proteins. Dissecting the molecular signatures of the adapted versus nonadapted cell populations will help to understand the determinants of the resulting higher

Jo

ur na

lP

re

-p

productivity phenotypes.

19

Acknowledgments

This work was supported by EU-funded project “EDUFLUVAC” (FP7-HEALTH-2013INNOVATION-1, GA n. 602640) and by the Portuguese “Fundação para a Ciência e a Tecnologia” (FCT) through the following initiatives: “Investigador FCT” Program (IF/01704/2014),

Exploratory

BIO/1541/2013

and

Research

and

Development

IF/01704/2014/CP1229/CT0001),

Projects

and

PhD

(EXPL/BBBfellowships

ro of

(SFRH/BD/90564/2012 and SFRH/BD/138937/2018). The authors wish to thank: Marcos Sousa for the support in bioreaction, Sara Rosa and Ana Sofia Moreira for the support in nanoparticle analysis, Catarina Pinto for the support in qPCR analysis and to Sara Bonucci

-p

and E.M. Tranfield from the Electron Microscopy Facility at Instituto Gulbenkian de Ciência

Jo

ur na

lP

re

for technical support in TEM.

20

References

Bollati-Fogolín, M., Forno, G., Nimtz, M., Conradt, H. S., Etcheverrigaray, M., & Kratje, R. (2008). Temperature Reduction in Cultures of hGM-CSF-expressing CHO Cells: Effect on Productivity

and

Product

Quality.

Biotechnology

Progress,

21(1),

17–21.

https://doi.org/10.1021/bp049825t Caspeta, L., & Nielsen, J. (2015). Thermotolerant Yeast Strains Adapted by Laboratory

ro of

Evolution Show Trade-Off at Ancestral Temperatures and Preadaptation to Other Stresses. mBio, 6(4). https://doi.org/10.1128/mBio.00431-15

Cervera, L., Fuenmayor, J., González-Domínguez, I., Gutiérrez-Granados, S., Segura, M.

-p

M., & Gòdia, F. (2015). Selection and optimization of transfection enhancer additives for

re

increased virus-like particle production in HEK293 suspension cell cultures. Applied Microbiology and Biotechnology, 99(23), 9935–9949. https://doi.org/10.1007/s00253-015-

lP

6842-4

Cervera, L., González-Domínguez, I., Segura, M. M., & Gòdia, F. (2017). Intracellular

ur na

characterization of Gag VLP production by transient transfection of HEK 293 cells: Intracellular Characterization of Gag VLP Production. Biotechnology and Bioengineering, 114(11), 2507–2517. https://doi.org/10.1002/bit.26367

Jo

Cervera, L., Gutiérrez-Granados, S., Martínez, M., Blanco, J., Gòdia, F., & Segura, M. M. (2013). Generation of HIV-1 Gag VLPs by transient transfection of HEK 293 suspension cell cultures using an optimized animal-derived component free medium. Journal of Biotechnology, 166(4), 152–165. https://doi.org/10.1016/j.jbiotec.2013.05.001 Chen, Y., Wu, B., Musier-Forsyth, K., Mansky, L. M., & Mueller, J. D. (2009). Fluorescence Fluctuation Spectroscopy on Viral-Like Particles Reveals Variable Gag 21

Stoichiometry.

Biophysical

Journal,

96(5),

1961–1969.

https://doi.org/10.1016/j.bpj.2008.10.067 Fernandes, F., Dias, M. M., Vidigal, J., Sousa, M. F. Q., Patrone, M., Teixeira, A. P., & Alves, P. M. (2014). Production of rotavirus core-like particles in Sf9 cells using recombinase-mediated cassette exchange. Journal of Biotechnology, 171, 34–38. https://doi.org/10.1016/j.jbiotec.2013.11.020

ro of

Fernandes, F., Teixeira, A. P., Carinhas, N., Carrondo, M. J., & Alves, P. M. (2013). Insect cells as a production platform of complex virus-like particles. Expert Review of Vaccines, 12(2), 225–236. https://doi.org/10.1586/erv.12.153

-p

Fernandes, F., Vidigal, J., Dias, M. M., Prather, K. L. J., Coroadinha, A. S., Teixeira, A. P., & Alves, P. M. (2012). Flipase-mediated cassette exchange in Sf9 insect cells for stable gene Biotechnology

and

109(11),

2836–2844.

lP

https://doi.org/10.1002/bit.24542

Bioengineering,

re

expression.

Fox, S. R., Yap, M. G., & Wang, D. I. (2004). The Effect of Culture Temperature on

ur na

Recombinant IFN-γ Production and Quality.

Fuenmayor, J., Cervera, L., Gòdia, F., & Kamen, A. (2018). Extended gene expression for Gag VLP production achieved at bioreactor scale: Extended gene expression for Gag VLP production at bioreactor scale. Journal of Chemical Technology & Biotechnology.

Jo

https://doi.org/10.1002/jctb.5777

Fuenmayor, J., Cervera, L., Gutiérrez-Granados, S., & Gòdia, F. (2018). Transient gene expression optimization and expression vector comparison to improve HIV-1 VLP production in HEK293 cell lines. Applied Microbiology and Biotechnology, 102(1), 165– 174. https://doi.org/10.1007/s00253-017-8605-x Gutiérrez-Granados, S., Cervera, L., Gòdia, F., Carrillo, J., & Segura, M. M. (2013). 22

Development and validation of a quantitation assay for fluorescently tagged HIV-1 virus-like particles.

Journal

of

Virological

Methods,

193(1),

85–95.

https://doi.org/10.1016/j.jviromet.2013.05.010 Gutiérrez-Granados, S., Cervera, L., Segura, M. de las M., Wölfel, J., & Gòdia, F. (2015). Optimized production of HIV-1 virus-like particles by transient transfection in CAP-T cells. Applied

Microbiology

and

Biotechnology,

100(9),

3935–3947.

ro of

https://doi.org/10.1007/s00253-015-7213-x Gutiérrez-Granados, S., Farràs, Q., Hein, K., Fuenmayor, J., Félez, P., Segura, M., & Gòdia, F. (2017). Production of HIV virus-like particles by transient transfection of CAP-T cells at

https://doi.org/10.1016/j.jbiotec.2017.09.019

-p

bioreactor scale avoiding medium replacement. Journal of Biotechnology, 263, 11–20.

re

Hwa Chang, K., Hwa Park, J., Hyung Lee, Y., Ho Kim, J., Ok Chun, H., Hak Kim, J., & Sik Chung, I. (2002). Dimethylsulfoxide and sodium butyrate enhance the production of

lP

recombinant cyclooxygenase 2 in stably transformed Drosophila melanogaster S2 cells. Biotechnology Letters, 24(16), 1353–1359. https://doi.org/10.1023/A:1019841829667

ur na

Jostock, T., & Knopf, H.-P. (2012). Mammalian Stable Expression of Biotherapeutics. In V. Voynov & J. A. Caravella (Eds.), Therapeutic Proteins (Vol. 899, pp. 227–238). Retrieved from http://link.springer.com/10.1007/978-1-61779-921-1_15

Jo

Kumar, N., Gammell, P., & Clynes, M. (2007). Proliferation control strategies to improve productivity and survival during CHO based production culture: A summary of recent methods employed and the effects of proliferation control in product secreting CHO cell lines. Cytotechnology, 53(1-3), 33–46. https://doi.org/10.1007/s10616-007-9047-6 Lamotte, D., Buckberry, L., Monaco, L., Soria, M., Jenkins, N., Engasser, J. M., & Marc, A. (1999). Na-butyrate increases the production and alpha2,6-sialylation of recombinant 23

interferon-gamma expressed by alpha2,6- sialyltransferase engineered CHO cells. Cytotechnology, 29(1), 55–64. https://doi.org/10.1023/A:1008080432681 Ling, W. L. W., Deng, L., Lepore, J., Cutler, C., Cannon-Carlson, S., Wang, Y., & Voloch, M. (2003). Improvement of Monoclonal Antibody Production in Hybridoma Cells by Dimethyl

Sulfoxide.

Biotechnology

Progress,

19(1),

158–162.

https://doi.org/10.1021/bp020068d

ro of

McCarroll, L., & King, L. A. (1997). Stable insect cell cultures for recombinant protein production. Current Opinion in Biotechnology, 8(5), 590–594.

Merrihew, R. V., Clay, W. C., Condreay, J. P., Witherspoon, S. M., Dallas, W. S., & Kost,

Mammalian

Cells.

Journal

of

Virology,

75(2),

903–909.

re

https://doi.org/10.1128/JVI.75.2.903-909.2001

-p

T. A. (2001). Chromosomal Integration of Transduced Recombinant Baculovirus DNA in

lP

Mimura, Y., Lund, J., Church, S., Dong, S., Li, J., Goodall, M., & Jefferis, R. (2001). Butyrate increases production of human chimeric IgG in CHO-K1 cells whilst maintaining

ur na

function and glycoform profile. Journal of Immunological Methods, 247(1-2), 205–216. Nielsen, J., Villadsen, J., & Lidén, G. (2003). Bioreaction Engineering Principles. Retrieved from http://link.springer.com/10.1007/978-1-4615-0767-3 Park, J. H., Chang, K. H., Lee, J. M., Lee, Y. H., & Chung, I. S. (2001). Optimal production

Jo

and in vitro activity of recombinant endostatin from stably transformed Drosophila melanogaster S2 cells. In Vitro Cellular & Developmental Biology. Animal, 37(1), 5–9. Pillay, S., Meyers, A., Williamson, A.-L., & Rybicki, E. P. (2009). Optimization of chimeric HIV-1 virus-like particle production in a baculovirus-insect cell expression system. Biotechnology Progress, 25(4), 1153–1160. https://doi.org/10.1002/btpr.187

24

Pirt, S. J. (1965). The maintenance energy of bacteria in growing cultures. Proceedings of the Royal Society of London. Series B, Biological Sciences, 163(991), 224–231. Rossi, N., Silva, B. G., Astray, R., Swiech, K., Pereira, C. A., & Suazo, C. A. T. (2012). Effect of hypothermic temperatures on production of rabies virus glycoprotein by recombinant Drosophila melanogaster S2 cells cultured in suspension. Journal of Biotechnology, 161(3), 328–335. https://doi.org/10.1016/j.jbiotec.2012.05.016

ro of

Sakuragi, S., Goto, T., Sano, K., & Morikawa, Y. (2002). HIV type 1 Gag virus-like particle budding from spheroplasts of Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences, 99(12), 7956–7961. https://doi.org/10.1073/pnas.082281199

-p

Schmidt, F. R. (2004). Recombinant expression systems in the pharmaceutical industry. Applied Microbiology and Biotechnology, 65(4), 363–372. https://doi.org/10.1007/s00253-

re

004-1656-9

lP

Steppert, P., Burgstaller, D., Klausberger, M., Berger, E., Aguilar, P. P., Schneider, T. A., … Jungbauer, A. (2016). Purification of HIV-1 gag virus-like particles and separation of other extracellular

particles.

Journal

of

Chromatography

A,

1455,

93–101.

ur na

https://doi.org/10.1016/j.chroma.2016.05.053

Sunley, K., & Butler, M. (2010). Strategies for the enhancement of recombinant protein production from mammalian cells by growth arrest. Biotechnology Advances, 28(3), 385–

Jo

394. https://doi.org/10.1016/j.biotechadv.2010.02.003 Swiech, K., Rossi, N., Astray, R. M., & Suazo, C. A. T. (2008). Enhanced production of recombinant rabies virus glycoprotein (rRVGP) by Drosophila melanogaster S2 cells through

control

of

culture

conditions.

Cytotechnology,

57(1),

67–72.

https://doi.org/10.1007/s10616-008-9134-3 Tagliamonte, M., Visciano, M. L., Tornesello, M. L., De Stradis, A., Buonaguro, F. M., & 25

Buonaguro, L. (2010). Constitutive expression of HIV-VLPs in stably transfected insect cell line

for

efficient

delivery

system.

Vaccine,

28(39),

6417–6424.

https://doi.org/10.1016/j.vaccine.2010.07.054 Tapia, F., Vázquez-Ramírez, D., Genzel, Y., & Reichl, U. (2016). Bioreactors for high cell density and continuous multi-stage cultivations: options for process intensification in cell culture-based viral vaccine production. Applied Microbiology and Biotechnology, 100(5),

ro of

2121–2132. https://doi.org/10.1007/s00253-015-7267-9 van Oers, M. M. (2011). Opportunities and challenges for the baculovirus expression system. Journal of Invertebrate Pathology, 107, S3–S15. https://doi.org/10.1016/j.jip.2011.05.001

-p

Venereo-Sanchez, A., Simoneau, M., Lanthier, S., Chahal, P., Bourget, L., Ansorge, S., … Kamen, A. (2017). Process intensification for high yield production of influenza H1N1 Gag

re

virus-like particles using an inducible HEK-293 stable cell line. Vaccine, 35(33), 4220– 4228. https://doi.org/10.1016/j.vaccine.2017.06.024

lP

Vidigal, J., Fernandes, B., Dias, M. M., Patrone, M., Roldão, A., Carrondo, M. J. T., … Teixeira, A. P. (2017). RMCE-based insect cell platform to produce membrane proteins

ur na

captured on HIV-1 Gag virus-like particles. Applied Microbiology and Biotechnology. https://doi.org/10.1007/s00253-017-8628-3 Wagner, J. M., Pajerowski, J. D., Daniels, C. L., McHugh, P. M., Flynn, J. A., Balliet, J. W.,

Jo

… Subramanian, S. (2014). Enhanced Production of Chikungunya Virus-Like Particles Using a High-pH Adapted Spodoptera frugiperda Insect Cell Line. PLoS ONE, 9(4), e94401. https://doi.org/10.1371/journal.pone.0094401 Willis, S., Davidoff, C., Schilling, J., Wanless, A., Doranz, B. J., & Rucker, J. (2008). Viruslike Particles as Quantitative Probes of Membrane Protein Interactions. Biochemistry, 47(27), 6988–6990. https://doi.org/10.1021/bi800540b 26

Yoon, S. K., Hong, J. K., Choo, S. H., Song, J. Y., Park, H. W., & Lee, G. M. (2006). Adaptation of Chinese hamster ovary cells to low culture temperature: Cell growth and recombinant

protein

production.

Journal

of

Biotechnology,

122(4),

463–472.

Jo

ur na

lP

re

-p

ro of

https://doi.org/10.1016/j.jbiotec.2005.09.010

27

Figure captions

Figure 1. Adaptation profiles of stable Sf9-Gag and Hi5-Gag cell lines to hypothermic culture conditions. Cell growth rate (µ, h-1), p24 protein titer (p24, ng.mL-1) and specific p24 production rate (rp24, ng.cell-1.h-1) of Sf9-Gag (A) and Hi5-Gag (B) cells during the adaptation process. Data in bar graphs are expressed as mean ± standard deviation (relative to three measurements of p24 as assessed by ELISA). Differences were tested by One-Way

ro of

ANOVA with post-hoc Tukey’s multiple comparison analysis method. * = adjusted p-value  <  0.05 was considered statistically significant. The shadow under data points is intended to aid the visualization of cell growth rate variation during the adaptation process.

-p

Figure 2. Impact of adaptation process on growth kinetics and p24 protein expression of Sf9-Gag(A) and Hi5-Gag (B) cells. Scatter graphs with trend lines show total cell

re

concentration (cell.ml-1) and cell viability (%) at different time points during culture. Bar

1

lP

graphs show p24 protein titer (p24, ng.mL-1) and specific p24 production rate (rp24, ng.cell.h-1). Black symbols/bars correspond to non-adapted cells cultured at 27ºC (NC-27C). Dark

grey symbols/bars correspond to non-adapted cells cultured at 22ºC (NC-22C). Light grey

ur na

symbols/bars correspond to adapted cells cultured at 22ºC (AC-22C). Data in bar graphs are expressed as mean ± standard deviation (relative to three biological replicates, n=3). Differences were tested by One-Way ANOVA with post-hoc Tukey’s multiple comparison

Jo

analysis method. * = adjusted p-value  <  0.05 was considered statistically significant. Figure 3. Hierarchical clustering analysis and heatmap of insect cell cultures performed under multiple combinations of productivity enhancers (NaBu or DMSO) and cell concentrations (Xv) based on p24 protein expression (p24, ng.mL-1) and cell growth kinetics (IVCC - integral of viable cell concentration, 106 cell.mL-1.h). Upper panel (A) reports to results obtained with DMSO (0.5 and 1 % v/v) whereas the lower panel (B) reports to results 28

obtained with NaBu (0.75, 1, 5 and 10 mM). The cell concentrations evaluated were 2x10 6 cell.ml-1 and 5x106 cell.ml-1. Non-adapted Hi5-Gag cells cultured at 27ºC without addition of productivity enhancers is the control culture. Heatmap score bar at bottom shows standardized deviation from control culture color-coded from low (white) to high (black). The target score is 1 for p24 (maximizing p24 protein expression when compared to control culture) and 0 for IVCC (minimizing the impact of NaBu or DMSO on cell growth kinetics). Data in bar graphs are expressed as mean ± standard deviation (relative to three

ro of

measurements of p24 as assessed by ELISA), and represent the fold-change in p24 and IVCC between cultures of non-adapted Sf9-Gag cells cultured at 27ºC with addition of productivity enhancers (1 % v/v DMSO or 1 mM NaBu) and control culture.

-p

Figure 4. Effect of productivity enhancers on cell growth and p24 protein production of Sf9Gag and Hi5-Gag cells. Sodium butyrate (NaBu, 1 mM) and dimethyl sulfoxide (DMSO, 1

re

% v/v) were explored as potential enhancers. p24 protein titer (p24, ng.mL-1) and specific

lP

p24 production rate (rp24, ng.cell-1.h-1) were estimated; data is expressed as mean ± standard deviation (relative to three biological replicates, n=3). The deviation from control culture (non-adapted cells cultured at 27ºC) was scored from 0-1, in which a score of 1 symbolizes

ur na

the maximum p24 or rp24 (black background) and a score of 0 the minimum p24 or rp24 (white background).

Jo

Figure 5. Production of Gag-VLPs in 0.5 L stirred-tank bioreactor (STB). Sf9-Gag cells were cultured in STB and shake-flasks (SF), and their performance in terms of cell growth kinetics and p24 protein production compared. Non-adapted cells cultured at 27ºC (NC-27C) and adapted cells cultured at 22º C (AC-22C). (A, left panel) linear regression of total cell concentration (XT, cell.ml-1) from STB on SF, with ensuing Pearson’s correlation (r) and regression coefficient (b); (A, right panel) box-plot diagrams showing the degree of 29

dispersion and skewness in the cell viability (%) values obtained for cultures performed in STB and SF, in which horizontal lines are medians, boxes represent the interquartile range, and error bars show the full range of values; AC-22C and NC-27C cultures are represented in grey and black symbols/bars/lines/letters, respectively. (B) fold change in p24 protein titer and specific p24 production rate between AC-22C and NC-27C cultures; data expressed as mean ± standard deviation (relative to three measurements of p24 as assessed by ELISA). (C, left panel) relative fold change of Gag gene expression using housekeeping genes 18S

ro of

rRNA for Sf9-Gag cells in AC-22C and NC-27C cultures performed in STB; (C, right panel) intracellular p24 protein content (µg) in AC-22C and NC-27C cultures performed in STB, in which values represent means ± standard deviation (relative to three measurements of p24 as

-p

assessed by ELISA). (D) histogram showing the normalized frequency distribution of particles (binned by 50 nm intervals from 0 to +500 nm) in concentrated Gag-VLP samples

re

from AC-22C (grey bars) and NC-27C (black bars) cultures performed in STB; the

lP

percentage of particles in group size 100-250 nm is highlighted in light grey and represented by Σ. (E) negative staining transmission electron microscopy of concentrated Gag-VLP

Jo

ur na

samples from AC-22C and NC-27C cultures performed in STB; scale bar represents 100 nm.

30

ro of

-p

re

lP

ur na

Jo Fig 1

31

ro of

-p

re

lP

ur na

Jo Fig 2

32

ro of

-p

re

lP

ur na

Jo Fig 3

33

ro of

-p

re

lP

ur na

Jo Fig 4

34

ro of

-p

re

lP

ur na

Jo Fig 5

35

Table captions

Table 1. Impact of NaBu and/or DMSO on Sf9-Gag and Hi5-Gag cells (non-adapted and adapted) during growth and p24 protein production. Footnote: Cultures were performed as described in Materials and Methods. The standard deviation of three independent biological replicates is shown (n=3). Viable Culture

Productivity

cell

Integral of viable

temperature enhancers

ro of

concentration

cell concentration

TOH

DMSO NaBu

IVCC

(%, v/v) (mM)

(106 cell.mL-1.h)

Cell line

-

-

1

-

adapted

27 -

1

lP

cells

± 48

13

±1

527

± 19

11.3

± 0.2

359

± 31

9.2

± 0.3

1

1

511

± 20

13

±2

-

-

1474

± 21

15

±2

1

-

1308

± 21

11.2

± 0.3

-

1

989

± 82

8.9

± 0.4

1

1

581

± 10

4.2

± 0.6

-

-

541

± 15

6.7

± 0.2

1

-

459

±7

5.4

± 0.2

-

1

439

± 11

4.7

± 0.1

1

1

326

± 15

4.2

± 0.7

-

-

485

± 11

4.6

± 0.2

ur na

Adapted

(106 cell.mL-1)

866

re

Non-

XvTOH

-p

oC

22

Jo

cells

Non-

adapted

27

cells

Adapted

22

36

at

1

-

376

±5

3.2

± 0.1

-

1

481

± 37

3.3

± 0.5

1

1

333

±5

2.8

± 0.01

Jo

ur na

lP

re

-p

ro of

cells

37