Administration of Donor-Derived Mesenchymal Stem Cells Can Prolong the Survival of Rat Cardiac Allograft

Administration of Donor-Derived Mesenchymal Stem Cells Can Prolong the Survival of Rat Cardiac Allograft H.P. Zhou, D.H. Yi, S.Q. Yu, G.C. Sun, Q. Cui, H.L. Zhu, J.C. Liu, J.Z. Zhang, and T.J. Wu ABSTRACT Background. Mesenchymal stem cells (MSCs) are multipotent adult elements that have recently been shown to have profound immunomodulatory effects both in vitro and in vivo. Herein we have examined the impact of intravenous infusion of donor MSCs on the survival of transplanted hearts in a rat allograft model. Methods. Recipient Fisher344 rats were transplanted with hearts from inbred Wistar rats. Wistar rat MSCs were infused via the tail vein at designated intervals. In vitro mixed lymphocyte reaction (MLR) and cell-mediated lympholysis (CML) assays were performed to assess whether MSCs downregulated T-cell responses in vivo. Real-time polymerase chain reaction (PCR) was used to analyze the Th1/Th2 balance in MSC-treated and control groups. Results. The MSCs cultured in vitro exhibited multipotential for differentiation. Survival of the allografts was markedly prolonged by administration of MSCs compared with the controls, namely mean survivals of 12.4 vs 6.4 days, respectively. Real-time PCR showed a shift in the Th1/Th2 balance toward Th2. By MLR and CML assays, untreated control rats showed greater alloreactivity than did MSC-treated rats. Conclusion. Our results indicated that MSCs suppressed allogeneic T-cell responses both in vitro and in vivo. Intravenous administration of MSCs prolonged the survival of transplanted hearts, possibly by induction of allograft tolerance through changing the Th1/Th2 balance.

M

ESENCHYMAL stem cells (MSCs) are one of the most promising, nonhematopoietic, pluripotent cells present in adult bone marrow that can differentiate under appropriate stimuli along three principal lineages: osteoblastic, adipocytic, and chondrocytic.1 Differentiation of MSCs into cardiomyocyte-like cells has been observed under specific culture conditions and after injection into healthy or infarcted myocardium in animals.2– 4 Therapeutic uses of marrow-derived MSCs in cardiovascular repair have been recently reported, such as acute myocardial infarction.5 In addition to its great potential in regenerative medicine, MSCs have been receiving increased attention to maintain immunoregulatory function. The MSCs possess unique immunologic properties. Human MSCs express negligible levels of human leukocyte antigen (HLA) major histocompatibility complex (MHC) class I. They can be induced to express MHC class II antigen, and Fas ligand by interferon-␥(IFN-␥) treatment.6 – 8 Moreover, MSCs do not express co-stimulatory molecules, such as B7-1, B7-2, CD40, and CD40 ligand; therefore, they may not activate alloreac-

tive T cells.8,9 Moreover, MSCs have been successfully harnessed to treat severe acute graft-versus-host disease (GVHD),10 and co-infusion with hematopoietic stem cells greatly reduced the incidence of GVHD. A recent study indicated that adult human MSCs can engraft and survive in a xenogenic immunocompetent environment.11 Heart transplantation still remains the only solution for end-stage heart diseases, but long-term immunosuppressive drug treatment carries direct toxicity and metabolic side effects.12 The active induction of allograft tolerance allowing drug-free allograft acceptance with preserved immunocompetence has long been a dream for clinicians. From the Department of Cardiovascular Surgery, Xijing Hospital, Fourth Military Medical University, Xi’an City, Shannxi Province, China. Address reprint requests to Heping Zhou, MD, Department of Cardiovascular Surgery, Xijing Hospital, Fourth Military Medical University, 17 Changle West Road, 710032, Xi’an, People’s Republic of China. E-mail: [email protected]

0041-1345/06/$–see front matter doi:10.1016/j.transproceed.2006.10.002

© 2006 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710

3046

Transplantation Proceedings, 38, 3046 –3051 (2006)

PROLONGING RAT CARDIAC ALLOGRAFT SURVIVAL

Considering MSC’s multipotential for differentiation and immunoregulatory characteristics, we investigated whether intravenous (IV) infusion with MSCs prolonged the survival of transplanted hearts. MATERIALS AND METHODS Experimental Animals Inbred Wistar rats weighing 180 to 200 g and Fisher344(F344) rats weighing 160 to 180 g were used as donors and recipients in a cardiac allograft model, respectively. Animals were purchased from National Rodent Laboratory Animal Resources, Shanghai Branch (Shanghai, China) and humanely cared for in compliance with institutional guidelines.

Cell Isolation, Culture, and Characterization Isolation and primary culture of MSCs were performed according to a protocol modified from a previously reported method.13 Briefly, after donor Wistar rats were euthanized with an overdose of pentobarbital (100 mg/kg given intraperitoneally), bone marrow was collected by flushing femurs and tibias with complete medium constituted of Dulbecco’s modified Eagle’s medium (DMEM, Gibco-BRL, Grand Island, New York; Sigma-Aldrich, St. Louis, MO), 10% fetal calf serum (FCS, Sigma-Aldrich,), 2 mmol/L L-glutamine, 100 U/mL penicillin, and 50 mg/mL streptomycin(Gibco-BRL) supplemented with heparin at a final concentration of 5 U/mL. The cells filtered through a 70-␮m nylon filter (Falcon, San Jose, Calif) were then washed twice in a medium without heparin and plated into 75-cm2 flasks at a density of 2 ⫻ 106 cells/cm2. Medium was completely replaced every 3 days, and the nonadherent cells were discarded. Cultured MSCs were observed under a phase microscope to assess their level of expansion and to verify their morphology at each culture medium change. In order to prevent the MSCs from differentiating or slowing their rate of division, each primary culture was replated to new flasks when the cell density within colonies became 80% to 90% confluent, approximately 2 weeks after seeding. The adherent cells were detached with 0.25% trypsin (Sigma-Aldrich) in 1 mmol/L sodium ethylenediaminetetraacetic acid (EDTA, Gibco-BRL), split 1:3, and seeded into fresh flasks. After the twice-passaged cells became nearly confluent, they were harvested and used for the experiments described below. For immunocytochemical staining, cells were fixed with methanol at ⫺20°C for 10 minutes and rinsed with phosphate-buffered saline (PBS) twice. Samples were then incubated with antibodies to CD29, CD31, CD34, CD45, CD106, CD117 (Sigma-Aldrich) for 30 minutes, rinsed with PBS, and incubated with tetramethylrhodamine isothiocyanate (TRITC)-labeled secondary goat anti-rabbit monoclonal antibodies (Santa Cruz, Calif). Negative controls for antibody type were performed on MSCs by omitting the primary antibody.

Mixed Lymphocyte Reaction and Cell-Mediated Lympholysis Peripheral blood mononuclear cells (PBMC) were isolated from heparinized blood by gradient centrifugation over 1.088 g/mL Percoll solution (Sigma-Aldrich). Peripheral blood lymphocytes (PBLs) were purified from the PBMC preparation by the removal of plastic-adherent cells during culture at 37°C for 1 hour in a horizontal 25-cm2 flask. Cell counts and viability were assessed by trypan blue dye exclusion. To assess whether MSCs elicited an immune response, a modified mixed lymphocyte reaction (MLR)

3047 assay was performed, in which donor-derived MSCs were cocultured with recipient responder PBLs in one-way MLR. Briefly, responder recipient cells (1 ⫻ 105) and an equal number of irradiated (3000 cGy) donor-stimulating cells were co-cultured in triplicate in 0.2 mL of tissue culture medium (Roswell Park Memorial Institute Media [RPMI-1640], Gibco-BRL) using 96 V-bottomed well plates. The MSCs were administered at 105, 104, 103, and 102 per well or without MSCs. The plates were pulsed with 1 ␮Ci/well 3H-thymidine during the last 13 hours of a 5-day culture. Cells were harvested over fiberglass filters and thymidine uptake, quantified in a microplate scintillation and luminescence counter (Beckman Coulter, Fullerton, Calif). Results were expressed as mean counts per minute (CPM). Percent of maximal response was calculated by dividing the proliferative response observed with the addition of MSCs by that without MSCs. To test MSC immunoregulatory effect on T-cell cytotoxicity, cell-mediated lympholysis (CML) assays were performed using a standard 4-hour 51Cr-release assay, as previously described.14 Splenocytes from recipients posttransplantation and donors were added as effector cells and target cells, respectively, (target:effector cell ratio ⫽ 50:1). All experiments were performed a minimum of three separate times.

Heterotopic Heart Transplantation and Administration of MSCs Intra-abdominal cardiac transplantation was performed between donor Wistar rats and recipient F344 rats according to Corry’s method.15 In brief, animals were anesthetized and the donor heart was infused with cold lactated Ringer’s solution containing heparin (100 U/mL), harvested, and preserved in cold Ringer’s solution. The donor heart was then implanted into the abdominal cavity by anastomosing the aorta and pulmonary artery to the aorta and vena cava of recipient in an end-to-side manner, respectively. Operative times for the heterotopic heart transplantation ranged from 45 to 60 minutes, with a success rate of approximately 95%. Graft function was assessed daily by palpation. Loss of graft function within 48 hours of transplantation was considered a technical failure (⬍5% on average), and these animals were omitted from further analysis. Recipients were engrafted with donor-derived MSCs by IV injection (2 ⫻ 106 cells resuspended in 2 mL sterile lactated Ringer’s solution) through the tail vein. The first dose was given at 1 week before, and the second dose was given at the time of heart transplantation, followed by three additional doses each day for 3 consecutive days’ posttransplantation. Recipients injected with only sterile lactated Ringer’s solution at the same intervals were used as a control group.

Real-Time Polymerase Chain Reaction (PCR) For analysis of the pattern of cytokine expression during allograft rejection, transplanted hearts were screened for mRNA changes by real-time quantitative PCR. In brief, total mRNA was isolated with the RNeasy Mini Kit (Qiagen), including a DNase digestion step to exclude contaminating DNA. It was reverse-transcribed with TaqMan Reverse Transcription Reagents (Applied Biosystems, Foster City, Calif) Real-time PCR with relative quantification of target gene copy numbers in relation to ␤-actin gene was performed using the following primers: IL-1␤ Sense GGACCCAAGCACCTTCTTTT Antisense AGACAGCACGAGGCATTTTT IFN-␥ Sense TCTGGAGGAACTGGCAAAAG Antisense GTGCTGGATCTGTGGGTTG IL-10 Sense CACTGCTATGTTGCCTGCTC

3048

ZHOU, YI, YU ET AL

Antisense TGTCCAGCTGGTCCTTCTTT IL-4 Sense GTGCACCGAGTTGACCGTAA Antisense TGTAGAACTGCCGGAGCACA The DNA Engine Opticon system (MJ Research, Watertown, Mass) was used to monitor real-time PCR amplification using SYBR Green I (Molecular Probes, Eugene, Ore). All reactions were performed in a total volume of 25 ␮L. We subsequently determined the threshold cycle (Ct), ie, the cycle number at which the amount of amplified gene of interest reached a fixed threshold. Relative quantitation of IL-1␤, IFN-␥, IL-10, and IL-4 mRNA expression was performed with the comparative Ct method. The relative quantitation value of target, normalized to an endogenous control ␤-actin gene and relative to a calibrator, is expressed as 2⫺⌬⌬Ct, where ⌬Ct ⫽ (Ct of target gene)⫺(Ct of control gene), and ⌬⌬Ct ⫽ (⌬Ct of samples for target gene)⫺(⌬Ct of calibrator for the target gene). To avoid the possibility of amplifying contaminant DNA, (i) all of the primers for real-time (RT)PCR were designed with an intron sequence inside cDNA to be amplified; (ii) reactions were performed with appropriate negative controls (template-free controls); (iii) a uniform amplification of the products was rechecked by analyzing the melting curves of the amplified products (dissociation graphs); (iv) the melting temperature (Tm) was 57° to 60°C, the probe Tm was at least 10°C higher than primer Tm; and (v) gel electrophoresis was performed to confirm the correct size of the amplification and the absence of nonspecific bands.

Statistics Data are expressed as mean values ⫾ standard deviations (SD). One-way ANOVA was used for two-group comparisons. P values less than .05 were considered to be significant.

RESULTS Cell Culture of MSCs and Immunocytochemistry

The MSCs were isolated according to their ability to adhere to cell culture plastic. In vitro MSCs appeared as two distinct morphological phenotypes. Cells from passage 0 demonstrated a fibroblast-like, spindle-shaped morphology (Fig 1A). Later, MSCs began to display a broadened, flat morphology (Fig 1B). Immunocytochemical findings revealed that MSCs were negative for hematopoietic markers CD34, CD45, or endothelial cell marker CD31, but typically expressed the antigens CD29, CD106, and CD117 (Fig 2). Suppression of T-Cell Response by MSCs

To test whether MSCs elicited an allogeneic lymphocyte response when injected in vivo, recipient PBLs were cocultured with donor-derived MSCs. As shown in Fig 3A, no significant proliferative response was detected: the proliferative response against allogeneic MSCs was comparable to autologous controls. Results were expressed as mean counts per minute (CPM) ⫾ SD. To assess whether MSCs exerted an effect on T-cell proliferation, recipient respondent PBLs were stimulated with irradiated allogeneic PBLs from donors. Donor MSCs were added on day 0 at decreasing concentrations. From Fig 3B we observed that proliferative activity was suppressed in dose-dependent fashion. Furthermore, CML results indicated that T-cell cytotoxicity was also significantly inhibited in the MSC-treated group compared with the control group (Fig 3C).

Fig 1. Rat mesechymal stem cell isolation. (A) Passage 0 MSCs with a 100⫻ magnification. (B) MSCs of passage 3 magnified 200⫻.

Heart Allograft Survival

Eight recipients were injected with donor MSCs at scheduled intervals for five doses. Only one of eight heart allografts was rejected at day 2 posttransplantation before the last dose of MSC infusion. The mean allograft survival time was 12 days (Table 1). Compared with control group (n ⫽ 8, mean survival time 6 days) injected with only sterile lactated Ringer’s solution, the MSC-treatment group exhibited significantly prolonged allograft survival (P ⫽ .009). Effect of Treatment With MSCs on Th1/Th2 Balance

To elucidate potential mechanisms underlying their immunomodulatory function on allograft, transplanted hearts on day 5 posttransplantation used real-time quantitative PCR to screen for changes in the gene expression of Th1- and Th2-type cytokines. As shown by Fig 4, heart allografts in the MSCtreated group showed a highly significant (P ⬍ .05) reduction in the expression of genes encoding the pro-inflammatory Th1-type cytokines IL-1␤ and IFN-␥, while the anti-inflammatory Th2-type cytokines IL-4 and IL-10 were greatly expressed in the MSC-treated group but not in the control group.

PROLONGING RAT CARDIAC ALLOGRAFT SURVIVAL

Fig 2. Immunocytochemical staining of MSCs. Immunostaining was performed with antibodies against CD29, CD31, CD34, CD45, CD106, and CD107. The TRITC-conjugated secondary antibodies were used. Positive staining for CD29, CD106, and CD107 was displayed with a magnification of 400⫻. TRITC, tetramethylrhodamine isothiocyanate.

DISCUSSION

Our study reported the implication for heart transplantation of the immunological properties of MSC. Infusion of MSCs appeared to shift the Th1/Th2 balance toward a Th2-type response. This shift of Th1/Th2 balance seemed to be closely associated with a significant prolongation of heart allograft survival.

3049

Fig 3. (A) The MSCs do not elicit an allogeneic proliferative response when co-cultured with recipient lymphocytes (third bar), which is similar to experiments performed between autologous lymphocytes (second bar). A positive control was also performed between donor and recipient lymphocytes (first bar). (B) This view reveals that MSCs suppress alloreactivity in a dose-dependent way. Responding recipient lymphocytes were cultured with irradiated donor-derived lymphocytes without MSCs (first bar), and the mean value of these reponses was used as the maximal stimulation. The mean of triplicates observed after addition of MSCs divided by the maximal responses was calculated as a percent of maximal response. (C) The MSCs inhibit T-cell cytotoxicity in heart allograft. A total of 5 ⫻ 105 splenocytes from recipients posttransplantation were used as target cells, and 1 ⫻ 104 splenocytes from donors were used as effector cells. Target cells and 1% Triton were cultured together to get the maximal release.

3050

ZHOU, YI, YU ET AL

Although there are several reports on the isolation of MSCs, we have selected the most efficient and clinically accessible method to obtain highly purified MSCs. The immunophenotype profile of the cells was consistent with MSCs.1 In vitro, MSCs can undergo adipogenic, chondrogenic, and osteogenic differentiation (data not shown), suggesting that the cells are indeed MSCs. However, because cell cloning was not performed, it is possible that the MSCs used in the study were heterogeneous. In the field of solid-organ transplantation, induction of specific immunologic tolerance to donor antigens would avoid both chronic graft rejection and the side effects associated with chronic, nonspecific immunosuppressive therapy. Stable chimerism seems to be linked to permanent tolerance of donor organ.16 Hematopoietic stem cells and embryonic stem cells have both proved to be able to establish chimerism and induce allograft tolerance, but some unavoidable problems such as necessary host conditioning, GVHD, and ethical obstacles stymie their wide clinical application.17,18 Thus, it is urgent to develop a new cell population for induction of donor-specific allograft tolerance. More and more research has shown that MSCs exhibit outstanding immunomodulatory functions both in vitro and in vivo. In our study, we demonstrated that MSCs did not elicit proliferative responses from allogeneic lymphocytes and significantly suppressed T-cell responses in a dose-dependent manner, which is consistent with previously reported findings.19 The MSCs are preferred for several reasons. They can be obtained conveniently through a standard clinical procedure and easily expanded in culture into sufficient numbers for therapeutic use. Moreover, their administration can be autologous or via banked stores, given evidence that they may be immunoprivileged.20 Furthermore, MSCs can home to sites of tissue damage or inflammation,21 and thus in heart transplantation they may contribute to improved cardiac function. Mechanisms of tolerance induction include clonal deletion in the peripheral immune system22; clonal anergy in which T cells cannot respond adequately to specific antigens because of a lack of co-stimulatory signals23; and immunosuppression in which the balance of Th1/Th2 is mainly involved.24 The Th1 cells, which produce IFN-␥ and IL-2, are dominant in rejection reactions, whereas Th2 cells, which produce IL-4 and IL-10, are involved in the maintenance of immune hyporesponsiveness. In vitro study with interactions between culture-expanded human MSCs and various immune cells by Aggarwal et al25 revealed that human MSCs altered the outcome of immune cell responses by inhibiting two of the most important proinflamTable 1. Effect of MSC Treatment on Heart Allograft Survival Group

n

Graft Survival Days

Mean ⫾ SD (days)

MSC-treated Controls

8 8

2,10,10,12,14,15,17,19 3,5,5,6,7,8,8,9

12.4 ⫾ 5.3 6.4 ⫾ 2.0

MSC, mesenchymal slem cell.

P Value

P ⫽ .009

Fig 4. Cytokine gene expression difference between MSCtreated and control group. The ratio is MSC-treated vs controls. In the MSC-treated group, pro-inflammatory IL-1␤ and IFN-␥ (numbers above bars indicate actual values) were significantly (P ⬍ .05) suppressed, whereas anti-inflammatory IL-10 and IL-4 were greatly expressed in the MSC-treated group, shown as an arbitrary value, and not in control rats. Values above or below “1” indicate that gene expression in MSC-treated animals increased or decreased compared to control rats.

matory cytokines (TNF-␣ and IFN-␥) and by increasing expression of suppressive cytokines, including IL-10. They also proposed that when present in an inflammatory microenvironment, MSCs inhibited IFN-␥ secretion from Th1 and natural killer cells and increased IL-4 secretion from Th2 cells, thereby promoting a Th1 to Th2 shift. Furthermore, after systemic infusion of MSCs into immunocompetent hosts, MSCs established long-term residence in tissues, including bone marrow, spleen, liver, thymus, cardiac muscle, lung, and gastrointestinal tissues.26,27 Hence, according to our results, it may be that MSCs interact with immune cells possibly within liver, spleen, or bone marrow, thereby inducing a shift toward Th2 and resulting in helper T-cell polarization in the transplanted heart. In conclusion, our study suggested that IV infusion of MSCs induced allograft tolerance, possibly by Th2 dominance in the Th1/Th2 balance. Further work should be performed to understand how MSCs interact with immune cells in vivo to induce hyporesponsiveness. ACKNOWLEDGMENTS We thank P. Yuan, Department of Gynecology and Obstetrics, for his expert help with the real-time PCR study.

REFERENCES 1. Pittenger MF, Mackay AM, Beck SC, et al: Multilineage potential of adult mesenchymal stem cells. Science 284:143, 1999 2. Makino S, Fukuda K, Miyoshi S, et al: Cardiomyocytes can be generated from marrow stromal cells in vitro. J Clin Invest 103:697, 1999 3. Toma C, Pittenger MF, Cahill KS, et al: Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation 105:93, 2002 4. Mangi AA, Noiseux N, Kong D, et al: Mesenchymal stem cells modified with Akt prevent remodeling and restore performance of infarcted hearts. Nat Med 9:1195, 2003

PROLONGING RAT CARDIAC ALLOGRAFT SURVIVAL 5. Chen SL, Fang WW, Ye F, et al: Effect on left ventricular function of intracoronary transplantation of autologous bone marrow mesenchymal stem cell in patients with acute myocardial infarction. Am J Cardiol 94:92, 2004 6. Le Blanc K, Tammik L, Sundberg B, et al: Mesenchymal stem cells inhibit and stimulate mixed lymphocyte cultures and mitogenic responses independently of the major histocompatibility complex. Scand J Immunol 57:11, 2003 7. Majumdar MK, Keane-Moore M, Buyaner D, et al: Characterization and functionality of cell surface molecules on human mesenchymal stem cells. J Biomed Sci 10:228, 2003 8. Di Nicola M, Carlo-Stella C, Magni M, et al: Human bone marrow stromal cells suppress T-lymphocyte proliferation induced by cellular or nonspecific mitogenic stimuli. Blood 99:3838, 2002 9. Tse WT, Pendleton JD, Beyer WM, et al: Suppression of allogeneic T-cell proliferation by human marrow stromal cells: implications in transplantation. Transplantation 75:389, 2003 10. Le Blanc K, Rasmusson I, Sundberg B, et al: Treatment of severe acute graft-versus-host disease with third party haploidentical mesenchymal stem cells. Lancet 363:1439, 2004 11. Grinnemo KH, Mansson A, Dellgren G, et al: Xenoreactivity and engraftment of human mesenchymal stem cells transplanted into infarcted rat myocardium. J Thorac Cardiovasc Surg 127:1293, 2004 12. Denton MD, Magee CC, Sayegh MH. Immunosuppressive strategies in transplantation. Lancet 353:1083, 1999 13. Wang JS, Shum-Tim D, Galipeau J, et al: Marrow stromal cells for cellular cardiomyoplasty: feasibility and potential clinical advantages. J Thorac Cardiovasc Surg 120:999, 2000 14. Fandrich F, Zhu X, Schroder J, et al: Different in vivo tolerogenicity of MHC class I peptides. J Leukoc Biol 65:16, 1999 15. Corry RJ, Winn HJ, Russell PS. Primarily vascularized allografts of hearts in mice. The role of H-2D, H-2K, and non-H-2 antigens in rejection. Transplantation 16:343, 1973 16. Wekerle T, Sykes M: Mixed chimerism and transplantation tolerance. Annu Rev Med 52:353, 2001

3051 17. Helg C, Chapuis B, Bolle JF, et al: Renal transplantation without immunosuppression in a host with tolerance induced by allogeneic bone marrow transplantation. Transplantation 58:1420, 1994 18. Fandrich F, Lin X, Chai GX, et al: Preimplantation-stage stem cells induce long-term allogeneic graft acceptance without supplementary host conditioning. Nat Med 8:171, 2002 19. Bartholomew A, Sturgeon C, Siatskas M, et al: Mesenchymal stem cells suppress lymphocyte proliferation in vitro and prolong skin graft survival in vivo. Exp Hematol 30:42, 2002 20. Liechty KW, MacKenzie TC, Shaaban AF, et al: Human mesenchymal stem cells engraft and demonstrate site-specific differentiation after in utero transplantation in sheep. Nat Med 6:1282, 2000 21. Devine SM, Bartholomew AM, Mahmud N, et al: Mesenchymal stem cells are capable of homing to the bone marrow of non-human primates following systemic infusion. Exp Hematol 29:244, 2001 22. Ferber I, Schonrich G, Schenkel J, et al: Levels of peripheral T cell tolerance induced by different doses of tolerogen. Science 263:674, 1994 23. Schwartz RH: A cell culture model for T lymphocyte clonal anergy. Science 248:1349, 1990 24. Onodera K, Hancock WW, Graser E, et al: Type 2 helper T cell-type cytokines and the development of “infectious” tolerance in rat cardiac allograft recipients. J Immunol 158:1572, 1997 25. Aggarwal S, Pittenger MF: Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 105:1815, 2005 26. Devine SM, Cobbs C, Jennings M, et al: Mesenchymal stem cells distribute to a wide range of tissues following systemic infusion into nonhuman primates. Blood 101:2999, 2003 27. Allers C, Sierralta WD, Neubauer S, et al: Dynamic of distribution of human bone marrow-derived mesenchymal stem cells after transplantation into adult unconditioned mice. Transplantation 78:503, 2004