AdipoRon promotes diabetic fracture repair through endochondral ossification-based bone repair by enhancing survival and differentiation of chondrocytes

Journal Pre-proof AdipoRon promotes diabetic fracture repair through endochondral ossification-based bone repair by enhancing survival and differentiation of chondrocytes Zhongyi Wang, Jinxin Tang, Ying Li, Yu Wang, Yanyang Guo, Qisheng Tu, Jake Chen, Chen Wang PII:

S0014-4827(19)30640-8

DOI:

https://doi.org/10.1016/j.yexcr.2019.111757

Reference:

YEXCR 111757

To appear in:

Experimental Cell Research

Received Date: 29 August 2019 Revised Date:

3 December 2019

Accepted Date: 4 December 2019

Please cite this article as: Z. Wang, J. Tang, Y. Li, Y. Wang, Y. Guo, Q. Tu, J. Chen, C. Wang, AdipoRon promotes diabetic fracture repair through endochondral ossification-based bone repair by enhancing survival and differentiation of chondrocytes, Experimental Cell Research (2020), doi: https:// doi.org/10.1016/j.yexcr.2019.111757. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier Inc.

Title page Article title AdipoRon promotes diabetic fracture repair through endochondral ossification-based bone repair by enhancing survival and differentiation of chondrocytes Authors Zhongyi Wanga1 , Jinxin Tanga1, Ying Lib, Yu Wanga, Yanyang Guoa, Qisheng Tuc, Jake Chenc,*, Chen Wanga,** a

Jiangsu Key Laboratory of Oral Diseases, Department of Prosthodontics, Affiliated

Hospital of Stomatology, Nanjing Medical University, Nanjing 210029, China. b

Department of Stomatology, Jinan Central Hospital Affiliated to Shandong University,

Jinan 250013, China. c

Tufts School of Dental Medicine, Sackler School of Graduate Biomedical Sciences,

Tufts School of Medicine, Boston 02111, USA. Correspondence * Jake Chen

Address: NO.136, Harrison Ave, Boston, MA 02111, USA.

Tel: 617-636-2729. E-mail: [email protected] **Chen Wang

Address: No.136, Han-zhong Road, Nanjing 210029, P.R.China.

Tel: 0086-25-85031831. 1

E-mail: [email protected]

These authors contributed equally to this work.

Highlights • AdipoRon ameliorated chondrocyte survival and differentiation in diabetes. • ERK1/2 is the key pathway that mediates the effects of AdipoRon on chondrocyte. • AdipoRon stimulated bone regeneration via endochondral ossification in diabetes. Abbreviations AdipoR1: APN receptor 1; AdipoR2: APN receptor 2; AGC: Aggrecan AGEs: advanced glycation end products; APN: adiponectin; ASCs: adipose-derived mesenchymal stem cells; BMSCs: bone marrow-derived mesenchymal stem cells; BSA: bovine serum albumin; cDNA: complementary DNA; Col II: Collagen type II; Col X: Collagen type X; DCFH-DA: 2’,7’ –dichlorodihydrofluorescein diacetate;

ddwater: double distilled water; DIO: diet-induced-obesity; DM: diabetes mellitus; ECO:

endochondral

ossification;

EDTA:

ethylenediaminetetraacetate;

ERK:

extracellular signal-related kinases; HG: high glucose; ICH: intracerebral hemorrhage;; MSCs: mesenchymal stem cells; PVDF: polyvinylidene difluoride; ROS: oxygen species; SOX9: Sry-type HMG box-9; T2DM: type 2 diabetes; CCA: cartilaginous callus area; TCA：TCA: total callus area; ROI: region of interest; BV: bone volume; TV: tissue volume; Tb. N: trabecular number; Tb. Th: trabecular thickness; Tb. Sp: trabecular separation; Ct.Ar: cortical bone area; Tt.Ar: total cross-sectional area inside the periosteal envelope; TNF-α: tumor necrosis factor; VEGF: vascular endothelial growth factor. Abstract Diabetic bone defects may exhibit impaired endochondral ossification (ECO) leading to delayed bone repair. AdipoRon, a receptor agonist of adiponectin polymers, can ameliorate diabetes and related complications, as well as overcome the disadvantages of the unstable structure of artificial adiponectin polymers. Here, the effects of AdipoRon on the survival and differentiation of chondrocytes in a diabetic environment were explored focusing on related mechanisms in gene and protein levels. In vivo, AdipoRon was applied to diet-induced-obesity (DIO) mice, a model of obesity and type 2 diabetes, with femoral fracture. Sequential histological evaluations and micro-CT were examined for further verification. We found that AdipoRon could ameliorate cell viability, apoptosis, and reactive oxygen species (ROS) production and promote mRNA expression of chondrogenic markers and cartilaginous matrix production of ATDC5 cells in high glucose medium via activating ERK1/2 pathway. Additionally, DIO mice with intragastric AdipoRon administration had more neocartilage and accelerated new bone formation. These data suggest that AdipoRon could stimulate bone regeneration via ECO. Keywords: AdipoRon, endochondral ossification, bone regeneration, diabetes mellitus, apoptosis, ERK1/2 pathway Conflicts of interest The authors have declared that no conflict of interest exists.

Funding This study was supported by the National Natural Science Foundation of China (No. 81300913), the Natural Science Foundation of Jiangsu Province of China (No. BK20161566) and Postgraduate Research & Practice Innovation Program of Jiangsu Province (No. KYCX18_1511). A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD, 2018-87), and NIH Grants (No. DE25681 and DE26507). Declarations of interest None. Data Statement The data that support the findings of this study are available from the corresponding author upon reasonable request. Credit Author Statement Zhongyi Wang: Data curation, Formal analysis, Investigation, Methodology, Software, Visualization, Roles/Writing-original draft, Writing-review & editing. Jinxin Tang: Formal analysis, Investigation, Methodology, Writing-review & editing. Ying Li: Investigation, Supervision. Yu Wang: Writing-review & editing. Yanyang Guo: Writing-review & editing. Qisheng Tu: Investigation, Supervision. Jake Chen: Conceptualization, Funding acquisition, Project administration, Resources. Chen Wang: Conceptualization, Funding acquisition, Project administration, Resources, Validation, Writing-review & editing. Acknowledgments None.

Main Text AdipoRon promotes diabetic fracture repair through endochondral ossification–based bone repair by enhancing survival and differentiation of chondrocytes Zhongyi Wanga, 1 , Jinxin Tanga,1, Ying Lib, Yu Wanga, Yanyang Guoa, Qisheng Tuc, Jake Chenc,*, Chen Wanga,** a

Jiangsu Key Laboratory of Oral Diseases, Department of Prosthodontics, Affiliated

Hospital of Stomatology, Nanjing Medical University, Nanjing 210029, China. b

Department of Stomatology, Jinan Central Hospital Affiliated to Shandong University,

Jinan 250013, China. c

Tufts School of Dental Medicine, Sackler School of Graduate Biomedical Sciences,

Tufts School of Medicine, Boston 02111, USA. To whom correspondence should be addressed. * Jake Chen

Address: NO.136, Harrison Ave, Boston, MA 02111, USA.

Tel: 617-636-2729. E-mail: [email protected] **Chen Wang

Address: No.136, Han-zhong Road, Nanjing 210029, P.R.China.

Tel: 0086-25-85031831. 1

E-mail: [email protected].

These authors contributed equally to this work.

Abstract Diabetic bone defects may exhibit impaired endochondral ossification (ECO) leading to delayed bone repair. AdipoRon, a receptor agonist of adiponectin polymers, can ameliorate diabetes and related complications, as well as overcome the disadvantage of the unstable structure of artificial adiponectin polymers. Here, the effects of AdipoRon on the survival and differentiation of chondrocytes in a diabetic environment were explored focusing on related mechanisms in gene and protein levels. In vivo, AdipoRon was applied to diet-induced-obesity (DIO) mice with femoral fracture. Sequential histological evaluations and micro-CT were examined for further

verification. We found that AdipoRon could ameliorate cell viability, apoptosis, and reactive oxygen species (ROS) production and promote mRNA expression of chondrogenic markers and cartilaginous matrix production of ATDC5 cells in high glucose medium via activating ERK1/2 pathway. Additionally, DIO mice with intragastric AdipoRon administration had more neocartilage and accelerated new bone formation. These data suggest that AdipoRon could stimulate bone regeneration via ECO.

Keywords: AdipoRon, endochondral ossification, bone regeneration, diabetes mellitus, apoptosis, ERK1/2 pathway

1. Introduction Diabetes mellitus (DM) is a group of chronic metabolic diseases characterized by hyperglycemia. Over 440 million people, nearly 8.8% of the global adult population, are plagued by it worldwide causing an enormous burden on the healthcare system [1]. This glucose metabolism disorder gives rise to complications involving the majority of the organs of diabetes patients [2]. Diabetes-related bone disease is one such complication, with higher rates of fractures and impaired bone regeneration ability posing a great challenge to clinicians [3, 4]. Endochondral ossification (ECO) is vital for appendicular bone development and reconstuction. Chondrocytes play an indispensable role in ECO [5, 6]. Growing evidence demonstrates that hyperglycemia can suppress the chondrogenic differentiation of mesenchymal stem cells (MSCs) [7-9] and induce the production of reactive oxygen species (ROS), tumor necrosis factor (TNF-α), and advanced glycation end products (AGEs), which facilitate chondrocyte apoptosis. Impaired differentiation and apoptosis of chondrocytes are associated with diminished hypertrophic chondrocytes and cartilage-related matrix synthesis, leading to damaged bone elongation and delayed fracture repair [10-13]. However, to our knowledge, few drugs can alleviate the diabetes-associated adverse effects on ECO. Hence, discovering an effective therapeutic method that can improve chondrocyte apoptosis

and chondrogenic differentiation to stimulate ECO-based bone repair in diabetic bone disease is critically imperative. Adiponectin (APN), the most promising adipokine for intervention in obesity-related disorders, exerts anti-inflammatory, antioxidant, and anti-apoptotic effects, especially in DM [14-18]. Humans and mice with obesity and type 2 diabetes (T2DM) exhibit decreased plasma APN and APN receptors (AdipoRs) levels [19, 20]. Replenishment of APN has been proved to increase fatty-acid oxidation to directly regulate glucose metabolism and reverse insulin resistance not only in lipoatrophic, but also obesity and type 2 diabetic mice [21, 22]. Recently, there has been increased interest in the applications of APN in diabetic bone repair therapy. Yu, et al. found that APN can facilitate the migration and recruitment of bone marrow-derived MSCs (BMSCs) in response to bone injury, especially in T2DM patients [23]. Zhang, et al. reported its role in inhibiting bone resorption and decreasing inflammation of T2DM mice [24]. Although the anti-diabetic effects of APN have been highlighted, its high molecular weight and short half-life make it difficult to produce and administer [21, 25]. Moreover, the inconvenience of constant intravenous injection and the elicit effects of excessive circulating concentration limit its clinical application [26]. AdipoRon, an oral AdipoR agonist, can deliver the favorable effects of APN and does not influence it’s plasma level in db/db mice [14, 27-29]. In diabetic nephropathy, AdipoRon apparently ameliorated the oxidative stress and apoptosis of glomerular endothelial cells and podocytes, protecting against renal damage [14, 29]. In diet-induced-obesity (DIO) mice, AdipoRon can significantly reduce plasma glucose levels, promote postperiodontitis alveolar bone regeneration, and inhibit osteoclastogenesis [27, 30]. Therefore, AdipoRon may be a curative agent for bone regeneration in diabetes. Challa, et al. demonstrated that APN can enhance proliferation, proteoglycan synthesis, and matrix mineralization of the mouse chondrocyte cell line ATDC5 cells [31]. However, to our knowledge, there are few investigations on whether AdipoRon can affect ECO and what its role is in diabetic bone regeneration [32]. In this study, ATDC5 cells, which can undergo a similar chondrogenic process as chondrocyte differentiation [33], were used as an in vitro model to study ECO. We

investigated the effects and underlying mechanism of AdipoRon on oxidative stress, apoptosis, and chondrogenic differentiation of ATDC5 cells in HG medium. To directly address the role of AdipoRon in diabetes-associated bone regeneration, DIO mice [34] with femoral fracture were used. Intragastric AdipoRon administration accelerated cartilage callus formation and mineralization through ECO, suggesting promising prospects for the therapeutic application of AdipoRon for improving ECO-based repair in diabetes.

2. Materials and Methods 2.1 Cell preparation and culture The mouse chondrocyte cell line ATDC5 was purchased from Shanghai Institute of Biosciences Cell Resource Center, Chinese Academy of Sciences. Cells were cultured in L-DMEM (GIBCO, Life Technology, Grand Island, NY, USA) supplemented with 10% Fetal Bovine Serum (GIBCO) and 1% penicillin/streptomycin (Hyclone, GE healthcare life sciences, Pasching, Austria) in 5% CO2 at 37 °C. Cells were harvested with 0.25% Trypsin-EDTA (GIBCO) after reaching 85-90% confluence. 2.2 Cell viability assay Cell viability was detected by 3-[4,5-dimethylthiazol-2-yl]-5-[3-carboxymethoxyphenyl]-2-[4-sulfophenyl]-2H-tetra zolium, inner salt (MTS, Bestbio, Shanghai, China) colorimetric assay. Briefly, ATDC5 cells were seeded in 96-well plates at a density of 5×103 per well. Cells were left to adhere for 24 h. Then, cells cultured with L-DMEM containing indicated doses of D-glucose (KESHI, Sinopharm Chemical Reagent, Chengdu, China), and AdipoRon for 24 and 72 h. The MTS assay was performed according to the manufacturer’s instructions. The absorbance was evaluated at 490 nm using a microplate reader (SpectraMax M2, Molecular Devices LLC, Sunnyvale, CA, USA). Cell viability was normalized to the control. 2.3 Flow cytometric analysis ATDC5 cells were seeded in 6-well plates at a density of 105 per well. Cells were left to adhere for 24 h. Cells were then treated with L-DMEM containing increasing doses

of D-glucose (5.5, 50, 100, 150, and 200 mmol/L), AdipoRon (0, 1, and 5 µg/mL), ROS (Beyotime, Beyotime Biotechnology, Jiangsu, China) (0 and 50 µg/mL), and PD98059 (MedChem Express, Monmouth Junction, NJ, USA) (0 and 6 µM) for 24h. Following treatment, ATDC5 cells were collected and then labeled with FITC-Annexin V and PI (Fcmacs, Nanjing, China) in binding buffer, according to the manufacturer’s instructions. The percentage of apoptotic cells present was determined by recording and analyzing 10,000 events using a FACScan flow cytometer (BD Bioscience, San Jose, CA, USA). Following the same treatment, the intracellular ROS levels were measured using a 2’,7’-dichlorodihydrofluorescein diacetate (DCFH-DA) assay kit (Beyotime). The level of intracellular ROS was analyzed by a FACScan flow cytometer and expressed as mean fluorescence intensity. 2.4 Quantitative real-time polymerase chain reaction (RT-PCR) Total RNA was isolated from ATDC5 cells incubated in chondrogenic medium (L-DMEM + 1% Insulin-Transferrin-Selenium Solution 100x) with D-glucose (5.5, 100, and 200 mmol/L), AdipoRon (0 and 1 µg/mL) and PD98059 (0 and 6 µM) for 7 and 14 days, using TRIzol reagent (Invitrogen, Carlsbad, CA, United States) according to the supplier’s protocol. A total of 1.0 µg RNA from each sample was used to synthesize complementary DNA (cDNA) with the PrimeScript 1st Strand cDNA Synthesis kit (TaKaRa, Tokyo, Japan) in a T3 thermocycler (Mastercycler 5333, Eppendorf, Hamburg, Germany). Quantitative PCR was performed using the FastStart universal SYBR Green Master (ROX) kit (Roche, Basel, Switzerland) on a quantitative real-time amplification system (7900HT Fast, Applied Biosystems, Foster City,CA, USA). Relative mRNA expression of the target gene, normalized to the housekeeping gene GAPDH, was then calculated by the 2-∆∆Ct method. Primer sequences used in the PCR are listed in Table 1. Table 1 Primers used for real time RT-PCR Target gene

Forward primer sequence (5’-3’)

Reverse primer sequence (5’-3’)

Agc

CCTGCTACTTCATCGACCCC

AGATGCTGTTGACTCGAACCT

Col II

TGGTGGAGCAGCAAGAGCAA

CAGTGGACAGTAGACGGAGGAAA

Sox9

GAGCCGGATCTGAAGAGGGA

GCTTGACGTGTGGCTTGTTC

Col X

TTCTGCTGCTAATGTTCTTGACC

GGGATGAAGTATTGTGTCTTGGG

GAPDH

GACCCCTTCATTGACCTCAACTAC

CACGGAGGCCATGCCAGYGAG

2.5 Alcian blue staining The production of cartilaginous matrices was observed through Alcian blue staining. ATDC5 cells seeded in 12-well plates were cultured in chondrogenic medium for 7 and 14 days, with indicated doses of D-glucose, AdipoRon, and PD98059. After washing with PBS, the samples were fixed with methanol for 5 minutes and then stained with Alcian blue for 30 min. The stained cells were washed three times with double distilled water and then photographed. 2.6 Western blot analysis ATDC5 cells were incubated in L-DMEM with/without 1 µg/mL AdipoRon and increasing concentrations of D-glucose (5.5, 100, 150, and 200 mM) for 24h. Cells were then lysed in icy RIPA buffer (Beyotime) for half an hour. Cell lysates were centrifuged at 12,000 rpm at 4°C for 10 minutes, and the supernatants were stored at -20 °C for analysis. Equal amount of proteins (35 µg) were electrophoresed by 12% SDS-PAGE and then transferred to a polyvinylidene difluoride (PVDF) membrane. After blocking with 5% bovine serum albumin (BSA) for 2 hours at room temperature, the membranes were incubated with anti-p-extracellular signal-related kinases (ERK) -1/2, anti-ERK1/2, and GAPDH (1:1,000, rabbit polyclonal antibodies, Cell Signaling Technology, Boston, MA, USA) for immunoblotting at 4 °C overnight. After rinsing three times and secondary antibodies for 1 hour, immunoreactive bands were detected using a chemiluminescence gel imaging system (LAS4000M; GE Healthcare Bio-Sciences AB, Uppsala, Sweden). The ratio of the p-ERK to ERK was quantified using ImageJ v.1.4 analysis software (Bethesda, MD, USA). 2.7 Ethics Statement All mice were used following recommendations from the Guide for the Care and Use of Laboratory Animals prepared by the Institute on Laboratory Animal Resources,

National Research Council (Department of Health and Human Services Publication NIH 86-23, 1985). The experimental protocol was approved by the Institutional Animal Care and Use Committee at Tufts University. 2.8 Mice, Experimental femoral fracture model establishment, and AdipoRon intragastric administration WT (C57BL/6J, Jax #000664) and DIO (Jax #380050) male mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). DIO mice were fed a 60% high fat diet at six weeks of age. The mice were divided into three groups per time point (three time points): WT, DIO, DIO+AdipoRon (n=5). Femoral fracture surgeries were performed on 12-14 week-old WT and DIO mice as described [35]. Briefly, each mouse was anesthetized with ketamine (80 mg/kg) and xylazine (10 mg/kg) by intraperitoneal injection, and a ~1.5 cm longitudinal incision was created along the axis of femur extending from the greater trochanter to the knee joint. A transverse osteotomy was made in the mid-diaphysis of the femur using a low-speed rotary diamond disk with saline irrigation. The fractured bones were immediately repositioned and stabilized by inserting a 23-gauge intramedullary needle. In the AdipoRon group, mice were treated with AdipoRon intragastricly (50 mg/kg) every day [27]. The mice were sacrificed for analyses at 1, 2, and 4 weeks after surgery. 2.9 Micro-CT analysis of endochondral bone formation at the fracture sites The morphology of the femur defects was assessed using a viva CT 80 (Scanco Medical AG, Brüttisellen, Zurich, Switzerland). Micro-CT parameters were 55 kV, 145 mA, 200 ms of integration time, 1024 × 1024 pixel resolution and an isotropic voxel size of 8.8 µm for the scanning region. CT Analyser v.1.15 (Bruker, Billerica, MA, USA) and CTVox v.3.0 (Bruker) were used for three-dimensional (3D) reconstructions of the defect site. For micro-CT analysis [36], femurs were analyzed by DataViewer v.1.5 (Bruker) and CT Analyser v.1.15. The mineral density of objects was presented as a grayscale index from 0 to 255 [37]. For femoral geometry analysis in the process of bone repair, the segmentation of mineralized structure was computed at threshold above 80 and nonmineralized structure was below 80. Contour lines of

trabecular number (Tb. N), trabecular thickness (Tb. Th) and trabecular separation (Tb. Sp) analysis were applied to endosteal surface, while bone volume/tissue volume (BV/TV), cortical bone area/total cross-sectional area inside the periosteal envelope (Ct.Ar/Tt.Ar) analysis were applied to periosteal surface [38, 39]. For fracture callus analysis in the process of bone remodeling, the contour lines were applied to the callus surfaces, and the segmentation of mineralized structure was computed at threshold above 50 and nonmineralized structure was below 50. Callus density was calibrated by using two hydroxyapatite phantoms with defined density of 250 and 750 mg/cm3. Intact region of interest (ROI) consisted of 101 slices centered at the fracture line/callus midpoint, and the length of the ROI was 0.89 mm. 2.10 Safranin O/fast green staining For histological assessment, harvested femurs were fixed in 4% paraformldehyde then decalcified with 5% ethylenediaminetetraacetate (EDTA) solution. Samples were subsequently embedded in paraffin and sliced into 7 µm sections by a Leica RM2235 rotary microtome (Leica Biosystems, Nussloch, Eisfeld, Germany). Slides were stained using Safranin O/fast green. Afterwards, digital images for all stained slides were captured with a Leica DM 4000B microscope (Leica Microsystems, Wetzlar, Germany). Finally, we selected the region spanning 6 mm on both side of the fracture line as identical ROI, and quantified the ratio of cartilaginous callus area (CCA) in total callus area (TCA) by Image-Pro Plus 6.0 software (Media Cybernetics, Silver Spring, MD, USA) according to histologic staining.

2.11 Statistical analysis All data were used normality test and homogeneity of variance test to determine that they meet normality and homoscedasticity. Data are expressed as mean ± standard deviation (SD) of at least three separate experiments. Statistical analyses were conducted using SPSS 24.0 software (SPSS Inc., Chicago, USA) via one-way ANOVA and two-way ANOVA (group and time in micro-CT analysis). Statistical significance were determined by post hoc LSD analysis. Values of P< 0.05 were considered statistically significant. Statistical analysis was presented with GraphPad

Prism 5 (GraphPad software, La Jolla, CA).

3. Results 3.1 AdipoRon enhanced cell viability of ATDC5 in HG medium Cell metabolic activity was evaluated after exposing ATDC5 cells to HG for 24 and 72 h. As shown in Figure 1A and B, cell viability decreased in a dose-dependent manner after treatment with 100-250 mM HG glucose medium by 15-20% compared to control, while concentrations of glucose higher than 300 mM resulted in a significant decrease in cell viability. As shown in Figure 1C and D, 1-20 µg/mL AdipoRon supplementation for 24 to 72 h improved cell viability in HG medium, and 1 µg/mL AdipoRon (the lowest dose) exhibited the best effects. Moreover, HG induced more damage to ATDC5 cells than the same osmolarity of mannitol, especially over 350 mM (Figure 2s). Therefore, no osmotic control was used for the subsequent experiments.

Figure 1. AdipoRon enhanced cell viability of ATDC5 in HG medium. The viability of ATDC5 cells cultured with indicated concentrations of glucose and AdipoRon was measured for (A, C) 24 and (B, D) 72 h. *P<0.05, **P<0.01, ***P<0.001 versus the control; #P<0.05,

##

P<0.01,

###

P<0.001 versus the 0 µg/mL

AdipoRon group in the same glucose concentration. Cells incubated in 5.5 mM glucose medium without AdipoRon treatment were set as the control group, and cell viability was normalized as a percentage of control. Abbreviations: HG, high glucose.

3.2 AdipoRon rescued HG-induced apoptosis in ATDC5 cells To further investigate the cytotoxicity of HG on ATDC5 cells, apoptosis was quantified. After 24 h of incubation with 100, 150, and 200 mM HG medium, cell apoptosis rates increased by 120%, 150%, and 200% compared to the control group, respectively. 1 µg/mL AdipoRon protected ATDC5 cells from apoptosis in 50-150 mM HG medium, however, concentrations over 200 mM exhibited cytotoxicity too high to be rescued by AdipoRon (Figure 2). 100, 150, and 200 mM glucose medium were therefore chosen as HG in vitro models with decreasing ATDC5 cell viability and increasing apoptosis rates to mimic the diabetic bone environment. Moreover, 5 µg/mL AdipoRon can induce a slight increase of ATDC5 cell apoptosis in normal glucose medium. Thus, a concentration of 1 µg/mL AdipoRon, which protected ATDC5 cells well from HG medium damage, was used in all subsequent experiments.

Figure 2. AdipoRon rescued HG-induced apoptosis in ATDC5 cells. ATDC5 cells were treated with indicated concentrations of glucose and AdipoRon for 24 h. (A) Representative scatter plots show ATDC5 apoptosis levels determined by flow cytometry. (B) Apoptosis rate of ATDC5 cells. *P< 0.05, **P< 0.01, ***P<0.001 vs. the control, #P< 0.05,

##

P< 0.01 vs. the 0 µg/mL AdipoRon group in the same

glucose concentration. Cells incubated in 5.5 mM glucose medium without AdipoRon treatment were set as the control group. Abbreviations: HG, high glucose.

3.3 Inhibitory effect of AdipoRon on HG-induced oxidative stress in ATDC5 cells HG environment may induce oxidative stress in cells, leading to serious cell injury. The quantification of intracellular ROS production was used to reflect the HG-induced oxidative stress in ATDC5 cells. As shown in Figure 3 after incubation in HG medium for 24 h, ROS levels in ATDC5 cells significantly increased in a dose-dependent manner. Not unexpectedly, 1 µg/mL AdipoRon ameliorated intracellular ROS generation to protect ATDC5 cells from oxidative stress injury (Figure 3).

Figure 3. Inhibitory effect of AdipoRon on HG-induced oxidative stress in ATDC5 cells. Quantification of the intracellular ROS levels in ATDC5 cells treated with indicated concentrations of glucose and AdipoRon for 24 h. ***P< 0.001 vs. the control;

##

P<

0.01 vs. the 0 µg/mL AdipoRon group in the same glucose concentration. Cells incubated in 5.5 mM glucose medium without AdipoRon treatment were set as the control group. Abbreviations: HG, high glucose; ROS, reactive oxygen species.

3.4 AdipoRon upregulated the mRNA expression levels of chondrogenic markers in ATDC5 cells in HG medium

To further uncover the effects of AdipoRon on chondrogenic differentiation of ATDC5 cells in a HG environment, we assessed the mRNA expression levels of chondrogenic markers, including Aggrecan (AGC), Collagen type II (Col II), Collagen type X (Col X) and Sry-type HMG box-9 (SOX9) by quantitative RT-PCR analysis. The gene expression profile demonstrated that 1 µg/mL AdipoRon upregulated chondrogenic differentiation of ATDC5 cells in HG medium. On culture day 7, in ATDC5 cells cultured with 200 mM glucose medium, AdipoRon doubled or tripled the expression of COL II, AGC and SOX9, as well as upregulated the expression of COL X. However, only the expression of COL X and SOX9 in ATDC5 cells cultured with 100 mM glucose medium was obviously upregulated by AdiopoRon, while the expression of COL II and AGC was not changed (Figure 4A). On culture day 14, AdipoRon doubled and tripled the expression of COL II and SOX9 respectively, as well as increased the expression of AGC and COL X significantly in ATDC5 cultured with 100 mM glucose medium, whereas only the expression of COL X in 200 mM glucose medium was elevated by AdipoRon. Upregulation was not observed in the remaining 3 chondrogenic genes (AGC, COL II, and SOX9) (Figure 4B). When adding PD98059 to HG medium, the protective effects of AdipoRon on chondrogenic differentiation of ATDC5 cells were inhibited. Taken together, these changes in the expression of chondrogenic markers suggested that AdipoRon promoted chondrogenic differentiation of ATDC5 cells in HG medium.

Figure 4. AdipoRon upregulated the mRNA expression of chondrogenic markers in ATDC5 cells. Chondrogenic differentiation-related gene expression in ATDC5 cells cultured with indicated concentrations of glucose, AdipoRon, and PD98059 for (A) 7 and (B) 14 days. (*), (**), and (***) indicate P< 0.05, P< 0.01, and P< 0.001, respectively, in comparison with the 0 µg/mL AdipoRon group in the same glucose concentration. (#),

(##), and (###) indicate P< 0.05, P< 0.01, and P< 0.001, respectively, representing the comparison between the 1 µg/mL AdipoRon group and the 1 µg/mL AdipoRon + PD98059 group in the same glucose concentration.

3.5 AdipoRon stimulated chondrogenic differentiation of ATDC5 cells in HG medium To visually observe the production of cartilaginous matrices and chondrogenic differentiation of ATDC5 cells in HG medium, cells were incubated with indicated concentrations of glucose in chondrogenic medium for 7 and 14 days and followed by Alcian blue staining. As shown in Figure 5, cells cultured in HG medium had shriveled and irregular shapes and produced less cartilaginous matrix. Consistent with above results, after supplementation with 1 µg/mL AdipoRon, more cartilaginous matrix deposition of ATDC5 cells were observed on day 14 compared with HG groups.

Figure 5. AdipoRon stimulated chondrogenic differentiation of ATDC5 cells in HG medium

ATDC5 cells were incubated with indicated concentrations of glucose and AdipoRon in chondrogenic medium for (A) 7 and (B) 14 days. The cartilaginous matrices were then visualized by Alcian blue staining. Scale bars: 200 µm. Cells incubated in 5.5 mM glucose medium without AdipoRon treatment were set as the control group. Abbreviations: G, glucose medium; HG, high glucose.

3.6 AdipoRon ameliorated HG-induced oxidative stress and apoptosis and improved chondrogenic differentiation of ATDC5 cells via activating the ERK1/2 pathway To investigate the mechanisms involved in the oxidative stress, apoptosis, and chondrogenic differentiation of ATDC5 cells in HG medium treated with AdipoRon, the ERK1/2 signaling pathway was examined. As shown in Figure 6, the expression of total ERK1/2 remains unaltered, and p-ERK1/2 levels decreased in ATDC5 cells treated with 150 and 200 mM glucose medium for 24 h. AdipoRon supplementation significantly increased the p-ERK1/2 levels, except for the 200 mM glucose group. To reveal whether the activation of ERK1/2 is necessary for the observed effects of AdipoRon on antioxidation, anti-apoptosis, and chondrogenic differentiation of ATDC5 cells, a specific MEK inhibitor, PD98059, was used. PD98059 significantly reduced the mRNA levels of chondrogenic markers in ATDC5 cells cultured with HG medium (Figure 4). The irreversible suppression of ERK1/2 by PD98059 can lead to reduced chondrogenesis (Figure 8), increased cell apoptosis, and intracellular ROS production, which also can give rise to cell apoptosis (Figure 7). Interestingly, when p-ERK1/2 levels are irreversibly suppressed by PD98059, AdipoRon failed to rescue impaired apoptosis and chondrogenesis of cells, although it led to decreased ROS production (Figure 7 and 8). However, the ERK1/2 suppression by HG medium can be counteracted by 1 µg/mL AdipoRon to improve chondrogenesis (Figure 5), reduce apoptosis (Figure 2, 7A and B), and decrease oxidative stress (Figure 7C).

Figure 6. AdipoRon rescued the suppression of p-ERK1/2 levels of ATDC5 cells in HG medium. ATDC5 cells were treated with indicated concentrations of glucose and AdipoRon for 24 h. (A) Phosphorylation of key kinases involved in ERK1/2 pathways were assessed by Western blot analysis. Representative blots are shown. (B) Densitometric measurements of ERK1/2 and p-ERK1/2 from part (A). The integrated density was normalized as a percentage of ERK1/2. *P< 0.05, ***P< 0.001 vs. the control, #P< 0.05,

##

P< 0.01 vs. the 0 µg/mL AdipoRon group in the same glucose concentration.

Cells incubated in 5.5 mM glucose medium without AdipoRon treatment were set as the control group. Abbreviations: HG, high glucose.

Figure 7. AdipoRon ameliorated HG-induced oxidative stress and apoptosis of ATDC5 cells by activating the ERK1/2 pathway. ATDC5 cells were treated with indicated concentrations of glucose, ROS, PD98059, and AdipoRon for 24 h. (A) Representative scatter plots showed ATDC5 apoptosis levels determined by flow cytometry. (B) Apoptosis rate of ATDC5 cells. (C) Intracellular ROS results were analyzed. *P< 0.05, **P< 0.01, ***P< 0.001 vs. the control; #P< 0.05, ###P< 0.001 vs. the ROS group in the same glucose concentration; $$

P< 0.01 vs. the 100 mM glucose group;

&&

p < 0.01 vs. the 100 mM glucose +

PD98059 group; ns = not significant. Untreated cells incubated in 5.5 mM glucose medium were set as the control group.

Figure 8. AdipoRon ameliorated HG-induced reduced chondrogenesis of ATDC5 cells via activation of the ERK1/2 pathway. ATDC5 cells were incubated with indicated concentrations of glucose and PD98059 in chondrogenic medium for (A) 7 and (B) 14 days. The cartilaginous matrices were then visualized by Alcian blue staining. Untreated cells incubated in 5.5 mM glucose medium were set as the control group. Abbreviations: HG, high glucose; G, glucose medium.

3.7 Intragastric administration of AdipoRon promoted ECO-based bone repair in DIO mice At one week postsurgery, Safranin O/Fast Green staining showed that the newly formed cartilage invaded into most of the fracture sites from the edge to the center in both the WT and AdipoRon groups, suggesting the beginning of ECO. In contrast, cartilage was hardly seen around the fracture in the DIO group (Figure 9A). After two weeks, a small amount of newly formed cartilage tissue was observed in the DIO

group, and it mainly presented in the peripheral region of the fracture. Compared with the DIO group, abundant and denser cartilage tissue was detected in the WT and AdipoRon groups. As qualitative results show, the percentage of cartilaginous callus area (CCA) in total callus area (TCA) was significantly lower in the DIO than the WT group (P<0.05), while intragastric administration of AdipoRon in the DIO mice could obviously increase the ratio of cartilaginous callus (Figure 9B). Safranin O/Fast Green staining evaluation indicated that AdipoRon accelerated ECO in the fracture area of the DIO mice (Figure 9). Subsequently, femoral geometry and fracture calluses under the process of bony repair were evaluated using micro-CT analysis. One week following surgery, there was little visible bone callus around the fracture in all groups (Figure 10A). Compared to the DIO group, BV/TV, Ct.Ar/Tt.Ar, and Tb. N significantly increased in the AdipoRon group (Figure 10B). After two weeks, callus began to be generated from the metaphysis to the fracture site in both the WT and AdipoRon groups (Figure 10A). The least bony callus, as well as the lowest BV/TV, Ct.Ar/Tt.Ar, Tb. N, and Tb. Sp were observed in the DIO group (Figure 10B and C). In contrast, the best value of the five indices occurred in the AdipoRon group, which is consistent with the results of the Safranin O/Fast Green staining (Figure 9 and 10). Four weeks post-operation, a large number of calluses and visible fracture lines were detected in DIO group which demonstrated the delayed fracture repair (Figure 10A and C2). Compared with the DIO group, the WT and AdipoRon groups had blurry/disappeared fracture lines and decreased callus volume, which may be due to osteoclastic remodeling. The increased mineralized callus and callus density showed a trend towards stronger callus in the WT and AdipoRon groups (Figure 10C). Moreover, through longitudinal comparison, cortical bone area/total cross-sectional area (Ct.Ar/Tt.Ar), bone volume/tissue volume (BV/TV), trabecular number (Tb. N), and callus mineralized percentage of the AdipoRon group were increased more significantly and quickly than the DIO group. In short, compared to the DIO group, the observed differences between the groups and the three time-points indicated more osteogenic callus formation and higher quality and accelerated bone repair in the AdipoRon group during the early stages of fracture repair.

Figure 9 Histologic analysis of newly formed cartilage at early stage endochondral bone formation. Mice were sacrificed after a recovery period of 1 and 2 weeks following surgery with indicated treatments. (A) Representative Safranin O/fast green histological staining (100x magnification) of femurs in WT, DIO and AdipoRon-treated DIO mice. Red color indicates newly formed cartilage area. (B) The percentage of CCA in TCA was quantified according to Safranin O/fast green staining in mice two weeks post-surgery. *P< 0.05 vs. the WT group; $$P< 0.01 vs. the DIO group. Abbreviations: DIO mice, diet-induced obesity mice; CCA，cartilaginous callus area; TCA, total callus area; Adi, AdipoRon.

Figure 10. Micro-CT evaluation of fractured femoral repair (A) Representative 3D micro-CT images of fractured femurs 1, 2, and 4 weeks postoperative. (B1) A representative transverse cross-sectional image of the femur. The red contour line applied to the periosteal surface was the ROI for (B2) BV/TV, and (B3) Ct.Ar/Tt.Ar quantitative analysis. The green contour line applied to the

endosteal surface was the ROI for (B4) Tb. N, (B5) Tb. Th, and (B6) Tb. Sp quantitative analysis. (C1) A representative longitudinal cross-sectional image of the femur. The red contour line applied to the callus surface was the ROI for (C2) Callus volume, (C3) Callus density, (C4) Mineralized callus volume, and (C5) Callus mineralized percentage quantitative analysis. *P< 0.05, **P< 0.01, ***P< 0.001 vs. the WT group; $P< 0.05, $$P< 0.01, $$$P< 0.001 vs. the DIO group; aP< 0.05, aaP< 0.01, aaa

P< 0.001 vs. WT mice of the control group; bP< 0.05,

bb

P< 0.01,

bbb

P< 0.001 vs.

DIO mice of the control group; cP< 0.05, ccP< 0.01, cccP< 0.001 vs. DIO+AdipoRon mice of the control group. The control group in Figure B2-6 and Figure C2-5 was 1 week and 2 weeks post-operative, respectively. Abbreviations: ROI, region of interest; DIO mice, diet-induced obesity mice; BV, bone volume; TV, tissue volume; Tb. N, trabecular number; Tb. Th, trabecular thickness; Tb. Sp, trabecular separation; Ct.Ar, cortical bone area; Tt.Ar, total cross-sectional area inside the periosteal envelope.

Figure 11. A schematic graph of possible mechanisms. Abbreviations: ROS reactive oxygen species.

4. Discussion

ECO-based bone repair represents a promising direction for bone regeneration due to its resembling the morphogenetic process of long-bone development [40-42]. Maintaining sufficient chondrocyte quantities for chondrocyte survival and cartilaginous matrix synthesis are essential for the initial period of endochondral bone formation. However, diabetic environments can disturb ECO，leading to delayed union or non-union of fractures [43], which makes finding an effective treatment necessary. Diminished bone regeneration in diabetes is mostly caused by compromised osteogenesis and angiogenesis. The rate of failed vascularization during tissue engineering-based induction of direct osteogenesis is increased in diabetes. For ECO, the fracture callus is initially avascular, so researchers attempted to use biocompatible scaffolds with chondroprogenitors mimicking ECO-based bone regeneration. However, chondroprogenitors, which expand well in vitro under ideal conditions, may hardly survive after implantation into the hypoxic, ischemic, and oxidatively stressful environment of a diabetic bone defect zone [9, 10, 44-48], leading to ineffective grafting and poor therapeutic effect. Therefore, we first attempted to use AdipoRon to directly ameliorate the adverse effects of the diabetic environment on chondrocytes to promote diabetic bone repair through ECO. In this study, we evaluated the therapeutic potential of AdipoRon in DIO mice with femoral fracture. At early stages of ECO, Safranin O/Fast Green staining and micro-CT consistently revealed that DIO mice with intragastric AdipoRon administration had more neocartilage adjacent to the defect compared to untreated DIO mice. At later stages of ECO, micro-CT revealed that the AdipoRon group had fewer bone calluses, implying entering the process of bone remodeling. These results indicate the application potential of AdipoRon in diabetic bone regeneration. To investigate how AdipoRon promotes ECO-based bone repair in diabetic environment, we focused on its effects on chondrocyte survival [49]. Hyperglycemia is always accompanied by mitochondrial dysfunction leading to oxidative damage and cell apoptosis and is increasingly deemed as a contributor to the pathogenesis of DM [50]. AdipoRon has been found to improve neuronal survival after intracerebral

hemorrhage through alleviating mitochondrial dysfunction via reducing ROS generation and enhancing ATP levels [51]. Fan et al. also found that HG-induced apoptosis can be ameliorated by inhibiting mitochondrial dysfunction. Consistent with previous studies [52], HG medium can decrease cell viability, induce high levels of intracellular ROS, and increase apoptosis of ATDC5 cells. However, ROS production can be decreased by AdipoRon, following which cell viability and apoptosis improve (Figure 1-3 and 7). Thus, AdipoRon may promote chondrocyte survival in diabetes by reducing ROS production to ameliorate mitochondrial dysfunction, which also helps to improve cell viability and reduce apoptosis. Sufficient chondrogenic differentiation of chondrocytes is necessary for hypertrophic cartilage formation, which could act as a template to initiate ECO [53]. Promoting hypertrophic differentiation is one of the main challenges for ECO-based bone repair, especially in a diabetic environment [54]. In ECO, chondrocyte differentiation is characterized by the alterations of both chondrogenic and hypertrophic markers [44]. In this study, AdipoRon increased the expression of chondrogenic genes in ATDC5 cells cultured with HG medium at day 7, demonstrating the promotion of chondrogenic differentiation during early-stage chondrogenesis (Figure 4A). At day 14, AdipoRon obviously upregulated the expression of Col X, a typical hypertrophic marker, suggesting AdipoRon stimulates chondrocyte maturation (Figure 4B). The production of cartilaginous matrices was significantly increased by AdipoRon supplementation at days 7 and 14 (Figure 5), which further confirmed that the activation of AdipoRs ameliorated the chondrogenic differentiation of ATDC5 cells in HG medium. These results may be ascribed to following possible factors. For one thing, APN has been seen as a key element in promoting chondrocyte differentiation through activating AdipoRs [31], so AdipoRon may also have a similar effect on chondrocyte differentiation. For another, diabetes-induced augmentation of ROS has been suggested to cause severe damage to cell structures [49], consequently interfering with the modulation of differentiation [55]. In this study, AdipoRon can decrease ROS production (Figure 3), which may play a vital role in promoting chondrocyte differentiation.

To utilize AdipoRon to stimulate ECO impaired by diabetes, it’s necessary to clarify its molecular mechanisms. In previous studies, ERK1/2 has been demonstrated as an essential pathway for chondrogenesis of ATDC5 cells and endochondral bone development [56-59]. APN can activate the ERK1/2 pathway to exert an anti-apoptotic effect on pancreatic beta cells and neutrophils [18, 60]. However, the exact role of the ERK1/2 pathway in AdipoRon's protection against HG-induced oxidative stress, apoptosis, and reduced chondrogenesis remains unknown. In the present study, protein expression profiles demonstrated that glucose medium over 150 mM significantly suppressed p-ERK1/2 in ATDC5 cells. Nevertheless, AdipoRon can activate ERK1/2 signaling in 5.5-150 mM HG medium (Figure 6). As shown in Figure 8，PD98059 directly induced apoptosis, which cannot be rescued by AdipoRon. PD98059 can also increase intracellular ROS production, giving rise to apoptosis indirectly. Unexpectedly, AdipoRon reversed intracellular ROS production, but failed to inhibit apoptosis. This is likely because p-ERK1/2 is the key pathway in ATDC5 cell apoptosis rather than ROS production, and the anti-oxidative effects of AdipoRon cannot be completely attributed to ERK1/2 activation. Furthermore, AdipoRon can upregulate the mRNA levels of AGC, COL II, COL X and SOX9. and ameliorate the impaired chondrogenic differentiation and proteoglycan production of ATDC5 cells in HG medium (Figure 4 and 5). These effects were lost after PD98059 supplementation (Figure 4 and 8). Surprisingly, 100 mM HG medium had little effect on p-ERK1/2 levels, which could also be activated by AdipoRon to rescue apoptosis and promote chondrogenic differentiation (Figure 2, 6, and 8). This may reflect the complex effects of HG medium on cells [61, 62]. Moreover, ERK1/2 signaling failed to be activated by AdipoRon in 200 mM HG medium (Figure 6), similar to its inability to improve apoptosis and chondrogenesis (Figure 2 and 5). This may be attributed to its HG concentration and osmotic pressure, as well as decreased cell viability (Figure 1). These observations collectively indicated that AdipoRon could serve to improve ATDC5 cell survival and chondrogenic differentiation though the ERK1/2 signaling in a diabetic environment.

Diabetes can result in delayed fracture repair, which is partly ascribed to impaired cartilage formation and accelerated resorption [63, 64]. To our knowledge, the current antidiabetic drugs mostly have no effect on improving bone repair, and some even have an adverse effect on skeletal homeostasis [65]. Orally-administered AdipoRon has been reported to ameliorate insulin resistance and glucose intolerance [27]. Our results showed that AdipoRon can also accelerate bone repair by promoting ECO (Figure 9 and 10). According to our in vitro study, this improvement in fracture repair may be explained by the following reasons: First, diabetes induces more ROS and causes a reduction in antioxidant levels, increasing susceptibility to oxidative stress [66] and negatively affecting bone repair [67]. AdipoRon ameliorates intracellular ROS generation partly via activating the ERK1/2 pathway (Figure 3 and 7) and may promote fracture repair through protecting chondrocytes from oxidative stress injury. Secondly, diabetes can impair fracture repair by stimulating resorption of cartilage though increased apoptosis rates in chondrocytes [68]. AdipoRon protected chondrocyte from a HG environment through increased viability (Figure 1) and reduced apoptosis (Figure 2), which is partly attributed to decreased ROS production. Furthermore, diabetes conditions may reduce cartilage formation through decreased proliferation and differentiation [63] and induce the BMSCs to preferentially differentiate into adipocytes rather than osteoblasts [69], contributing to the impaired bone repair [70]. APN can stimulate bone formation by favoring BMSC differentiation toward the osteoblastic lineage [71] and promote chondrocytes to switch to hypertrophic chondrocytes [31] which ultimately turn into osteoblasts and osteocytes [72]. As AdipoRon activates AdipoRs like APN, it may have a similar influence on BMSC fate and hypertrophic differentiation of chondrocytes (Figure 4), leading to increased bone repair. Finally, the diabetic environment hinders hypertrophic differentiation of chondrocytes, resulting in smaller calluses with decreased bone formation [54]. Hypertrophic chondrocytes can secret vascular endothelial growth factor (VEGF) to stimulate blood vessel invasion to increase the vascularization in the bone defect area and accelerate tissue regeneration [41]. Preconditioning of MSCs with AdipoRon can enhance the cell expression of VEGF

[73]. It is reasonable to hypothesize that AdipoRon may enhance the VEGF generation to promote angiogenesis, which is essential for the maturation of the chondrocyte, to accelerate fracture repair. There are also a few other limitations to our study. First, due to the limited duration of the study, mechanical testing of healing bones, such as callus strength, were not performed. Second, the DIO mice used were all young, growing mice, which cannot represent all age groups. Finally, the DIO mice were purchased, and the HbA1c or blood glucose were not tested in our laboratory.

5. Conclusion In summary, we investigated the effects of AdipoRon on ECO-based bone repair. The in vitro results indicated that AdipoRon plays a crucial role in enhancing the survival and hypertrophic and chondrogenic differentiation of chondrocytes in HG medium via activation of the ERK1/2 pathway. A bone regeneration study with AdipoRon in a DIO mouse femur fracture model showed that AdipoRon could accelerate cartilage callus and new bone formation. These observations collectively suggest that AdipoRon can enhance ECO–based diabetic bone repair.

Conflicts of interest The authors have declared that no conflict of interest exists.

Funding This study was supported by the National Natural Science Foundation of China (No. 81300913), the Natural Science Foundation of Jiangsu Province of China (No. BK20161566) and Postgraduate Research & Practice Innovation Program of Jiangsu Province (No. KYCX18_1511). A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD, 2018-87), and NIH Grants (No. DE25681 and DE26507).

Declarations of interest

None.

Data Statement The data that support the findings of this study are available from the corresponding author upon reasonable request.

Credit Author Statement Zhongyi Wang: Data curation, Formal analysis, Investigation, Methodology, Roles/Writing-original

draft.

Jinxin

Tang:

Formal

analysis,

Investigation,

Methodology, Roles/Writing-original. Ying Li: Investigation. Yu Wang: Investigation. Yanyang Guo: Investigation. Qisheng Tu: Investigation, Supervision. Jake Chen: Conceptualization, Project administration, Resources. Chen Wang: Conceptualization, Project administration, Writing-review & editing.

Acknowledgments None.

References 1.

2. 3. 4.

5. 6.

7.

Cho, N.H., et al., IDF Diabetes Atlas: Global estimates of diabetes prevalence for 2017 and projections for 2045. Diabetes Res Clin Pract, 2018. 138: p. 271-281. Ma, R.C.W., Epidemiology of diabetes and diabetic complications in China. Diabetologia, 2018. 61(6): p. 1249-1260. Schwartz, A.V., Diabetes, bone and glucose-lowering agents: clinical outcomes. Diabetologia, 2017. 60(7): p. 1170-1179. Beam, H.A., J.R. Parsons, and S.S. Lin, The effects of blood glucose control upon fracture healing in the BB Wistar rat with diabetes mellitus. Journal of Orthopaedic Research, 2002. 20(6): p. 1210-1216. Karsenty, G., H.M. Kronenberg, and C. Settembre, Genetic control of bone formation. Annu Rev Cell Dev Biol, 2009. 25: p. 629-48. Yang, L., et al., Hypertrophic chondrocytes can become osteoblasts and osteocytes in endochondral bone formation. Proc Natl Acad Sci U S A, 2014. 111(33): p. 12097-102. Tsai, T.L., P.A. Manner, and W.J. Li, Regulation of mesenchymal stem cell chondrogenesis by glucose through protein kinase C/transforming growth

8.

9.

10. 11.

12.

13.

14.

15.

16.

17. 18.

19.

20.

21.

22.

factor signaling. Osteoarthritis and Cartilage, 2013. 21(2): p. 368-376. Cramer, C., et al., Persistent high glucose concentrations alter the regenerative potential of mesenchymal stem cells. Stem Cells Dev, 2010. 19(12): p. 1875-84. Chen, Y.J., et al., PPARgamma is involved in the hyperglycemia-induced inflammatory responses and collagen degradation in human chondrocytes and diabetic mouse cartilages. J Orthop Res, 2015. 33(3): p. 373-81. Roszer, T., Inflammation as death or life signal in diabetic fracture healing. Inflamm Res, 2011. 60(1): p. 3-10. Rosa, S.C., et al., Impaired glucose transporter-1 degradation and increased glucose transport and oxidative stress in response to high glucose in chondrocytes from osteoarthritic versus normal human cartilage. Arthritis Res Ther, 2009. 11(3): p. R80. Ogasawara, A., et al., Molecular basis for affected cartilage formation and bone union in fracture healing of the streptozotocin-induced diabetic rat. Bone, 2008. 43(5): p. 832-9. Kayal, R.A., et al., TNF-alpha mediates diabetes-enhanced chondrocyte apoptosis during fracture healing and stimulates chondrocyte apoptosis through FOXO1. J Bone Miner Res, 2010. 25(7): p. 1604-15. Kim, Y., et al., The Adiponectin Receptor Agonist AdipoRon Ameliorates Diabetic Nephropathy in a Model of Type 2 Diabetes. J Am Soc Nephrol, 2018. 29(4): p. 1108-1127. Korner, A., et al., Obesity in childhood and adolescence: a review in the interface between adipocyte physiology and clinical challenges. Hormones (Athens), 2005. 4(4): p. 189-199. Zhu, L., et al., Adiponectin alleviates exacerbation of airway inflammation and oxidative stress in obesity-related asthma mice partly through AMPK signaling pathway. Int Immunopharmacol, 2019. 67: p. 396-407. Sun, Y. and X. Chen, Effect of adiponectin on apoptosis: proapoptosis or antiapoptosis? Biofactors, 2010. 36(3): p. 179-86. Wijesekara, N., et al., Adiponectin-induced ERK and Akt phosphorylation protects against pancreatic beta cell apoptosis and increases insulin gene expression and secretion. J Biol Chem, 2010. 285(44): p. 33623-31. Hotta, K., et al., Plasma concentrations of a novel, adipose-specific protein, adiponectin, in type 2 diabetic patients. Arterioscler Thromb Vasc Biol, 2000. 20(6): p. 1595-9. Su, N., et al., The Effects of Adiponectin and Adiponectin Receptor 1 Levels on Macrovascular Complications Among Patients with Type 2 Diabetes Mellitus. Cell Physiol Biochem, 2019. 52(2): p. 225-231. Yamauchi, T., et al., Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nat Med, 2002. 8(11): p. 1288-95. Yamauchi, T., et al., The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat Med, 2001. 7(8):

23.

24.

25. 26. 27. 28.

29.

30. 31.

32.

33. 34. 35.

36.

37.

38.

39.

p. 941-6. Yu, L., et al., Adiponectin regulates bone marrow mesenchymal stem cell niche through a unique signal transduction pathway: an approach for treating bone disease in diabetes. Stem Cells, 2015. 33(1): p. 240-52. Hu, J., et al., Globular Adiponectin Attenuated H2O2-Induced Apoptosis in Rat Chondrocytes by Inducing Autophagy Through the AMPK/ mTOR Pathway. Cell Physiol Biochem, 2017. 43(1): p. 367-382. Holland, W.L. and P.E. Scherer, Cell Biology. Ronning after the adiponectin receptors. Science, 2013. 342(6165): p. 1460-1. Naot, D., D.S. Musson, and J. Cornish, The Activity of Adiponectin in Bone. Calcif Tissue Int, 2017. 100(5): p. 486-499. Okada-Iwabu, M., et al., A small-molecule AdipoR agonist for type 2 diabetes and short life in obesity. Nature, 2013. 503(7477): p. 493-9. Okada-Iwabu, M., et al., Perspective of Small-Molecule AdipoR Agonist for Type 2 Diabetes and Short Life in Obesity. Diabetes Metab J, 2015. 39(5): p. 363-72. Choi, S.R., et al., Adiponectin receptor agonist AdipoRon decreased ceramide, and lipotoxicity, and ameliorated diabetic nephropathy. Metabolism, 2018. 85: p. 348-360. Wu, X., et al., An Adiponectin Receptor Agonist Reduces Type 2 Diabetic Periodontitis. J Dent Res, 2019. 98(3): p. 313-321. Challa, T.D., Y. Rais, and E.M. Ornan, Effect of adiponectin on ATDC5 proliferation, differentiation and signaling pathways. Mol Cell Endocrinol, 2010. 323(2): p. 282-91. Malih, S., et al., Promigratory and proangiogenic effects of AdipoRon on bone marrow-derived mesenchymal stem cells: an in vitro study. Biotechnol Lett, 2017. 39(1): p. 39-44. Phornphutkul, C., K.Y. Wu, and P.A. Gruppuso, The role of insulin in chondrogenesis. Mol Cell Endocrinol, 2006. 249(1-2): p. 107-15. Surwit, R.S., et al., Diet-induced type II diabetes in C57BL/6J mice. Diabetes, 1988. 37(9): p. 1163-7. Matsubara, H., et al., Vascular tissues are a primary source of BMP2 expression during bone formation induced by distraction osteogenesis. Bone, 2012. 51(1): p. 168-80. Bouxsein, M.L., et al., Guidelines for assessment of bone microstructure in rodents using micro-computed tomography. J Bone Miner Res, 2010. 25(7): p. 1468-86. Tu, J., et al., Disruption of glucocorticoid signaling in chondrocytes delays metaphyseal fracture healing but does not affect normal cartilage and bone development. Bone, 2014. 69: p. 12-22. Komatsu, D.E., et al., Enhanced bone regeneration associated with decreased apoptosis in mice with partial HIF-1 alpha deficiency. Journal of Bone and Mineral Research, 2007. 22(3): p. 366-374. Grongroft, I., et al., Development of a novel murine delayed secondary

40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

50.

51.

52.

fracture healing in vivo model using periosteal cauterization. Arch Orthop Trauma Surg, 2019. 139(12): p. 1743-1753. Scotti, C., et al., Recapitulation of endochondral bone formation using human adult mesenchymal stem cells as a paradigm for developmental engineering. Proceedings of the National Academy of Sciences of the United States of America, 2010. 107(16): p. 7251-7256. Thompson, E.M., et al., An Endochondral Ossification-Based Approach to Bone Repair: Chondrogenically Primed Mesenchymal Stem Cell-Laden Scaffolds Support Greater Repair of Critical-Sized Cranial Defects Than Osteogenically Stimulated Constructs In Vivo. Tissue Eng Part A, 2016. 22(5-6): p. 556-67. Li, J., et al., Ceria nanoparticles enhance endochondral ossification-based critical-sized bone defect regeneration by promoting the hypertrophic differentiation of BMSCs via DHX15 activation. FASEB J, 2019. 33(5): p. 6378-6389. Kasperk, C., C. Georgescu, and P. Nawroth, Diabetes Mellitus and Bone Metabolism. Experimental and Clinical Endocrinology & Diabetes, 2017. 125(4): p. 213-217. Caron, M.M.J., et al., Indomethacin induces differential effects on in vitro endochondral ossification depending on the chondrocyte's differentiation stage. J Orthop Res, 2017. 35(4): p. 847-857. Deng, J., et al., Inositol pyrophosphates mediated the apoptosis induced by hypoxic injury in bone marrow-derived mesenchymal stem cells by autophagy. Stem Cell Res Ther, 2019. 10(1): p. 159. Hardin, J.A., N. Cobelli, and L. Santambrogio, Consequences of metabolic and oxidative modifications of cartilage tissue. Nat Rev Rheumatol, 2015. 11(9): p. 521-9. Hong, Y.H., et al., Effects of hypoxia/ischemia on catabolic mediators of cartilage in a human chondrocyte, SW1353. Biochem Biophys Res Commun, 2013. 431(3): p. 478-83. Schumann, P., et al., Decelerated vascularization in tissue-engineered constructs in association with diabetes mellitus in vivo. J Diabetes Complications, 2015. 29(7): p. 855-64. Bacevic, M., et al., Does Oxidative Stress Play a Role in Altered Characteristics of Diabetic Bone? A Systematic Review. Calcif Tissue Int, 2017. 101(6): p. 553-563. Higgins, G.C. and M.T. Coughlan, Mitochondrial dysfunction and mitophagy: the beginning and end to diabetic nephropathy? Br J Pharmacol, 2014. 171(8): p. 1917-42. Yu, J., et al., AdipoRon Protects Against Secondary Brain Injury After Intracerebral Hemorrhage via Alleviating Mitochondrial Dysfunction: Possible Involvement of AdipoR1-AMPK-PGC1alpha Pathway. Neurochem Res, 2019. 44(7): p. 1678-1689. Karunakaran, U., et al., Myricetin Protects Against High Glucose-Induced

53.

54.

55.

56.

57.

58.

59.

60.

61.

62.

63.

64.

65.

66.

beta-Cell Apoptosis by Attenuating Endoplasmic Reticulum Stress via Inactivation of Cyclin-Dependent Kinase 5. Diabetes Metab J, 2019. 43(2): p. 192-205. Bai, Y., et al., Mangiferin enhances endochondral ossification-based bone repair in massive bone defect by inducing autophagy through activating AMP-activated protein kinase signaling pathway. FASEB J, 2018. 32(8): p. 4573-4584. Kayal, R.A., et al., Diabetes causes the accelerated loss of cartilage during fracture repair which is reversed by insulin treatment. Bone, 2009. 44(2): p. 357-63. Bai, X.C., et al., Oxidative stress inhibits osteoblastic differentiation of bone cells by ERK and NF-kappaB. Biochem Biophys Res Commun, 2004. 314(1): p. 197-207. Nepal, M., et al., Kaempferol induces chondrogenesis in ATDC5 cells through activation of ERK/BMP-2 signaling pathway. Food Chem Toxicol, 2013. 62: p. 238-45. Papaioannou, G., et al., Raf Kinases Are Essential for Phosphate Induction of ERK1/2 Phosphorylation in Hypertrophic Chondrocytes and Normal Endochondral Bone Development. J Biol Chem, 2017. 292(8): p. 3164-3171. Yang, M., et al., Aloe-Emodin Induces Chondrogenic Differentiation of ATDC5 Cells via MAP Kinases and BMP-2 Signaling Pathways. Biomol Ther (Seoul), 2016. 24(4): p. 395-401. Li, J., et al., MEK/ERK and p38 MAPK regulate chondrogenesis of rat bone marrow mesenchymal stem cells through delicate interaction with TGF-beta 1/Smads pathway. Cell Proliferation, 2010. 43(4): p. 333-343. Rossi, A. and J.M. Lord, Adiponectin inhibits neutrophil apoptosis via activation of AMP kinase, PKB and ERK 1/2 MAP kinase. Apoptosis, 2013. 18(12): p. 1469-80. Han, Y.S., et al., High dose of glucose promotes chondrogenesis via PKCalpha and MAPK signaling pathways in chick mesenchymal cells. Cell Tissue Res, 2004. 318(3): p. 571-8. Wu, T.J., et al., Glucose enhances aggrecan expression in chondrocytes via the PKCalpha/p38-miR141-3p signaling pathway. J Cell Physiol, 2018. 233(9): p. 6878-6887. Gooch, H.L., et al., Alterations of cartilage and collagen expression during fracture healing in experimental diabetes. Connect Tissue Res, 2000. 41(2): p. 81-91. Kayal, R.A., et al., Diminished bone formation during diabetic fracture healing is related to the premature resorption of cartilage associated with increased osteoclast activity. J Bone Miner Res, 2007. 22(4): p. 560-8. Colhoun, H.M., et al., Hospitalised hip fracture risk with rosiglitazone and pioglitazone use compared with other glucose-lowering drugs. Diabetologia, 2012. 55(11): p. 2929-37. Niedowicz, D.M. and D.L. Daleke, The role of oxidative stress in diabetic

67.

68.

69.

70.

71.

72. 73.

complications. Cell Biochem Biophys, 2005. 43(2): p. 289-330. Morikawa, D., et al., Cytoplasmic reactive oxygen species and SOD1 regulate bone mass during mechanical unloading. J Bone Miner Res, 2013. 28(11): p. 2368-80. Li, L., et al., Contribution of interleukin-11 and prostaglandin(s) in lipopolysaccharide-induced bone resorption in vivo. Infect Immun, 2002. 70(7): p. 3915-22. Hamann, C., et al., Delayed bone regeneration and low bone mass in a rat model of insulin-resistant type 2 diabetes mellitus is due to impaired osteoblast function. Am J Physiol Endocrinol Metab, 2011. 301(6): p. E1220-8. Bakker, A.D., et al., Quantitative screening of engineered implants in a long bone defect model in rabbits. Tissue Eng Part C Methods, 2008. 14(3): p. 251-60. Lee, H.W., et al., Adiponectin Stimulates Osteoblast Differentiation Through Induction of COX2 in Mesenchymal Progenitor Cells. Stem Cells, 2009. 27(9): p. 2254-2262. Yang, G., et al., Osteogenic fate of hypertrophic chondrocytes. Cell Res, 2014. 24(10): p. 1266-9. Malih, S., et al., The Effect of AdipoRon on the Activity of Caspase 3, Matrix Metalloproteinases 2 and 9, and Angiogenesis in Rat Bone Marrow-Derived Mesenchymal Stem Cell. Journal of Isfahan Medical School, 2018. 36: p. 1-7.

Caption of Figure 2s The viability of ATDC5 cells cultured with indicated concentrations of glucose and mannitol for 24 h. After inclusion in the culture medium for 1d, HG caused more damage to ATDC5 cells than the same osmotic load of mannitol, especially over 350 mM. *P<0.05, **P<0.01, ***P<0.001 versus control; $P<0.05, $$P<0.01, $$$P<0.001 versus glucose group in the same osmotic pressure. Cells incubated in 5.5 mM glucose medium without AdipoRon treatment were set as the control group, and cell viability was normalized as a percentage of control.

Highlights • AdipoRon ameliorated chondrocyte survival and differentiation in diabetes. • ERK1/2 is the key pathway that mediates the effects of AdipoRon on chondrocyte. • AdipoRon stimulated bone regeneration via endochondral ossification in diabetes.

Zhongyi Wang: Data curation, Formal analysis, Investigation, Methodology, Roles/Writing-original

draft.

Jinxin

Tang:

Formal

analysis,

Investigation,

Methodology, Roles/Writing-original. Ying Li: Investigation. Yu Wang: Investigation. Yanyang Guo: Investigation. Qisheng Tu: Investigation, Supervision. Jake Chen: Conceptualization, Project administration, Resources. Chen Wang: Conceptualization, Project administration, Writing-review & editing.

Conflicts of interest The authors have declared that no conflict of interest exists.

Declarations of interest None.

Data Statement The data that support the findings of this study are available from the corresponding author upon reasonable request.