- Email: [email protected]
Adiponectin is required for pioglitazone-induced improvements in hepatic steatosis in mice fed a high-fat diet
Molecular and Cellular Endocrinology 493 (2019) 110480
Contents lists available at ScienceDirect
Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce
Adiponectin is required for pioglitazone-induced improvements in hepatic steatosis in mice fed a high-fat diet
T
Mariana de Mendonça1, Bruna de Araújo Cardoso dos Santos1, Érica de Sousa, Alice Cristina Rodrigues∗ Institute of Biomedical Sciences, Department of Pharmacology, University of Sao Paulo, Sao Paulo, SP, Brazil
A R T I C LE I N FO
A B S T R A C T
Keywords: MicroRNA Adiponectin Obesity Insulin resistance Pioglitazone NAFLD
Pioglitazone has been used for the treatment of nonalcoholic fatty liver disease (NAFLD) related to diabetes. The role of adiponectin in pioglitazone-induced improvements in NAFLD was studied by using wild-type (adipoWT) and adiponectin knockout (adipoKO) mice. High-fat diet fed mice were insulin resistant, glucose intolerant and had increased hepatic lipid accumulation as evidenced by increased NAFLD activity score. Despite pioglitazone has improved insulin resistance in both genotypes, hepatic steatosis was only improved in adipoWT obese mice. Amelioration of NAFLD in adipoWT mice promoted by pioglitazone was associated with up-regulation of Pparg, Fgf21 and down-regulation of Pepck liver expression. On the other hand, resistance to pioglitazone treatment in adipoKO mice was associated with increased expression of miR-192 and Hsl, which was not followed by increased fatty acid oxidation. In conclusion, our data provides evidence that increased adiponectin production by pioglitazone is necessary for its beneficial action on NAFLD.
1. Introduction Adiponectin (adipoQ), which was firstly identified by four independent groups approximately 20 years ago (Hu et al., 1996; Maeda et al., 1996; Nakano et al., 1996; Scherer et al., 1995), it is produced by adipocytes and found in plasma in both cleaved and integrate forms (for review, refer to 5)(Kadowaki and Yamauchi, 2005). There are three known adipoQ receptors: adipoR1 and adipoR2, both coupled to APPL1 protein (Cheng et al., 2007; Mao et al., 2006), and T-cadherin (Hug et al., 2004). The adipoR1 receptor is mainly expressed in the skeletal muscle and liver and has greater affinity to the cleaved form of adipoQ. The adipoR2 receptor, in its turn, is mainly expressed in the liver and has affinity to both forms of adipoQ (Yamauchi et al., 2003). The sinalization after these receptors activates AMPK, increasing glucose uptake and fatty acid oxidation (Yamauchi et al., 2002). Knockout of adipoR1 (Iwabu et al., 2010) or both adipoR1 and adipoR2 (Yamauchi et al., 2007) leads to insulin resistance and glucose intolerance. In the skeletal muscle, adipoQ sinalization also controls CPT1b (Li et al., 2007), whose activity is the limitant step for fatty acid oxidation, and PGC1alpha (Iwabu et al., 2010; Yamauchi et al., 2007), which regulates mitochondrial biogenesis and fatty acid oxidation (Finck and Kelly,
2006). In the liver, adipoR2 activity induces PPAR alpha expression, increasing the transcription of its targets like Acox1 and UCP2 (Yamauchi et al., 2007). Pioglitazone, a PPAR alpha and PPAR gamma agonist, is an insulin sensitizer used to treat diabetes type 2 that belongs to thiazolidinediones (TZDs) class. A well-known effect of pioglitazone is to increase plasmatic levels of adipoQ in both human and mice (Pereira et al., 2008; Phillips et al., 2003). Non-alcoholic steatohepatitis patients under treatment with pioglitazone had increased adiponectin plasma levels which was associated with improved liver histology and reversed hepatic insulin resistance, evidencing a role of adiponectin in pioglitazone beneficial effects (Gastaldelli et al., 2010). In rodents, pioglitazone was ineffective to prevent methionine and choline deficient diet-induced steatohepatitis in female adiponectin KO mice (Da Silva Morais et al., 2009) and pioglitazone increases skeletal muscle insulin sensitivity in a dose-dependent manner but not hepatic insulin sensitivity in adiponectin and leptin KO mice (Kubota et al., 2006). Despite the fact that there is some evidence that adiponectin seems not to be required for pioglitazone improvement of skeletal muscle insulin sensitivity but may be necessary for the liver, the molecular mechanisms involved are not fully understood. In addition, no other study has investigated the role of
∗
Corresponding author. Laboratory of Pharmacogenomics, Department of Pharmacology, Institute of Biomedical Sciences, University of Sao Paulo, Sao Paulo, SP, CEP 05508-900, Brazil. E-mail address: [email protected] (A.C. Rodrigues). 1 Mariana de Mendonça and Bruna de Araújo Cardoso dos Santos contributed equally to this work. https://doi.org/10.1016/j.mce.2019.110480 Received 20 March 2019; Received in revised form 23 April 2019; Accepted 5 June 2019 Available online 06 June 2019 0303-7207/ © 2019 Elsevier B.V. All rights reserved.
Molecular and Cellular Endocrinology 493 (2019) 110480
M. de Mendonça, et al.
epididymal and interscapular brown adipose tissue depots were dissected and weighed to evaluate adiposity level. The number of individual experiments was representative of at least two litters. The total number of animals used in each experiment is indicated in the figure legends.
adiponectin in high-fat diet-induced NAFLD, which display NAFLD features more similar to humans than MCD diet (Santhekadur et al., 2018). MicroRNAs (miRNAs) are short non coding RNA (19-22 nucleotides) (Ambros, 2004) that regulate target messenger RNA stability and translational rate interacting through Watson-Crick pairing (Bartel, 2004). TZDs drugs have been shown to modulate the expression of miRNAs in human subcutaneous and visceral adipocytes and, among the miRNAs regulated, miR-378 was associated with differential effects of TZDs on the two fat depot accumulation (Yu et al., 2014). Considering the liver and skeletal muscle, there is a lack of studies that investigated the relationship between pioglitazone effects and miRNA expression, although microRNAs play a role in insulin resistance and NAFLD. The levels of a panel of circulating microRNAs (miR-34a, miR-122, miR-192 and miR-200b) have been shown to significantly correlate with a severity of NAFLD-specific liver pathomorphological features, with the strongest correlation occurring with miR34a (Tryndyak et al., 2012). In addition, we analyzed the expression of miR-23b and miR-222 that have been associated with hepatic steatosis in HFD animals (Borji et al., 2019) and with insulin resistance (unpublished data). The molecular mechanisms by which pioglitazone improves insulin sensitivity and ameliorates NAFLD are not fully elucidated. As adiponectin seems to mediate some of the beneficial effects of pioglitazone we used adiponectin KO mice, first to evaluate in a model of high-fat diet-induced NAFLD if adiponectin is required for pioglitazone effects and second to study the molecular pathway involved in pioglitazone benefits in skeletal muscle. In addition we hypothesized that those microRNAs described above would be dysregulated in HFD fed mice and pioglitazone treatment of WT but not KO mice would normalize their expression.
2.3. Glucose tolerance test (GTT), insulin tolerance test (ITT), and serum metabolite measurements All groups were fasted for 6 h (from 8a.m.–2 p.m.). GTT and ITT tests were performed as previously described (Frias et al., 2018). Insulin and adiponectin levels were measured by ELISA using Rat/Mouse Insulin ELISA kit (EMD Millipore, Billerica, MA, USA. Total Cholesterol (K083-2), LDL (K088), HDL (K015), and TG (K117-1) concentrations were determined using specific kits (Bioclin, Belo Horizonte, BH, Brazil). 2.4. Histological analysis and NAFLD activity score Liver sections were stained with HE for histological analysis. For each liver, ten random fields of HE stained were photographed at 40× magnification were captured using a Nikon DM×1200 digital camera. Liver histology for KO and WT animals was evaluated and scored blinded by two independent observers (BACS, LAFR) using a non-alcoholic fatty liver disease scoring system for rodents (Liang et al., 2014). 2.5. microRNA and mRNA expression by real-time PCR Total RNA was extracted from liver and soleus adipose tissue using TRIzol (Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer's instructions. Total RNA concentration and purity were measured with NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). The relative quantification of miRNAs miR-23b and miR-222 was done by stem-loop RT-qPCR as described in Chen et al. (2005) and of miRs miR-34a-5p, miR-122-5p, miR-192-5p and miR-200b-3p was done by real-time qPCR using the miRCURY LNA ™ microRNA system (Exiqon) as described by the manufacturer. The primers required for each miRNA were purchased from Exiqon or Thermo Scientific. For the quantification of gene expression the relative quantification method was used, using the average Ct of SNORD110, U6 and miR-130b as reference, using the 2-ΔΔCT method (Livak and Schmittgen, 2001). For mRNA expression, cDNA was synthetized from 500 ng of total RNA using High Capacity cDNA Reverse Transcription Kit (Thermo Scientific). All PCR reactions was then performed using diluted (1/10) cDNA template, forward and reverse primers (200 nM each) and Power SYBR Green PCRMaster Mix (Thermo-Fisher). For mRNA expression, genes analyzed included were: adiponectin receptor 2 (Adipor2), carnitine palmitoyltransferase 1a, liver (Cpt1a), fatty acid synthase (Fasn), fibroblast growth factor 21 (Fgf21), glucose-6-phosphatase, catalytic (G6pc) insulin receptor substrate 1 (Irs1), lipase hormone sensitive (Lipe), patatin-like phospholipase domain containing 2 (Pnlpa2 or Atgl), phosphoenolpyruvate carboxykinase 1, cytosolic (Pck1 or Pepck), peroxisome proliferator-activated receptor (PPAR)-alpha (Ppara), PPAR gamma (Pparg), Peroxisome proliferative activated receptor, gamma, coactivator 1 alpha (Ppargc1a), stearoyl-Coenzyme A desaturase 1 (Scd1), uncoupling protein 2 (Ucp2). Primer sequences for Pparα, Lipe, Atgl, Srebp1, Fasn, Scd1, Irs1 and Ppargc1α were previously described (Frias et al., 2018) and for the others the sequences were: Adipor2 FW: AGGCTGGCTAATGCTTATGG and RV: GATGTGGAAGAGCTGATGA GAG; Cpt1a FW: GGCCACAAATTATGTGAGTGA and RV: GAGCATCT CCATGGCGTAGT; Fgf21- FW: CTGCTGGGGGTCTACCAAG and RV: CTGCGCCTACCACTGTTCC; G6PC - FW: CGTATGGATTCCGGTGTTTG and RV: GGGAAAGTGAGCAGCAAGGT; Pparg FW: CAAACCTGATGGC ATTGTGAG and RV: ATCTTAACTGCCGGATCCAC; Pepck -FW: ATGCT
2. Material and methods 2.1. Animals Adiponectin knockout mice (B6; 129-Adipoqtm1Chan/J) were obtained from the Jackson Laboratory (Bar Harbor, ME) on a C57BL/6J background and were maintained at 12:12-h light–dark cycle and 23 °C ± 2 °C. The animals were housed in cage (2-3 animals/cage) and received standard diet (Nuvilab-Nuvital Nutrients Ltd., Parana, Brazil) and water ad libitum until to the beginning of the experimental period. The Experimental Animal Ethics Committees of the Institute of Biomedical Sciences (ICB), University of Sao Paulo (USP), approved the experimental procedure of this study (Protocols Numbers: 165/2011 and 137/2015). 2.2. Experimental design Both adiponectin knockout (adipoKO) and its background (adipoWT) with 8 weeks of age were randomly divided into two groups (n = 10 per group): control diet (C) (9% fat, 15% protein and 76% carbohydrate) and high-fat diet (H) (59% fat, 15% protein and 26% carbohydrate, as a percentage of total kcal) (Frias Fde et al., 2016). Both diets were prepared according to the American Institute of Nutrition - AIN (Reeves, 1997). After 6 weeks of diet, pioglitazone (EMS®), was mixed in the diet (35 mg/kg of b.w./day), and part of the animals of groups H was treated for the last 2 weeks of the protocol, creating a new group: high-fat diet plus pioglitazone (HP). Body weight was measured every week and food intake every 3 days. By the end of 8 weeks, animals were euthanized (between 1 and 3 pm) by decapitation, serum was collected, centrifuged and stored at −80 °C. For total RNA and protein extraction, soleus muscle and liver were harvested, frozen in liquid nitrogen and stored at −80 °C. For histochemical analysis livers samples were fixed in 4%formaldehyde and after 48 processed with hematoxylin and eosin (HE) staining. Retroperitoneal, mesenteric, 2
Molecular and Cellular Endocrinology 493 (2019) 110480
M. de Mendonça, et al.
hyperphagic behavior when compared to H group (Table 1). Despite ameliorating insulin sensitivity as indicated by an increase in KITT of both adipoKO and adipoWT fed a HFD, pioglitazone treatment increased lipid accumulation as suggested by increased fat depots (Table 1), a well-established pioglitazone side effect in humans (Miyazaki et al., 2002) and rodents (Hallakou et al., 1997). Interestingly, for epididymal fat pad, adipoKO mice fed a HFD gained less fat compared to adipoWT in the same diet, and pioglitazone promoted a 1.7-fold increase in this fat pad (Table 1). Moreover, pioglitazone treatment lowered fasting plasma insulin in HFD-fed mice of both genotypes, although no significant difference was observed in GTT glycemic curve (Fig. 1A). In adipoWT mice, pioglitazone increased serum adiponectin compared to control and obese animals (Table 1). As expected, adiponectin was not detected in adipoKO mice.
GATCCTGGGCATAAC and RV: GTCTTCCCACAGGCACTAGG; Ucp2FW: CTGCGGTCCGGACACAATA and RV:CCCGATCCCCTCGATTTTC. RT-qPCR was performed using ABI Prism 7500 equipment (Thermo Fisher Scientific). For the quantification of gene expression the relative quantification method was used, using constitutive genes 36b4 and Hprt1 (soleus muscle) or 36b4 and Rpl19 (liver) as reference using the 2ΔΔCT method (Livak and Schmittgen, 2001). 2.6. Western blot analysis Protein from soleus muscle was homogenized in cell disruption buffer from miRvana PARIS kit (Thermo Fisher Scientific, Waltham, MA, USA) and concentration was determined by the Bradford method. Thirty micrograms of protein was boiled, fractionated in 10% SDSPAGE and transferred onto a nitrocellulose membrane. Membranes were blocked in 5% non-fat milk diluted in TBS-Tween for 1 h at room temperature. Membranes were incubated overnight at 4 °C with primary antibodies (p-Ampkalpha [Thr172), Cell Signaling #2535; Sirt1, Santa Cruz biotechnology). Detection was performed by C-Digit Imager (LI-COR, Lincoln, NE, USA) after incubation with peroxidase-conjugated secondary antibodies for 2 h at room temperature, and “ClarityTM Western ECL Substrate” detection system (Bio-Rad, Hercules, CA, EUA). Signals were quantified using NIH ImageJ 1.63 Software and protein expression was normalized with total protein content stained with amido black for soleus muscle (Fortes et al., 2016).
3.2. Pioglitazone insulin sensitizer effect in adipoKO mice fed a HFD is associated with stimulation of Adipor2 pathway in skeletal muscle It has been shown pioglitazone-induced amelioration of insulin resistance and diabetes is mediated via adiponectin-independent pathway in skeletal muscle (Kubota et al., 2006). However, the underlying mechanisms are not clear. We investigated in soleus muscle of adipoWT and adipoKO the mechanism by which pioglitazone could restore insulin sensitivity in HFD-fed mice. Pioglitazone insulin-sensitizer effect in adipoKO mice was associated with stimulation of Adipor2 pathway, suggested by up-regulation of Adipor2 mRNA (Fig. 1B), increased phospho-AMPK (Thr172) and Sirt1 (Fig. 1C) and up-regulation of Ppargc1a, and consequently Ppara in soleus muscle (Fig. 1B). Glut4 mRNA was not regulated; suggesting increased fatty acid oxidation is associated with insulin sensitivity improvement. As pioglitazone induced adiponectin receptor Adipor2 signaling in the absence of its ligand, we postulated if some microRNAs could be involved in stimulation of Adipor2. We measured let7b-5p that was predicted to bind to Adipor2 3′UTR and has been shown to improve insulin sensitivity in skeletal muscle (Frost and Olson, 2011) and miR150-5p that targets Adipor2 (J. Li and Zhang, 2016). Interestingly miR150-5p was dramatically reduced in soleus muscle of adipoKO mice fed a HFD after treatment with pioglitazone (adipoKO-HP) when compared to adipoKO mice fed a HFD (adipoKO-H) (Fig. 1C), suggesting it controls Adipor2 mRNA, as it was 2-fold increased when compared to adipoKO-H or to adipoWT-HP (Fig. 1B). Let-7b-5p expression was not different between HP and H group in both genotypes (Fig. 1D).
2.7. Statistical analysis Interaction between diet and genotype was tested by two-way analysis variance (ANOVA) and Tukey post-test was performed for comparisons between groups. When there was no interaction (DxG), the effect of diet (D) or genotype (G), showed in the boxes above the graphs, were also analyzed. Pearson's correlation was used to measure the strength between microRNAs or mRNA expression and NAFLD activity score. A p-value < 0.05 was considered significant. 3. Results 3.1. Obesity features and metabolic parameters In adipoKO and adipoWT mice initial body weight was not different among the groups, however, after 8 weeks of high-fat diet (HFD), mice from both genotypes had increased body weight when compared to mice fed a control diet. Even though HFD-fed animals had a reduced food intake and only in adipoWT mice pioglitazone induced a
Table 1 Obesity features and metabolic parameters from adipoKO (KO) and adipoWT (WT) mice fed with control (C) or high-fat diet (H) and treated with pioglitazone (HP).
Initial BW (g) Final BW (g) BW gain (g) Food intake (calories/animal) Epididymal fat pad (g) Mesenteric fat pad (g) Retroperitoneal fat pad (g) Brown fat pad (g) Gastrocnemius weight (g) Liver weight (g) Adiponectin (μg/mL) KITT (%glucose/min) AUC (mg/mL.min−1)
C WT
C KO
H WT
H KO
HP WT
HP KO
P*
Diet
Genotype
23.2 ± 1.7 31.0 ± 2.8 7.8 ± 1.3 17.0 ± 1.2 1.1 ± 0.3 0.57 ± 0.12 0.30 ± 0.07 0.10 ± 0.05 0.14 ± 0.02 1.2 ± 0.1 12.1 ± 4.6 6.3 ± 2.1 950 ± 209
21.0 ± 0.8 27.5 ± 1.3 6.5 ± 1.3 17.2 ± 1.0 0.80 ± 0.2 0.45 ± 0.15 0.23 ± 0.08 0.07 ± 0.01 0.13 ± 0.01 1.0 ± 0.0 N/D 6.6 ± 0.7 1125 ± 109
24.2 ± 1.7 37.2 ± 4.0 13.0 ± 3.3 12.3 ± 2.8a 2.4 ± 0.7a 0.93 ± 0.25 0.57 ± 0.11* 0.12 ± 0.04 0.16 ± 0.02 1.3 ± 0.3 11.3 ± 1.8 2.7 ± 0.8* 1325 ± 184
21.7 ± 1.50 30 ± 2.37 8.33 ± 3.27 11.9 ± 1.4b 1.2 ± 0.3c 0.52 ± 0.24 0.43 ± 0.11* 0.05 ± 0.02 0.14 ± 0.01 0.8 ± 0.3 N/D 4.4 ± 1.9* 1620 ± 434*
25.5 ± 1.6 37.8 ± 3.5 12.8 ± 2.7* 14.5 ± 1.0c 2.2 ± 0.6a 0.77 ± 0.21* 0.57 ± 0.15* 0.16 ± 0.08*# 0.16 ± 0.01 1.2 ± 0.2 37.5 ± 6.7*# 4.8 ± 1.7# 1231 ± 80
21.9 ± 1.5 34.4 ± 3.0 12.6 ± 3.7* 11.7 ± 1.7b 2.0 ± 0.5bd 0.79 ± 0.303* 0.57 ± 0.07* 0.16 ± 0.05*# 0.14 ± 0.01 1.0 ± 0.1 N/D 6.7 ± 1.1# 1347 ± 365
> 0.05 > 0.05 > 0.05 < 0.05 < 0.05 > 0.05 > 0.05 > 0.05 > 0.05 > 0.05 – > 0.05 > 0.05
> 0.05 < 0.05 < 0.05 < 0.05 < 0.05 < 0.05 > 0.05 > 0.05 < 0.05 < 0.05 < 0.05
< 0.05 < 0.05 > 0.05 – – > 0.05 > 0.05 > 0.05 < 0.05 < 0.05 > 0.05 > 0.05
Values are presented as mean ± SD (n = 5–7/group). BW: body weight; AUC GTT, area under curve of glucose tolerance test; Kitt, constant for glycemia decay obtained from insulin tolerance test. In bold, statistically significant values. *p-value for interaction as indicated by two-way ANOVA. a,b,c,d p < 0.05 as indicated by Tukey's post-test vs C–WTa; vs C-KOb; vs: WT-Hc; vs:H-KOd. When interaction was not significant, the effect of one effect (diet or genotype) was considered and pvalue < 0.05 are indicated as *#; vs C diet or WT genotype* and vs H diet#. 3
Molecular and Cellular Endocrinology 493 (2019) 110480
M. de Mendonça, et al.
Fig. 1. Adiponectin is not necessary for pioglitazone improvements in insulin resistance. AdipoWT and adipoKO mice were fed a control (C) or a high-fat diet (H) for 8 weeks and treated with pioglitazone (HP) and insulin and glucose tolerance tests (A) were performed. Soleus muscles were collected after euthanasia and processed for total RNA and protein extraction. mRNA (B) and microRNA (D) expression were measured by RT-qPCR and pAmpk and Sirt1 expression were quantified by western blot. Statistical analysis was performed by two-way ANOVA. When interaction was significant, Tukey posttest was performed. *#&p < 0.05 compared to C within the group (*), H within the group (#), and HP adipowt (&). When there was no interaction diet (d) or genotype (g) effect were analyzed separately. ap < 0.05 compared to control, as indicated by Tukey's posttest only considering the diet.
when compared to HFD-fed mice but not in adipoKO (Fig. 3A). Fgf21 levels in the liver of adipoWT were positively correlated with Irs-1 levels (Fig. 3B). HFD-fed adipoWT mice showed a significant increase in Lipe expression compared to control mice, and pioglitazone did not reverse this effect. In adipoKO mice pioglitazone treatment promoted an up-regulation of Lipe expression (Fig. 3A). Pepck levels were decreased by pioglitazone treatment only in adipoWT animals consistent with a reduced gluconeogenesis. Considering only genotype effect, Fasn expression was increased in adipoKO mice, suggesting these mice have increased de novo lipogenesis (Fig. 3A). With respect to diet effet, Adipor2, Ucp2 and Scd1 mRNAs were higher expressed in HFD-fed mice treated with pioglitazone compared to control or HFD groups (Fig. 3A). Altogether these data suggest pioglitazone reduces lipid accumulation by increasing lipolysis and fatty acid oxidation as a result of Fgf21 stimulation. In the absence of adiponectin the effect of pioglitazone in liver steatosis is abrogated probably by absence of Fgf21 stimulation.
3.3. Pioglitazone does not reverse hepatic steatosis in adipoKO mice fed a HFD Mice fed a HFD had increased ectopic triglycerides (TG) accumulation as indicated by TG hepatic content (Fig. 2A) and non-alcoholic fatty liver disease (NAFLD) activity score (Fig. 2C), calculated after histopathological analysis (Fig. 2B). Pioglitazone treatment reduced hepatic TG content in adipoWT mice but not on adipoKO (Fig. 2A). Accordingly, pioglitazone reversed liver steatosis in 67% of adipoWT mice, however in adipoKO mice up to 14% of mice responded to the treatment (Fig. 2C). Among WT mice the lack of response was associated with a residual macrovesicular steatosis (Fig. 2C). On the other hand, in adipoKO mice, the lack of response was associated mainly with pioglitazone-induced hepatocellular hypertrophy in 43% of the animals (Fig. 2C). 3.4. Pioglitazone effect on glucose and lipid metabolism gene expression in liver of AdipoKO mice fed a HFD
3.5. Pioglitazone increases miR-192 in the liver of adipoKO mice fed a HFD We evaluated in adipoWT and adipoKO mice some genes related to lipid and glucose metabolism to understand the mechanism by which adiponectin ameliorates hepatic steatosis and insulin resistance. Interaction between genotype and pioglitazone treatment was found in mRNA expression of PParg, Fgf21, Lipe and Pepck. Pioglitazone induced a significant increase of Pparg and Fgf21 expression in adipoWT mice
We analyzed the expression of miR-34a, miR-122, miR-192, miR200b, miR-23b and miR-222 because they have been associated with development of NAFLD, and many of their targets are lipid metabolism genes. Considering the interaction between pioglitazone treatment and 4
Molecular and Cellular Endocrinology 493 (2019) 110480
M. de Mendonça, et al.
Fig. 2. Pioglitazone does not improve hepatic steatosis in adiponectin knockout mice. AdipoWT and adipoKO mice were fed a control (C) or a high-fat diet (H) for 8 weeks and treated with pioglitazone (HP). After euthanasia the livers were collected and triglycerides (TG) content (A) were quantified after lipid extraction and liver samples were subjected to histological analysis (B), which were used to measure NAFLD activity score (C). *#p < 0.05 as indicated by two-way ANOVA followed by Tukey's posttest: C vs H (*); H vs HP (#).
this, adiponectin is an important mediator of TZD improvements in glucose tolerance (Nawrocki et al., 2006) and hepatic insulin resistance (Kubota et al., 2006). Corroborating with these findings, our data provided herein bring new evidence for the role of adiponectin in pioglitazone-induced improvements in liver steatosis associated with obesity, supporting those findings in humans described before. The preventive effect of pioglitazone has been also reported in a model of methionine-choline deficient diet (MCD)-induced steatohepatitis, a mechanism dependent on adiponectin up regulation but that does not involve AMPK or PPAR alpha activation (Da Silva Morais et al., 2009). NAFLD in the presence of obesity is approximately 80–90%, and insulin resistance is one of the triggers for NAFLD (Santhekadur et al., 2018; Younossi et al., 2018). In this context, HFD-induced fatty liver is a model that is more similar to the physiopathological mechanism of NAFLD in humans than MCD (Santhekadur et al., 2018). Pioglitazone treatment improves hepatic steatosis by a mechanism that seems to involve up-regulation of Fgf21 in the liver as the upregulation of Fgf21 was only observed in pioglitazone-treated adipoWT mice. Corroborating with our findings, the antagonizing effects of Fgf21 against high fat diet-induced hepatic insulin resistance, steatosis, and liver injury were completely abolished in adiponectin KO mice (Z. Lin et al., 2013). As well as this, pioglitazone has been shown in vitro to increase FgF21 levels, an effect associated to PPARg rather than PParalpha (Oishi and Tomita, 2011). Interestingly, loss of Fgf21 reduces Pparg transcriptional activity. In addition, the PPARγ stimulant, rosiglitazone has side effects, including insulin sensitization, weight gain and edema; however, such side effects do not occur in mice with FGF21 knockout (Dutchak et al., 2012). Thus, in white adipose tissue Fgf21 is a key mediator of physiological and pharmacological actions of Pparg (Dutchak et al., 2012). These observations may explain the fact that pioglitazone in adipoKO mice does not stimulate Pparg expression and also the fact that adipoKO mice under high-fat diet gain less weight than adipoWT mice. MicroRNAs have been proposed both as biomarkers of NAFLD or as targets for NAFLD therapy. Induction of miR-34a, miR-181a, miR-200b
mice genotype, miR-192 expression was increased by 3-fold in liver of adipoKO mice treated with pioglitazone, but not in adipoWT animals (Fig. 4A). Increased expression of miR-192 in adipoKO mice was positively correlated with NAFLD activity score (r = 0.63; p = 0.01) and Lipe mRNA expression (r = 0.68; p = 0.02) and negatively correlated with Fgf21 mRNA expression (r = −0.73, p = 0.01) (Fig. 4C). Considering only the effect of the genotype, liver miR-23b expression was decreased in adipoKO mice compared to adipoWT, although its hepatic expression was increased by pioglitazone treatment in both adipoWT and adipoKO mice (Fig. 4A). In adipoWT mice miR-23b levels were negatively correlated with NAFLD activity score (r = −0.63; p = 0.01) and Lipe expression (r = −0.66; p = 0.01) (Fig. 4B). MiR-34a and miR-200b liver expression were positively correlated (r = 0.84, p = 0.08) and were also positively correlated with Hsl levels (r = 0.72, p = 0.0002). Pioglitazone treatment up-regulated miR-34a and miR-200b independent of the mice genotype (Fig. 4A). miR-222 was up-regulated by pioglitazone independent of the mice genotype when compared to control mice (Fig. 4A). 4. Discussion In the present study, we report that pioglitazone is ineffective to treat liver steatosis induced by HFD in adiponectin-deficient mice and this mechanism in independent of improvements in insulin resistance. In addition we have shown pioglitazone increases hepatic Fgf21 and its expression correlates with Irs1 levels, an effect abrogated in adipoKO mice, indicating a biological significance of Fgf21-adiponectin axis in pioglitazone effects in the liver. Interestingly, in the absence of adiponectin pioglitazone induces miR-192, and miR-192 levels were correlated with NAFLD activity score. In human randomized controlled trials, pioglitazone improves liver histologic scores and insulin resistance in patients with non-alcoholic steatohepatitis (NASH) but not fibrosis (Said and Akhter, 2017). Increase in plasma adiponectin concentration induced by pioglitazone is significantly correlated with histological improvement and hepatic insulin sensitivity in NASH patients (Gastaldelli et al., 2010). As well as 5
Molecular and Cellular Endocrinology 493 (2019) 110480
M. de Mendonça, et al.
Fig. 3. Liver mRNA expression of adipoWT and adipoKO mice fed a control (C) or a high-fat diet (H) and treated with pioglitazone (HP). mRNA expression was measured by qPCR and 36b4 and Rpl19 were used as endogenous control (A). Correlation analysis between Fgf21 levels and the others genes were performed by Pearson correlation coefficient (B). *#p < 0.05 as indicated by two-way ANOVA followed by Tukey's posttest: C vs H (*); H vs HP (#). When only diet (d) or genotype (g) effect were evaluated as one factor: abp < 0.05 compared to C (a) and H (b).
Corroborating to this hypothesis, despite the fact that miR-34a was found to be positively up-regulated during adipogenesis and correlated positively with BMI (Ortega et al., 2010), chronic down-regulation of miR-34a seems to have some metabolic side effects as mice knockout for miR-34 are more susceptible to weight gain (Lavery et al., 2016). This effect was associated with dysregulation of Pgc1a.
and miR-222 in the liver is significantly correlated with the histopathology score in choline and folate deficient diet-fed mice, with the strongest correlations being observed with miR-181a and miR200b. Interestingly, expression of miR-122 and miR-192 in the livers, two of the most abundant hepatic miRNAs did not correlate with the extent of liver injury (Tryndyak et al., 2012). Acid ursodeoxycholic acid activates miR-34a/SIRT1/p53 signaling and promote apoptosis of primary rat hepatocytes (Castro et al., 2013), showing that miR-34a may be a drug target for NASH therapy. MiR-192 levels in adipoKO were correlated positively to NAFLD score. Corroborating with our data, after 15 weeks of HFD, miR-192 was up-regulated in livers of mice which also displayed liver steatosis (Castano et al., 2018). miR-192 has been shown to target Scd1 and Srebp1 mRNA in rats and humans cells, respectively (Y. Lin et al., 2017), however in adipoKO mice pioglitazone does not repress Sbebp1 and consequently lipogenesis (Da Silva Morais et al., 2009). We have also found in adipoKO Fasn is increase compared to wild-type mice, suggesting increased de novo lipogenesis. Surprisingly, we found miR-34a and miR-220b were up regulated in mouse liver after pioglitazone treatment although it has improved liver lipid accumulation. Despite the fact that it seems to be negative, pioglitazone-induced increases in those microRNAs may be protective.
5. Conclusions Our data presented herein confirms results from clinical studies that have suggested pioglitazone-induced adiponectin production is critical for improvements in hepatic steatosis. Furthermore, we have shown adiponectin is important for up-regulation of Fgf21 and down-regulation of miR-192 by pioglitazone, which seems to be mediators of pioglitazone beneficial effects on NAFLD. Statement of ethics The study protocol has been approved by the research institute's committee on human research. Animal experiments conform to internationally accepted standards and have been approved by the appropriate institutional review body. 6
Molecular and Cellular Endocrinology 493 (2019) 110480
M. de Mendonça, et al.
Fig. 4. Liver microRNA expression of adipoWT and adipoKO mice fed a control (C) or a high-fat diet (H) and treated with pioglitazone (HP). *p < 0.05 as indicated by two-way ANOVA. When interaction was significant: *p < 0.05 compared to control within the group For diet (d) or genotype(g) significant effects (*p < 0.05): posttest was performed only considering one of the factors abp < 0.05 compared to C (a) and H (b).
Disclosure statement
(2), 281–297. Retrieved from. https://www.ncbi.nlm.nih.gov/pubmed/14744438. Borji, M., Nourbakhsh, M., Shafiee, S.M., Owji, A.A., Abdolvahabi, Z., Hesari, Z., et al., 2019. Down-regulation of SIRT1 expression by mir-23b contributes to lipid accumulation in HepG2 cells. Biochem. Genet. https://doi.org/10.1007/s10528-01909905-5. Castano, C., Kalko, S., Novials, A., Parrizas, M., 2018. Obesity-associated exosomal miRNAs modulate glucose and lipid metabolism in mice. Proc. Natl. Acad. Sci. U. S. A. 115 (48), 12158–12163. https://doi.org/10.1073/pnas.1808855115. Castro, R.E., Ferreira, D.M., Afonso, M.B., Borralho, P.M., Machado, M.V., Cortez-Pinto, H., Rodrigues, C.M., 2013. miR-34a/SIRT1/p53 is suppressed by ursodeoxycholic acid in the rat liver and activated by disease severity in human non-alcoholic fatty liver disease. J. Hepatol. 58 (1), 119–125. https://doi.org/10.1016/j.jhep.2012.08. 008. Chen, C., Ridzon, D.A., Broomer, A.J., Zhou, Z., Lee, D.H., Nguyen, J.T., et al., 2005. Realtime quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33 (20), e179. https://doi.org/10.1093/nar/gni178. Cheng, K.K., Lam, K.S., Wang, Y., Huang, Y., Carling, D., Wu, D., et al., 2007. Adiponectin-induced endothelial nitric oxide synthase activation and nitric oxide production are mediated by APPL1 in endothelial cells. Diabetes 56 (5), 1387–1394. https://doi.org/10.2337/db06-1580. Da Silva Morais, A., Lebrun, V., Abarca-Quinones, J., Brichard, S., Hue, L., Guigas, B., et al., 2009. Prevention of steatohepatitis by pioglitazone: implication of adiponectindependent inhibition of SREBP-1c and inflammation. J. Hepatol. 50 (3), 489–500. https://doi.org/10.1016/j.jhep.2008.10.027. Dutchak, P.A., Katafuchi, T., Bookout, A.L., Choi, J.H., Yu, R.T., Mangelsdorf, D.J., Kliewer, S.A., 2012. Fibroblast growth factor-21 regulates PPARgamma activity and the antidiabetic actions of thiazolidinediones. Cell 148 (3), 556–567. https://doi.org/ 10.1016/j.cell.2011.11.062. Finck, B.N., Kelly, D.P., 2006. PGC-1 coactivators: inducible regulators of energy metabolism in health and disease. J. Clin. Investig. 116 (3), 615–622. https://doi.org/10. 1172/JCI27794. Fortes, M.A., Marzuca-Nassr, G.N., Vitzel, K.F., da Justa Pinheiro, C.H., Newsholme, P., Curi, R., 2016. Housekeeping proteins: how useful are they in skeletal muscle diabetes studies and muscle hypertrophy models? Anal. Biochem. 504, 38–40. https:// doi.org/10.1016/j.ab.2016.03.023. Frias Fde, T., de Mendonca, M., Martins, A.R., Gindro, A.F., Cogliati, B., Curi, R., Rodrigues, A.C., 2016. MyomiRs as markers of insulin resistance and decreased myogenesis in skeletal muscle of diet-induced obese mice. Front. Endocrinol. 7, 76. https://doi.org/10.3389/fendo.2016.00076.
The authors have no conflicts of interest to declare. Funding sources This study was financed by Fundação de Amparo à Pesquisa do Estado de São Paulo (Research Grant number: 15/24789-8 and Scholarship Grant number: 15/24650-0). Author contributions Conceived and designed the research: MM and ACR. Acquired, analyzed, or interpreted data: MM, BACS, ES and ACR. Wrote the manuscript: MM, ES and ACR. Acknowledgements We thank Professor William Festuccia, PhD for providing adipoKO mice. This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) Finance code 001. Mariana de Mendonça and Erica de Sousa are recipients of fellowships from FAPESP, Sao Paulo, (Grant number: 17/ 19513-9 (MM) and 16/08202- and 18/13793-2 (ES)). We thanks Vitória de Mendonça for making the graphical abstract figure. References Ambros, V., 2004. The functions of animal microRNAs. Nature 431 (7006), 350–355. https://doi.org/10.1038/nature02871. Bartel, D.P., 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116
7
Molecular and Cellular Endocrinology 493 (2019) 110480
M. de Mendonça, et al.
Cell Biol. 8 (5), 516–523. https://doi.org/10.1038/ncb1404. Miyazaki, Y., Matsuda, M., DeFronzo, R.A., 2002. Dose-response effect of pioglitazone on insulin sensitivity and insulin secretion in type 2 diabetes. Diabetes Care 25 (3), 517–523. Retrieved from. http://www.ncbi.nlm.nih.gov/pubmed/11874940. Nakano, Y., Tobe, T., Choi-Miura, N.H., Mazda, T., Tomita, M., 1996. Isolation and characterization of GBP28, a novel gelatin-binding protein purified from human plasma. J. Biochem. 120 (4), 803–812. Retrieved from. http://www.ncbi.nlm.nih. gov/pubmed/8947845. Nawrocki, A.R., Rajala, M.W., Tomas, E., Pajvani, U.B., Saha, A.K., Trumbauer, M.E., et al., 2006. Mice lacking adiponectin show decreased hepatic insulin sensitivity and reduced responsiveness to peroxisome proliferator-activated receptor gamma agonists. J. Biol. Chem. 281 (5), 2654–2660. https://doi.org/10.1074/jbc.M505311200. Oishi, K., Tomita, T., 2011. Thiazolidinediones are potent inducers of fibroblast growth factor 21 expression in the liver. Biol. Pharm. Bull. 34 (7), 1120–1121. Retrieved from. http://www.ncbi.nlm.nih.gov/pubmed/21720023. Ortega, F.J., Moreno-Navarrete, J.M., Pardo, G., Sabater, M., Hummel, M., Ferrer, A., et al., 2010. MiRNA expression profile of human subcutaneous adipose and during adipocyte differentiation. PLoS One 5 (2), e9022. https://doi.org/10.1371/journal. pone.0009022. Pereira, R.I., Leitner, J.W., Erickson, C., Draznin, B., 2008. Pioglitazone acutely stimulates adiponectin secretion from mouse and human adipocytes via activation of the phosphatidylinositol 3'-kinase. Life Sci. 83 (19–20), 638–643. https://doi.org/10. 1016/j.lfs.2008.09.002. Phillips, S.A., Ciaraldi, T.P., Kong, A.P., Bandukwala, R., Aroda, V., Carter, L., et al., 2003. Modulation of circulating and adipose tissue adiponectin levels by antidiabetic therapy. Diabetes 52 (3), 667–674. Retrieved from. http://www.ncbi.nlm.nih.gov/ pubmed/12606507. Reeves, P.G., 1997 May. Components of the AIN-93diets as improvements in the AIN-76A diet. J Nutr. 5 Suppl (19–20), 838S–841S. https://doi.org/10.1093/jn/127.5.838S. Said, A., Akhter, A., 2017. Meta-analysis of randomized controlled trials of pharmacologic agents in non-alcoholic steatohepatitis. Ann. Hepatol. 16 (4), 538–547. https://doi. org/10.5604/01.3001.0010.0284. Santhekadur, P.K., Kumar, D.P., Sanyal, A.J., 2018. Preclinical models of non-alcoholic fatty liver disease. J. Hepatol. 68 (2), 230–237. https://doi.org/10.1016/j.jhep.2017. 10.031. Scherer, P.E., Williams, S., Fogliano, M., Baldini, G., Lodish, H.F., 1995. A novel serum protein similar to C1q, produced exclusively in adipocytes. J. Biol. Chem. 270 (45), 26746–26749. Retrieved from. http://www.ncbi.nlm.nih.gov/pubmed/7592907. Tryndyak, V.P., Latendresse, J.R., Montgomery, B., Ross, S.A., Beland, F.A., Rusyn, I., Pogribny, I.P., 2012. Plasma microRNAs are sensitive indicators of inter-strain differences in the severity of liver injury induced in mice by a choline- and folate-deficient diet. Toxicol. Appl. Pharmacol. 262 (1), 52–59. https://doi.org/10.1016/j. taap.2012.04.018. Yamauchi, T., Kamon, J., Ito, Y., Tsuchida, A., Yokomizo, T., Kita, S., et al., 2003. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 423 (6941), 762–769. https://doi.org/10.1038/nature01705. Yamauchi, T., Kamon, J., Minokoshi, Y., Ito, Y., Waki, H., Uchida, S., et al., 2002. Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nat. Med. 8 (11), 1288–1295. https://doi.org/10. 1038/nm788. Yamauchi, T., Nio, Y., Maki, T., Kobayashi, M., Takazawa, T., Iwabu, M., et al., 2007. Targeted disruption of AdipoR1 and AdipoR2 causes abrogation of adiponectin binding and metabolic actions. Nat. Med. 13 (3), 332–339. https://doi.org/10.1038/ nm1557. Younossi, Z., Anstee, Q.M., Marietti, M., Hardy, T., Henry, L., Eslam, M., et al., 2018. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nat. Rev. Gastroenterol. Hepatol. 15 (1), 11–20. https://doi.org/10.1038/nrgastro. 2017.109. Yu, J., Kong, X., Liu, J., Lv, Y., Sheng, Y., Lv, S., et al., 2014. Expression profiling of PPARgamma-regulated microRNAs in human subcutaneous and visceral adipogenesis in both genders. Endocrinology 155 (6), 2155–2165. https://doi.org/10.1210/en. 2013-2105.
Frias, F.T., Rocha, K.C.E., de Mendonca, M., Murata, G.M., Araujo, H.N., de Sousa, L.G.O., et al., 2018. Fenofibrate reverses changes induced by high-fat diet on metabolism in mice muscle and visceral adipocytes. J. Cell. Physiol. 233 (4), 3515–3528. https:// doi.org/10.1002/jcp.26203. Frost, R.J., Olson, E.N., 2011. Control of glucose homeostasis and insulin sensitivity by the Let-7 family of microRNAs. Proc. Natl. Acad. Sci. U. S. A. 108 (52), 21075–21080. https://doi.org/10.1073/pnas.1118922109. Gastaldelli, A., Harrison, S., Belfort-Aguiar, R., Hardies, J., Balas, B., Schenker, S., Cusi, K., 2010. Pioglitazone in the treatment of NASH: the role of adiponectin. Aliment Pharmacol. Ther. 32 (6), 769–775. https://doi.org/10.1111/j.1365-2036.2010. 04405.x. Hallakou, S., Doare, L., Foufelle, F., Kergoat, M., Guerre-Millo, M., Berthault, M.F., et al., 1997. Pioglitazone induces in vivo adipocyte differentiation in the obese Zucker fa/fa rat. Diabetes 46 (9), 1393–1399. Retrieved from. http://www.ncbi.nlm.nih.gov/ pubmed/9287037. Hu, E., Liang, P., Spiegelman, B.M., 1996. AdipoQ is a novel adipose-specific gene dysregulated in obesity. J. Biol. Chem. 271 (18), 10697–10703. Retrieved from. http:// www.ncbi.nlm.nih.gov/pubmed/8631877. Hug, C., Wang, J., Ahmad, N.S., Bogan, J.S., Tsao, T.S., Lodish, H.F., 2004. T-cadherin is a receptor for hexameric and high-molecular-weight forms of Acrp30/adiponectin. Proc. Natl. Acad. Sci. U. S. A. 101 (28), 10308–10313. https://doi.org/10.1073/pnas. 0403382101. Iwabu, M., Yamauchi, T., Okada-Iwabu, M., Sato, K., Nakagawa, T., Funata, M., et al., 2010. Adiponectin and AdipoR1 regulate PGC-1alpha and mitochondria by Ca(2+) and AMPK/SIRT1. Nature 464 (7293), 1313–1319. https://doi.org/10.1038/ nature08991. Kadowaki, T., Yamauchi, T., 2005. Adiponectin and adiponectin receptors. Endocr. Rev. 26 (3), 439–451. https://doi.org/10.1210/er.2005-0005. Kubota, N., Terauchi, Y., Kubota, T., Kumagai, H., Itoh, S., Satoh, H., et al., 2006. Pioglitazone ameliorates insulin resistance and diabetes by both adiponectin-dependent and -independent pathways. J. Biol. Chem. 281 (13), 8748–8755. https:// doi.org/10.1074/jbc.M505649200. Lavery, C.A., Kurowska-Stolarska, M., Holmes, W.M., Donnelly, I., Caslake, M., Collier, A., et al., 2016. miR-34a(-/-) mice are susceptible to diet-induced obesity. Obesity 24 (8), 1741–1751. https://doi.org/10.1002/oby.21561. Li, J., Zhang, S., 2016. microRNA-150 inhibits the formation of macrophage foam cells through targeting adiponectin receptor 2. Biochem. Biophys. Res. Commun. 476 (4), 218–224. https://doi.org/10.1016/j.bbrc.2016.05.096. Li, L., Wu, L., Wang, C., Liu, L., Zhao, Y., 2007. Adiponectin modulates carnitine palmitoyltransferase-1 through AMPK signaling cascade in rat cardiomyocytes. Regul. Pept. 139 (1–3), 72–79. https://doi.org/10.1016/j.regpep.2006.10.007. Liang, W., Menke, A.L., Driessen, A., Koek, G.H., Lindeman, J.H., Stoop, R., et al., 2014. Establishment of a general NAFLD scoring system for rodent models and comparison to human liver pathology. PLoS One 9 (12), e115922. https://doi.org/10.1371/ journal.pone.0115922. Lin, Y., Ding, D., Huang, Q., Liu, Q., Lu, H., Lu, Y., et al., 2017. Downregulation of miR192 causes hepatic steatosis and lipid accumulation by inducing SREBF1: novel mechanism for bisphenol A-triggered non-alcoholic fatty liver disease. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 1862 (9), 869–882. https://doi.org/10.1016/j. bbalip.2017.05.001. Lin, Z., Tian, H., Lam, K.S., Lin, S., Hoo, R.C., Konishi, M., et al., 2013. Adiponectin mediates the metabolic effects of FGF21 on glucose homeostasis and insulin sensitivity in mice. Cell Metabol. 17 (5), 779–789. https://doi.org/10.1016/j.cmet.2013. 04.005. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25 (4), 402–408. https://doi.org/10.1006/meth.2001.1262. Maeda, K., Okubo, K., Shimomura, I., Funahashi, T., Matsuzawa, Y., Matsubara, K., 1996. cDNA cloning and expression of a novel adipose specific collagen-like factor, apM1 (AdiPose Most abundant Gene transcript 1). Biochem. Biophys. Res. Commun. 221 (2), 286–289. https://doi.org/10.1006/bbrc.1996.0587. Mao, X., Kikani, C.K., Riojas, R.A., Langlais, P., Wang, L., Ramos, F.J., et al., 2006. APPL1 binds to adiponectin receptors and mediates adiponectin signalling and function. Nat.
8
Contents lists available at ScienceDirect
Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce
Adiponectin is required for pioglitazone-induced improvements in hepatic steatosis in mice fed a high-fat diet
T
Mariana de Mendonça1, Bruna de Araújo Cardoso dos Santos1, Érica de Sousa, Alice Cristina Rodrigues∗ Institute of Biomedical Sciences, Department of Pharmacology, University of Sao Paulo, Sao Paulo, SP, Brazil
A R T I C LE I N FO
A B S T R A C T
Keywords: MicroRNA Adiponectin Obesity Insulin resistance Pioglitazone NAFLD
Pioglitazone has been used for the treatment of nonalcoholic fatty liver disease (NAFLD) related to diabetes. The role of adiponectin in pioglitazone-induced improvements in NAFLD was studied by using wild-type (adipoWT) and adiponectin knockout (adipoKO) mice. High-fat diet fed mice were insulin resistant, glucose intolerant and had increased hepatic lipid accumulation as evidenced by increased NAFLD activity score. Despite pioglitazone has improved insulin resistance in both genotypes, hepatic steatosis was only improved in adipoWT obese mice. Amelioration of NAFLD in adipoWT mice promoted by pioglitazone was associated with up-regulation of Pparg, Fgf21 and down-regulation of Pepck liver expression. On the other hand, resistance to pioglitazone treatment in adipoKO mice was associated with increased expression of miR-192 and Hsl, which was not followed by increased fatty acid oxidation. In conclusion, our data provides evidence that increased adiponectin production by pioglitazone is necessary for its beneficial action on NAFLD.
1. Introduction Adiponectin (adipoQ), which was firstly identified by four independent groups approximately 20 years ago (Hu et al., 1996; Maeda et al., 1996; Nakano et al., 1996; Scherer et al., 1995), it is produced by adipocytes and found in plasma in both cleaved and integrate forms (for review, refer to 5)(Kadowaki and Yamauchi, 2005). There are three known adipoQ receptors: adipoR1 and adipoR2, both coupled to APPL1 protein (Cheng et al., 2007; Mao et al., 2006), and T-cadherin (Hug et al., 2004). The adipoR1 receptor is mainly expressed in the skeletal muscle and liver and has greater affinity to the cleaved form of adipoQ. The adipoR2 receptor, in its turn, is mainly expressed in the liver and has affinity to both forms of adipoQ (Yamauchi et al., 2003). The sinalization after these receptors activates AMPK, increasing glucose uptake and fatty acid oxidation (Yamauchi et al., 2002). Knockout of adipoR1 (Iwabu et al., 2010) or both adipoR1 and adipoR2 (Yamauchi et al., 2007) leads to insulin resistance and glucose intolerance. In the skeletal muscle, adipoQ sinalization also controls CPT1b (Li et al., 2007), whose activity is the limitant step for fatty acid oxidation, and PGC1alpha (Iwabu et al., 2010; Yamauchi et al., 2007), which regulates mitochondrial biogenesis and fatty acid oxidation (Finck and Kelly,
2006). In the liver, adipoR2 activity induces PPAR alpha expression, increasing the transcription of its targets like Acox1 and UCP2 (Yamauchi et al., 2007). Pioglitazone, a PPAR alpha and PPAR gamma agonist, is an insulin sensitizer used to treat diabetes type 2 that belongs to thiazolidinediones (TZDs) class. A well-known effect of pioglitazone is to increase plasmatic levels of adipoQ in both human and mice (Pereira et al., 2008; Phillips et al., 2003). Non-alcoholic steatohepatitis patients under treatment with pioglitazone had increased adiponectin plasma levels which was associated with improved liver histology and reversed hepatic insulin resistance, evidencing a role of adiponectin in pioglitazone beneficial effects (Gastaldelli et al., 2010). In rodents, pioglitazone was ineffective to prevent methionine and choline deficient diet-induced steatohepatitis in female adiponectin KO mice (Da Silva Morais et al., 2009) and pioglitazone increases skeletal muscle insulin sensitivity in a dose-dependent manner but not hepatic insulin sensitivity in adiponectin and leptin KO mice (Kubota et al., 2006). Despite the fact that there is some evidence that adiponectin seems not to be required for pioglitazone improvement of skeletal muscle insulin sensitivity but may be necessary for the liver, the molecular mechanisms involved are not fully understood. In addition, no other study has investigated the role of
∗
Corresponding author. Laboratory of Pharmacogenomics, Department of Pharmacology, Institute of Biomedical Sciences, University of Sao Paulo, Sao Paulo, SP, CEP 05508-900, Brazil. E-mail address: [email protected] (A.C. Rodrigues). 1 Mariana de Mendonça and Bruna de Araújo Cardoso dos Santos contributed equally to this work. https://doi.org/10.1016/j.mce.2019.110480 Received 20 March 2019; Received in revised form 23 April 2019; Accepted 5 June 2019 Available online 06 June 2019 0303-7207/ © 2019 Elsevier B.V. All rights reserved.
Molecular and Cellular Endocrinology 493 (2019) 110480
M. de Mendonça, et al.
epididymal and interscapular brown adipose tissue depots were dissected and weighed to evaluate adiposity level. The number of individual experiments was representative of at least two litters. The total number of animals used in each experiment is indicated in the figure legends.
adiponectin in high-fat diet-induced NAFLD, which display NAFLD features more similar to humans than MCD diet (Santhekadur et al., 2018). MicroRNAs (miRNAs) are short non coding RNA (19-22 nucleotides) (Ambros, 2004) that regulate target messenger RNA stability and translational rate interacting through Watson-Crick pairing (Bartel, 2004). TZDs drugs have been shown to modulate the expression of miRNAs in human subcutaneous and visceral adipocytes and, among the miRNAs regulated, miR-378 was associated with differential effects of TZDs on the two fat depot accumulation (Yu et al., 2014). Considering the liver and skeletal muscle, there is a lack of studies that investigated the relationship between pioglitazone effects and miRNA expression, although microRNAs play a role in insulin resistance and NAFLD. The levels of a panel of circulating microRNAs (miR-34a, miR-122, miR-192 and miR-200b) have been shown to significantly correlate with a severity of NAFLD-specific liver pathomorphological features, with the strongest correlation occurring with miR34a (Tryndyak et al., 2012). In addition, we analyzed the expression of miR-23b and miR-222 that have been associated with hepatic steatosis in HFD animals (Borji et al., 2019) and with insulin resistance (unpublished data). The molecular mechanisms by which pioglitazone improves insulin sensitivity and ameliorates NAFLD are not fully elucidated. As adiponectin seems to mediate some of the beneficial effects of pioglitazone we used adiponectin KO mice, first to evaluate in a model of high-fat diet-induced NAFLD if adiponectin is required for pioglitazone effects and second to study the molecular pathway involved in pioglitazone benefits in skeletal muscle. In addition we hypothesized that those microRNAs described above would be dysregulated in HFD fed mice and pioglitazone treatment of WT but not KO mice would normalize their expression.
2.3. Glucose tolerance test (GTT), insulin tolerance test (ITT), and serum metabolite measurements All groups were fasted for 6 h (from 8a.m.–2 p.m.). GTT and ITT tests were performed as previously described (Frias et al., 2018). Insulin and adiponectin levels were measured by ELISA using Rat/Mouse Insulin ELISA kit (EMD Millipore, Billerica, MA, USA. Total Cholesterol (K083-2), LDL (K088), HDL (K015), and TG (K117-1) concentrations were determined using specific kits (Bioclin, Belo Horizonte, BH, Brazil). 2.4. Histological analysis and NAFLD activity score Liver sections were stained with HE for histological analysis. For each liver, ten random fields of HE stained were photographed at 40× magnification were captured using a Nikon DM×1200 digital camera. Liver histology for KO and WT animals was evaluated and scored blinded by two independent observers (BACS, LAFR) using a non-alcoholic fatty liver disease scoring system for rodents (Liang et al., 2014). 2.5. microRNA and mRNA expression by real-time PCR Total RNA was extracted from liver and soleus adipose tissue using TRIzol (Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer's instructions. Total RNA concentration and purity were measured with NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). The relative quantification of miRNAs miR-23b and miR-222 was done by stem-loop RT-qPCR as described in Chen et al. (2005) and of miRs miR-34a-5p, miR-122-5p, miR-192-5p and miR-200b-3p was done by real-time qPCR using the miRCURY LNA ™ microRNA system (Exiqon) as described by the manufacturer. The primers required for each miRNA were purchased from Exiqon or Thermo Scientific. For the quantification of gene expression the relative quantification method was used, using the average Ct of SNORD110, U6 and miR-130b as reference, using the 2-ΔΔCT method (Livak and Schmittgen, 2001). For mRNA expression, cDNA was synthetized from 500 ng of total RNA using High Capacity cDNA Reverse Transcription Kit (Thermo Scientific). All PCR reactions was then performed using diluted (1/10) cDNA template, forward and reverse primers (200 nM each) and Power SYBR Green PCRMaster Mix (Thermo-Fisher). For mRNA expression, genes analyzed included were: adiponectin receptor 2 (Adipor2), carnitine palmitoyltransferase 1a, liver (Cpt1a), fatty acid synthase (Fasn), fibroblast growth factor 21 (Fgf21), glucose-6-phosphatase, catalytic (G6pc) insulin receptor substrate 1 (Irs1), lipase hormone sensitive (Lipe), patatin-like phospholipase domain containing 2 (Pnlpa2 or Atgl), phosphoenolpyruvate carboxykinase 1, cytosolic (Pck1 or Pepck), peroxisome proliferator-activated receptor (PPAR)-alpha (Ppara), PPAR gamma (Pparg), Peroxisome proliferative activated receptor, gamma, coactivator 1 alpha (Ppargc1a), stearoyl-Coenzyme A desaturase 1 (Scd1), uncoupling protein 2 (Ucp2). Primer sequences for Pparα, Lipe, Atgl, Srebp1, Fasn, Scd1, Irs1 and Ppargc1α were previously described (Frias et al., 2018) and for the others the sequences were: Adipor2 FW: AGGCTGGCTAATGCTTATGG and RV: GATGTGGAAGAGCTGATGA GAG; Cpt1a FW: GGCCACAAATTATGTGAGTGA and RV: GAGCATCT CCATGGCGTAGT; Fgf21- FW: CTGCTGGGGGTCTACCAAG and RV: CTGCGCCTACCACTGTTCC; G6PC - FW: CGTATGGATTCCGGTGTTTG and RV: GGGAAAGTGAGCAGCAAGGT; Pparg FW: CAAACCTGATGGC ATTGTGAG and RV: ATCTTAACTGCCGGATCCAC; Pepck -FW: ATGCT
2. Material and methods 2.1. Animals Adiponectin knockout mice (B6; 129-Adipoqtm1Chan/J) were obtained from the Jackson Laboratory (Bar Harbor, ME) on a C57BL/6J background and were maintained at 12:12-h light–dark cycle and 23 °C ± 2 °C. The animals were housed in cage (2-3 animals/cage) and received standard diet (Nuvilab-Nuvital Nutrients Ltd., Parana, Brazil) and water ad libitum until to the beginning of the experimental period. The Experimental Animal Ethics Committees of the Institute of Biomedical Sciences (ICB), University of Sao Paulo (USP), approved the experimental procedure of this study (Protocols Numbers: 165/2011 and 137/2015). 2.2. Experimental design Both adiponectin knockout (adipoKO) and its background (adipoWT) with 8 weeks of age were randomly divided into two groups (n = 10 per group): control diet (C) (9% fat, 15% protein and 76% carbohydrate) and high-fat diet (H) (59% fat, 15% protein and 26% carbohydrate, as a percentage of total kcal) (Frias Fde et al., 2016). Both diets were prepared according to the American Institute of Nutrition - AIN (Reeves, 1997). After 6 weeks of diet, pioglitazone (EMS®), was mixed in the diet (35 mg/kg of b.w./day), and part of the animals of groups H was treated for the last 2 weeks of the protocol, creating a new group: high-fat diet plus pioglitazone (HP). Body weight was measured every week and food intake every 3 days. By the end of 8 weeks, animals were euthanized (between 1 and 3 pm) by decapitation, serum was collected, centrifuged and stored at −80 °C. For total RNA and protein extraction, soleus muscle and liver were harvested, frozen in liquid nitrogen and stored at −80 °C. For histochemical analysis livers samples were fixed in 4%formaldehyde and after 48 processed with hematoxylin and eosin (HE) staining. Retroperitoneal, mesenteric, 2
Molecular and Cellular Endocrinology 493 (2019) 110480
M. de Mendonça, et al.
hyperphagic behavior when compared to H group (Table 1). Despite ameliorating insulin sensitivity as indicated by an increase in KITT of both adipoKO and adipoWT fed a HFD, pioglitazone treatment increased lipid accumulation as suggested by increased fat depots (Table 1), a well-established pioglitazone side effect in humans (Miyazaki et al., 2002) and rodents (Hallakou et al., 1997). Interestingly, for epididymal fat pad, adipoKO mice fed a HFD gained less fat compared to adipoWT in the same diet, and pioglitazone promoted a 1.7-fold increase in this fat pad (Table 1). Moreover, pioglitazone treatment lowered fasting plasma insulin in HFD-fed mice of both genotypes, although no significant difference was observed in GTT glycemic curve (Fig. 1A). In adipoWT mice, pioglitazone increased serum adiponectin compared to control and obese animals (Table 1). As expected, adiponectin was not detected in adipoKO mice.
GATCCTGGGCATAAC and RV: GTCTTCCCACAGGCACTAGG; Ucp2FW: CTGCGGTCCGGACACAATA and RV:CCCGATCCCCTCGATTTTC. RT-qPCR was performed using ABI Prism 7500 equipment (Thermo Fisher Scientific). For the quantification of gene expression the relative quantification method was used, using constitutive genes 36b4 and Hprt1 (soleus muscle) or 36b4 and Rpl19 (liver) as reference using the 2ΔΔCT method (Livak and Schmittgen, 2001). 2.6. Western blot analysis Protein from soleus muscle was homogenized in cell disruption buffer from miRvana PARIS kit (Thermo Fisher Scientific, Waltham, MA, USA) and concentration was determined by the Bradford method. Thirty micrograms of protein was boiled, fractionated in 10% SDSPAGE and transferred onto a nitrocellulose membrane. Membranes were blocked in 5% non-fat milk diluted in TBS-Tween for 1 h at room temperature. Membranes were incubated overnight at 4 °C with primary antibodies (p-Ampkalpha [Thr172), Cell Signaling #2535; Sirt1, Santa Cruz biotechnology). Detection was performed by C-Digit Imager (LI-COR, Lincoln, NE, USA) after incubation with peroxidase-conjugated secondary antibodies for 2 h at room temperature, and “ClarityTM Western ECL Substrate” detection system (Bio-Rad, Hercules, CA, EUA). Signals were quantified using NIH ImageJ 1.63 Software and protein expression was normalized with total protein content stained with amido black for soleus muscle (Fortes et al., 2016).
3.2. Pioglitazone insulin sensitizer effect in adipoKO mice fed a HFD is associated with stimulation of Adipor2 pathway in skeletal muscle It has been shown pioglitazone-induced amelioration of insulin resistance and diabetes is mediated via adiponectin-independent pathway in skeletal muscle (Kubota et al., 2006). However, the underlying mechanisms are not clear. We investigated in soleus muscle of adipoWT and adipoKO the mechanism by which pioglitazone could restore insulin sensitivity in HFD-fed mice. Pioglitazone insulin-sensitizer effect in adipoKO mice was associated with stimulation of Adipor2 pathway, suggested by up-regulation of Adipor2 mRNA (Fig. 1B), increased phospho-AMPK (Thr172) and Sirt1 (Fig. 1C) and up-regulation of Ppargc1a, and consequently Ppara in soleus muscle (Fig. 1B). Glut4 mRNA was not regulated; suggesting increased fatty acid oxidation is associated with insulin sensitivity improvement. As pioglitazone induced adiponectin receptor Adipor2 signaling in the absence of its ligand, we postulated if some microRNAs could be involved in stimulation of Adipor2. We measured let7b-5p that was predicted to bind to Adipor2 3′UTR and has been shown to improve insulin sensitivity in skeletal muscle (Frost and Olson, 2011) and miR150-5p that targets Adipor2 (J. Li and Zhang, 2016). Interestingly miR150-5p was dramatically reduced in soleus muscle of adipoKO mice fed a HFD after treatment with pioglitazone (adipoKO-HP) when compared to adipoKO mice fed a HFD (adipoKO-H) (Fig. 1C), suggesting it controls Adipor2 mRNA, as it was 2-fold increased when compared to adipoKO-H or to adipoWT-HP (Fig. 1B). Let-7b-5p expression was not different between HP and H group in both genotypes (Fig. 1D).
2.7. Statistical analysis Interaction between diet and genotype was tested by two-way analysis variance (ANOVA) and Tukey post-test was performed for comparisons between groups. When there was no interaction (DxG), the effect of diet (D) or genotype (G), showed in the boxes above the graphs, were also analyzed. Pearson's correlation was used to measure the strength between microRNAs or mRNA expression and NAFLD activity score. A p-value < 0.05 was considered significant. 3. Results 3.1. Obesity features and metabolic parameters In adipoKO and adipoWT mice initial body weight was not different among the groups, however, after 8 weeks of high-fat diet (HFD), mice from both genotypes had increased body weight when compared to mice fed a control diet. Even though HFD-fed animals had a reduced food intake and only in adipoWT mice pioglitazone induced a
Table 1 Obesity features and metabolic parameters from adipoKO (KO) and adipoWT (WT) mice fed with control (C) or high-fat diet (H) and treated with pioglitazone (HP).
Initial BW (g) Final BW (g) BW gain (g) Food intake (calories/animal) Epididymal fat pad (g) Mesenteric fat pad (g) Retroperitoneal fat pad (g) Brown fat pad (g) Gastrocnemius weight (g) Liver weight (g) Adiponectin (μg/mL) KITT (%glucose/min) AUC (mg/mL.min−1)
C WT
C KO
H WT
H KO
HP WT
HP KO
P*
Diet
Genotype
23.2 ± 1.7 31.0 ± 2.8 7.8 ± 1.3 17.0 ± 1.2 1.1 ± 0.3 0.57 ± 0.12 0.30 ± 0.07 0.10 ± 0.05 0.14 ± 0.02 1.2 ± 0.1 12.1 ± 4.6 6.3 ± 2.1 950 ± 209
21.0 ± 0.8 27.5 ± 1.3 6.5 ± 1.3 17.2 ± 1.0 0.80 ± 0.2 0.45 ± 0.15 0.23 ± 0.08 0.07 ± 0.01 0.13 ± 0.01 1.0 ± 0.0 N/D 6.6 ± 0.7 1125 ± 109
24.2 ± 1.7 37.2 ± 4.0 13.0 ± 3.3 12.3 ± 2.8a 2.4 ± 0.7a 0.93 ± 0.25 0.57 ± 0.11* 0.12 ± 0.04 0.16 ± 0.02 1.3 ± 0.3 11.3 ± 1.8 2.7 ± 0.8* 1325 ± 184
21.7 ± 1.50 30 ± 2.37 8.33 ± 3.27 11.9 ± 1.4b 1.2 ± 0.3c 0.52 ± 0.24 0.43 ± 0.11* 0.05 ± 0.02 0.14 ± 0.01 0.8 ± 0.3 N/D 4.4 ± 1.9* 1620 ± 434*
25.5 ± 1.6 37.8 ± 3.5 12.8 ± 2.7* 14.5 ± 1.0c 2.2 ± 0.6a 0.77 ± 0.21* 0.57 ± 0.15* 0.16 ± 0.08*# 0.16 ± 0.01 1.2 ± 0.2 37.5 ± 6.7*# 4.8 ± 1.7# 1231 ± 80
21.9 ± 1.5 34.4 ± 3.0 12.6 ± 3.7* 11.7 ± 1.7b 2.0 ± 0.5bd 0.79 ± 0.303* 0.57 ± 0.07* 0.16 ± 0.05*# 0.14 ± 0.01 1.0 ± 0.1 N/D 6.7 ± 1.1# 1347 ± 365
> 0.05 > 0.05 > 0.05 < 0.05 < 0.05 > 0.05 > 0.05 > 0.05 > 0.05 > 0.05 – > 0.05 > 0.05
> 0.05 < 0.05 < 0.05 < 0.05 < 0.05 < 0.05 > 0.05 > 0.05 < 0.05 < 0.05 < 0.05
< 0.05 < 0.05 > 0.05 – – > 0.05 > 0.05 > 0.05 < 0.05 < 0.05 > 0.05 > 0.05
Values are presented as mean ± SD (n = 5–7/group). BW: body weight; AUC GTT, area under curve of glucose tolerance test; Kitt, constant for glycemia decay obtained from insulin tolerance test. In bold, statistically significant values. *p-value for interaction as indicated by two-way ANOVA. a,b,c,d p < 0.05 as indicated by Tukey's post-test vs C–WTa; vs C-KOb; vs: WT-Hc; vs:H-KOd. When interaction was not significant, the effect of one effect (diet or genotype) was considered and pvalue < 0.05 are indicated as *#; vs C diet or WT genotype* and vs H diet#. 3
Molecular and Cellular Endocrinology 493 (2019) 110480
M. de Mendonça, et al.
Fig. 1. Adiponectin is not necessary for pioglitazone improvements in insulin resistance. AdipoWT and adipoKO mice were fed a control (C) or a high-fat diet (H) for 8 weeks and treated with pioglitazone (HP) and insulin and glucose tolerance tests (A) were performed. Soleus muscles were collected after euthanasia and processed for total RNA and protein extraction. mRNA (B) and microRNA (D) expression were measured by RT-qPCR and pAmpk and Sirt1 expression were quantified by western blot. Statistical analysis was performed by two-way ANOVA. When interaction was significant, Tukey posttest was performed. *#&p < 0.05 compared to C within the group (*), H within the group (#), and HP adipowt (&). When there was no interaction diet (d) or genotype (g) effect were analyzed separately. ap < 0.05 compared to control, as indicated by Tukey's posttest only considering the diet.
when compared to HFD-fed mice but not in adipoKO (Fig. 3A). Fgf21 levels in the liver of adipoWT were positively correlated with Irs-1 levels (Fig. 3B). HFD-fed adipoWT mice showed a significant increase in Lipe expression compared to control mice, and pioglitazone did not reverse this effect. In adipoKO mice pioglitazone treatment promoted an up-regulation of Lipe expression (Fig. 3A). Pepck levels were decreased by pioglitazone treatment only in adipoWT animals consistent with a reduced gluconeogenesis. Considering only genotype effect, Fasn expression was increased in adipoKO mice, suggesting these mice have increased de novo lipogenesis (Fig. 3A). With respect to diet effet, Adipor2, Ucp2 and Scd1 mRNAs were higher expressed in HFD-fed mice treated with pioglitazone compared to control or HFD groups (Fig. 3A). Altogether these data suggest pioglitazone reduces lipid accumulation by increasing lipolysis and fatty acid oxidation as a result of Fgf21 stimulation. In the absence of adiponectin the effect of pioglitazone in liver steatosis is abrogated probably by absence of Fgf21 stimulation.
3.3. Pioglitazone does not reverse hepatic steatosis in adipoKO mice fed a HFD Mice fed a HFD had increased ectopic triglycerides (TG) accumulation as indicated by TG hepatic content (Fig. 2A) and non-alcoholic fatty liver disease (NAFLD) activity score (Fig. 2C), calculated after histopathological analysis (Fig. 2B). Pioglitazone treatment reduced hepatic TG content in adipoWT mice but not on adipoKO (Fig. 2A). Accordingly, pioglitazone reversed liver steatosis in 67% of adipoWT mice, however in adipoKO mice up to 14% of mice responded to the treatment (Fig. 2C). Among WT mice the lack of response was associated with a residual macrovesicular steatosis (Fig. 2C). On the other hand, in adipoKO mice, the lack of response was associated mainly with pioglitazone-induced hepatocellular hypertrophy in 43% of the animals (Fig. 2C). 3.4. Pioglitazone effect on glucose and lipid metabolism gene expression in liver of AdipoKO mice fed a HFD
3.5. Pioglitazone increases miR-192 in the liver of adipoKO mice fed a HFD We evaluated in adipoWT and adipoKO mice some genes related to lipid and glucose metabolism to understand the mechanism by which adiponectin ameliorates hepatic steatosis and insulin resistance. Interaction between genotype and pioglitazone treatment was found in mRNA expression of PParg, Fgf21, Lipe and Pepck. Pioglitazone induced a significant increase of Pparg and Fgf21 expression in adipoWT mice
We analyzed the expression of miR-34a, miR-122, miR-192, miR200b, miR-23b and miR-222 because they have been associated with development of NAFLD, and many of their targets are lipid metabolism genes. Considering the interaction between pioglitazone treatment and 4
Molecular and Cellular Endocrinology 493 (2019) 110480
M. de Mendonça, et al.
Fig. 2. Pioglitazone does not improve hepatic steatosis in adiponectin knockout mice. AdipoWT and adipoKO mice were fed a control (C) or a high-fat diet (H) for 8 weeks and treated with pioglitazone (HP). After euthanasia the livers were collected and triglycerides (TG) content (A) were quantified after lipid extraction and liver samples were subjected to histological analysis (B), which were used to measure NAFLD activity score (C). *#p < 0.05 as indicated by two-way ANOVA followed by Tukey's posttest: C vs H (*); H vs HP (#).
this, adiponectin is an important mediator of TZD improvements in glucose tolerance (Nawrocki et al., 2006) and hepatic insulin resistance (Kubota et al., 2006). Corroborating with these findings, our data provided herein bring new evidence for the role of adiponectin in pioglitazone-induced improvements in liver steatosis associated with obesity, supporting those findings in humans described before. The preventive effect of pioglitazone has been also reported in a model of methionine-choline deficient diet (MCD)-induced steatohepatitis, a mechanism dependent on adiponectin up regulation but that does not involve AMPK or PPAR alpha activation (Da Silva Morais et al., 2009). NAFLD in the presence of obesity is approximately 80–90%, and insulin resistance is one of the triggers for NAFLD (Santhekadur et al., 2018; Younossi et al., 2018). In this context, HFD-induced fatty liver is a model that is more similar to the physiopathological mechanism of NAFLD in humans than MCD (Santhekadur et al., 2018). Pioglitazone treatment improves hepatic steatosis by a mechanism that seems to involve up-regulation of Fgf21 in the liver as the upregulation of Fgf21 was only observed in pioglitazone-treated adipoWT mice. Corroborating with our findings, the antagonizing effects of Fgf21 against high fat diet-induced hepatic insulin resistance, steatosis, and liver injury were completely abolished in adiponectin KO mice (Z. Lin et al., 2013). As well as this, pioglitazone has been shown in vitro to increase FgF21 levels, an effect associated to PPARg rather than PParalpha (Oishi and Tomita, 2011). Interestingly, loss of Fgf21 reduces Pparg transcriptional activity. In addition, the PPARγ stimulant, rosiglitazone has side effects, including insulin sensitization, weight gain and edema; however, such side effects do not occur in mice with FGF21 knockout (Dutchak et al., 2012). Thus, in white adipose tissue Fgf21 is a key mediator of physiological and pharmacological actions of Pparg (Dutchak et al., 2012). These observations may explain the fact that pioglitazone in adipoKO mice does not stimulate Pparg expression and also the fact that adipoKO mice under high-fat diet gain less weight than adipoWT mice. MicroRNAs have been proposed both as biomarkers of NAFLD or as targets for NAFLD therapy. Induction of miR-34a, miR-181a, miR-200b
mice genotype, miR-192 expression was increased by 3-fold in liver of adipoKO mice treated with pioglitazone, but not in adipoWT animals (Fig. 4A). Increased expression of miR-192 in adipoKO mice was positively correlated with NAFLD activity score (r = 0.63; p = 0.01) and Lipe mRNA expression (r = 0.68; p = 0.02) and negatively correlated with Fgf21 mRNA expression (r = −0.73, p = 0.01) (Fig. 4C). Considering only the effect of the genotype, liver miR-23b expression was decreased in adipoKO mice compared to adipoWT, although its hepatic expression was increased by pioglitazone treatment in both adipoWT and adipoKO mice (Fig. 4A). In adipoWT mice miR-23b levels were negatively correlated with NAFLD activity score (r = −0.63; p = 0.01) and Lipe expression (r = −0.66; p = 0.01) (Fig. 4B). MiR-34a and miR-200b liver expression were positively correlated (r = 0.84, p = 0.08) and were also positively correlated with Hsl levels (r = 0.72, p = 0.0002). Pioglitazone treatment up-regulated miR-34a and miR-200b independent of the mice genotype (Fig. 4A). miR-222 was up-regulated by pioglitazone independent of the mice genotype when compared to control mice (Fig. 4A). 4. Discussion In the present study, we report that pioglitazone is ineffective to treat liver steatosis induced by HFD in adiponectin-deficient mice and this mechanism in independent of improvements in insulin resistance. In addition we have shown pioglitazone increases hepatic Fgf21 and its expression correlates with Irs1 levels, an effect abrogated in adipoKO mice, indicating a biological significance of Fgf21-adiponectin axis in pioglitazone effects in the liver. Interestingly, in the absence of adiponectin pioglitazone induces miR-192, and miR-192 levels were correlated with NAFLD activity score. In human randomized controlled trials, pioglitazone improves liver histologic scores and insulin resistance in patients with non-alcoholic steatohepatitis (NASH) but not fibrosis (Said and Akhter, 2017). Increase in plasma adiponectin concentration induced by pioglitazone is significantly correlated with histological improvement and hepatic insulin sensitivity in NASH patients (Gastaldelli et al., 2010). As well as 5
Molecular and Cellular Endocrinology 493 (2019) 110480
M. de Mendonça, et al.
Fig. 3. Liver mRNA expression of adipoWT and adipoKO mice fed a control (C) or a high-fat diet (H) and treated with pioglitazone (HP). mRNA expression was measured by qPCR and 36b4 and Rpl19 were used as endogenous control (A). Correlation analysis between Fgf21 levels and the others genes were performed by Pearson correlation coefficient (B). *#p < 0.05 as indicated by two-way ANOVA followed by Tukey's posttest: C vs H (*); H vs HP (#). When only diet (d) or genotype (g) effect were evaluated as one factor: abp < 0.05 compared to C (a) and H (b).
Corroborating to this hypothesis, despite the fact that miR-34a was found to be positively up-regulated during adipogenesis and correlated positively with BMI (Ortega et al., 2010), chronic down-regulation of miR-34a seems to have some metabolic side effects as mice knockout for miR-34 are more susceptible to weight gain (Lavery et al., 2016). This effect was associated with dysregulation of Pgc1a.
and miR-222 in the liver is significantly correlated with the histopathology score in choline and folate deficient diet-fed mice, with the strongest correlations being observed with miR-181a and miR200b. Interestingly, expression of miR-122 and miR-192 in the livers, two of the most abundant hepatic miRNAs did not correlate with the extent of liver injury (Tryndyak et al., 2012). Acid ursodeoxycholic acid activates miR-34a/SIRT1/p53 signaling and promote apoptosis of primary rat hepatocytes (Castro et al., 2013), showing that miR-34a may be a drug target for NASH therapy. MiR-192 levels in adipoKO were correlated positively to NAFLD score. Corroborating with our data, after 15 weeks of HFD, miR-192 was up-regulated in livers of mice which also displayed liver steatosis (Castano et al., 2018). miR-192 has been shown to target Scd1 and Srebp1 mRNA in rats and humans cells, respectively (Y. Lin et al., 2017), however in adipoKO mice pioglitazone does not repress Sbebp1 and consequently lipogenesis (Da Silva Morais et al., 2009). We have also found in adipoKO Fasn is increase compared to wild-type mice, suggesting increased de novo lipogenesis. Surprisingly, we found miR-34a and miR-220b were up regulated in mouse liver after pioglitazone treatment although it has improved liver lipid accumulation. Despite the fact that it seems to be negative, pioglitazone-induced increases in those microRNAs may be protective.
5. Conclusions Our data presented herein confirms results from clinical studies that have suggested pioglitazone-induced adiponectin production is critical for improvements in hepatic steatosis. Furthermore, we have shown adiponectin is important for up-regulation of Fgf21 and down-regulation of miR-192 by pioglitazone, which seems to be mediators of pioglitazone beneficial effects on NAFLD. Statement of ethics The study protocol has been approved by the research institute's committee on human research. Animal experiments conform to internationally accepted standards and have been approved by the appropriate institutional review body. 6
Molecular and Cellular Endocrinology 493 (2019) 110480
M. de Mendonça, et al.
Fig. 4. Liver microRNA expression of adipoWT and adipoKO mice fed a control (C) or a high-fat diet (H) and treated with pioglitazone (HP). *p < 0.05 as indicated by two-way ANOVA. When interaction was significant: *p < 0.05 compared to control within the group For diet (d) or genotype(g) significant effects (*p < 0.05): posttest was performed only considering one of the factors abp < 0.05 compared to C (a) and H (b).
Disclosure statement
(2), 281–297. Retrieved from. https://www.ncbi.nlm.nih.gov/pubmed/14744438. Borji, M., Nourbakhsh, M., Shafiee, S.M., Owji, A.A., Abdolvahabi, Z., Hesari, Z., et al., 2019. Down-regulation of SIRT1 expression by mir-23b contributes to lipid accumulation in HepG2 cells. Biochem. Genet. https://doi.org/10.1007/s10528-01909905-5. Castano, C., Kalko, S., Novials, A., Parrizas, M., 2018. Obesity-associated exosomal miRNAs modulate glucose and lipid metabolism in mice. Proc. Natl. Acad. Sci. U. S. A. 115 (48), 12158–12163. https://doi.org/10.1073/pnas.1808855115. Castro, R.E., Ferreira, D.M., Afonso, M.B., Borralho, P.M., Machado, M.V., Cortez-Pinto, H., Rodrigues, C.M., 2013. miR-34a/SIRT1/p53 is suppressed by ursodeoxycholic acid in the rat liver and activated by disease severity in human non-alcoholic fatty liver disease. J. Hepatol. 58 (1), 119–125. https://doi.org/10.1016/j.jhep.2012.08. 008. Chen, C., Ridzon, D.A., Broomer, A.J., Zhou, Z., Lee, D.H., Nguyen, J.T., et al., 2005. Realtime quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33 (20), e179. https://doi.org/10.1093/nar/gni178. Cheng, K.K., Lam, K.S., Wang, Y., Huang, Y., Carling, D., Wu, D., et al., 2007. Adiponectin-induced endothelial nitric oxide synthase activation and nitric oxide production are mediated by APPL1 in endothelial cells. Diabetes 56 (5), 1387–1394. https://doi.org/10.2337/db06-1580. Da Silva Morais, A., Lebrun, V., Abarca-Quinones, J., Brichard, S., Hue, L., Guigas, B., et al., 2009. Prevention of steatohepatitis by pioglitazone: implication of adiponectindependent inhibition of SREBP-1c and inflammation. J. Hepatol. 50 (3), 489–500. https://doi.org/10.1016/j.jhep.2008.10.027. Dutchak, P.A., Katafuchi, T., Bookout, A.L., Choi, J.H., Yu, R.T., Mangelsdorf, D.J., Kliewer, S.A., 2012. Fibroblast growth factor-21 regulates PPARgamma activity and the antidiabetic actions of thiazolidinediones. Cell 148 (3), 556–567. https://doi.org/ 10.1016/j.cell.2011.11.062. Finck, B.N., Kelly, D.P., 2006. PGC-1 coactivators: inducible regulators of energy metabolism in health and disease. J. Clin. Investig. 116 (3), 615–622. https://doi.org/10. 1172/JCI27794. Fortes, M.A., Marzuca-Nassr, G.N., Vitzel, K.F., da Justa Pinheiro, C.H., Newsholme, P., Curi, R., 2016. Housekeeping proteins: how useful are they in skeletal muscle diabetes studies and muscle hypertrophy models? Anal. Biochem. 504, 38–40. https:// doi.org/10.1016/j.ab.2016.03.023. Frias Fde, T., de Mendonca, M., Martins, A.R., Gindro, A.F., Cogliati, B., Curi, R., Rodrigues, A.C., 2016. MyomiRs as markers of insulin resistance and decreased myogenesis in skeletal muscle of diet-induced obese mice. Front. Endocrinol. 7, 76. https://doi.org/10.3389/fendo.2016.00076.
The authors have no conflicts of interest to declare. Funding sources This study was financed by Fundação de Amparo à Pesquisa do Estado de São Paulo (Research Grant number: 15/24789-8 and Scholarship Grant number: 15/24650-0). Author contributions Conceived and designed the research: MM and ACR. Acquired, analyzed, or interpreted data: MM, BACS, ES and ACR. Wrote the manuscript: MM, ES and ACR. Acknowledgements We thank Professor William Festuccia, PhD for providing adipoKO mice. This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) Finance code 001. Mariana de Mendonça and Erica de Sousa are recipients of fellowships from FAPESP, Sao Paulo, (Grant number: 17/ 19513-9 (MM) and 16/08202- and 18/13793-2 (ES)). We thanks Vitória de Mendonça for making the graphical abstract figure. References Ambros, V., 2004. The functions of animal microRNAs. Nature 431 (7006), 350–355. https://doi.org/10.1038/nature02871. Bartel, D.P., 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116
7
Molecular and Cellular Endocrinology 493 (2019) 110480
M. de Mendonça, et al.
Cell Biol. 8 (5), 516–523. https://doi.org/10.1038/ncb1404. Miyazaki, Y., Matsuda, M., DeFronzo, R.A., 2002. Dose-response effect of pioglitazone on insulin sensitivity and insulin secretion in type 2 diabetes. Diabetes Care 25 (3), 517–523. Retrieved from. http://www.ncbi.nlm.nih.gov/pubmed/11874940. Nakano, Y., Tobe, T., Choi-Miura, N.H., Mazda, T., Tomita, M., 1996. Isolation and characterization of GBP28, a novel gelatin-binding protein purified from human plasma. J. Biochem. 120 (4), 803–812. Retrieved from. http://www.ncbi.nlm.nih. gov/pubmed/8947845. Nawrocki, A.R., Rajala, M.W., Tomas, E., Pajvani, U.B., Saha, A.K., Trumbauer, M.E., et al., 2006. Mice lacking adiponectin show decreased hepatic insulin sensitivity and reduced responsiveness to peroxisome proliferator-activated receptor gamma agonists. J. Biol. Chem. 281 (5), 2654–2660. https://doi.org/10.1074/jbc.M505311200. Oishi, K., Tomita, T., 2011. Thiazolidinediones are potent inducers of fibroblast growth factor 21 expression in the liver. Biol. Pharm. Bull. 34 (7), 1120–1121. Retrieved from. http://www.ncbi.nlm.nih.gov/pubmed/21720023. Ortega, F.J., Moreno-Navarrete, J.M., Pardo, G., Sabater, M., Hummel, M., Ferrer, A., et al., 2010. MiRNA expression profile of human subcutaneous adipose and during adipocyte differentiation. PLoS One 5 (2), e9022. https://doi.org/10.1371/journal. pone.0009022. Pereira, R.I., Leitner, J.W., Erickson, C., Draznin, B., 2008. Pioglitazone acutely stimulates adiponectin secretion from mouse and human adipocytes via activation of the phosphatidylinositol 3'-kinase. Life Sci. 83 (19–20), 638–643. https://doi.org/10. 1016/j.lfs.2008.09.002. Phillips, S.A., Ciaraldi, T.P., Kong, A.P., Bandukwala, R., Aroda, V., Carter, L., et al., 2003. Modulation of circulating and adipose tissue adiponectin levels by antidiabetic therapy. Diabetes 52 (3), 667–674. Retrieved from. http://www.ncbi.nlm.nih.gov/ pubmed/12606507. Reeves, P.G., 1997 May. Components of the AIN-93diets as improvements in the AIN-76A diet. J Nutr. 5 Suppl (19–20), 838S–841S. https://doi.org/10.1093/jn/127.5.838S. Said, A., Akhter, A., 2017. Meta-analysis of randomized controlled trials of pharmacologic agents in non-alcoholic steatohepatitis. Ann. Hepatol. 16 (4), 538–547. https://doi. org/10.5604/01.3001.0010.0284. Santhekadur, P.K., Kumar, D.P., Sanyal, A.J., 2018. Preclinical models of non-alcoholic fatty liver disease. J. Hepatol. 68 (2), 230–237. https://doi.org/10.1016/j.jhep.2017. 10.031. Scherer, P.E., Williams, S., Fogliano, M., Baldini, G., Lodish, H.F., 1995. A novel serum protein similar to C1q, produced exclusively in adipocytes. J. Biol. Chem. 270 (45), 26746–26749. Retrieved from. http://www.ncbi.nlm.nih.gov/pubmed/7592907. Tryndyak, V.P., Latendresse, J.R., Montgomery, B., Ross, S.A., Beland, F.A., Rusyn, I., Pogribny, I.P., 2012. Plasma microRNAs are sensitive indicators of inter-strain differences in the severity of liver injury induced in mice by a choline- and folate-deficient diet. Toxicol. Appl. Pharmacol. 262 (1), 52–59. https://doi.org/10.1016/j. taap.2012.04.018. Yamauchi, T., Kamon, J., Ito, Y., Tsuchida, A., Yokomizo, T., Kita, S., et al., 2003. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 423 (6941), 762–769. https://doi.org/10.1038/nature01705. Yamauchi, T., Kamon, J., Minokoshi, Y., Ito, Y., Waki, H., Uchida, S., et al., 2002. Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nat. Med. 8 (11), 1288–1295. https://doi.org/10. 1038/nm788. Yamauchi, T., Nio, Y., Maki, T., Kobayashi, M., Takazawa, T., Iwabu, M., et al., 2007. Targeted disruption of AdipoR1 and AdipoR2 causes abrogation of adiponectin binding and metabolic actions. Nat. Med. 13 (3), 332–339. https://doi.org/10.1038/ nm1557. Younossi, Z., Anstee, Q.M., Marietti, M., Hardy, T., Henry, L., Eslam, M., et al., 2018. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nat. Rev. Gastroenterol. Hepatol. 15 (1), 11–20. https://doi.org/10.1038/nrgastro. 2017.109. Yu, J., Kong, X., Liu, J., Lv, Y., Sheng, Y., Lv, S., et al., 2014. Expression profiling of PPARgamma-regulated microRNAs in human subcutaneous and visceral adipogenesis in both genders. Endocrinology 155 (6), 2155–2165. https://doi.org/10.1210/en. 2013-2105.
Frias, F.T., Rocha, K.C.E., de Mendonca, M., Murata, G.M., Araujo, H.N., de Sousa, L.G.O., et al., 2018. Fenofibrate reverses changes induced by high-fat diet on metabolism in mice muscle and visceral adipocytes. J. Cell. Physiol. 233 (4), 3515–3528. https:// doi.org/10.1002/jcp.26203. Frost, R.J., Olson, E.N., 2011. Control of glucose homeostasis and insulin sensitivity by the Let-7 family of microRNAs. Proc. Natl. Acad. Sci. U. S. A. 108 (52), 21075–21080. https://doi.org/10.1073/pnas.1118922109. Gastaldelli, A., Harrison, S., Belfort-Aguiar, R., Hardies, J., Balas, B., Schenker, S., Cusi, K., 2010. Pioglitazone in the treatment of NASH: the role of adiponectin. Aliment Pharmacol. Ther. 32 (6), 769–775. https://doi.org/10.1111/j.1365-2036.2010. 04405.x. Hallakou, S., Doare, L., Foufelle, F., Kergoat, M., Guerre-Millo, M., Berthault, M.F., et al., 1997. Pioglitazone induces in vivo adipocyte differentiation in the obese Zucker fa/fa rat. Diabetes 46 (9), 1393–1399. Retrieved from. http://www.ncbi.nlm.nih.gov/ pubmed/9287037. Hu, E., Liang, P., Spiegelman, B.M., 1996. AdipoQ is a novel adipose-specific gene dysregulated in obesity. J. Biol. Chem. 271 (18), 10697–10703. Retrieved from. http:// www.ncbi.nlm.nih.gov/pubmed/8631877. Hug, C., Wang, J., Ahmad, N.S., Bogan, J.S., Tsao, T.S., Lodish, H.F., 2004. T-cadherin is a receptor for hexameric and high-molecular-weight forms of Acrp30/adiponectin. Proc. Natl. Acad. Sci. U. S. A. 101 (28), 10308–10313. https://doi.org/10.1073/pnas. 0403382101. Iwabu, M., Yamauchi, T., Okada-Iwabu, M., Sato, K., Nakagawa, T., Funata, M., et al., 2010. Adiponectin and AdipoR1 regulate PGC-1alpha and mitochondria by Ca(2+) and AMPK/SIRT1. Nature 464 (7293), 1313–1319. https://doi.org/10.1038/ nature08991. Kadowaki, T., Yamauchi, T., 2005. Adiponectin and adiponectin receptors. Endocr. Rev. 26 (3), 439–451. https://doi.org/10.1210/er.2005-0005. Kubota, N., Terauchi, Y., Kubota, T., Kumagai, H., Itoh, S., Satoh, H., et al., 2006. Pioglitazone ameliorates insulin resistance and diabetes by both adiponectin-dependent and -independent pathways. J. Biol. Chem. 281 (13), 8748–8755. https:// doi.org/10.1074/jbc.M505649200. Lavery, C.A., Kurowska-Stolarska, M., Holmes, W.M., Donnelly, I., Caslake, M., Collier, A., et al., 2016. miR-34a(-/-) mice are susceptible to diet-induced obesity. Obesity 24 (8), 1741–1751. https://doi.org/10.1002/oby.21561. Li, J., Zhang, S., 2016. microRNA-150 inhibits the formation of macrophage foam cells through targeting adiponectin receptor 2. Biochem. Biophys. Res. Commun. 476 (4), 218–224. https://doi.org/10.1016/j.bbrc.2016.05.096. Li, L., Wu, L., Wang, C., Liu, L., Zhao, Y., 2007. Adiponectin modulates carnitine palmitoyltransferase-1 through AMPK signaling cascade in rat cardiomyocytes. Regul. Pept. 139 (1–3), 72–79. https://doi.org/10.1016/j.regpep.2006.10.007. Liang, W., Menke, A.L., Driessen, A., Koek, G.H., Lindeman, J.H., Stoop, R., et al., 2014. Establishment of a general NAFLD scoring system for rodent models and comparison to human liver pathology. PLoS One 9 (12), e115922. https://doi.org/10.1371/ journal.pone.0115922. Lin, Y., Ding, D., Huang, Q., Liu, Q., Lu, H., Lu, Y., et al., 2017. Downregulation of miR192 causes hepatic steatosis and lipid accumulation by inducing SREBF1: novel mechanism for bisphenol A-triggered non-alcoholic fatty liver disease. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 1862 (9), 869–882. https://doi.org/10.1016/j. bbalip.2017.05.001. Lin, Z., Tian, H., Lam, K.S., Lin, S., Hoo, R.C., Konishi, M., et al., 2013. Adiponectin mediates the metabolic effects of FGF21 on glucose homeostasis and insulin sensitivity in mice. Cell Metabol. 17 (5), 779–789. https://doi.org/10.1016/j.cmet.2013. 04.005. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25 (4), 402–408. https://doi.org/10.1006/meth.2001.1262. Maeda, K., Okubo, K., Shimomura, I., Funahashi, T., Matsuzawa, Y., Matsubara, K., 1996. cDNA cloning and expression of a novel adipose specific collagen-like factor, apM1 (AdiPose Most abundant Gene transcript 1). Biochem. Biophys. Res. Commun. 221 (2), 286–289. https://doi.org/10.1006/bbrc.1996.0587. Mao, X., Kikani, C.K., Riojas, R.A., Langlais, P., Wang, L., Ramos, F.J., et al., 2006. APPL1 binds to adiponectin receptors and mediates adiponectin signalling and function. Nat.
8