Adrenomedullin attenuates interleukin-1β-induced inflammation and apoptosis in rat Leydig cells via inhibition of NF-κB signaling pathway

Experimental Cell Research 339 (2015) 220–230

Contents lists available at ScienceDirect

Experimental Cell Research journal homepage: www.elsevier.com/locate/yexcr

Research Article

Adrenomedullin attenuates interleukin-1β-induced inflammation and apoptosis in rat Leydig cells via inhibition of NF-κB signaling pathway Wei Hu a,1, Pang-hu Zhou b,n,1, Ting Rao a, Xiao-bin Zhang a, Wei Wang a, Li-jun Zhang a a b

Department of Urology, Renmin Hospital of Wuhan University, No. 238 Liberation Road, Wuhan 430060, Hubei Province, China Department of Orthopedics, Renmin Hospital of Wuhan University, No. 238 Liberation Road, Wuhan 430060, Hubei Province, China

art ic l e i nf o

a b s t r a c t

Article history: Received 18 May 2015 Received in revised form 20 October 2015 Accepted 23 October 2015 Available online 25 October 2015

The aim of this paper is to investigate the protective effects of adrenomedullin (ADM) on interleukin-1β (IL-1β)-induced inflammation and apoptosis in rat Leydig cells and its underlying molecular mechanisms. Leydig cells were isolated from adult Sprague–Dawley rats. The cell culture was established by adding ADM 2 h prior to 24 h treatment with IL-1β-induced cytotoxicity. We detected cell viability and concentrations of testosterone, reactive oxygen species (ROS), malondialdehyde (MDA), and reduced glutathione (GSH). Gene expression levels were measured for inducible nitric oxide synthase (iNOS) and cyclo-oxygenase-2 (COX-2). Concentrations were detected for nitric oxide (NO) and prostaglandin E2 (PGE2). Apoptosis was assessed using terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL). Levels of gene expression and protein were detected for Bcl-2, Bax, caspase-3, and poly adenosine diphosphate-ribose polymerase (PARP). Protein levels were measured for nuclear factor kappa B (NF-κB) p65 and IκBα. ADM reduced IL-1β-induced cytotoxicity. ADM pretreatment significantly increased testosterone concentrations and decreased ROS, MDA, and GSH concentrations. ADM pretreatment inhibited IL-1β-induced inflammation in Leydig cells by decreasing the gene expression levels of iNOS and COX-2, as well as the concentrations of NO and PGE2. ADM pretreatment further decreased the number of TUNEL-positive stained Leydig cells, as confirmed by the increase in gene expression and protein levels of Bcl-2 and the decrease of Bax, caspase-3, and PARP levels. Moreover, ADM pretreatment inhibited NF-κB p65 phosphorylation and IκBα phosphorylation and degradation. ADM has potential anti-inflammatory and anti-apoptotic properties in IL-1β-induced rat Leydig cells, which might be related to NF-κB signaling pathway. & 2015 Elsevier Inc. All rights reserved.

Keywords: Adrenomedullin Interleukin-1β Inflammation Apoptosis Leydig cell NF-κB

1. Introduction Testosterone, which is the steroid hormone responsible for male sexual development and fertility, is primarily produced by the Leydig cells in the mammalian testis [1]. Leydig cells also produce pro- and anti-inflammatory cytokines and chemokines,

Abbreviations: IL-1β, Interleukin-1β; NF-κB, Nuclear factor-kappa B; ADM, Adrenomedullin; DMEM, Dulbecco's modified Eagle's medium; FBS, Fetal bovine serum; DAPI, 6-Dianidino-2-phenylindole dihydrochlor; PARP, Poly adenosine diphosphate-ribose polymerase; PBS, phosphate buffer solution; MTT, 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenytetrazolium bromide; RIA, Radioimmunoassay; H2DCF-DA, 2′,7′-Dichlorodihydrofluorescein diacetate; ROS, Reactive oxidative species; MDA, Malondialdehyde; TBARS, Thiobarbituric acid reactive substances; GSH, glutathione; NO, Nitric oxide; PGE2, Prostaglandin E2; ELISA, Enzyme-linked immunosorbent assay; TUNEL, Terminal deoxynucleotidyl transferase dUTP nickend labeling; PCR, Polymerase chain reaction; iNOS, Inducible nitric oxide synthase; COX-2, Cyclo-oxygenase-2 n Corresponding author. E-mail address: [email protected] (P.-h. Zhou). 1 Wei Hu and Pang-hu Zhou contributed equally to this study. http://dx.doi.org/10.1016/j.yexcr.2015.10.024 0014-4827/& 2015 Elsevier Inc. All rights reserved.

which are paracrine regulators of spermatogenesis and steroidogenesis under normal and pathological conditions [2]. Inflammation is the body's adaptive response to tissue malfunction or homeostatic imbalance to ensure removal of noxious stimuli, as well as a healing process for repairing damaged tissue [3]. Under certain conditions, inflammation can be triggered by various inducers, including microbial infection, tissue injury, or toxic compounds [4]. Inflammation has numerous beneficial effects; however, sustained or chronic inflammation is responsible for the detrimental conditions associated with the development of male infertility [5]. Pro-inflammatory cytokines, such as interleukin-1β (IL-1β), promote inflammation to inhibit testicular Leydig cell steroidogenesis at the gene expression level of steroidogenic enzymes and reduce intensity of spermatogenesis via apoptosis [6,7]. Apoptosis is known as an essential and autonomous physiological process of programmed cell death regulated by multiple signaling pathways. As with other organs, apoptosis occurs at a high rate in the primary male reproductive organ, testis [8]. Adrenomedullin (ADM) is a peptide initially isolated from pheochromocytoma and has shown to have potent vasodilatory

W. Hu et al. / Experimental Cell Research 339 (2015) 220–230

activity [9]. However, like other vasoactive peptide hormones, the physiological roles of ADM extend far beyond the regulation of vascular tonus and include a wide range of effects on cell proliferation, differentiation, and apoptosis [10,11]. ADM may play a role as an anti-inflammatory regulator of inflammatory response in the macrophages via its effect on production of inflammatory cytokines [12,13]. ADM2, a member of the ADM peptide family, has restorative effect on steroidogenesis in hydrogen peroxidetreated rat Leydig cells in primary culture [14]. However, no data have been reported on the effect of ADM on inflammation and apoptosis in Leydig cells. Transcriptional regulator nuclear factor-kappa B (NF-κB) was extensively studied in relation to inflammatory diseases because of its important roles in the regulation of inflammation and apoptosis [15]. NF-κB activation is the central mediator of inflammatory responses as mechanism of host defense against infection and stress [16]. NF-κB activation can cause cell death in some cases although it provides a survival-promoting signal in the majority of systems [17]. NF-κB is also involved in the regulation of Leydig cell apoptosis [18]. In this study, we investigated the ability of ADM to attenuate inflammation and apoptosis in Leydig cells by establishing an in vitro model in rat Leydig cells. We also explored the underlying mechanism of the protective role of ADM on Leydig cells by studying changes in the NF-κB signaling pathway.

2. Materials and methods 2.1. Reagents Rat ADM (1–50) was purchased from Phoenix (Belmont, CA, USA) and recombinant rat IL-1β was obtained from PeproTech (Rocky Hill, NJ, USA). Collagenase type IV, 3-(4,5-dimethylthiazol2-yl)-2,5-diphenytetrazolium bromide (MTT), Percoll, Dulbecco's modified Eagle's medium (DMEM)-F12, fetal bovine serum (FBS), 6-dianidino-2-phenylindole dihydrochloride (DAPI), and penicillin/streptomycin were obtained from Gibco (Grand Island, NY, USA). Caspase 3 colorimetric assay kits were purchased from R&D Systems (Minneapolis, MN, USA). In Situ Cell Apoptosis Detection kits were purchased from Roche Diagnostics (East Sussex, UK). Rabbit polyclonal antibodies for Bcl-2, Bax, and caspase-3; goat polyclonal antibody for poly adenosine diphosphate-ribose polymerase (PARP); and mouse monoclonal antibodies for NF-κB p65, phospho-NF-κB p65, and β-actin were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Mouse monoclonal antibodies for IκBα and phospho-IκBα were purchased from Cell Signaling Technology (Beverly, MA, USA). All other chemicals used in this study were of the highest available commercial grade.

221

followed by cervical dislocation for each isolation event. Testes were dissociated from the scrotum and decapsulated using fine forceps without breaking the seminiferous tubules under aseptic conditions. Harvested testes were cut into small pieces, placed in a 50 mL plastic tube (two testes per tube), and digested in 10 mL DMEM-F12 containing collagenase (0.25 mg/mL) at 37 °C in a shaking water bath (90 cycles/min) for 20 min. After incubation, the enzyme was diluted with collagenase-free DMEM-F12 until a total volume of 50 mL was reached. The tubes were allowed to stand for 10 min at room temperature without mixing. The supernatant was then aspirated using a Pasteur pipette and filtered using stainless steel trap valves (200 screen mesh) into sterile centrifuge tubes. This procedure was repeated to remove excess Leydig cells. The supernatants were combined and centrifuged at 2500
g for 10 min at 4 °C. After discarding the supernatant, the pellet obtained was resuspended in 2 mL of DMEM-F12 representing a crude testicular interstitial cell suspension. Cell suspension was then processed separately using Percoll gradient centrifugation to obtain the purified Leydig cells, as described previously [20], with modifications. Briefly, 2 mL of 35% Percoll gradient was carefully added to a graduated centrifuge tube. Above this layer, 30%, 25%, 20%, and 15% gradients of Percoll (2 mL of each) were overlaid gently one over the other without mixing. Finally, 2 mL of the crude Leydig cell suspension was applied on top of the entire discontinuous gradients of Percoll and centrifuged at 800
g for 30 min at 4 °C. After centrifugation, most of the purified Leydig cells were observed between the 25% and 30% gradients. These cells were carefully collected, resuspended with DMEM-F12, and centrifuged at 250
g at 4 °C for 15 min. The resulting supernatant was discarded. Percoll was removed by dilution with Percoll buffer and centrifugation. The Leydig cell viability was assessed using trypan blue dye exclusion method. Briefly, isolated Leydig cells were mixed with an equal volume of 0.4% trypan blue (Flow Laboratories, Irvine, Scotland), incubated for 5 min at 37 °C, and examined under a microscope. Leydig cells with at least 95% viability were used for subsequent experiments. Leydig cell enrichment was evaluated using histochemical staining for 3-beta-hydroxysteroid dehydrogenase activity with 0.4 mM etiocholanolone as the steroid substrate [21]. Briefly, an aliquot of Leydig cell fraction was incubated in 50 mM phosphate buffer solution (PBS) at pH 7.4 containing 0.2 mg/mL nitroblue tetrazolium (GIBCO/BRL), 1 mg/mL NAD, and 0.12 mg/mL dehydroepiandrosterone (Sigma) for 90 min at 34 °C. The percentage of positively stained cells was determined under the microscope. Leydig cells showed intense staining and were 90% more enriched. Depending on the isolation, the yield per isolation from 16 testes ranged from 24
106 to 32
106 Leydig cells. 2.4. Cell culture and experimental design

2.2. Animals Adult Sprague–Dawley rats approximately 90 days old and weighing approximately 400 g were purchased from the Experimental Animal Center of Wuhan University, China. Rats were housed individually under standard conditions (temperature: 217 1 °C; humidity: 55%–60%) with food and water available ad libitum and were used before they reached 120 days old. The care and use of the animals followed the recommendations and guidelines of the National Institutes of Health and were approved by the Wuhan University Animal Care and Use Committee. 2.3. Isolation, purification, and identification of Leydig cells Leydig cells were isolated as previously reported [19] with modifications. A total of 8 rats were euthanized with isoflurane

Leydig cells were cultured in 6-well plates at a density of 1
106 cells/well for a total volume of 2 mL of the growth medium (DMEM-F12 containing 3% FBS), 24-well plates at a density of 1.25
105 cells/well for a total volume of 1 mL of the growth medium (DMEM-F12 containing 3% FBS), or 96-well plates at a density of 1
104 cells/well for a total volume of 200 ml of the growth medium (DMEM-F12 containing 3% FBS). The cells were incubated at 37 °C for 24 h under 5% CO2 and 95% air. At the end of incubation, FBS medium was removed and the cells were incubated with serum-free medium for 1 h before the onset of experimental treatments. To determine the time- and dose-dependent effects of ADM, cells were cultured in 96-well plates with 200 ml serum-free DMEM in the presence of 100 nM ADM for various times (0, 12, 24, 36, and 48 h) or in the presence of various ADM doses (0, 10, 50,

222

W. Hu et al. / Experimental Cell Research 339 (2015) 220–230

100, and 300 nM) for 24 h, as indicated. The control Leydig cells were cultured using serum-free medium as a vehicle. Cell viability was assessed by MTT assay. To investigate the protective effect of ADM on IL-1β-induced cytotoxicity, cells were incubated in 96-well plates with 200 ml serum-free DMEM with ADM for 2 h before adding 10 ng/mL IL1β. Cells in the control group were cultured in serum-free medium. MTT assay was performed to detect cell viability at 24 h after incubation. For the other experiments, the cells were cultured in 6-well plates with 2 ml serum-free medium or 24-well plates with 1 ml serum-free medium. The cells were divided into four groups: control (cells were cultured in serum-free medium alone), IL-1β (cells were cultured in serum-free medium containing 10 ng/mL IL-1β for 24 h), ADM alone (cells were cultured in serum-free medium containing 100 nM ADM without IL-1β for 24 h), and ADMþIL-1β (cells were cultured in serum-free medium containing 100 nM ADM for 2 h followed by 24 h with 10 ng/mL IL-1β). 2.5. MTT assay Cell viability was assessed using MTT assay, which is based on the reduction of a soluble pale yellow tetrazolium dye to waterinsoluble purple formazan crystals in living cells. Briefly, Leydig cells (1
104 cells/well) were cultured in a 96-well plate according to the cell culture and experimental design. The media was replaced with MTT-containing media (0.5 mg/mL) and was incubated at 37 °C for 4 h. An equal volume of solubilization solution (10% SDS) was added and the plate was incubated at 37 °C overnight to solubilize formazan crystals. The color developed was measured at 570 nm using a microplate reader (Bio-Rad, Hercules, CA, USA). Cell viability was expressed as the proportion of absorbance values to the control group. Serum-free medium was used as a blank. 2.6. Testosterone measurement by radioimmunoassay (RIA) Testosterone concentrations in media were detected through RIA, as previously described [22]. Testosterone radioimmunoassay kit was purchased from Diagnostic Systems Laboratories, Inc. (Webster, TX, USA). Standard curve interpolation was used to determine testosterone concentration. The sensitivity of the testosterone assay was 0.06 ng/mL. The cross-reactivity of the testosterone antiserum was 24% for dihydrotestosterone, 2.0% for androstenedione, and 0.001% for cortisol. The intra- and inter-assay coefficients of variation were 4.3% and 4.9%, respectively. Testosterone concentrations were expressed as ng/mL. 2.7. Measurement of intracellular reactive oxidative species (ROS) Levels of ROS were measured through the molecular probe of 2′,7′-dichlorodihydrofluorescein diacetate (H2DCF-DA) [23]. H2DCF-DA is a fluorescent dye and non-polar compound. After being incorporated into cells and decomposed by cellular esterases, H2DCF-DA is converted into H2DCF, which is a membraneimpermeable and non-fluorescent polar compound. The amount of intracellular ROS was proportional to the intensity of DCF fluorescence. ROS levels were normalized against the control concentration.

was thus evaluated using MDA measurement as previously described [24]. MDA concentrations were spectrophotometrically determined by the absorbance of TBARS at 532 nm. Results were expressed as pmol/mL and were normalized against the control concentration. 2.9. Estimation of reduced glutathione (GSH) Reduced GSH was determined by measuring the reduction rate of 5,5′-dithiobis-2-nitrobenzoate to 2-nitro-5-thiobenzoate [25]. Fluorescence was read with a BioRad luminescence spectrometer at an excitation wavelength of 350 nm and an emission wavelength of 420 nm. The cellular GSH content was calculated using a concurrently run GSH standard curve. Results were expressed as mg/mg protein and normalized against the control concentration. 2.10. Quantification of nitric oxide (NO) Nitrite levels in culture medium were assessed using Griess reaction, as previously described [26]. To measure nitrite levels in the medium, sample aliquots were mixed with an equal volume of Griess reagent and the absorbance was spectrophotometrically determined at the wavelength of 550 nm. Nitrite concentrations were determined relative to a standard curve derived from increasing concentrations of sodium nitrite. Results were expressed as nmol/mL and were normalized against the control concentration. 2.11. Assay of prostaglandin E2 (PGE2) concentrations We investigated PGE2 levels using a commercially available enzyme-linked immunosorbent assay (ELISA) kit (R&D Systems, Minneapolis, MN, USA) according to the manufacture's protocol. The lower limit of detection was 15 pg/mL and the intra- and interassay coefficients of variation were 7% and 10%, respectively. Results were expressed as ng/mL and were normalized against the control concentration. 2.12. Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) staining Cell apoptosis was assessed with TUNEL assay. Leydig cells were plated in a 24-well plate and cultured for 12 h in serum-free DMEM. After appropriate treatment according to the experimental design, cell samples were fixed with 4% paraformaldehyde and incubated with 3% H2O2 in methanol for 10 min to inactivate endogenous peroxidases. Then, the samples were incubated with 0.1% Triton X-100 on ice for 5 min. After three washes in PBS, 100 mL mixed TUNEL was added to each well for incubation at 37 °C for 1 h. The cells were then washed thrice with PBS and stained with DAPI at 37 °C for 10 min. After the final washing operation, cells were observed using microscope. Apoptosis signals were counted manually. Images were randomly selected from two sections of each specimen. The stained cells were counted under 200
magnification. Apoptotic Leydig cells were recognized with dual TUNEL and DAPI staining. Inverted fluorescence microscope was used to randomly select three images for each group in experiments. 2.13. RNA extraction and real-time polymerase chain reaction (PCR)

2.8. Malondialdehyde (MDA) measurement MDA is a byproduct of the oxidative degradation of cell membrane lipids and is generally considered a lipid peroxidation marker. MDA can be easily measured by thiobarbituric acid reactive substances (TBARS). In the current study, lipid peroxidation

Real-time PCR was used to detect the effect of ADM on the gene expression of inducible nitric oxide synthase (iNOS), cyclo-oxygenase-2 (COX-2), Bcl-2, Bax, caspase-3, PARP, and β-actin. Total RNA was extracted from Leydig cells using Trizol and chloroform reagents according to the manufacturers’ instructions. RNA

W. Hu et al. / Experimental Cell Research 339 (2015) 220–230

223

Table 1 Sequences of primers for the real-time PCR experiments. Gene

Accession no.

Sense

Sequence 5′-3′

iNOS

NM012611.3

COX-2

NM017232.3

Bcl-2

NM001001280.1

Bax

NM017059.2

Caspase-3

NM012922.2

PARP

NM013063.2

β-actin

NM031144.3

F R F R F R F R F R F R F R

ACCAGTACGTTTGGCAATGG TCAGCATGAAGAGCGATTTCT CTTACAATGCTGACTATGGCTAC AAACTGATGCGTGAAGTGCTG CCACCAAGAAAGCAGGAAACC GGCAGGATAGCAGCACAGG TGGCAGCTGACATGTTTTCTGAC CGTCCCAACCACCCTGGTCT CGATTATGCAGCAGCCTCAA AGGAGATGCCACCTCTCCTT TCTTTGATGTGGAAAGTATGAAGAA GGCATCTTCTGAAGGTCGAT CGTTGACATCCGTAAAGAC TGGAAGGTGGACAGTGAG

concentration was measured using a spectrophotometer at 260 nm and purity was assessed by determining the ratio of A260/ A280; all samples had ratios of 1.8:1.9. Complimentary DNA (cDNA) was synthesized from RNA using reverse transcriptase and a PrimeScript RT reagent kit (Fermentas, Lithuania). PCR amplification was performed for 40 cycles under standard conditions as follows: 25 mL reaction mixture consisting of 0.5 μL 10 mM dNTP, 2.5 μL 10
buffer (containing Mg2 þ ), 1 μL upstream primer (50 μg/mL), 1 μL downstream primer (50 μg/mL), 4 μL cDNA, and 1 U Taq enzyme. Each PCR amplification cycle consisted of the following steps: initial denaturation at 95 °C for 5 min followed by a set cycle of denaturation at 94 °C for 10 s and different annealing temperatures for each pair of primers (ranging between 53 °C and 62 °C) for 10 s, extension at 72 °C for 28 s, and a final extension at 72 °C for 5 min. The generation of specific PCR products was confirmed by melting-curve analysis; mRNA encoding β-actin served as an internal control. Gene expression data for the proteins of interest were standardized against β-actin. Primer sequences (TaKaRa, Japan) of the targeted genes are listed in Table 1. 2.14. Protein extraction and Western blot analysis Whole cell lysates and cytoplasmic and nuclear extracts were harvested from Leydig cell monolayers to determine the effect of ADM on protein levels Bcl-2, Bax, caspase-3, PARP, NF-κB p65, phospho-NF-κB p65, IκBα, and phospho-IκBα. The total protein concentration of whole cell and cytoplasmic and nuclear extracts was determined using the bicinchoninic acid assay system (Uptima; Interchim, Montlucon, France) using bovine serum albumin as the standard. After adjusting for equal amounts of total protein, protein mixtures were separated using sodium dodecyl sulfate– polyacrylamide gel electrophoresis under reducing conditions and were then transferred to polyvinylidene difluoride membranes. After transfer, non-specific binding sites of the membranes were blocked for 1 h at room temperature in PBS at pH 7.4 containing 5% nonfat dry milk. The membranes were then incubated overnight at 4 °C with primary antibodies (Bcl-2, Bax, caspase-3, PARP, NF-κB p65, phospho-NF-κB p65, IκBα, and phospho-IκBα). The membranes were probed with an anti-β-actin antibody to control for protein loading. Next, the membranes were incubated for 2 h at room temperature with horseradish peroxidase-conjugated secondary antibodies, followed with visualization using enhanced chemiluminescence kit. Results were scanned using a gel imaging system (UVP Company, Upland, CA, USA) and densitometry measurements were performed with Image lab software (BioRad Laboratories, Hercules, CA, USA). Relative protein expression was normalized to β-actin and compared with control.

Size (bp) 70 242 129 195 118 64 201

2.15. Caspase-3 activity assay Caspase-3 activity was measured using a commercial caspase-3 colorimetric assay kit (R&D systems, Minneapolis, MN) according to the manufacturer's instructions. Briefly, freshly isolated Leydig cells were homogenized in lysis buffer and then centrifuged. The caspase-3 activity colorimetric assay is based on the hydrolysis of the peptide substrate acetyl-Asp-Glu-Val-Asp-p-nitroaniline by caspase-3, resulting in the release of p-nitroaniline moiety, of which the optical density was colorimetrically measured at 450 nm with a microplate reader. The fold increase in caspase-3 activity was normalized to the control group. 2.16. Statistical analysis All data were expressed as mean7SEM of the average of the three wells in each of five experiments. Data were analyzed using SPSS version 19.0 (SPSS Inc., Chicago, IL, USA). Significant differences among the mean values of multiple groups were evaluated using one-way ANOVA followed by Student–Newman–Keuls's method. Two-sided P valueo0.05 was considered statistically significant.

3. Results The effect of ADM on cell viability and IL-1β-induced damage of Leydig cells is shown Fig. 1. The absorbance did not significantly differ among the five treated groups (Fig. 1A). The effect of 100 nM ADM on cell viability of Leydig cells did not significantly differ among the five groups at different time courses. However, the group treated at 24 h showed a relatively stronger effect (Fig. 1A). No significant differences in absorbance were observed among the five treated groups (Fig. 1B). The effect of ADM on cell viability of Leydig cells did not significantly differ among the five groups treated with different concentrations of ADM, but the group with 100 nM ADM had relatively stronger effect (Fig. 1B). IL-1β significantly decreased cell viability (Fig. 1C). However, IL1β-induced cell damage was significantly reduced by the addition of ADM at concentrations of 50, 100, and 300 nM (P o0.01). No significant difference in protective effect was observed among the three groups with different ADM concentrations. However, the group with 100 nM ADM had relatively stronger effect (Fig. 1C). Thus, experiments were performed using a dose of 100 nM ADM and after an exposure to 24 h unless otherwise stated. Fig. 2 shows that compared with the control group, IL-1β significantly decreased testosterone concentration and significantly increased the concentrations of ROS, MDA, and GSH (P o0.01). However, compared with the IL-1β group, ADM pretreatment

224

W. Hu et al. / Experimental Cell Research 339 (2015) 220–230

Fig. 1. Effect of ADM on cell viability and IL-1β-induced damage of Leydig cells. Cell viability in different treatment groups was assessed using MTT assay. (A) Time course of effect of ADM (100 nM) on viability of Leydig cells. (B) Dose-response effect of ADM on viability of Leydig cells after 24 h treatment. (C) ADM (0, 10, 50, 100, or 300 nM) was added 2 h prior to 24-h treatment with IL-1β (10 ng/mL). All data are shown as mean7 SEM (n ¼5) obtained from five separate experiments performed in triplicate.

Fig. 2. Effect of ADM on concentrations of testosterone, reactive oxygen species (ROS), malondialdehyde (MDA), and reduced glutathione (GSH) in primary culture of Leydig cells. All data are mean7 SEM (n ¼5) obtained from five separate experiments performed in triplicate.

W. Hu et al. / Experimental Cell Research 339 (2015) 220–230

225

Fig. 3. Effect of ADM on IL-1β-induced gene expression of iNOS and COX-2 and production of NO and PGE2. The normalized levels of gene expression are expressed as ratios of the copy number of the mRNA and of β-actin cDNA. Culture media were analyzed for nitrite concentration on behalf of NO production. All data are mean 7 SEM (n ¼5) obtained from five separate experiments performed in triplicate.

significantly increased testosterone concentration and significantly decreased the concentrations of ROS, MDA, and GSH (P o0.01). Fig. 3 shows the effect of ADM on the IL-1β-induced gene expression of iNOS and COX-2 and the production of NO and PGE2. Stimulation with IL-1β led to significant increases in gene expression of iNOS and COX-2, as well as in the production of NO and PGE2 in the supernatant (P o0.01). However, compared with the IL-1β group, the gene expression of iNOS and COX-2 and the concentrations of NO and PGE2 were significantly reduced by ADM pretreatment (P o0.01). Anti-apoptotic effect of ADM on IL-1β-induced apoptosis are depicted in Fig. 4. Results showed that IL-1β significantly increased the percentage of TUNEL-positive cells compared with the control group (Po 0.01). However, compared with the IL-1β group, ADM pretreatment significantly reduced the percentage of apoptotic cells (P o0.01). Fig. 5 shows the effect of ADM on IL-1β-induced Bcl-2, Bax, caspase-3, and PARP gene expression. Stimulation with IL-1β led to a significant decrease in gene expression of Bcl-2 and significant increase in gene expression of Bax, caspase-3, and PARP (P o0.01). After pretreatment with ADM, the gene expression of Bcl-2 significantly increased. By contrast, the gene expression of Bax, caspase-3, and PARP significantly decreased (Po 0.01).

Fig. 6 shows that IL-1β caused a significant decrease in the protein level of Bcl-2 and significant increase in the protein levels of Bax, procaspase-3, cleaved caspase-3, PARP, and cleaved PARP (P o0.01). Moreover, the ratio of Bcl-2/Bax significantly decreased, whereas caspase-3 activity significantly increased (P o0.01). When ADM was added prior to IL-1β, the protein level of Bcl-2 significantly increased and protein levels of Bax, procaspase-3, cleaved caspase-3, PARP, and cleaved PARP significantly decreased (P o0.01). In addition, the ratio of Bcl-2/Bax significantly increased, whereas, the caspase-3 activity significantly decreased (P o0.01). Fig. 7 shows the effect of ADM on IL-1β-induced phosphorylation of NF-κB p65 in nucleus, as well as on degradation and phosphorylation of IκBα in cytoplasm. Elevated levels of IL-1βinduced phospho-NF-κB p65 (p-p65) were observed in nuclear protein extracts from Leydig cells as compared with control (P o0.01). ADM inhibited NF-κB p65 phosphorylation in nucleus of Leydig cells (P o0.01) without altering p65 levels. Decreased levels of IL-1β-induced IκBα and elevated levels of IL-1β-induced serine-phosphorylated form of IκBα (p-IκBα) were observed in cytoplasmic protein extracts from Leydig cells compared with control (P o0.01). ADM increased the protein level of IκBα and decreased the protein level of p-IκBα in the cytoplasm of Leydig cells (P o0.01).

226

W. Hu et al. / Experimental Cell Research 339 (2015) 220–230

Fig. 4. Anti-apoptotic effect of ADM (100 nM) on apoptosis induced by IL-1β (10 ng/mL) in Leydig cells. Leydig cells were treated with ADM (100 nM) for 2 h prior to 24-h treatment with IL-1β (10 ng/mL). TUNEL labeling and DAPI staining were employed to assess apoptosis of Leydig cells. All data are mean 7SEM (n ¼5) obtained from five separate experiments performed in triplicate.

4. Discussion The endogenous antioxidant potential to protect against ROSinduced podocyte injury might be possessed by ADM [27]. ADM induces the downregulation of inflammatory cytokines in cultured cells and downregulates inflammatory processes in a variety of different colitis models [28]. ADM acted as a survival factor that inhibits hypoxic-induced apoptosis by interacting with its receptors in osteosarcoma cells [29]. In the present study, the cytotoxic effect of ADM on Leydig cells showed that ADM with the concentration of 100 nM has the relatively highest cell viability. Furthermore, the protective effect of ADM was relatively the strongest on IL-1β-induced damage of

Leydig cells when ADM was at the concentration of 100 nM. These findings are in accordance with those of previous reports on other cell types, such as human endothelial progenitor cells and mouse MC3T3-E1 cells [30,31]. Overexpression of ADM2, which belongs to ADM peptide family in the kidney, apparently reduces oxidative stress and suppresses inflammation and apoptosis [32]. In our study, ADM can improve the steroidogenesis dysfunction and attenuate the excessive oxidative stress induced by IL-1β. Therefore, ADM exerts a protective role in steroidogenesis of Leydig cells by inhibiting IL1β-induced excessive oxidative stress. Oxidative stress results in inflammation; uncontrolled inflammation may lead to apoptosis, which plays a crucial role in the

W. Hu et al. / Experimental Cell Research 339 (2015) 220–230

227

Fig. 5. Effect of ADM on IL-1β-induced gene expression of Bcl-2, Bax, caspase-3, and PARP. The normalized levels of gene expression are expressed as ratios of the copy number of the mRNA and that of β-actin cDNA. All data are mean 7 SEM (n¼ 5) obtained from five separate experiments performed in triplicate.

pathogenesis of inflammatory diseases [33]. Inflammatory agents such as NO and PGE2, which are respectively produced by iNOS and COX-2 induced in the presence of IL-1β, may be involved in some parts of the regulation of Leydig cell dysfunction [34,35]. ADM plays an important role in regulating systemic inflammation and may be an important intrinsic anti-inflammatory factor in protection against liver damage [36]. ADM significantly reduces the development of acute lung injury by downregulating a broad spectrum of inflammatory factors [37]. In our paper, ADM can improve IL-1β-induced uncontrolled inflammation by inhibiting the production of inflammatory cytokines. We can infer that ADM may act as an anti-inflammatory agent by inhibiting IL-1β-induced oxidative stress from causing inflammation. This behavior indicates the therapeutic potential of ADM on IL-1β-induced inflammatory conditions of Leydig cells. The anti-apoptotic effect of ADM appears to be partly responsible for its beneficial effect on vascular endothelial cell apoptosis that occurs in late sepsis [38]. ADM significantly reduced the percentage of IL-1β-induced Leydig cell apoptosis. Thus, ADM may improve IL-1β-related apoptosis of Leydig cells by inhibiting the IL-1β-induced uncontrolled inflammation that resulted from excessive oxidative stress. The Bcl-2 family of proteins governs the mitochondria-dependent pathway for apoptosis and is thought to regulate apoptosis by forming hetero- and homodimers in the mitochondrial membrane; the prevailing outcome depends on the ratio of Bcl-2 to Bax

of apoptosis [39]. In this paper, ADM increased the levels of gene expression and protein of Bcl-2 and decreased the levels of gene expression and protein of Bax, thereby increasing Bcl-2/Bax ratio. ADM may decrease mitochondrial permeability to inhibit the mitochondrial pathway in Leydig cells and block IL-1β-induced apoptosis. An important pathway during the apoptotic process involves caspase-3 activation, which is the most important biomarker and executor of cell apoptosis. This pathway induces hydrolysis of nucleic acids and cytoskeletal proteins. Caspase activation is the final process in the death signaling pathway, in which pro-caspase 3 is activated into cleaved caspase 3[40]. PARP is a downstream target of caspase-3 and a nuclear enzyme normally involved in DNA repair: however, extensive activation of PARP promotes cell death [41]. PARP is cleaved in fragments of 89 and 24 kd during apoptosis; this has become a useful hallmark of this type of cell death [42]. We found that ADM downregulated the expression levels of these genes in IL-1β-stimulated Leydig cells. Furthermore, ADM inhibited the upregulated protein levels of procaspase-3, cleaved caspase-3, PARP, and cleaved PARP; likewise, ADM reduced the increased caspase 3 activity. PARP activity increases with oxidative stress, which can lead to cellular dysfunction and necrosis [43]. Basing on these findings, ADM could inhibit apoptosis generated from uncontrolled inflammation that is due to IL-1β-induced oxidative stress by maintaining mitochondrial function and inhibiting caspase-3 activation. We also investigated the molecular mechanisms underlying

228

W. Hu et al. / Experimental Cell Research 339 (2015) 220–230

Fig. 6. Effect of ADM on IL-1β-induced protein levels of Bcl-2, Bax, procaspase-3, cleaved caspase-3, PARP, and cleaved PARP and caspase-3 activity. β-actin was used as internal reference. All data are mean7 SEM (n¼ 5) obtained from five separate experiments performed in triplicate.

ADM's inhibition of inflammatory and apoptotic mediators in response to IL-1β in Leydig cells. We focused on NF-κB because of its importance in inflammatory process [44]. IL-1β regulates NF-κB nuclear translocation and binding to DNA. IL-1β can also activate NFκB, which is generally retained in the cytoplasm with IκB-α inactivity, by triggering IκB-α degradation. NF-κB activation results in the upregulation of a group of responsive genes that contribute to

inflammation, including iNOS and COX-2 [45]. NF-κB plays an important role in the apoptosis induced by testicular ischemia–reperfusion injury [46]. In the current study, ADM blocked the phosphorylation of NF-κB, as well as the phosphorylation and degradation of IκB-α. Our findings suggest that ADM may exert potential anti-inflammatory and anti-apoptotic properties in IL-1β-induced rat Leydig cells through inhibition of NF-κB signal pathway, which

W. Hu et al. / Experimental Cell Research 339 (2015) 220–230

229

Fig. 7. Effect of ADM on IL-1β-induced phosphorylation of NF-κB p65 in nucleus and on degradation and phosphorylation of IκBα in cytoplasm. β-actin was used as internal reference. All data are mean 7 SEM (n¼ 5) obtained from five separate experiments performed in triplicate.

might represent a target for the effect of ADM on inflammation and apoptosis of IL-1β-induced rat Leydig cells. Our study has several limitations. First, all experiments were performed on cell lines. Further studies are necessary to determine whether equivalent effect would be observed consistently in vivo and during clinical trials. Second, all data were acquired with ADM pretreatment experiments, which seems essential in permitting the protective role of the compound in our study. Third, given the impact of endogenous ADM on Leydig cells, we cannot exclude a possible overestimation of the protective role of ADM. Future studies are needed to elucidate the precise mechanism of ADM regulation in inflammatory and apoptotic processes in Leydig cells. In conclusion, our study shows that IL-1β-induced inflammation and apoptosis of rat Leydig cells were inhibited by ADM, which affected NF-κB mitochondrial signaling pathway. Collectively, these results indicate that ADM may protect the damaged testicular Leydig cell under pathological conditions, including uncontrolled inflammation resulting from oxidative stress from degenerating to apoptosis.

Conflict of interest None.

Funding support This research was supported by the National Natural Science Foundation of China (81071494), the Natural Science Foundation of Hubei Province (2011CHB021), and Young Scientists Foundation of Health Department of Hubei Province (QJX2012-12) in China.

Authors' contribution Hu: project development, data collection, data analysis, manuscript writing; Zhou: project development, data collection; Rao: project development, data analysis; Zhang: project development; Wang: data collection; Zhang: data collection.

230

W. Hu et al. / Experimental Cell Research 339 (2015) 220–230

Acknowledgment This work was approved by the Ethics Committee of Renmin Hospital Wuhan University. The authors wish to thank the Department of Urology in Renmin Hospital of Wuhan University.

References [1] H. Liu, et al., Basic fibroblast growth factor promotes stem Leydig cell development and inhibits LH-stimulated androgen production by regulating microRNA expression, J. Steroid Biochem. Mol. Biol. 144 (2014) 483–491 (Pt B). [2] V.A. Guazzone, et al., Cytokines and chemokines in testicular inflammation: a brief review, Microsc. Res. Tech. 72 (8) (2009) 620–628. [3] S. Zhang, et al., Fluoride-elicited developmental testicular toxicity in rats: roles of endoplasmic reticulum stress and inflammatory response, Toxicol. Appl. Pharmacol. 271 (2) (2013) 206–215. [4] R. Medzhitov, Origin and physiological roles of inflammation, Nature 454 (7203) (2008) 428–435. [5] M.P. Hedger, Immunophysiology and pathology of inflammation in the testis and epididymis, J. Androl. 32 (6) (2011) 625–640. [6] N. Rozwadowska, D. Fiszer, M. Kurpisz, Function of the interleukin-1 gene system in immunomodulation, apoptosis and proliferation in the male gonad, Postepy Hig. Med. Dosw. (Online) 59 (2005) 56–67. [7] C.Y. Hong, et al., Molecular mechanism of suppression of testicular steroidogenesis by proinflammatory cytokine tumor necrosis factor alpha, Mol. Cell. Biol. 24 (7) (2004) 2593–2604. [8] K.K. Shukla, A.A. Mahdi, S. Rajender, Apoptosis, spermatogenesis and male infertility, Front. Biosci. (Elite Ed.), 4, (2012) 746–754. [9] K. Kitamura, et al., Adrenomedullin: a novel hypotensive peptide isolated from human pheochromocytoma. 1993, Biochem. Biophys. Res. Commun. 425 (3) (2012) 548–555. [10] M. Shichiri, Y. Hirata, Regulation of cell growth and apoptosis by adrenomedullin, Hypertens. Res. 26 (Suppl.) (2003) S9–S14. [11] B.M. Cheung, F. Tang, Adrenomedullin: exciting new horizons, Recent Pat. Endocr. Metab. Immune Drug. Discov. 6 (1) (2012) 4–17. [12] R. Wu, M. Zhou, P. Wang, Adrenomedullin and adrenomedullin binding protein-1 downregulate TNF-alpha in macrophage cell line and rat Kupffer cells, Regul. Pept. 112 (1–3) (2003) 19–26. [13] B.M. Cheung, et al., Increased adrenomedullin expression in lungs in endotoxaemia, J. Endocrinol. 181 (2) (2004) 339–345. [14] L. Li, et al., Intermedin attenuates LPS-induced inflammation in the rat testis, PLoS One 8 (6) (2013) e65278. [15] E. Niederberger, G. Geisslinger, Proteomics and NF-kappaB: an update, Expert Rev. Proteom. 10 (2) (2013) 189–204. [16] S. Pal, et al., Chronic inflammation and cancer: potential chemoprevention through nuclear factor kappa B and p53 mutual antagonism, J. Inflamm. 11 (2014) 23. [17] S. Shishodia, B.B. Aggarwal, Nuclear factor-kappaB activation: a question of life or death, J. Biochem. Mol. Biol. 35 (1) (2002) 28–40. [18] Q. Wang, H.B. Gao, Involvement of nuclear factor-kappa B on corticosterone – induced rat Leydig cell apoptosis, Asian J. Androl. 8 (6) (2006) 693–702. [19] Y. Wang, et al., Zearalenone induces apoptosis and cytoprotective autophagy in primary Leydig cells, Toxicol. Lett. 226 (2) (2014) 182–191. [20] A. Catizone, et al., Hepatocyte growth factor (HGF) modulates Leydig cell extracellular matrix components, J. Androl. 31 (3) (2010) 306–313. [21] S.O. Abarikwu, et al., Atrazine induces transcriptional changes in marker genes associated with steroidogenesis in primary cultures of rat Leydig cells, Toxicol. Vitro 25 (8) (2011) 1588–1595. [22] D. Demirbas, et al., A yeast-based chemical screen identifies a PDE inhibitor that elevates steroidogenesis in mouse Leydig cells via PDE8 and PDE4 inhibition, PLoS One 8 (8) (2013) e71279.

[23] S.O. Abarikwu, et al., Kolaviron protects apoptotic cell death in PC12 cells exposed to atrazine, Free. Radic. Res. 45 (9) (2011) 1061–1073. [24] S.O. Abarikwu, A.B. Pant, E.O. Farombi, Quercetin decreases steroidogenic enzyme activity, NF-kappaB expression, and oxidative stress in cultured Leydig cells exposed to atrazine, Mol. Cell. Biochem. 373 (1–2) (2013) 19–28 (Zearalenone induces apoptosis and cytoprotective autophagy in primary Leydig cells). [25] H. Chen, et al., Effect of glutathione redox state on Leydig cell susceptibility to acute oxidative stress, Mol. Cell. Endocrinol. 323 (2) (2010) 147–154. [26] S.A. Andric, et al., Testosterone-induced modulation of nitric oxide-cGMP signaling pathway and androgenesis in the rat Leydig cells, Biol. Reprod. 83 (3) (2010) 434–442. [27] S. Oba, M. Hino, T. Fujita, Adrenomedullin protects against oxidative stressinduced podocyte injury as an endogenous antioxidant, Nephrol. Dial. Transplant. 23 (2) (2008) 510–517. [28] S. Ashizuka, et al., Adrenomedullin as a potential therapeutic agent for inflammatory bowel disease, Curr. Protein Pept. Sci. 14 (4) (2013) 246–255. [29] X.Y. Wu, et al., Hypoxia-induced apoptosis is blocked by adrenomedullin via upregulation of Bcl-2 in human osteosarcoma cells, Oncol. Rep. 34 (2) (2015) 787–794. [30] X.Q. Kong, et al., Effects of adrenomedullin on the cell numbers and apoptosis of endothelial progenitor cells, Clin. Investig. Med. 31 (3) (2008) E117–E122. [31] B. Uzan, et al., Adrenomedullin is anti-apoptotic in osteoblasts through CGRP1 receptors and MEK-ERK pathway, J. Cell. Physiol. 215 (1) (2008) 122–128. [32] X. Qiao, et al., Intermedin protects against renal ischemia-reperfusion injury by inhibition of oxidative stress, Am. J. Physiol. Ren. Physiol. 304 (1) (2013) F112–F119. [33] B.E. Oyinloye, A.F. Adenowo, A.P. Kappo, Reactive oxygen species, apoptosis, antimicrobial peptides and human inflammatory diseases, Pharmaceuticals 8 (2) (2015) 151–175. [34] N. Tatsumi, et al., Nitric oxide production by cultured rat Leydig cells, Endocrinology 138 (3) (1997) 994–998. [35] M.E. Matzkin, et al., Cyclooxygenase-2 in testes of infertile men: evidence for the induction of prostaglandin synthesis by interleukin-1beta, Fertil. Steril. 94 (5) (2010) 1933–1936. [36] R. Saito, et al., Function of Adrenomedullin in inflammatory response of liver against LPS-induced endotoxemia, APMIS 120 (9) (2012) 706–711. [37] E. Talero, et al., Anti-inflammatory effects of adrenomedullin on acute lung injury induced by Carrageenan in mice, Mediat. Inflamm. 2012 (2012) 717851. [38] M. Zhou, H.H. Simms, P. Wang, Adrenomedullin and adrenomedullin binding protein-1 attenuate vascular endothelial cell apoptosis in sepsis, Ann. Surg. 240 (2) (2004) 321–330. [39] L.A. Gillies, T. Kuwana, Apoptosis regulation at the mitochondrial outer membrane, J. Cell. Biochem. 115 (4) (2014) 632–640. [40] S. Shalini, et al., Old, new and emerging functions of caspases, Cell Death Differ. 22 (4) (2015) 526–539. [41] M.M. El-Domyati, et al., The expression and distribution of deoxyribonucleic acid repair and apoptosis markers in testicular germ cells of infertile varicocele patients resembles that of old fertile men, Fertil. Steril. 93 (3) (2010) 795–801. [42] M. Tekcan, et al., Potential role of poly(ADP-ribose) polymerase activation in the pathogenesis of experimental left varicocele, J. Androl. 33 (1) (2012) 122–132. [43] L. Virag, et al., Poly(ADP-ribose) signaling in cell death, Mol. Asp. Med. 34 (6) (2013) 1153–1167. [44] R.G. Baker, M.S. Hayden, S. Ghosh, NF-kappaB, inflammation, and metabolic disease, Cell Metab. 13 (1) (2011) 11–22. [45] Y. Du, et al., Toxicological effect of manganese on NF-kappaB/iNOS-COX-2 signaling pathway in chicken testes, Biol. Trace Elem. Res. 168 (1) (2015) 227–234. [46] L. Minutoli, et al., Mitogen-activated protein kinase 3/mitogen-activated protein kinase 1 activates apoptosis during testicular ischemia-reperfusion injury in a nuclear factor-kappaB-independent manner, Eur. J. Pharmacol. 604 (1–3) (2009) 27–35.