Adler hantavirus, a new genetic variant of Tula virus identified in Major’s pine voles (Microtus majori) sampled in southern European Russia

MEEGID 2161

No. of Pages 8, Model 5G

27 November 2014 Infection, Genetics and Evolution xxx (2014) xxx–xxx 1

Contents lists available at ScienceDirect

Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid 5 6

Adler hantavirus, a new genetic variant of Tula virus identified in Major’s pine voles (Microtus majori) sampled in southern European Russia

3 4 7

Q1

8 9

a

10 11 12 13 14

Chumakov Institute of Poliomyelitis and Viral Encephalitides, Moscow, Russia Institute of Medical Virology, Helmut-Ruska-Haus, Charité University Hospital, Berlin, Germany Anti-Plague Stations, Sochi, Russia d Medical State University, Samara, Russia e Institute of Virology, Slovak Academy of Sciences, Bratislava, Slovakia b c

15 16

a r t i c l e

1 3 8 1 19 20 21 22 23 24 25 26 27 28 29 30

Evgeniy A. Tkachenko a, Peter T. Witkowski b, Lukas Radosa b, Tamara K. Dzagurova a, Nataliya M. Okulova a, Yulia V. Yunicheva c, Ludmila Vasilenko c, Vyacheslav G. Morozov d, Gennadiy A. Malkin a, Detlev H. Krüger b, Boris Klempa b,e,⇑

i n f o

Article history: Received 21 July 2014 Received in revised form 21 November 2014 Accepted 22 November 2014 Available online xxxx

Q3

Keywords: Hantavirus Vole Microtus arvalis M. majori Russia

a b s t r a c t Although at least 30 novel hantaviruses have been recently discovered in novel hosts such as shrews, moles and even bats, hantaviruses (family Bunyaviridae, genus Hantavirus) are primarily known as rodent-borne human pathogens. Here we report on identification of a novel hantavirus variant associated with a rodent host, Major’s pine vole (Microtus majori). Altogether 36 hantavirus PCR-positive Major’s pine voles were identified in the Krasnodar region of southern European Russia within the years 2008–2011. Initial partial L-segment sequence analysis revealed novel hantavirus sequences. Moreover, we found a single common vole (Microtus arvalis) infected with Tula virus (TULV). Complete S- and M-segment coding sequences were determined from 11 Major’s pine voles originating from 8 trapping sites and subjected to phylogenetic analyses. The data obtained show that Major’s pine vole is a newly recognized hantavirus reservoir host. The newfound virus, provisionally called Adler hantavirus (ADLV), is closely related to TULV. Based on amino acid differences to TULV (5.6–8.2% for nucleocapsid protein, 9.4–9.5% for glycoprotein precursor) we propose to consider ADLV as a genotype of TULV. Occurrence of ADLV and TULV in the same region suggests that ADLV is not only a geographical variant of TULV but a host-specific genotype. High intra-cluster nucleotide sequence variability (up to 18%) and geographic clustering indicate long-term presence of the virus in this region. Ó 2014 Published by Elsevier B.V.

32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50

51 52

1. Introduction

53

Hantaviruses are known as rodent-borne viruses causing hemorrhagic fever with renal syndrome (HFRS) in Eurasia and hantavirus cardiopulmonary syndrome in the Americas (Krüger et al., 2011; Peters et al., 1999). Recently, knowledge of hantavirus host range has been significantly extended due to at least 30 novel hantaviruses have been discovered in ‘‘unexpected’’ hosts such as shrews (Arai et al., 2007; Klempa et al., 2007; Song et al., 2007a,b), moles (Arai et al., 2008; Kang et al., 2009a,b), and most

54 55 56 57 58 59 60

⇑ Corresponding author at: Institute of Virology, Slovak Academy of Sciences, Dubravska cesta 9, 84505 Bratislava, Slovakia. Tel.: +421 2 59302465; fax: +421 2 54774284. E-mail address: [email protected] (B. Klempa).

recently even bats (Guo et al., 2013; Sumibcay et al., 2012; Weiss et al., 2012). Despite the current ‘‘hunt’’ for hantaviruses in these newly recognized hosts, several new hantaviruses have also been identified in rodents including voles of the genus Microtus. Most recently, Tatenale virus (TATV) was identified in a single field vole (Microtus agrestis) in northwestern England and in fact represents the first hantavirus found in the United Kingdom (Pounder et al., 2013), thus disproving the long held belief that the British Isles are hantavirus-free. In addition, several hantaviruses associated with reed voles (Microtus fortis) and Maximowicz’s voles (Microtus maximowiczii) were recently reported from China (Zou et al., 2008a,b). Microtus-borne hantaviruses can be phylogenetically classified into the group of Arvicolinae-associated hantaviruses. Probably the most prominent members of this group are Puumala virus (PUUV), Tula virus (TULV), and Prospect Hill virus (PHV). PUUV,

http://dx.doi.org/10.1016/j.meegid.2014.11.018 1567-1348/Ó 2014 Published by Elsevier B.V.

Please cite this article in press as: Tkachenko, E.A., et al. Adler hantavirus, a new genetic variant of Tula virus identified in Major’s pine voles (Microtus majori) sampled in southern European Russia. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.11.018

61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76

MEEGID 2161

No. of Pages 8, Model 5G

27 November 2014 2 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105

E.A. Tkachenko et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx

the causative agent of HFRS, has been detected widely in Europe and is associated with bank voles (Myodes glareolus) as carrier. In some countries, such as Finland, Germany, Sweden and the European part of Russia, thousands of HFRS cases caused by PUUV can occur in epidemic peak years (Krüger et al., 2013; Tkachenko et al., 1999, 2013; Vaheri et al., 2013). There are several aspects which make the Microtus-borne hantaviruses particularly interesting. They are generally believed to not be pathogenic to humans. There is only limited evidence for few clinical cases associated with TULV infection (Klempa et al., 2003; Zelená et al., 2013). TULV also seems to be less host-specific than generally assumed for hantaviruses which are usually considered to be associated with a single host species (Schlegel et al., 2012b; Schmidt-Chanasit et al., 2010). In contrast to other rodent-borne hantaviruses, Microtus-borne hantaviruses are present in both the Old World and the New World. Besides PHV which is associated with Microtus pennsylvanicus voles (Lee et al., 1985) there is Isla Vista virus (ILV; associated with Microtus californicus, Song et al., 1995) and Prairie vole virus (PVV; associated with Microtus ochrogaster Acc. No. U19303; Song et al., unpublished data) all of which have been discovered in North America. Here we report the identification of a new genetic variant of Tula virus associated with a rodent host, Major’s pine vole, Microtus majori (Terricola majori according to the systematics of Russian mammals; Pavlinov and Lisovskyi, 2012) in the Black Sea coast area of European Russia, the region where the highly pathogenic Sochi genotype of Dobrava-Belgrade virus (DOBV) is known to circulate (Dzagurova et al., 2012; Klempa et al., 2008; Tkachenko et al., 2005).

106

2. Material and methods

107

2.1. Screening of tissue samples by reverse-transcription PCR (RT-PCR)

108

Small mammals were trapped in frame of the epizootiological study focused on hantavirus reservoir hosts in the Krasnodar

109

region of southern European Russia from 2008–2011 (Russian Ministry of Public Health task, #88 order of March 17, 2008). Frozen lung tissue samples of voles collected within the study were first screened for presence of hantavirus antigens by ELISA using ‘‘HANTAGNOST’’ kit (Federal State Unitary Enterprise on Manufacture of Bacterial and Viral Preparations of Chumakov Institute of Poliomyelitis & Viral Encephalitides) according to the manufacturer’s instructions (Ivanov et al., 1996). Presence of hantavirus specific antibodies was tested by IFA with slides containing combined antigens from Vero E6 cells infected with PUUV, DOBV, Hantaan virus, and Seoul virus. Anti-mouse FITC-conjugated IgM and IgG mixture (Imtek, Russia) was used as secondary antibody (Tkachenko et al., 2005). The positive samples were then screened for hantavirus RNA by RT-PCR. Briefly, total RNA was extracted from the homogenized tissue samples using TRIzol (Invitrogen). RNA was then reverse transcribed with Moloney murine leukemia virus reverse transcriptase with random hexamers used as primers. Hantavirus RNA was detected with the genus-specific PCR assay based on degenerated primers targeting a conserved region within the Lsegment (Klempa et al., 2006).

110

2.2. Sequencing of S- and M-segments

130

To obtain complete S- and M-segment sequences, a broad variety of oligonucleotide primers has been applied in a series of RT-PCR assays (Table 1) in order to obtain overlapping PCR fragments. The obtained PCR products were then column-purified and either directly sequenced or cloned into pSCA vector using a StrataClone PCR cloning kit (Stratagene). At least three clones were sequenced in both directions.

131

2.3. Molecular host identification

138

To ensure correct classification of the collected voles, both the cytochrome b gene encoded by mitochondrial DNA as well as the mitochondrial DNA control region, D-loop, were sequenced for

139

Table 1 List of PCR primers used within the study. Target

Primer name

Primer sequence (50 ? 30 )

References

S segment

S1n SnMa2 TULS1F TULS27F ADLS527R ADLS1201F ADLS1243F TULS1760R

CCAAGTGGRCARACWGCWGAYTGG TTAGATTTTTARYGGTTCCTG TAGTAGTAKRCTCCTTGAAAAGC TACTRAARCCGCTGGKATGA TCATCYTTRAAYCKTATACGRGT ATGATGGARTGGGGTGC GGGGATGAYATGGAYCCWGA CGTGCATATATATAAGTGTACRGAGG

Sibold et al. (1995) Sibold et al. (1995) This study This study This study This study This study This study

M segment

TULM1F TULM15F ADLM1691R ADLM540F ADLM1426R ADLM1591F ADLM2103R ADLM2640F ADLM3179R ADLM2000F TULM3681R TULM3694R

TAGTAGTAGACTCCGCAAGAAGAAGC GCAAGAAGAAGCAAAYACAGA CCATWGTTTTCTGRTAYTCYTG TGGGYTTAGGRGATCAYCGG ATAAATGCAYTGCCCRATYAC ATGATMATAATCCGYATYCTT GGCAAWGARAARTCTARCTCT TGAAGARGGYGGGATGATATT TGCCCTCCYTTACCYA TGGGCWGCWAGTGCIGAIAC CGCARGAACAAAAGTCCAGG TAGTAGTAKICTCCGCARGAAC

This This This This This This This This This This This This

L segment

Han-L-F1 Han-L-R1 Han-L-F2 Han-L-R2

ATGTAYGTBAGTGCWGATGC AACCADTCWGTYCCRTCATC TGCWGATGCHACIAARTGGTC GCRTCRTCWGARTGRTGDGCAA

Klempa Klempa Klempa Klempa

D-loop

CB1n 12S1n

GGAGGMCARCCAGTWGAAYACCCATT TAATTATAAGGCCAGGACCAAACC T

This study This study

Cytochrome B

CytB Uni fw CytB Uni rev

TCATCMTGATGAAAYTTYGG ACTGGYTGDCCBCCRATTCA

Schlegel et al. (2012a) Schlegel et al. (2012a)

study study study study study study study study study study study study et et et et

al. al. al. al.

(2006) (2006) (2006) (2006)

Please cite this article in press as: Tkachenko, E.A., et al. Adler hantavirus, a new genetic variant of Tula virus identified in Major’s pine voles (Microtus majori) sampled in southern European Russia. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.11.018

111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129

132 133 134 135 136 137

140 141

MEEGID 2161

No. of Pages 8, Model 5G

27 November 2014 3

E.A. Tkachenko et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx

146

host identification. A part of the cytochrome b gene (positions 82–1028 according to Mus musculus sequence, GenBank Acc. No. EF108332) was amplified by PCR using cDNA as a template as described before (Schlegel et al., 2012a). For the D-loop amplification, primers CB1n and 12S1n (Table 1) were used.

147

2.4. Sequence and phylogenetic analysis

142 143 144 145

148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167

Obtained sequences were edited and assembled in the SEQMAN program from the Lasergene software package (DNASTAR). All sequences revealed within the study have been deposited in the GenBank database under the accession numbers KP013556-95. The sequence data were further analyzed with the BioEdit software package (Hall, 1999). Multiple-sequence alignments were constructed using the MUSCLE program (Edgar, 2004) implemented in MEGA6 (Tamura et al., 2013). Before tree construction, automated screening for recombination between genomic segment sequences was performed using program RDP4 (Martin et al., 2010), which used 9 recombination detection programs: Bootscan, Chimeric, GENECONV, MaxChi, RDP, 3Seq, LARD, PhylPro and SiScan with their default parameters. No putative recombination regions could be consequently detected by more than 3 of the implemented programs. Evolutionary analyses were also conducted by using MEGA6 (Tamura et al., 2013). The evolutionary history was inferred using the maximum-likelihood method based on the model which was estimated for every alignment separately to be the Best-Fit substitution model according to the Bayesian information criterion.

168

3. Results

169

3.1. Screening of vole tissue samples and initial molecular phylogenetic analysis

170 171 172 173 174 175 176 177 178 179 180 181 182

A total of 238 voles comprising 228 Major’s pine voles (115 males and 113 females; 198 adults, 27 subadults, 3 juveniles) and 10 common voles (5 males and 5 females; 9 adults and 1 subadult), were collected from a total of 20 trapping sites in the Krasnodar region of southern European Russia within the years 2008–2011. Lung tissue samples of the collected voles were first screened for presence of hantavirus antigens by ELISA and antibody by IFA (Table 2). Out of 238 voles, 48 (31 males and 17 females; 44 adults, 3 subadults, 1 juvenile) were found antigen or antibody-positive and 42 were further analyzed by the screening RT-PCR. Altogether 36 hantavirus PCR-positive voles were identified. Initial sequence comparisons revealed that the obtained

sequences were most similar to other Arvicolinae-associated hantaviruses PHV, PUUV, TATV, and TULV (nucleotide sequence identities of 72.2–82.0%). The intra-cluster variability was 0–18.0%. Moreover, the phylogenetic analysis showed that the vole 5990–09, in agreement with its identification as a common vole (Fig. 1a), was infected with TULV (Fig. 1b). All other newly identified sequences formed a distinct well-supported monophyletic group within the clade of Arvicolinae-associated hantaviruses. To clearly distinguish the novel M. majori-associated strains from the original TULV, we provisionally call the new strains as Adler hantavirus (ADLV) according to the one of the regions where the virus was detected. More detailed analysis of the obtained sequences was hampered by the fact that very limited number of Arvicolinaeassociated hantavirus L-segment sequences are available in GenBank. Moreover, suboptimal length of the dataset (347 bp) led to insufficient statistical support. We therefore further focused on obtaining complete coding sequences of both S- and M-segments. To confirm morphological host identification, 12 of the hantavirus-positive samples were molecularly characterized by sequencing the D-loop region of the mitochondrial DNA (923 bp; Fig. 1a). Although not all major clades were statistically supported, phylogenetic analysis of the obtained D-loop sequences showed that one sample (designated 5990-09) was a common vole while all other obtained sequences formed a single, clearly distinct monophyletic group. However, no other Major’s pine voles D-loop sequences were available in GenBank for comparison. Therefore, partial cytochrome b gene sequences (814 bp) were also prepared for specimens 98–08 and 296–08 and these showed 97% identity to the available Major’s pine voles sequences from Turkey (Jaarola et al., 2004; Martinkova et al., 2007) – data not shown here.

183

3.2. Sequence analysis of the S- and M-segment sequences

216

Detailed sequence and phylogenetic analyses were then performed for 11 strains from Major’s pine voles trapped at 8 sites in the Black Sea coast area belonging to three administrative districts; Adler, Lazarevsky, and Tuapse (for details, see Table 2 and Fig. 2). For the S segment, we succeeded in determining the complete sequences for the Mm/98-08 and Mm/302-08 strains, which were 1796 and 1792 nt long, respectively. For all 11 strains, the N protein-encoding ORF was found to be 1296 nt long (corresponding to positions 43–1338 of the complete S-segment sequence of TULV,

217

Table 2 Origin, serologic and antigenic status of the 12 rodent specimens used in the phylogenetic analyses. Locality*

Year of collection

Sample No.

Vole species

Sex

Age

Ab

Ag

Adler d., Krasnaya Polyana, ski trail Adler d., Krasnaya Polyana, ski trail Adler d., Krasnaya Polyana v. Adler d., Maklyukova v. Adler d., Maklyukova v. Krimsky d., Keslerovo v. Lazarevsky d., Makopse river Lazarevsky d., Maryino v. Lazarevsky d., Maryino v. Lazarevsky d., Nadzhigo v. Lazarevsky d., waterfall ‘‘Serenada Lyubvi’’ Tuapse d., Anastasievski meadow

2008 2008 2008 2011 2011 2009 2008 2011 2009 2011 2011 2009

296 302 340 554 560 5990 98 173 5779 603 172 5844

M. majori M. majori M. majori M. majori M majori M. arvalis M. majori M. majori M. majori M. majori M. majori M. majori

f m f m m f m m f f m m

ad ad ad ad ad ad ad ad ad ad ad sad

+  + + + +  + + + + +

 +     + +   + +

Ab, Ag; results of the screening for hantavirus antibody and antigen, respectively. m, male; f, female; ad, adult; sad, subadult. * d., district; v., village.

Please cite this article in press as: Tkachenko, E.A., et al. Adler hantavirus, a new genetic variant of Tula virus identified in Major’s pine voles (Microtus majori) sampled in southern European Russia. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.11.018

184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215

218 219 220 221 222 223 224 225 226

MEEGID 2161

No. of Pages 8, Model 5G

27 November 2014 4

E.A. Tkachenko et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx

Fig. 1. Molecular phylogenetic analysis of vole- and virus-derived nucleotide sequences. Analyses of the mitochondrial DNA sequences (D-loop; 923 bp) from voles (a) and partial (347 bp) hantavirus L segment sequences (b) were conducted in MEGA6 (Tamura et al., 2013). The evolutionary history was inferred by using (a) the Neighbor-Joining method with the evolutionary distances computed with the Maximum Composite Likelihood method, (b) the Maximum Likelihood method based on the Tamura–Nei model with Gamma rates and Heterogeneous patterns (TN93+G+I) which was estimated to be the Best-Fit substitution model according to Bayesian Information Criterion. The scale bars indicate an evolutionary distance of 0.1 substitutions per position in the sequence. Bootstrap values P70%, calculated from 500 replicates, are shown at the tree branches. ANDV, Andes virus; DOBV, Dobrava-Belgrade virus; HOKV, Hokkaido virus; HTNV, Hantaan virus; PHV, Prospect Hill virus; PUUV, Puumala virus; SANGV, Sangassou virus; SEOV, Seoul virus; TATV, Tatenale virus; TULV, Tula virus.

Fig. 2. Map with the geographical origin of Adler virus RT-PCR positive Major’s pine voles (Microtus majori). Trapping sites with positive voles are marked by full circles. The trapping sites are divided into areas (gray circled areas) corresponding to the clades recognized in the phylogenetic tree (Fig. 3).

227 228 229 230 231

GenBank Acc. No. NC 005227), encoding a putative N protein of 431 amino acids (aa) in length. The second ORF encoding a putative 90 aa long NSS protein was also found to be present at the same position as in TULV (nucleotide positions 83–355; numbering according to GenBank Acc. No. NC_005227).

The complete M segment sequence was determined for the Mm/98-08, Mm/296-08, and Mm/302-08 strains and consists of 3682–3685 nt (terminal 34 nt are derived from primers and were not determined). It carries a single ORF (3426 nt; corresponding to positions 56–3481 of the complete M-segment sequence of TULV, GenBank Acc. No. NC_005228) encoding a putative glycoprotein precursor (GPC) of 1141 aa in length. Intra-cluster sequence diversity was considerably high; 0.5–13.8% on nt level, 0–2.8% on aa level for the S-segment, and 3.5–12.2% on nt level, 0.7–1.6% on aa level for the M-segment coding sequences. Comparison of the obtained complete S- and M-segment sequences with those of other hantavirus representatives revealed highest similarity to TULV. Amino acid differences to TULV of 5.6–8.2% for N protein and 9.4–9.5% for GPC were observed. Substantially higher differences, up to 22.6%, were found in comparison with PHV and PUUV (Table 3).

232

3.3. Phylogenetic analyses based on S- and M-segment genomic sequences

248

In the S-segment-based Maximum likelihood phylogenetic analysis focused on Arvicolinae-associated hantaviruses, complete N protein-coding sequences of all 11 ADLV sequences formed a well-supported monophyletic group within the clade of Microtusassociated hantaviruses comprising TULV, PHV, ILV, and PVV (Fig. 3). Within this cluster, TULV is the most closely related virus as it formed a sister group to the new ADLV sequences. Other Microtus-associated hantaviruses comprising Khabarovsk virus (associated with M. fortis) and its variant designated as Yakeshi (associated with M. maximowiczii) as well as Vladivostok virus including its variants Fusong, Shenyang, and Yuanjiang (all associated with M. fortis) clustered together within the second clade which also included Myodes-associated hantaviruses Hokkaido (associated with Myodes rufocanus), Muju (associated with Myodes

250

Please cite this article in press as: Tkachenko, E.A., et al. Adler hantavirus, a new genetic variant of Tula virus identified in Major’s pine voles (Microtus majori) sampled in southern European Russia. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.11.018

233 234 235 236 237 238 239 240 241 242 243 244 245 246 247

249

251 252 253 254 255 256 257 258 259 260 261 262 263

MEEGID 2161

No. of Pages 8, Model 5G

27 November 2014 E.A. Tkachenko et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx

Q7

Table 3 Estimates of evolutionary divergence between sequences of the newfound Adler virus and closely related viruses. p-Distance (%)

Poisson correction model (%)

S segment N: 431 aa

M segment GPC 1141 aa

S segment N: 431 aa

M segment GPC: 1141 aa

Species criteria

ICTV: 7%

ICTV: 7%

Maes*: 10%

Maes*: 12%

Virus Tula virus Prospect Hill virus Puumala virus

5.6–8.2 16.0–17.0 20.3–21.7

9.4–9.5 20.2–20.4 21.2–22.6

5.7–8.5 17.5–18.6 22.7–24.5

9.9–10.0 22.5–22.8 23.9–25.7

The % of amino acid substitutions are shown. Analyses were conducted using MEGA6 (Tamura et al., 2013). N, nucleocapsid protein; GPC, glycoprotein precursor; aa, amino acids. * Maes et al. (2009).

5

regulus), and Puumala (associated with My. glareolus) and Lemmus sibiricus-associated Topografov virus. Within the ADLV monophyletic group, one can define at least three well-supported subclades showing considerable level of sequence diversity (designated as I, II, and III in Fig. 3). Phylogenetic placement of the virus strains in these subclades perfectly correlates with the trapping sites of the respective positive voles (cp. Figs. 2 and 3). Thus, a high degree of geographic clustering could be observed which indicates long-term presence of the virus in the region. An analysis of the complete GPC-encoding M-segment sequences was greatly hampered by the fact that only a very few complete coding sequences of the M-segment for Arvicolinae-associated hantaviruses are currently available and most of them are of PUUV origin. Nevertheless, the Maximum Likelihood phylogenetic analyses confirmed the findings from the S segment analysis that TULV is the closest relative (Fig. 4).

Fig. 3. Maximum-Likelihood phylogenetic tree showing the phylogenetic position of Adler virus (marked by light grey box) constructed on the basis of complete nucleocapsid protein (S segment) coding sequences (1305 nt). Evolutionary analysis was conducted in MEGA6 (Tamura et al., 2013). The evolutionary history was inferred by using the Maximum-Likelihood method based on the General Time Reversible (GTR) model with using a discrete Gamma distribution (+G) with 5 rate categories and by assuming that a certain fraction of sites are evolutionarily invariable (+I) which was estimated to be the Best-Fit substitution model according to Bayesian Information Criterion. The scale bars indicate an evolutionary distance of 0.1 substitutions per position in the sequence. Bootstrap values P70%, calculated from 500 replicates, are shown at the tree branches. The three clusters defined within the Adler virus clade correspond to the three trapping areas defined in the Fig. 2.

Please cite this article in press as: Tkachenko, E.A., et al. Adler hantavirus, a new genetic variant of Tula virus identified in Major’s pine voles (Microtus majori) sampled in southern European Russia. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.11.018

264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280

MEEGID 2161

No. of Pages 8, Model 5G

27 November 2014 6

E.A. Tkachenko et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx

Fig. 4. Maximum-Likelihood phylogenetic tree showing the phylogenetic position of Adler virus (marked by light grey box) constructed on the basis of complete glycoprotein precursor protein (M segment) coding sequences (3438 nt). Evolutionary analysis was conducted in MEGA6 (Tamura et al., 2013). The evolutionary history was inferred by using the Maximum-Likelihood method based on the General Time Reversible (GTR) model with using a discrete Gamma distribution (+G) with 5 rate categories and by assuming that a certain fraction of sites are evolutionarily invariable (+I) which was estimated to be the Best-Fit substitution model according to Bayesian Information Criterion. The scale bars indicate an evolutionary distance of 0.1 substitutions per position in the sequence. Bootstrap values P70%, calculated from 500 replicates, are shown at the tree branches. HOKV, Hokkaido virus; KHAV, Khabarovsk virus; MUJV, Muju virus; PHV, Prospect Hill virus; PUUV, Puumala virus; TOPV, Topografov virus; TULV, Tula virus; VLAV, Vladivostok virus. For PUUV, following sequences were used and are represented by the black triangle: U22418, U14136, AY526218, Z49214, X61034, M29979, AB433852, Z84205, AB433850.

281

4. Discussion

282

In this study, we obtained hantavirus sequences from tissues of Major’s pine vole, a rodent host which was not known to carry hantaviruses. The obtained data indicate that Major’s pine vole is a primary reservoir host of a hantavirus which we provisionally called Adler virus (ADLV). Sequence and phylogenetic analyses showed that the new sequences are closely related to those of TULV. The highest amino acid sequence similarity values were observed in comparison to TULV (5.6–8.2% for N protein and 9.4–9.5% for GPC). In the S-, M-, and L segment phylogenetic analyses TULV sequences formed a sister group to the new sequences. The low support of the L-segment based tree is most likely a consequence of suboptimal quality of the L-segment dataset (limited length and number of sequences). Availability of more complete L segment sequence data will eventually resolve this issue. Comparisons of the N and GPC amino acid sequences revealed that ADLV fulfills one of the current ICTV criteria (at least 7% difference in N and GPC amino acid sequences; King et al., 2012) for the M segment (GPC) but only partially for the S segment (N). More strict criteria were proposed by Maes et al. (2009); these are a 10% difference in S segment similarity and a 12% difference in M segment similarity based on complete amino acid sequences. In contrast to the current, somewhat arbitrarily selected ICTV criteria, the cut-off values proposed by Maes et al. (2009) were based on frequency distribution of similarities (similarity histograms) and therefore have a sound mathematical base. These values seem to be more appropriate also in view of the fact that PUUV strains differ by up to 8% for N and 11% for GPC amino acid sequences (Sironen and Plyusnin, 2011) thus exceeding the current ICTV criterion but fulfilling the newly proposed cut-off values. Based on extensive sequence analysis of hantaviruses in South America,

283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312

the need for more stringent criteria for species delineation was expressed also by others (Firth et al., 2012). Using these criteria, ADLV was found to be insufficiently different from TULV to form a separate species. On the other hand, detection of TULV in M. arvalis vole and ADLV in M. majori voles within the same geographic area (distance of trapping sites about 150 km) indicated that the observed nucleotide sequence differences did not accumulate only through geographic isolation of ADLV from the other TULV strains but also through host adaptation. In other words, ADLV is not only a new geographical variant of TULV but a host-specific taxon. Altogether, the level of amino acid sequence similarity determines that ADLV belongs to the TULV species but the presence of substantial nucleotide sequence divergence along with distinct rodent host lead us to propose the distinction of this virus as unique, host-specific genotype of the TULV species. Analogously, we recently proposed the definition of four distinct genotypes within the DOBV species where the genotypes, besides substantial nucleotide sequence distance, differ also by their dominant rodent host and/or typical geographic occurrence (Klempa et al., 2013). ICTV has no guidelines for the demarcation of viruses below the species level. However, definition of genotypes appears to be very useful because it allows acknowledgement of particular biological aspects of the virus – such as pronounced nucleotide difference, specific host, or endemic occurrence – without inflation of the species list with dozens of new virus names representing nearly identical, serologically indistinguishable viruses. A similar approach was recently followed also for the Myodes-borne hantaviruses; Hokkaido virus (associated with My. rufocanus), Muju virus (associated with My. regulus), and Puumala (associated with My. glareolus). Based on the overall amino acid sequence similarity between the N and GPC of these viruses, Lee et al. (2014) concluded that Hokkaido and Muju viruses are in fact ‘‘genetic variants’’ of PUUV. We are convinced that the same approach would be useful also in case of the other Microtus-borne hantaviruses. Vladivostok virus (Kariwa et al., 1999; Plyusnina et al., 2008), Fusong virus (Zou et al., 2008a), Shenyang virus (Zou et al., 2008b), and Yuanjiang virus (Zou et al., 2008b), although clearly distinguishable in the nucleotide sequences-based phylogenetic analyses, are in fact nearly identical in their amino acid sequences (97% identity for N) and should be consequently classified as genotypes or ‘‘genetic variants’’ within a single species, Vladivostok virus. Similarly, Topografov virus (Vapalahti et al., 1999), Khabarovsk virus (Hörling et al., 1996; Wang et al., 2014), and Yakeshi virus (Zou et al., 2008a) show N protein amino acid sequence similarities which are above even of the current ICTV species demarcation criteria (95.2–99.5%). Recent reports have indicated that TULV is somewhat ‘‘promiscuous’’, i.e. less host-specific than usually found for hantaviruses. Besides initially determined M. arvalis and Microtus rossiaemeridionalis vole hosts (Plyusnin et al., 1994; Sibold et al., 1995), additional species of voles from Microtus genus, such as M. agrestis and Microtus subterraneus (Korva et al., 2009; Scharninghausen et al., 2002; Schmidt-Chanasit et al., 2010; Song et al., 2002), and even from a different genus such as Arvicola amphibious (Schlegel et al., 2012b), might serve as TULV reservoir hosts. In our study, M. arvalis-borne TULV was also found to be present in the investigated region, even though relatively far from the ADLV trapping sites (Fig. 2). Nevertheless, classical TULV was not detected in any of the investigated M. majori voles which in turn have their ‘‘own’’ ADLV. On the other hand, the observed strict host specificity of TULV and ADLV might be more driven by vole ecology than virus specificity because Major’s pine voles are mountain forest species while common voles are plain meadow land species (Okulova, unpublished data). Investigation of higher number of M. majori

Please cite this article in press as: Tkachenko, E.A., et al. Adler hantavirus, a new genetic variant of Tula virus identified in Major’s pine voles (Microtus majori) sampled in southern European Russia. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.11.018

313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378

MEEGID 2161

No. of Pages 8, Model 5G

27 November 2014 E.A. Tkachenko et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx

410

and M. arvalis voles will be needed to confirm this observation. It will be also helpful to evaluate putative reassortment events between these viruses. It is interesting to note that not all Microtus-borne hantaviruses are monophyletic. TULV ADLV strains share a common ancestor with the New World Microtus-borne hantaviruses PHV, ISLV, and PVV, while all the other Microtus-borne hantaviruses form a monophyletic group with the Myodes-borne hantaviruses. It is also surprising that TULV and ADLV are so closely related although M. arvalis and M. majori are not and belong to different subgenera within the genus Microtus (subgenus Microtus and subgenus Terricola, respectively). Also the reservoir hosts of PHV, ILV, and PVV, voles of the species M. pennsylvanicus, M. californicus, and M. ochrogaster, respectively, are not closely related. These observations indicate complex evolutionary scenarios most likely involving both co-divergence and host switches. Human disease caused by ADLV has not yet been identified. The virus was found in a region known for sporadic but severe HFRS cases caused by Sochi virus, an Apodemus ponticus-associated genotype of DOBV (Dzagurova et al., 2012; Klempa et al., 2008). Several PUUV HFRS cases in the same region were investigated and regarded as cases imported from other, PUUV-endemic regions of Russia (Dzagurova, unpublished data). Nevertheless, it cannot be ruled out that human ADLV infections with mild clinical courses have been overlooked. After identification of Sochi virus, this report shows that at least two more hantaviruses are present in the Black Sea coast area of European Russia. Moreover, this study adds Major’s pine voles to the list of hantavirus reservoir hosts. Although TULV as well as its M. majori-associated genotype, ADLV, most likely possess much lower health hazard for humans than Sochi virus, their occurrence in the region should not be disregarded.

411

Acknowledgements

379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409

412 413 414 415 416 417 418

We thank to Brita Auste for excellent technical assistance and to Martin Raftery for critical reading of the manuscript. Q4 Q5 This work was supported by Deutsche Forschungsgemeinschaft (Research Training Group 1121 and Grant No. KR1293/12-1), European Commission (European Virus Archive, FP7 CAPACITIES project – GA No. 228292), and Russian Science Foundation (Grant No. 14-15-00619).

419

References

420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446

Arai, S., Song, J.-W., Sumibcay, L., Bennett, S.N., Nerurkar, V.R., Parmenter, C., Cook, J.A., Yates, T.L., Yanagihara, R., 2007. Hantavirus in northern short-tailed shrew, United States. Emerg. Infect. Dis. 13, 1420–1423. Arai, S., Ohdachi, S.D., Asakawa, M., Kang, H.J., Mocz, G., Arikawa, J., Okabe, N., Yanagihara, R., 2008. Molecular phylogeny of a newfound hantavirus in the Japanese shrew mole (Urotrichus talpoides). Proc. Natl. Acad. Sci. U.S.A. 105, 16296–16301. Dzagurova, T.K., Witkowski, P.T., Tkachenko, E.A., Klempa, B., Morozov, V.G., Auste, B., Zavora, D.L., Iunicheva, I.V., Mutnih, E.S., Kruger, D.H., 2012. Isolation of Sochi virus from a fatal case of hantavirus disease with fulminant clinical course. Clin. Infect. Dis. 54, e1–4. Edgar, R., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797. Firth, C., Tokarz, R., Simith, D.B., Nunes, M.R.T., Bhat, M., Rosa, E.S.T., Medeiros, D.B.A., Palacios, G., Vasconcelos, P.F.C., Lipkin, W.I., 2012. Diversity and distribution of hantaviruses in South America. J. Virol. 86, 13756–13766. Guo, W.P., Lin, X.D., Wang, W., Tian, J.H., Cong, M.L., Zhang, H.L., Wang, M.R., Zhou, R.H., Wang, J.B., Li, M.H., Xu, J., Holmes, E.C., Zhang, Y.Z., 2013. Phylogeny and origins of hantaviruses harbored by bats, insectivores, and rodents. PLoS Pathog. 9, e1003159. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Hörling, J., Chizhikov, V., Lundkvist, A., Jonsson, M., Ivanov, L., Dekonenko, A., Niklasson, B., Dzagurova, T., Peters, C.J., Tkachenko, E., Nichol, S., 1996. Khabarovsk virus: a phylogenetically and serologically distinct hantavirus isolated from Microtus fortis trapped in far-east Russia. J. Gen. Virol. 77, 687– 694.

7

Ivanov, A.P., Dekonenko, Y.P., Shutkova, T.M., Dzagurova, T.K., Tkachenko, E.A., 1996. Polyclonal enzyme immunoassay system for detecting hantavirus antigens: Assessing the specificity using monoclonal antibodies and polymerase chain reaction (in Russian). Vopr. Virusol. 41, 110–112. Jaarola, M., Martinkova, N., Gunduz, I., Brunhoff, C., Zima, J., Nadachowski, A., Amori, G., Bulatova, N.S., Chondropoulos, B., Fraguedakis-Tsolis, S., Gonzalez-Esteban, J., Jose Lopez-Fuster, M., Kandaurov, A.S., Kefelioglu, H., da Luz Mathias, M., Villate, I., Searle, J.B., 2004. Molecular phylogeny of the speciose vole genus Microtus (Arvicolinae, Rodentia) inferred from mitochondrial DNA sequences. Mol. Phylogenet. Evol. 33, 647–663. Kang, H.J., Bennett, S.N., Dizney, L., Sumibcay, L., Arai, S., Ruedas, L.a., Song, J.-W., Yanagihara, R., 2009a. Host switch during evolution of a genetically distinct hantavirus in the American shrew mole (Neurotrichus gibbsii). Virology 388, 8– 14. Kang, H.J., Bennett, S.N., Sumibcay, L., Arai, S., Hope, A.G., Mocz, G., Song, J.-W., Cook, J.a., Yanagihara, R., 2009b. Evolutionary insights from a genetically divergent hantavirus harbored by the European common mole (Talpa europaea). PLoS ONE 4, e6149. Kariwa, H., Yoshimatsu, K., Sawabe, J., Yokota, E., Arikawa, J., Takashima, I., Fukushima, H., Lundkvist, A., Shubin, F.N., Isachkova, L.M., Slonova, R.A., Leonova, G.N., Hashimoto, N., 1999. Genetic diversities of hantaviruses among rodents in Hokkaido, Japan and Far East Russia. Virus Res. 59, 219–228. King, A.M.Q., Adams, M.J., Carstens, E.B., Lefkowitz, E.J. (Eds.), 2012. Virus Taxonomy: Classification and Nomenclature of Viruses. Elsevier, San Diego, Ninth Report of the International Committee on Taxonomy of Viruses. Klempa, B., Meisel, H., Rath, S., Bartel, J., Ulrich, R.G., Krüger, D.H., 2003. Occurrence of renal and pulmonary syndrome in a region of northeast Germany where Tula hantavirus circulates. J. Clin. Microbiol. 41, 4894–4897. Klempa, B., Fichet-Calvet, E., Lecompte, E., Auste, B., Aniskin, V., Meisel, H., Denys, C., Koivogui, L., ter Meulen, J., Krüger, D.H., 2006. Hantavirus in African wood mouse, Guinea. Emerg. Infect. Dis. 12, 838–840. Klempa, B., Fichet-Calvet, E., Lecompte, E., Auste, B., Aniskin, V., Meisel, H., Barrière, P., Koivogui, L., ter Meulen, J., Krüger, D.H., 2007. Novel hantavirus sequences in shrew, Guinea. Emerg. Infect. Dis. 13, 520–522. Klempa, B., Tkachenko, E.a., Dzagurova, T.K., Yunicheva, Y.V., Morozov, V.G., Okulova, N.M., Slyusareva, G.P., Smirnov, A., Krüger, D.H., 2008. Hemorrhagic fever with renal syndrome caused by 2 lineages of Dobrava hantavirus, Russia. Emerg. Infect. Dis. 14, 617–625. Klempa, B., Avsic-Zupanc, T., Clement, J., Dzagurova, T.K., Henttonen, H., Heyman, P., Jakab, F., Kruger, D.H., Maes, P., Papa, A., Tkachenko, E.a., Ulrich, R.G., Vapalahti, O., Vaheri, A., 2013. Complex evolution and epidemiology of Dobrava-Belgrade hantavirus: definition of genotypes and their characteristics. Arch. Virol. 158, 521–529. Korva, M., Duh, D., Puterle, A., Trilar, T., Avsic-Zupanc, T., 2009. First molecular evidence of Tula hantavirus in Microtus voles in Slovenia. Virus Res. 144, 318– 322. Krüger, D.H., Schönrich, G., Klempa, B., 2011. Human pathogenic hantaviruses and prevention of infection. Hum. Vaccines 7, 685–693. Krüger, D.H., Ulrich, R.G., Hofmann, J., 2013. Hantaviruses as zoonotic pathogens in Germany. Dtsch. Arztebl. Int. 110, 461–467. Lee, P.W., Amyx, H.L., Yanagihara, R., Gajdusek, D.C., Goldgaber, D., Gibbs, C.J., 1985. Partial characterization of Prospect Hill virus isolated from meadow voles in the United States. J. Infect. Dis. 152, 826–829. Lee, J.G., Gu, S.H., Baek, L.J., Shin, O.S., Park, K.S., Kim, H.-C., Klein, T.a., Yanagihara, R., Song, J.-W., 2014. Muju virus, harbored by Myodes regulus in Korea, might represent a genetic variant of Puumala Virus, the prototype arvicolid rodentborne Hantavirus. Viruses 6, 1701–1714. Maes, P., Klempa, B., Clement, J., Matthijnssens, J., Gajdusek, D.C., Krüger, D.H., Van Ranst, M., 2009. A proposal for new criteria for the classification of hantaviruses, based on S and M segment protein sequences. Infect. Genet. Evol. 9, 813–820. Martin, D.P., Lemey, P., Lott, M., Moulton, V., Posada, D., Lefeuvre, P., 2010. RDP3: a flexible and fast computer program for analyzing recombination. Bioinformatics 26, 2462–2463. Martinkova, N., Zima, J., Jaarola, M., Macholan, M., Spitzenberger, F., 2007. The origin and phylogenetic relationships of Microtus bavaricus based on karyotype and mitochondrial DNA sequences. Folia Zool. Brno 56, 39–49. Pavlinov, I.Y., Lisovskyi, A.A. (Eds.), 2012. Russian Mammals: Systematical and Geographical Hand-book, Vol. 52. MGU Zoological Museum Transactions, Moscow. Peters, C.J., Simpson, G.L., Levy, H., 1999. Spectrum of hantavirus infection: hemorrhagic fever with renal syndrome and hantavirus pulmonary syndrome. Annu. Rev. Med. 50, 531–545. Plyusnin, A., Vapalahti, O., Lankinen, H., Lehväslaiho, H., Apekina, N., Myasnikov, Y., Kallio-Kokko, H., Henttonen, H., Lundkvist, A., Brummer-Korvenkontio, M., 1994. Tula virus: a newly detected hantavirus carried by European common voles. J. Virol. 68, 7833–7839. Plyusnina, A., Laakkonen, J., Niemimaa, J., Nemirov, K., Muruyeva, G., Pohodiev, B., Lundkvist, A., Vaheri, A., Henttonen, H., Vapalahti, O., Plyusnin, A., 2008. Genetic analysis of hantaviruses carried by Myodes and Microtus rodents in Buryatia. Virol. J. 5, 4. Pounder, K.C., Begon, M., Sironen, T., Henttonen, H., Watts, P.C.P.C., Voutilainen, L., Vapalahti, O., Klempa, B., Fooks, A.R., McElhinney, L.M., 2013. Novel hantavirus in field vole, United Kingdom. Emerg. Infect. Dis. 19, 673–675. Scharninghausen, J.J., Pfeffer, M., Meyer, H., Davis, D.S., Honeycutt, R.L., Faulde, M., 2002. Genetic evidence for Tula virus in Microtus arvalis and Microtus agrestis populations in Croatia. Vector Borne Zoonotic Dis. 2, 19–27.

Please cite this article in press as: Tkachenko, E.A., et al. Adler hantavirus, a new genetic variant of Tula virus identified in Major’s pine voles (Microtus majori) sampled in southern European Russia. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.11.018

Q6

447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532

MEEGID 2161

No. of Pages 8, Model 5G

27 November 2014 8 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568

E.A. Tkachenko et al. / Infection, Genetics and Evolution xxx (2014) xxx–xxx

Schlegel, M., Ali, H.S., Stieger, N., Groschup, M.H., Wolf, R., Ulrich, R.G., 2012a. Molecular identification of small mammal species using novel cytochrome B gene-derived degenerated primers. Biochem. Genet. 50, 440–447. Schlegel, M., Kindler, E., Essbauer, S.S., Wolf, R., Thiel, J., Groschup, M.H., Heckel, G., Oehme, R.M., Ulrich, R.G., 2012b. Tula virus infections in the Eurasian water vole in Central Europe. Vector-Borne Zoonotic Dis. 12, 503–513. Schmidt-Chanasit, J., Essbauer, S., Petraityte, R., Yoshimatsu, K., Tackmann, K., Conraths, F.J., Sasnauskas, K., Arikawa, J., Thomas, A., Pfeffer, M., Scharninghausen, J.J., Splettstoesser, W., Wenk, M., Heckel, G., Ulrich, R.G., 2010. Extensive host sharing of central European Tula virus. J. Virol. 84, 459– 474. Sibold, C., Sparr, S., Schulz, A., Labuda, M., Kozuch, O., Lysy´, J., Krüger, D.H., Meisel, H., 1995. Genetic characterization of a new hantavirus detected in Microtus arvalis from Slovakia. Virus Genes 10, 277–281. Sironen, T., Plyusnin, A., 2011. Genetics and evolution of hantaviruses. In: Plyusnin, A., Elliott, R.M. (Eds.), Bunyaviridae: Molecular and Cellular Biology. Caister Academic Press, Norfolk, pp. 61–94. Song, W., Torrez-Martinez, N., Irwin, W., Harrison, F.J., Davis, R., Ascher, M., Jay, M., Hjelle, B., 1995. Isla Vista virus: a genetically novel hantavirus of the California vole Microtus californicus. J. Gen. Virol. 76, 3195–3199. Song, J.W., Gligic, A., Yanagihara, R., 2002. Identification of Tula hantavirus in Pitymys subterraneus captured in the Cacak region of Serbia–Yugoslavia. Int. J. Infect. Dis. 6, 31–36. Song, J.W., Gu, S.H., Bennett, S.N., Arai, S., Puorger, M., Hilbe, M., Yanagihara, R., 2007a. Seewis virus, a genetically distinct hantavirus in the Eurasian common shrew (Sorex araneus). Virol. J. 4, 114. Song, J.W., Kang, H.J., Song, K.J., Truong, T.T., Bennett, S.N., Arai, S., Truong, N.U., Yanagihara, R., 2007b. Newfound hantavirus in Chinese mole shrew, Vietnam. Emerg. Infect. Dis. 13, 1784–1787. Sumibcay, L., Kadjo, B., Gu, S.H., Kang, H.J., Lim, B.K., Cook, J.A., Song, J.W., Yanagihara, R., 2012. Divergent lineage of a novel hantavirus in the banana pipistrelle (Neoromicia nanus) in Côte d’Ivoire. Virol. J. 9, 34. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. Tkachenko, E.A., Dekonenko, A., Ivanov, A., Dzagurova, T., Ivanov, L., Slonova, R., Nurgaleeva, R., Stepanenko, A., Ivanidze, E., Zagidullin, I., 1999. Hemorrhagic

fever with renal syndrome and hantaviruses in Russia. In: Emergence and Control of Rodent-borne Viral Diseases. Elsevier, France, pp. 63–72. Tkachenko, E.A., Okulova, N.M., Yunicheva, Y.V., Morzunov, S.P., Khaibulina, S.F., Riabova, T.E., Vasilenko, L.E., Bashkirtsev, V.N., Dzagurova, T.K., Gorbachkova, E.A., Sedova, N.S., Balakirev, A.E., Dekonenko, A.E., Drozdov, S.G., 2005. The epizootological and virological characteristics of a natural hantavirus infection focus in the subtropic zone of the Krasnodar territory (in Russian). Vopr. Virusol. 50, 14–19. Tkachenko, E.A., Bernshtein, A.D., Dzagurova, T.K., Morozov, V.G., Slonova, R.A., Ivanov, L.I., Trankvilevskiy, D.V., Krüger, D.H., 2013. Actual problems of hemorrhagic fever with renal syndrome in Russia (in Russian). J. Microbiol. Epidemiol. Immunol. (1), 51–58. Vaheri, A., Henttonen, H., Voutilainen, L., Mustonen, J., Sironen, T., Vapalahti, O., 2013. Hantavirus infections in Europe and their impact on public health. Rev. Med. Virol. 23, 35–49. Vapalahti, O., Lundkvist, A., Fedorov, V., Conroy, C.J., Hirvonen, S., Plyusnina, A., Nemirov, K., Fredga, K., Cook, J.A., Niemimaa, J., Kaikusalo, A., Henttonen, H., Vaheri, A., Plyusnin, A., 1999. Isolation and characterization of a hantavirus from Lemmus sibiricus: evidence for host switch during hantavirus evolution. J. Virol. 73, 5586–5592. Wang, C.-Q., Gao, J.-H., Li, M., Guo, W.-P., Lu, M.-Q., Wang, W., Hu, M.-X., Li, M.-H., Yang, J., Liang, H.-J., Tian, X.-F., Holmes, E.C., Zhang, Y.-Z., 2014. Co-circulation of Hantaan, Kenkeme, and Khabarovsk Hantaviruses in Bolshoy Ussuriysky Island, China. Virus Res. 191, 51–58. Weiss, S., Witkowski, P.T., Auste, B., Nowak, K., Weber, N., Fahr, J., Mombouli, J.-V., Wolfe, N.D., Drexler, J.F., Drosten, C., Klempa, B., Leendertz, F.H., Kruger, D.H., 2012. Hantavirus in bat, Sierra Leone. Emerg. Infect. Dis. 18, 159–161. Zelená, H., Mrázek, J., Kuhn, T., 2013. Tula hantavirus infection in immunocompromised host, Czech Republic. Emerg. Infect. Dis. 19, 1873–1875. Zou, Y., Wang, J.B., Gaowa, H.S., Yao, L.S., Hu, G.W., Li, M.H., Chen, H.X., Plyusnin, A., Shao, R., Zhang, Y.Z., 2008a. Isolation and genetic characterization of hantaviruses carried by Microtus voles in China. J. Med. Virol. 80, 680–688. Zou, Y., Xiao, Q.Y., Dong, X., Lv, W., Zhang, S.P., Li, M.H., Plyusnin, A., Zhang, Y.Z., 2008b. Genetic analysis of hantaviruses carried by reed voles Microtus fortis in China. Virus Res. 137, 122–128.

Please cite this article in press as: Tkachenko, E.A., et al. Adler hantavirus, a new genetic variant of Tula virus identified in Major’s pine voles (Microtus majori) sampled in southern European Russia. Infect. Genet. Evol. (2014), http://dx.doi.org/10.1016/j.meegid.2014.11.018

569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604