- Email: [email protected]
Adrenomedullin Mediates Adipose Tissue‐Derived Stem Cell‐induced Restoration of Erectile Function in Diabetic Rats
482
Adrenomedullin Mediates Adipose Tissue-Derived Stem Cell-induced Restoration of Erectile Function in Diabetic Rats
jsm_2469
482..493
Hiroaki Nishimatsu, MD, PhD,*‡ Etsu Suzuki, MD, PhD,†‡ Shintaro Kumano, MD,* Akira Nomiya, MD,* Miao Liu, MD,* Haruki Kume, MD, PhD,* and Yukio Homma, MD, PhD* *The Department of Urology, Faculty of Medicine, University of Tokyo, Bunkyo-ku, Tokyo, Japan; †Institute of Medical Science, St. Marianna University School of Medicine, Miyamae-ku, Kawasaki, Japan DOI: 10.1111/j.1743-6109.2011.02469.x
ABSTRACT
Introduction. Erectile dysfunction (ED) is a major health problem. It is known that diabetic patients are more refractory to common treatments for ED. Aim. To explore the better treatment for ED, we examined the effects of adipose-derived stem cells (ASC) on ED using a diabetic rat model. We also analyzed the cytokines produced by ASC and implicated in ASC-induced restoration of erectile function. Methods. Male Wistar rats were injected with streptozotocin (STZ) to induce diabetes. ASC or adenoviruses were injected into the penis 6 weeks after STZ administration. Erectile function, penile histology and protein expression were analyzed 4 weeks after the injection of ASC or adenoviruses. Main Outcome Measures. Intracavernous pressure and mean arterial pressure were measured to evaluate erectile function. The morphology of the penis was analyzed by Elastica van Gieson stain and immunohistochemistry. The expression of proteins specific for vascular endothelial cells (VEC) was assessed by Western blot analysis. Results. ASC restored erectile function especially when they were cultured in medium containing growth factors for VEC. This restoration was associated with improvement in the histology of the cavernous body, and increased expression of VEC markers such as VE-cadherin and endothelial nitric oxide synthase (eNOS). When the expression of adrenomedullin (AM), a vasoactive peptide originally isolated from human pheochromocytoma tissue, was knocked down, the effect of ASC on ED was significantly diminished. Knockdown of AM was associated with decreased expressions of VE-cadherin and eNOS. Furthermore, overexpression of AM induced by adenovirus infection significantly improved erectile function in these diabetic rats. Overexpression of AM was associated with increased expressions of VE-cadherin and eNOS. Conclusions. These results suggested that ASC have the potentials to restore erectile function and that AM produced by ASC plays a major role in the restoration of erectile function. Nishimatsu H, Suzuki E, Kumano S, Nomiya A, Liu M, Kume H, and Homma Y. Adrenomedullin mediates adipose tissue-derived stem cell-induced restoration of erectile function in diabetic rats. J Sex Med 2012;9:482–493. Key Words. Gene Therapy; Cell Therapy; Adrenomedullin
Introduction
E
rectile dysfunction (ED) is a major health problem that profoundly affects the patients’ quality of life. More than 10 million Japanese men are estimated to be suffering from ED. Several risk factors for ED have been proposed, such as diabetes mellitus, hypertension, hyperlipidemia, age, and smoking. Although the use of selective phosphodi-
‡
Both authors contributed equally to this work.
J Sex Med 2012;9:482–493
esterase type 5 inhibitors (PDE5) for the treatment of ED is effective in some patients, diabetic patients are more refractory to treatment with PDE5 [1,2], probably because the cavernous body is severely damaged in these patients. In order to explore effective treatments for diabetic ED, alternative strategies such as gene therapy and cell therapy will be required to regenerate the cavernous body. In fact, several genes such as endothelial nitric oxide synthase (eNOS) and a Ca-sensitive K channel subtype (hSlo) have been injected in the cavernous © 2011 International Society for Sexual Medicine
483
Adrenomedullin Secretion from ASC body and turned out to be effective for the treatment of ED in animal models [3,4]. Stem cells such as bone marrow-derived stem cells (BMSC), adipose tissue-derived stem cells (ASC), brainderived stem cells (BSC), and skeletal musclederived stem cells (SMSC) have also been used to treat ED, and they are reportedly useful for the treatment of ED in animal models [5–12]. Recently, ASC have been drawing much attention, because collection of mesenchymal stem cells from subcutaneous adipose tissue is a relatively safer and less painful procedure to patients than bone marrow aspiration. ASC reportedly have the potential to differentiate into a variety of cell lineages, including adipocytes, chondrocytes, osteocytes, skeletal muscle, vascular endothelial cells (VEC), and vascular smooth muscle cells (VSMC) [13]. It has been reported that ASC stimulate angiogenesis in the mouse hindlimb ischemia model [14–18], suggesting the possibility that ASC will be useful for the treatment of ED, because ASC potentially regenerate VEC and VSMC in the cavernous body. However, the mechanism by which ASC stimulate angiogenesis remains to be debated. ASC promoted angiogenesis either by engrafting in the endothelial layer and stimulating neovascular formation [14,15] or by producing angiogenesis-stimulating factors without integration into the endothelial layer [17,18]. We have recently reported that ASC stimulate reendothelialization and inhibit neointimal formation in a paracrine fashion in wire-injured rat femoral artery [19]. Furthermore, it is reported that the cell lysate of ASC, as well as ASC themselves, improved erectile function [11], suggesting that ASC produce cytokines that potentially regenerate the cavernous body and restore erectile function. Adrenomedullin (AM) was originally isolated from human pheochromocytoma tissue [20]. It is also produced by VEC, VSMC, and macrophages [21–23], suggesting that it plays the role of a local mediator. AM not only activates the cAMPdependent pathway and induces relaxation of VSMC [20], but also activates the cGMP-dependent pathway and induces endothelium-dependent vasorelaxation via the Akt/eNOS-dependent pathway [24]. We have previously reported that acute administration of AM into the cavernous body enhances erectile function in rats [25]. During the screening of cytokines produced by ASC, we found that ASC produced AM especially when ASC were cultured in medium containing growth factors for VEC. In this study, we examined whether AM would be implicated in ASC-induced restoration of erectile function.
Materials and Methods
Reagents The anti-VE-cadherin antibody used for Western blot analysis, the anti-b-actin antibody, and the anti-total-eNOS antibody that recognizes eNOS regardless of whether it is phosphorylated or not, were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). The anti-phosphoeNOS antibody that recognizes the catalytically active form of eNOS was obtained from New England BioLabs (Beverly, MA, USA). The antiVE-cadherin antibody used for immunohistochemichal analysis was obtained from LifeSpan BioSciences (Seattle, WA, USA). Cell Culture ASC were cultured from male Wistar rats, as we previously reported [19]. ASC were first cultured in a 1:1 mixture of Dulbecco’s modified Eagle medium (DMEM) and F12 medium containing 10% fetal bovine serum (FBS), and split several times to expand the cells. Passages 2 to 4 were used for the experiments. ASC were then cultured on fibronectin-coated dishes in endothelial growth medium-2MV (EGM; Lonza Walkersville, Inc., Walkersville, MD, USA). EGM consists of endothelial basal medium-2 (Lonza Walkersville, Inc.) containing 5% FBS plus growth factors such as epidermal growth factor (EGF), hydrocortisone, vascular endothelial growth factor (VEGF)-A, basic fibroblast growth factor (bFGF), and insulin-like growth factor (IGF)-1. ASC were also cultured on fibronectin-coated dishes in endothelial basal medium-2 containing 5% FBS (EBM) as the negative control. In some experiments, ASC were labeled with PKH26 red fluorescent dye (Sigma-Aldrich, St. Louis, MO, USA) according to the protocol provided by the manufacturer in order to trace the fate of ASC injected into the penis. Human umbilical vein endothelial cells (HUVEC) were purchased from Sanko-Junyaku (Tokyo, Japan) and cultured using HuMedia-EG (Kurabo, Osaka, Japan). NRK52E cells, a cell line derived from rat renal tubular cells, as well as HEK293 cells, were obtained from ATCC (Manassas, VA, USA) and cultured in DMEM containing 5% FBS. 293 FT cells (Invitrogen, Carlsbad, CA, USA) were cultured in DMEM containing 10% FBS, 2 mM L-Glutamine and 500 mg/mL Geneticin (Sigma-Aldrich). Animal Experiments All procedures involving experimental animals were approved by the institutional committee for J Sex Med 2012;9:482–493
484 animal research of Tokyo University. Streptozotocin (STZ; 50 mg/kg body weight; Sigma-Aldrich) was dissolved in citrate buffer (pH 4.5) and injected in the tail vein of male Wistar rats (6 weeks old; Charles River, Wilmington, MA, USA). Blood glucose level was measured 4 weeks later to confirm that these mice became diabetic. ASC (5 ¥ 105 cells) that were cultured in EBM or EGM for 1 week were resuspended in 200 mL of saline and injected into the cavernous body at the glans 6 weeks after STZ injection. The same amount of saline was injected into the cavernous body as the negative control. Adenovirus suspension was also injected into the penis 6 weeks after STZ injection. Four weeks after ASC or adenovirus injection, rats (16 weeks old) were subjected to intracavernous pressure (ICP) measurement. The penis was also harvested for histochemical analysis and Western blot analysis at this time point.
ICP Measurement ICP measurement was performed in the same way as we previously reported [25]. Rats were anesthetized with ketamine (100 mg/kg body weight) injected intraperitoneally. The left carotid artery was exposed and cannulated with a PE-50 polyethylene tube to continuously monitor mean arterial pressure (MAP). The penis was denuded of skin, and the pelvic and cavernous nerves were isolated. The right cavernous nerve was hooked with stainless steel bipolar electrodes (TN-98119A, Unique Medical Co., Tokyo, Japan) and connected to a nerve stimulator (Nihon Kohden Co., Tokyo, Japan). Unilateral electrical field stimulation of the cavernous nerve was performed for 10 seconds using a square wave stimulator. The magnitude of electrical voltage ranged from 2.5 to 5.0 V with 20 Hz, 2 ms of duration. The right cavernous body was cannulated with a 23-gauge needle connected to a pressure transducer to continuously monitor ICP. Area under the curve (AUC) of ICP traces as well as the ratio of peak ICP to MAP (ICP/MAP) was used to evaluate erectile function. Protein Extraction and Western Blot Analysis The penis was homogenized in a cell lysis buffer (50 mM Tris–HCl (pH 8.0), 150 mM NaCl, 1% NP-40) containing 2 mg/mL aprotinin, 2 mg/mL leupeptin, and 1 mM phenylmethylsulfonyl fluoride. Western blot analysis was performed as previously described [26]. Histochemistry The penis was fixed by perfusing it with 4% paraformaldehyde and then processed for paraffin J Sex Med 2012;9:482–493
Nishimatsu et al. embedding. Cross sections (5 mm) were cut, deparaffinized, rehydrated, and subjected to Elastica van Gieson stain to visualize collagen and elastin fibers in the trabeculae of the cavernous body. For immunohistochemistry, sections were incubated with a primary antibody reactive to VE-cadherin (1:400 dilution). Sections were then incubated with biotinylated secondary antibody and finally horseradish peroxidase-labeled streptavidin according to the instructions provided by the manufacturer (DAKO, Cambridgeshire, UK).
Construction of Lentivirus that Expresses AM siRNA Lentivirus that expresses AM small interfering RNA (siRNA) was constructed using BLOCK-iT Lentiviral Pol II miR RNAi Expression System (Invitrogen) according to the instructions provided by the manufacturer. Each of two double-stranded oligonucleotides that target the coding region of rat AM to silence its expression was first subcloned into the pcDNA6.2-GW/EmGFPmiR plasmid that also expresses green fluorescence protein (GFP) to facilitate the identification of transfected cells. The DNA sequences of the sense strand of those oligonucleotides were as follows: AM siRNA1: 5′- TGCTGTAGCGTTTGACTC GAATGTGGGTTTTGGCCACT GACTGACCCACATTCGTCAAACGCTA-3′ AM siRNA2: 5′- TGCTGTAGCCTTGAGGGC TGATCTTGGTTTTGGCCA CTGACTGACCAAGATCACCTCAAGGCTA3′ After confirming the DNA sequences, the two double-stranded oligonucleotides were ligated together in the pcDNA6.2-GW/EmGFPmiR plasmid vector so that this plasmid expresses two AM siRNAs simultaneously. The region that encodes GFP and two AM siRNAs in the vector was then subcloned into pLenti7.3/V5-DEST Gateway vector using the clonase reaction as recommended by the manufacturer. pcDNA6.2GW/EmGFPmiR-neg control plasmid that is supplied by the manufacturer and expresses siRNA which is predicted not to target any known vertebrate gene (NC siRNA), was also subcloned into the pLenti7.3/V5-DEST Gateway vector to produce a negative control lentivirus. These plasmids were then transfected into 293 FT cells together with ViraPower Packaging Mix (Invitrogen) using the calcium phosphate method to produce lentivirus. Culture medium was changed the following day, and the medium containing lentivirus was
Adrenomedullin Secretion from ASC
485
collected two days later. Lentivirus was concentrated from the culture medium using polyethyleneglycol method as previously reported [27]. The titer of lentivirus was determined using 293FT cells with GFP fluorescence as the marker. Twenty multiplicity of infection (MOI) of lentivirus was infected in rat ASC. Under this condition, approximately 80% of cells expressed GFP and supposedly siRNA. After infection with lentivirus, ASC were cultured in EGM for 1 week and injected into the penis.
Construction of Adenovirus that Expresses AM Replication-defective adenovirus which expresses rat AM was constructed according to the method described previously using an AdMax kit (Microbix Biosystems Inc., Toronto, ON, Canada) [28]. The coding region of rat AM was amplified by PCR and subcloned into the pDC516 vector. The primer sequences used for PCR were as follows: RatAMsense primer: 5′-ATGAAGCTGGTTTC CATCGC-3′ RatAMantisense primer: 5′-CTATAACCTAGAG ACTCTGGA-3′ After determining the DNA sequence, the expression plasmid pDC516 that expresses rat AM was co-transfected into HEK293 cells with pBHGfrtdelE13FLP to construct adenovirus expressing rat AM (AdAM). A recombinant adenovirus that expresses GFP (AdGFP) was obtained from Quantum Biotechnologies (Montreal, QC, Canada).
Fluorescent Immunoassay Rat AM in culture medium was measured with a Fluorescent Immunoassay kit (Phoenix Pharmaceuticals, Burlingame, CA, USA) according to the methods provided by the manufacturer. Fluorescence was measured (Excitation wave length: 320 nm, emission wave length: 460 nm) with a Fluoroskan Ascent FL fluorescent microplate reader (Thermo Fisher Scientific, Waltham, MA, USA). Statistical Analysis The values are expressed as the mean ⫾ SEM. Statistical analyses were performed using analysis of variance followed by the Student-NeumannKeul’s test. Differences with a P value of <0.05 were considered statistically significant. Results
ASC Administration Restores ICP We first examined the effects of ASC injection on ICP. Administration of ASC cultured in EBM
Figure 1 ASC administration restores erectile function. ASC cultured in EBM (EBM) or EGM (EGM) were injected into the cavernous body of 12-week-old male Wistar rats (6 weeks after STZ injection via the tail vein), and ICP and MAP were measured 4 weeks after ASC injection. Agematched male Wistar rats were used as the positive control (Wistar), and STZ rats that were injected with saline into the penis were used as the negative control (C). (A) Bar graphs comparing ICP/MAP among the groups (N = 8 each). (B) Bar graphs comparing AUC among the groups (N = 8 each).
significantly increased ICP/MAP and AUC compared to the negative control STZ-injected diabetic rats (Figure 1). In the diabetic rats that were administered ASC cultured in EGM, ICP/ MAP and AUC increased more significantly to a similar level with those observed in age-matched Wistar rats. These results suggested that ASC administration restores erectile function especially when they are cultured in medium containing several growth factors for VEC.
ASC Administration Restores the Structure of the Cavernous Body We therefore examined the effects of ASC administration on the morphology of the cavernous body (Figure 2A). The trabeculae of the cavernous J Sex Med 2012;9:482–493
486
Nishimatsu et al.
Figure 2 Histological analysis of the cavernous body after ASC injection. (A) Elastica van Gieson staining of the cavernous body isolated from age-matched Wistar rats (PC), and STZ rats injected with saline (NC), EBM-cultured ASC (EBM) or EGM-cultured ASC (EGM) into the penis. The histology of the root portion of the penis (longitudinal section) is shown. Bars are 300 mm. (B) Immunohistochemical analysis of the cavernous body isolated from STZ rats injected with saline (NC), EBM-cultured ASC (EBM) or EGM-cultured ASC (EGM) into the penis. VE-cadherin was stained to visualize the endothelial layer in the cavernous body. The longitudinal section of the cavernous body at the root of the penis is shown. Bars are 100 mm. (C) Traces of ASC injected into the cavernous body. ASC cultured in EGM for 1 week were labeled with PKH26 and injected into the cavernous body of STZ-treated rats. The penis was isolated 1 and 4 weeks after ASC injection and fluorescence of PKH26 was analyzed under a fluorescent microscope. The penis injected with saline was used as the negative control (NC). The same fields were photographed with a light microscope and shown in the lower columns. Arrowheads indicate PKH26 positive cells. Bars are 40 mm.
body at the root of the penis largely consisted of collagen fibers, and elastin fibers were barely detected. The trabeculae of the cavernous body in STZ-injected diabetic rats appeared to be remarkJ Sex Med 2012;9:482–493
ably small and sparsely distributed especially at the root of the penis as compared with the positive control age-matched Wistar rats that were not injected with STZ. When ASC cultured either in
Adrenomedullin Secretion from ASC EBM or in EGM were injected, the trabeculae of the cavernous body became larger and were distributed more densely in the cavernous body. We, next, examined the expression of VE-cadherin, a marker of VEC, by immunohistochemistry (Figure 2B). The trabeculae of the cavernous body of the negative control STZ-injected rats were also surrounded by VE-cadherin-positive VEC to a similar extent as those of ASC (cultured either in EBM or in EGM)-injected rats. However, because the trabeculae were smaller and distributed more sparsely in the negative control STZ-injected rats than in ASC-injected rats, the absolute area of VE-cadherin-positive endothelial layer surrounding the trabeculae was estimated to be decreased in the negative control rats compared with the STZ rats injected with ASC. Therefore, we performed Western blot analysis to quantify the amount of VE-cadherin expression in the penis (Figure 3). When ASC cultured either in EBM or in EGM were injected, VE-cadherin expression in the penis increased significantly compared to the negative control STZ rats, as expected from the results of the immunohistochemical analysis. These results suggested that ASC injection stimulated the regeneration of the vascular endothelial layer in the cavernous body, resulting in the formation of larger and more densely distributed trabeculae.
The Fate of ASC in the Penis It has been reported that ASC potentially differentiate into a variety of cells such as VEC and VSMC [13]. On the other hand, many reports have suggested that the potential of ASC to differentiate into many cell types is not so high, and ASC assist the regeneration of tissues via the secretion of many cytokines that stimulate angiogenesis and inhibit apoptosis [17,18]. We therefore examined how long injected ASC could remain in the cavernous body (Figure 2C). We labeled ASC cultured in EGM with PKH26 and injected the cells into the cavernous body. A small number of ASC could be detected in the cavernous body 1 week after the injection. However, ASC were barely detected in the cavernous body 4 weeks after the injection, the time point when ICP and VE-cadherin expression were restored. These results suggested that ASC secreted several cytokines that improved erectile function rather than ASC being engrafted and differentiating into the cavernous body. Therefore, we searched for cytokines that were implicated in ASC-induced restoration of erectile function.
487
Figure 3 Western blot analysis of VE-cadherin expression in the penis. (A) ASC cultured in EBM (EBM) or EGM (EGM) were injected into the cavernous body of STZ-treated rats, and the penis was isolated for protein extraction 4 weeks after ASC injection. Saline was also injected into the cavernous body as the negative control (NC). Proteins extracted from HUVEC were used as the positive control. The blotted membranes were incubated with anti-VEcadherin antibody, and then anti-b-actin antibody as the internal control. (B) Histograms showing relative intensity of the bands (N = 5 each).
ASC Produce AM As we previously reported, because EGM contains several growth factors for VEC, expression of EGF, VEGF-A, bFGF, and IGF-1 was rather suppressed in ASC cultured in EGM compared with those cultured in EBM [19]. During the screening of cytokines that ASC produce, we found that ASC produce AM especially when they were cultured in EGM. ASC secreted AM in the culture medium in a time-dependent fashion (Figure 4A). ASC cultured in EGM secreted a more significant amount of AM (approximately 20-fold increase) than those cultured in EBM. When ASC were infected with lentivirus that expresses AM siRNA and cultured in EGM for 1 week, AM secretion by ASC was significantly suppressed (Figure 4B). We also examined whether the AdAM we constructed J Sex Med 2012;9:482–493
488
Nishimatsu et al. Figure 4 AM production by ASC. (A) AM accumulates in the culture medium of ASC in a time-dependent manner. ASC were plated in 24-well plates and cultured in EBM (open circles) or EGM (closed circles) for 1 week. After washing the wells with phosphate-buffered saline (PBS), medium was replaced with serum-free DMEM and incubated for the indicated periods. AM accumulated in the medium was measured with a fluorescent immunoassay kit. *: P < 0.05 vs. 0 hour, **: P < 0.01 vs. 0 hour and #: P < 0.01 vs. EBM culture at each time point (N = 6 each). (B) Effect of AM siRNA infection on AM production. ASC were cultured in 60 mm dishes and infected with LV_NC siRNA (NCsiRNA) or LV_AM siRNA (AMsiRNA). Some dishes were not infected with lentivirus as the positive control (C). ASC were then cultured in EGM for 1 week. After washing ASC with PBS, the medium was replaced with serum-free DMEM and incubated for 4 hours. Medium was collected and AM was measured with a fluorescent immunoassay kit. *: P < 0.05 vs. NCsiRNA (N = 3 each). (C) Effect of AdAM infection on AM production. NRK-52E cells were plated in 24-well plates and infected with AdAM or AdGFP. Culture medium from AdAM-infected cells (closed squares) and AdGFP-infected cells (open squares) was collected to measure the AM content with a fluorescent immunoassay kit. **: P < 0.001 vs. AdGFP infection (N = 6 each). 䉳
expressed AM. Because ASC produce endogenous AM, we used NRK-52E cells that do not produce AM. We infected NRK-52E cells with AdAM (20 MOI) and measured immunoreactive AM in the culture medium. NRK-52E cells infected with AdAM secreted a significant amount of AM in the culture medium (Figure 4C).
Effects of AM Knockdown and Forced Expression of AM We used lentivirus expressing rat AM siRNA and AdAM, and examined whether AM produced by J Sex Med 2012;9:482–493
ASC played pivotal roles in ASC-induced restoration of erectile function. Because ASC cultured in EGM restored ICP/MAP and AUC more significantly and produced a more significant amount of AM than those cultured in EBM, we used EGMcultured ASC to examine the effects of AM knockdown in the following experiments. ASC were infected with lentiviruses expressing AM siRNA (LV_AM siRNA) or its negative control NC siRNA (LV_NC siRNA), cultured in EGM for 1 week, and injected in the cavernous body. When ASC were infected with LV_NC siRNA, they significantly restored erectile function, as assessed by ICP/MAP and AUC (Figure 5). In contrast, when ASC were infected with LV_AM siRNA, ASC-induced restoration of ICP/MAP and AUC was significantly diminished. When AdAM (3.3 ¥ 108 pfu) was injected in the cavernous body, ICP/MAP and AUC were significantly restored compared with AdGFP injection. These results suggested that AM produced by ASC was implicated in ASC-induced restoration of erectile function. We also examined the histology of the cavernous body (Figure 6). When ASC were infected with LV_NC siRNA, cultured in EGM and injected in the cavernous body, the trabeculae of the cavernous body became larger and were distributed more densely in the cavernous body than
Adrenomedullin Secretion from ASC
489 control STZ rats, and reached a similar level observed when ASC cultured in EGM were injected. However, VE-cadherin expression was significantly suppressed to the basal level when ASC were infected with LV_AM siRNA, cultured in EGM, and injected in the cavernous body. When AdAM was injected in the cavernous body, VE-cadherin expression in the penis increased significantly compared with the control STZ rats injected with AdGFP. We finally examined the expressions of totaleNOS and phospho-eNOS in the penis. Administration of EGM-cultured ASC significantly increased total-eNOS expression in the penis. When EGM-cultured ASC were preinfected with LV_NC siRNA, ASC administration also significantly increased total-eNOS expression, whereas EGM-cultured ASC did not significantly increase total-eNOS expression when they were preinfected with LV_AM siRNA. AdAM administration significantly increased total-eNOS expression, whereas AdGFP administration did not. The expression of phospho-eNOS changed to a similar direction with total-eNOS. Administration of EGM-cultured ASC significantly increased phospho-eNOS expression in the penis.
Figure 5 Effect of knockdown and overexpression of AM on erectile function. ASC were infected with LV_NC siRNA or LV_AM siRNA. ASC were cultured in EGM for 1 week, and those LV_NC siRNA-infected ASC (EGM_NCsiRNA) and LV_AM siRNA-infected ASC (EGM_AMsiRNA) were injected in the cavernous body. ICP was measured 4 weeks after the ASC injection. AdAM or AdGFP was also injected into the cavernous body, and ICP was measured 4 weeks after the infection. Nontreated STZ-injected diabetic rats were used as the negative control (NC). (A) Bar graphs comparing ICP/MAP among the groups (N = 5 each). (B) Bar graphs comparing AUC among the groups (N = 5 each).
those of the penis injected with ASC that had been infected with LV_AM siRNA. Furthermore, when AdAM was injected in the cavernous body, the trabeculae of the cavernous body became larger and were distributed more densely than those of penis injected with AdGFP. We next examined the expression of VEcadherin by Western blot analysis (Figure 7). When ASC were infected with LV_NC siRNA, cultured in EGM, and injected in the cavernous body, the expression of VE-cadherin in the penis increased significantly compared with the negative
Figure 6 Effect of knockdown and overexpression of AM on the morphology of the cavernous body. Experiments were performed in the same way as described in the legend for Figure 5. The cavernous body was stained by the Elastica van Gieson method. The histology of the root portion of the penis (longitudinal section) is shown. Bars are 200 mm.
J Sex Med 2012;9:482–493
490
Nishimatsu et al.
Figure 7 Effect of knockdown and overexpression of AM on the expression of VE-cadherin, total-eNOS and phospho-eNOS. Experiments were performed in the same way as described in the legend for Figure 5. The penis was isolated 4 weeks after lentivirus-infected ASC injection or adenoviral infection. Protein was extracted from the penis and subjected to Western blot analysis to detect VE-cadherin (VE-Cad), totaleNOS (T-eNOS) and phospho-eNOS (P-eNOS). (A) Representative photographs showing the expression of VE-cadherin, total-eNOS, phosphoeNOS and b-actin. (B) Histograms comparing relative intensity of the bands among the groups (N = 5 each). *: P < 0.05 vs. NC, #: P < 0.05 vs. EGM_NCsiRNA, †: P < 0.05 vs. AdGFP infection and ††: P < 0.01 vs. AdGFP infection.
Injection of LV_NC siRNA-infected ASC also significantly increased phospho-eNOS expression, whereas preinfection of ASC with LV_AM siRNA significantly suppressed the increase in phospho-eNOS expression. AdAM administration significantly increased phospho-eNOS expression, whereas AdGFP administration did not. Discussion
In this study, we showed that ASC, especially when cultured in EGM, restored erectile function in STZ-injected diabetic rats, as assessed by ICP J Sex Med 2012;9:482–493
measurement. ASC administration appeared to stimulate regeneration of VEC in the cavernous body, which was reflected by increases in VEcadherin and total eNOS expressions in the penis. Knockdown of AM production from ASC using lentiviral expression of AM siRNA significantly diminished ASC-induced restoration of erectile function. Overexpression of AM in the penis using adenoviral expression significantly restored erectile function. These results suggested that AM is implicated in ASC-induced recovery of erectile function, especially when ASC were cultured in EGM.
491
Adrenomedullin Secretion from ASC Although ASC reportedly have the potential to differentiate into a variety of tissues [13], whether ASC effectively differentiate into a variety of cell types in vivo where ASC are administered remains debated. It was originally reported that ASC were engrafted in vascular endothelial layer and stimulated angiogenesis in mouse hindlimb ischemia model [14–16], suggesting that ASC potentially differentiated in VEC in vivo. However, recent reports suggested that ASC stimulated angiogenesis in mouse hindlimb ischemia model without integration into the vascular endothelial layer [17,18], suggesting that ASC produced some cytokines that stimulated angiogenesis. Stem cells such as BMSC, ASC, BSC, and SMSC have been used in the field of erectile dysfunction treatment. Several reports have suggested that BMSC, BSC, and SMSC differentiated into VEC and VSMC in the cavernous body, and stimulated the regeneration of the cavernous body, resulting in the recovery of erectile function [5–8,12]. ASC have characteristics that are very similar to those of BMSC. However, several reports published so far suggested that although ASC did have the potential to restore erectile function, differentiation of ASC into the cavernous body in vivo occurred in, if any, minimal amounts [9–11]. In fact, it was reported that cell lysate of ASC had the same potential to recover erectile function as ASC per se [11], suggesting strongly that ASC restore erectile function via the production of cytokines that stimulate the regeneration of the cavernous body. Therefore, it is very important now to identify such cytokines that ASC produce to restore erectile function. AM was originally isolated from human pheochromocytoma [20]. However, it is widely distributed including VEC, VSMC, and macrophages [21–23], suggesting its roles as a local mediator rather than a circulating hormone. AM activates the Akt/eNOS-dependent pathway and induces endothelium-dependent vasorelaxation as well as endothelium-independent vasorelaxation that is caused by the direct effect of AM on vascular smooth muscle cells [20,24]. Because eNOS is implicated in ischemia-induced angiogenesis [29,30], AM was expected to stimulate angiogenesis. In fact, several reports clearly showed that AM stimulates angiogenesis [31–33]. Therefore, we propose that AM restores erectile function, at least in part, via stimulation of angiogenesis in the cavernous body and regeneration of the cavernous body. Interestingly, expression of phospho-eNOS as well as total-eNOS was significantly increased in
the penis after ASC injection. Knockdown of AM in ASC diminished the increase in phospho-eNOS expression, and AdAM infection significantly increased phospho-eNOS expression. Furthermore, the extent of the increase in phospho-eNOS expression was higher than that in total eNOS. These results suggested that AM not only stimulated angiogenesis, but also improved vascular endothelial function. Intravenous administration of AM or, if possible in the future, percutaneous administration of AM by topical application, will be a useful strategy to treat severe erectile dysfunction in which the effect of PDE5 is not expected. Although injected ASC were barely detected in the penis 4 weeks after injection, their effects on erectile function lasted for at least 4 weeks. It remains unclear why the effect of AM that was produced by ASC lasted until after ASC disappeared from the penis. It appeared that transient overexpression of AM could initiate the cascade of angiogenesis and regeneration of the cavernous body. It was shown that AM stimulated the production of VEGF and bFGF [34]. It was also reported that VEGF stimulated AM production [35]. Although we did not measure the expression of AM, VEGF or bFGF in the penis after ASC injection, we speculate that transient overexpression of AM from ASC stimulated not only angiogenesis but also production of VEGF and/or bFGF in the cavernous body, which further promoted angiogenesis and AM production from VEC located in the cavernous body in a paracrine fashion. Our results indicated that ASC cultured in EGM were apparently more effective to restore erectile function than those cultured in EBM. These results suggested that the culture condition of ASC critically affects their effects in cell therapy. Therefore, it will be possible to enhance the effect of ASC by modifying culture conditions or pretreatment of ASC with some chemical compounds. Future studies will be required to clarify this point. Conclusions
ASC restored erectile function, especially when ASC were cultured in a medium containing several growth factors for VEC. AM seems to play a major role in ASC-induced restoration of erectile function in the diabetic model. Administration of AM, together with PDE-5I, will be useful to improve the quality of life of diabetic patients. J Sex Med 2012;9:482–493
492 Corresponding Author: Etsu Suzuki, MD, PhD, Institute of Medical Science, St. Marianna University School of Medicine, 2-16-1 Sugao, Miyamae-ku, Kawasaki 216-8512, Japan. Tel: (044) 977-8111; Fax: (044) 9778361; E-mail: [email protected] Conflict of Interest: None declared. Statement of Authorship
Category 1 (a) Conception and Design Etsu Suzuki; Haruki Kume; Yukio Homma (b) Acquisition of Data Hiroaki Nishimatsu; Etsu Suzuki; Shintaro Kumano; Akira Nomiya; Miao Liu (c) Analysis and Interpretation of Data Hiroaki Nishimatsu; Etsu Suzuki; Akira Nomiya
Category 2 (a) Drafting the Article Etsu Suzuki (b) Revising It for Intellectual Content Etsu Suzuki; Hiroaki Nishimatsu
Category 3 (a) Final Approval of the Completed Article Hiroaki Nishimatsu; Etsu Suzuki; Shintaro Kumano; Akira Nomiya; Miao Liu; Haruki Kume; Yukio Homma References 1 Dey J, Shepherd MD. Evaluation and treatment of erectile dysfunction in men with diabetes mellitus. Mayo Clin Proc 2002;77:276–82. 2 Siroky MB, Azadzoi KM. Vasculogenic erectile dysfunction: Newer therapeutic strategies. J Urol 2003;170:S24–30. 3 Champion HC, Bivalacqua TJ, Hyman AL, Ignarro LJ, Hellstrom WJ, Kadowitz PJ. Gene transfer of endothelial nitric oxide synthase to the penis augments erectile responses in the aged rat. Proc Natl Acad Sci U S A 1999;96:11648–52. 4 Christ GJ, Day N, Santizo C, Sato Y, Zhao W, Sclafani T, Bakal R, Salman M, Davies K, Melman A. Intracorporal injection of hslo cdna restores erectile capacity in stz-diabetic f-344 rats in vivo. Am J Physiol Heart Circ Physiol 2004;287: H1544–53. 5 Bivalacqua TJ, Deng W, Kendirci M, Usta MF, Robinson C, Taylor BK, Murthy SN, Champion HC, Hellstrom WJ, Kadowitz PJ. Mesenchymal stem cells alone or ex vivo gene modified with endothelial nitric oxide synthase reverse ageassociated erectile dysfunction. Am J Physiol Heart Circ Physiol 2007;292:H1278–90. 6 Song YS, Lee HJ, Park IH, Kim WK, Ku JH, Kim SU. Potential differentiation of human mesenchymal stem cell transplanted in rat corpus cavernosum toward endothelial or smooth muscle cells. Int J Impot Res 2007;19:378–85. 7 Nolazco G, Kovanecz I, Vernet D, Gelfand RA, Tsao J, Ferrini MG, Magee T, Rajfer J, Gonzalez-Cadavid NF. Effect of muscle-derived stem cells on the restoration of corpora cavernosa smooth muscle and erectile function in the aged rat. BJU Int 2008;101:1156–64.
J Sex Med 2012;9:482–493
Nishimatsu et al. 8 Song Y, Mehta N, Sheh B, Saljooque F, U HS, Rajasekaran M. Transdifferentiation of rat fetal brain stem cells into penile smooth muscle cells. BJU Int 2009;104:257–62. 9 Garcia MM, Fandel TM, Lin G, Shindel AW, Banie L, Lin CS, Lue TF. Treatment of erectile dysfunction in the obese type 2 diabetic zdf rat with adipose tissue-derived stem cells. J Sex Med 2010;7:89–98. 10 Huang YC, Ning H, Shindel AW, Fandel TM, Lin G, Harraz AM, Lue TF, Lin CS. The effect of intracavernous injection of adipose tissue-derived stem cells on hyperlipidemia-associated erectile dysfunction in a rat model. J Sex Med 2010;7:1391–400. 11 Albersen M, Fandel TM, Lin G, Wang G, Banie L, Lin CS, Lue TF. Injections of adipose tissue-derived stem cells and stem cell lysate improve recovery of erectile function in a rat model of cavernous nerve injury. J Sex Med 2010;7:3331–40. 12 Qiu X, Lin H, Wang Y, Yu W, Chen Y, Wang R, Dai Y. Intracavernous transplantation of bone marrow-derived mesenchymal stem cells restores erectile function of streptozocininduced diabetic rats. J Sex Med 2011;8:427–36. 13 Gimble JM, Katz AJ, Bunnell BA. Adipose-derived stem cells for regenerative medicine. Circ Res 2007;100:1249–60. 14 Miranville A, Heeschen C, Sengenes C, Curat CA, Busse R, Bouloumie A. Improvement of postnatal neovascularization by human adipose tissue-derived stem cells. Circulation 2004; 110:349–55. 15 Planat-Benard V, Silvestre JS, Cousin B, Andre M, Nibbelink M, Tamarat R, Clergue M, Manneville C, Saillan-Barreau C, Duriez M, Tedgui A, Levy B, Penicaud L, Casteilla L. Plasticity of human adipose lineage cells toward endothelial cells: Physiological and therapeutic perspectives. Circulation 2004; 109:656–63. 16 Rehman J, Traktuev D, Li J, Merfeld-Clauss S, Temm-Grove CJ, Bovenkerk JE, Pell CL, Johnstone BH, Considine RV, March KL. Secretion of angiogenic and antiapoptotic factors by human adipose stromal cells. Circulation 2004;109:1292– 8. 17 Nakagami H, Maeda K, Morishita R, Iguchi S, Nishikawa T, Takami Y, Kikuchi Y, Saito Y, Tamai K, Ogihara T, Kaneda Y. Novel autologous cell therapy in ischemic limb disease through growth factor secretion by cultured adipose tissuederived stromal cells. Arterioscler Thromb Vasc Biol 2005;25: 2542–7. 18 Kondo K, Shintani S, Shibata R, Murakami H, Murakami R, Imaizumi M, Kitagawa Y, Murohara T. Implantation of adipose-derived regenerative cells enhances ischemia-induced angiogenesis. Arterioscler Thromb Vasc Biol 2009;29:61–6. 19 Takahashi M, Suzuki E, Oba S, Nishimatsu H, Kimura K, Nagano T, Nagai R, Hirata Y. Adipose tissue-derived stem cells inhibit neointimal formation in a paracrine fashion in rat femoral artery. Am J Physiol Heart Circ Physiol 2010;298: H415–H23. 20 Kitamura K, Kangawa K, Kawamoto M, Ichiki Y, Nakamura S, Matsuo H, Eto T. Adrenomedullin: A novel hypotensive peptide isolated from human pheochromocytoma. Biochem Biophys Res Commun 1993;192:553–60. 21 Sugo S, Minamino N, Kangawa K, Miyamoto K, Kitamura K, Sakata J, Eto T, Matsuo H. Endothelial cells actively synthesize and secrete adrenomedullin. Biochem Biophys Res Commun 1994;201:1160–6. 22 Sugo S, Minamino N, Shoji H, Kangawa K, Kitamura K, Eto T, Matsuo H. Production and secretion of adrenomedullin from vascular smooth muscle cells: Augmented production by tumor necrosis factor-alpha. Biochem Biophys Res Commun 1994;203:719–26. 23 Kubo A, Minamino N, Isumi Y, Katafuchi T, Kangawa K, Dohi K, Matsuo H. Production of adrenomedullin in macrophage cell line and peritoneal macrophage. J Biol Chem 1998;273:16730–8.
Adrenomedullin Secretion from ASC 24 Nishimatsu H, Suzuki E, Nagata D, Moriyama N, Satonaka H, Walsh K, Sata M, Kangawa K, Matsuo H, Goto A, Kitamura T, Hirata Y. Adrenomedullin induces endothelium-dependent vasorelaxation via the phosphatidylinositol 3-kinase/aktdependent pathway in rat aorta. Circ Res 2001;89:63–70. 25 Nishimatsu H, Hirata Y, Hayakawa H, Nagata D, Satonaka H, Suzuki E, Horie S, Takeuchi T, Ohta N, Homma Y, Minowada S, Nagai R, Kawabe K, Kitamura T. Effects of intracavernous administration of adrenomedullin on erectile function in rats. Peptides 2001;22:1913–8. 26 Suzuki E, Nagata D, Yoshizumi M, Kakoki M, Goto A, Omata M, Hirata Y. Reentry into the cell cycle of contact-inhibited vascular endothelial cells by a phosphatase inhibitor: Possible involvement of extracellular signal-regulated kinase and phosphatidylinositol 3-kinase. J Biol Chem 2000;275:3637– 44. 27 Kutner RH, Zhang XY, Reiser J. Production, concentration and titration of pseudotyped HIV-1-based lentiviral vectors. Nat Protoc 2009;4:495–505. 28 Suzuki E, Nishimatsu H, Satonaka H, Walsh K, Goto A, Omata M, Fujita T, Nagai R, Hirata Y. Angiotensin ii induces myocyte enhancer factor 2- and calcineurin/nuclear factor of activated t cell-dependent transcriptional activation in vascular myocytes. Circ Res 2002;90:1004–11. 29 Lee PC, Salyapongse AN, Bragdon GA, Shears L. L, 2nd, Watkins SC, Edington HD, Billiar TR. Impaired wound healing and angiogenesis in enos-deficient mice. Am J Physiol 1999;277:H1600–8.
493 30 Murohara T, Asahara T, Silver M, Bauters C, Masuda H, Kalka C, Kearney M, Chen D, Symes JF, Fishman MC, Huang PL, Isner JM. Nitric oxide synthase modulates angiogenesis in response to tissue ischemia. J Clin Invest 1998;101:2567–78. 31 Kim W, Moon SO, Sung MJ, Kim SH, Lee S, So JN, Park SK. Angiogenic role of adrenomedullin through activation of akt, mitogen-activated protein kinase, and focal adhesion kinase in endothelial cells. Faseb J 2003;17:1937–9. 32 Tokunaga N, Nagaya N, Shirai M, Tanaka E, Ishibashi-Ueda H, Harada-Shiba M, Kanda M, Ito T, Shimizu W, Tabata Y, Uematsu M, Nishigami K, Sano S, Kangawa K, Mori H. Adrenomedullin gene transfer induces therapeutic angiogenesis in a rabbit model of chronic hind limb ischemia: Benefits of a novel nonviral vector, gelatin. Circulation 2004;109:526–31. 33 Iimuro S, Shindo T, Moriyama N, Amaki T, Niu P, Takeda N, Iwata H, Zhang Y, Ebihara A, Nagai R. Angiogenic effects of adrenomedullin in ischemia and tumor growth. Circ Res 2004;95:415–23. 34 Maki T, Ihara M, Fujita Y, Nambu T, Harada H, Ito H, Nakao K, Tomimoto H, Takahashi R. Angiogenic roles of adrenomedullin through vascular endothelial growth factor induction. Neuroreport 2011;22:442–7. 35 Albertin G, Rucinski M, Carraro G, Forneris M, Andreis P, Malendowicz LK, Nussdorfer GG. Adrenomedullin and vascular endothelium growth factor genes are overexpressed in the regenerating rat adrenal cortex, and AM and VEGF reciprocally enhance their mRNA expression in cultured rat adrenocortical cells. Int J Mol Med 2005;16:431–5.
J Sex Med 2012;9:482–493
Adrenomedullin Mediates Adipose Tissue-Derived Stem Cell-induced Restoration of Erectile Function in Diabetic Rats
jsm_2469
482..493
Hiroaki Nishimatsu, MD, PhD,*‡ Etsu Suzuki, MD, PhD,†‡ Shintaro Kumano, MD,* Akira Nomiya, MD,* Miao Liu, MD,* Haruki Kume, MD, PhD,* and Yukio Homma, MD, PhD* *The Department of Urology, Faculty of Medicine, University of Tokyo, Bunkyo-ku, Tokyo, Japan; †Institute of Medical Science, St. Marianna University School of Medicine, Miyamae-ku, Kawasaki, Japan DOI: 10.1111/j.1743-6109.2011.02469.x
ABSTRACT
Introduction. Erectile dysfunction (ED) is a major health problem. It is known that diabetic patients are more refractory to common treatments for ED. Aim. To explore the better treatment for ED, we examined the effects of adipose-derived stem cells (ASC) on ED using a diabetic rat model. We also analyzed the cytokines produced by ASC and implicated in ASC-induced restoration of erectile function. Methods. Male Wistar rats were injected with streptozotocin (STZ) to induce diabetes. ASC or adenoviruses were injected into the penis 6 weeks after STZ administration. Erectile function, penile histology and protein expression were analyzed 4 weeks after the injection of ASC or adenoviruses. Main Outcome Measures. Intracavernous pressure and mean arterial pressure were measured to evaluate erectile function. The morphology of the penis was analyzed by Elastica van Gieson stain and immunohistochemistry. The expression of proteins specific for vascular endothelial cells (VEC) was assessed by Western blot analysis. Results. ASC restored erectile function especially when they were cultured in medium containing growth factors for VEC. This restoration was associated with improvement in the histology of the cavernous body, and increased expression of VEC markers such as VE-cadherin and endothelial nitric oxide synthase (eNOS). When the expression of adrenomedullin (AM), a vasoactive peptide originally isolated from human pheochromocytoma tissue, was knocked down, the effect of ASC on ED was significantly diminished. Knockdown of AM was associated with decreased expressions of VE-cadherin and eNOS. Furthermore, overexpression of AM induced by adenovirus infection significantly improved erectile function in these diabetic rats. Overexpression of AM was associated with increased expressions of VE-cadherin and eNOS. Conclusions. These results suggested that ASC have the potentials to restore erectile function and that AM produced by ASC plays a major role in the restoration of erectile function. Nishimatsu H, Suzuki E, Kumano S, Nomiya A, Liu M, Kume H, and Homma Y. Adrenomedullin mediates adipose tissue-derived stem cell-induced restoration of erectile function in diabetic rats. J Sex Med 2012;9:482–493. Key Words. Gene Therapy; Cell Therapy; Adrenomedullin
Introduction
E
rectile dysfunction (ED) is a major health problem that profoundly affects the patients’ quality of life. More than 10 million Japanese men are estimated to be suffering from ED. Several risk factors for ED have been proposed, such as diabetes mellitus, hypertension, hyperlipidemia, age, and smoking. Although the use of selective phosphodi-
‡
Both authors contributed equally to this work.
J Sex Med 2012;9:482–493
esterase type 5 inhibitors (PDE5) for the treatment of ED is effective in some patients, diabetic patients are more refractory to treatment with PDE5 [1,2], probably because the cavernous body is severely damaged in these patients. In order to explore effective treatments for diabetic ED, alternative strategies such as gene therapy and cell therapy will be required to regenerate the cavernous body. In fact, several genes such as endothelial nitric oxide synthase (eNOS) and a Ca-sensitive K channel subtype (hSlo) have been injected in the cavernous © 2011 International Society for Sexual Medicine
483
Adrenomedullin Secretion from ASC body and turned out to be effective for the treatment of ED in animal models [3,4]. Stem cells such as bone marrow-derived stem cells (BMSC), adipose tissue-derived stem cells (ASC), brainderived stem cells (BSC), and skeletal musclederived stem cells (SMSC) have also been used to treat ED, and they are reportedly useful for the treatment of ED in animal models [5–12]. Recently, ASC have been drawing much attention, because collection of mesenchymal stem cells from subcutaneous adipose tissue is a relatively safer and less painful procedure to patients than bone marrow aspiration. ASC reportedly have the potential to differentiate into a variety of cell lineages, including adipocytes, chondrocytes, osteocytes, skeletal muscle, vascular endothelial cells (VEC), and vascular smooth muscle cells (VSMC) [13]. It has been reported that ASC stimulate angiogenesis in the mouse hindlimb ischemia model [14–18], suggesting the possibility that ASC will be useful for the treatment of ED, because ASC potentially regenerate VEC and VSMC in the cavernous body. However, the mechanism by which ASC stimulate angiogenesis remains to be debated. ASC promoted angiogenesis either by engrafting in the endothelial layer and stimulating neovascular formation [14,15] or by producing angiogenesis-stimulating factors without integration into the endothelial layer [17,18]. We have recently reported that ASC stimulate reendothelialization and inhibit neointimal formation in a paracrine fashion in wire-injured rat femoral artery [19]. Furthermore, it is reported that the cell lysate of ASC, as well as ASC themselves, improved erectile function [11], suggesting that ASC produce cytokines that potentially regenerate the cavernous body and restore erectile function. Adrenomedullin (AM) was originally isolated from human pheochromocytoma tissue [20]. It is also produced by VEC, VSMC, and macrophages [21–23], suggesting that it plays the role of a local mediator. AM not only activates the cAMPdependent pathway and induces relaxation of VSMC [20], but also activates the cGMP-dependent pathway and induces endothelium-dependent vasorelaxation via the Akt/eNOS-dependent pathway [24]. We have previously reported that acute administration of AM into the cavernous body enhances erectile function in rats [25]. During the screening of cytokines produced by ASC, we found that ASC produced AM especially when ASC were cultured in medium containing growth factors for VEC. In this study, we examined whether AM would be implicated in ASC-induced restoration of erectile function.
Materials and Methods
Reagents The anti-VE-cadherin antibody used for Western blot analysis, the anti-b-actin antibody, and the anti-total-eNOS antibody that recognizes eNOS regardless of whether it is phosphorylated or not, were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). The anti-phosphoeNOS antibody that recognizes the catalytically active form of eNOS was obtained from New England BioLabs (Beverly, MA, USA). The antiVE-cadherin antibody used for immunohistochemichal analysis was obtained from LifeSpan BioSciences (Seattle, WA, USA). Cell Culture ASC were cultured from male Wistar rats, as we previously reported [19]. ASC were first cultured in a 1:1 mixture of Dulbecco’s modified Eagle medium (DMEM) and F12 medium containing 10% fetal bovine serum (FBS), and split several times to expand the cells. Passages 2 to 4 were used for the experiments. ASC were then cultured on fibronectin-coated dishes in endothelial growth medium-2MV (EGM; Lonza Walkersville, Inc., Walkersville, MD, USA). EGM consists of endothelial basal medium-2 (Lonza Walkersville, Inc.) containing 5% FBS plus growth factors such as epidermal growth factor (EGF), hydrocortisone, vascular endothelial growth factor (VEGF)-A, basic fibroblast growth factor (bFGF), and insulin-like growth factor (IGF)-1. ASC were also cultured on fibronectin-coated dishes in endothelial basal medium-2 containing 5% FBS (EBM) as the negative control. In some experiments, ASC were labeled with PKH26 red fluorescent dye (Sigma-Aldrich, St. Louis, MO, USA) according to the protocol provided by the manufacturer in order to trace the fate of ASC injected into the penis. Human umbilical vein endothelial cells (HUVEC) were purchased from Sanko-Junyaku (Tokyo, Japan) and cultured using HuMedia-EG (Kurabo, Osaka, Japan). NRK52E cells, a cell line derived from rat renal tubular cells, as well as HEK293 cells, were obtained from ATCC (Manassas, VA, USA) and cultured in DMEM containing 5% FBS. 293 FT cells (Invitrogen, Carlsbad, CA, USA) were cultured in DMEM containing 10% FBS, 2 mM L-Glutamine and 500 mg/mL Geneticin (Sigma-Aldrich). Animal Experiments All procedures involving experimental animals were approved by the institutional committee for J Sex Med 2012;9:482–493
484 animal research of Tokyo University. Streptozotocin (STZ; 50 mg/kg body weight; Sigma-Aldrich) was dissolved in citrate buffer (pH 4.5) and injected in the tail vein of male Wistar rats (6 weeks old; Charles River, Wilmington, MA, USA). Blood glucose level was measured 4 weeks later to confirm that these mice became diabetic. ASC (5 ¥ 105 cells) that were cultured in EBM or EGM for 1 week were resuspended in 200 mL of saline and injected into the cavernous body at the glans 6 weeks after STZ injection. The same amount of saline was injected into the cavernous body as the negative control. Adenovirus suspension was also injected into the penis 6 weeks after STZ injection. Four weeks after ASC or adenovirus injection, rats (16 weeks old) were subjected to intracavernous pressure (ICP) measurement. The penis was also harvested for histochemical analysis and Western blot analysis at this time point.
ICP Measurement ICP measurement was performed in the same way as we previously reported [25]. Rats were anesthetized with ketamine (100 mg/kg body weight) injected intraperitoneally. The left carotid artery was exposed and cannulated with a PE-50 polyethylene tube to continuously monitor mean arterial pressure (MAP). The penis was denuded of skin, and the pelvic and cavernous nerves were isolated. The right cavernous nerve was hooked with stainless steel bipolar electrodes (TN-98119A, Unique Medical Co., Tokyo, Japan) and connected to a nerve stimulator (Nihon Kohden Co., Tokyo, Japan). Unilateral electrical field stimulation of the cavernous nerve was performed for 10 seconds using a square wave stimulator. The magnitude of electrical voltage ranged from 2.5 to 5.0 V with 20 Hz, 2 ms of duration. The right cavernous body was cannulated with a 23-gauge needle connected to a pressure transducer to continuously monitor ICP. Area under the curve (AUC) of ICP traces as well as the ratio of peak ICP to MAP (ICP/MAP) was used to evaluate erectile function. Protein Extraction and Western Blot Analysis The penis was homogenized in a cell lysis buffer (50 mM Tris–HCl (pH 8.0), 150 mM NaCl, 1% NP-40) containing 2 mg/mL aprotinin, 2 mg/mL leupeptin, and 1 mM phenylmethylsulfonyl fluoride. Western blot analysis was performed as previously described [26]. Histochemistry The penis was fixed by perfusing it with 4% paraformaldehyde and then processed for paraffin J Sex Med 2012;9:482–493
Nishimatsu et al. embedding. Cross sections (5 mm) were cut, deparaffinized, rehydrated, and subjected to Elastica van Gieson stain to visualize collagen and elastin fibers in the trabeculae of the cavernous body. For immunohistochemistry, sections were incubated with a primary antibody reactive to VE-cadherin (1:400 dilution). Sections were then incubated with biotinylated secondary antibody and finally horseradish peroxidase-labeled streptavidin according to the instructions provided by the manufacturer (DAKO, Cambridgeshire, UK).
Construction of Lentivirus that Expresses AM siRNA Lentivirus that expresses AM small interfering RNA (siRNA) was constructed using BLOCK-iT Lentiviral Pol II miR RNAi Expression System (Invitrogen) according to the instructions provided by the manufacturer. Each of two double-stranded oligonucleotides that target the coding region of rat AM to silence its expression was first subcloned into the pcDNA6.2-GW/EmGFPmiR plasmid that also expresses green fluorescence protein (GFP) to facilitate the identification of transfected cells. The DNA sequences of the sense strand of those oligonucleotides were as follows: AM siRNA1: 5′- TGCTGTAGCGTTTGACTC GAATGTGGGTTTTGGCCACT GACTGACCCACATTCGTCAAACGCTA-3′ AM siRNA2: 5′- TGCTGTAGCCTTGAGGGC TGATCTTGGTTTTGGCCA CTGACTGACCAAGATCACCTCAAGGCTA3′ After confirming the DNA sequences, the two double-stranded oligonucleotides were ligated together in the pcDNA6.2-GW/EmGFPmiR plasmid vector so that this plasmid expresses two AM siRNAs simultaneously. The region that encodes GFP and two AM siRNAs in the vector was then subcloned into pLenti7.3/V5-DEST Gateway vector using the clonase reaction as recommended by the manufacturer. pcDNA6.2GW/EmGFPmiR-neg control plasmid that is supplied by the manufacturer and expresses siRNA which is predicted not to target any known vertebrate gene (NC siRNA), was also subcloned into the pLenti7.3/V5-DEST Gateway vector to produce a negative control lentivirus. These plasmids were then transfected into 293 FT cells together with ViraPower Packaging Mix (Invitrogen) using the calcium phosphate method to produce lentivirus. Culture medium was changed the following day, and the medium containing lentivirus was
Adrenomedullin Secretion from ASC
485
collected two days later. Lentivirus was concentrated from the culture medium using polyethyleneglycol method as previously reported [27]. The titer of lentivirus was determined using 293FT cells with GFP fluorescence as the marker. Twenty multiplicity of infection (MOI) of lentivirus was infected in rat ASC. Under this condition, approximately 80% of cells expressed GFP and supposedly siRNA. After infection with lentivirus, ASC were cultured in EGM for 1 week and injected into the penis.
Construction of Adenovirus that Expresses AM Replication-defective adenovirus which expresses rat AM was constructed according to the method described previously using an AdMax kit (Microbix Biosystems Inc., Toronto, ON, Canada) [28]. The coding region of rat AM was amplified by PCR and subcloned into the pDC516 vector. The primer sequences used for PCR were as follows: RatAMsense primer: 5′-ATGAAGCTGGTTTC CATCGC-3′ RatAMantisense primer: 5′-CTATAACCTAGAG ACTCTGGA-3′ After determining the DNA sequence, the expression plasmid pDC516 that expresses rat AM was co-transfected into HEK293 cells with pBHGfrtdelE13FLP to construct adenovirus expressing rat AM (AdAM). A recombinant adenovirus that expresses GFP (AdGFP) was obtained from Quantum Biotechnologies (Montreal, QC, Canada).
Fluorescent Immunoassay Rat AM in culture medium was measured with a Fluorescent Immunoassay kit (Phoenix Pharmaceuticals, Burlingame, CA, USA) according to the methods provided by the manufacturer. Fluorescence was measured (Excitation wave length: 320 nm, emission wave length: 460 nm) with a Fluoroskan Ascent FL fluorescent microplate reader (Thermo Fisher Scientific, Waltham, MA, USA). Statistical Analysis The values are expressed as the mean ⫾ SEM. Statistical analyses were performed using analysis of variance followed by the Student-NeumannKeul’s test. Differences with a P value of <0.05 were considered statistically significant. Results
ASC Administration Restores ICP We first examined the effects of ASC injection on ICP. Administration of ASC cultured in EBM
Figure 1 ASC administration restores erectile function. ASC cultured in EBM (EBM) or EGM (EGM) were injected into the cavernous body of 12-week-old male Wistar rats (6 weeks after STZ injection via the tail vein), and ICP and MAP were measured 4 weeks after ASC injection. Agematched male Wistar rats were used as the positive control (Wistar), and STZ rats that were injected with saline into the penis were used as the negative control (C). (A) Bar graphs comparing ICP/MAP among the groups (N = 8 each). (B) Bar graphs comparing AUC among the groups (N = 8 each).
significantly increased ICP/MAP and AUC compared to the negative control STZ-injected diabetic rats (Figure 1). In the diabetic rats that were administered ASC cultured in EGM, ICP/ MAP and AUC increased more significantly to a similar level with those observed in age-matched Wistar rats. These results suggested that ASC administration restores erectile function especially when they are cultured in medium containing several growth factors for VEC.
ASC Administration Restores the Structure of the Cavernous Body We therefore examined the effects of ASC administration on the morphology of the cavernous body (Figure 2A). The trabeculae of the cavernous J Sex Med 2012;9:482–493
486
Nishimatsu et al.
Figure 2 Histological analysis of the cavernous body after ASC injection. (A) Elastica van Gieson staining of the cavernous body isolated from age-matched Wistar rats (PC), and STZ rats injected with saline (NC), EBM-cultured ASC (EBM) or EGM-cultured ASC (EGM) into the penis. The histology of the root portion of the penis (longitudinal section) is shown. Bars are 300 mm. (B) Immunohistochemical analysis of the cavernous body isolated from STZ rats injected with saline (NC), EBM-cultured ASC (EBM) or EGM-cultured ASC (EGM) into the penis. VE-cadherin was stained to visualize the endothelial layer in the cavernous body. The longitudinal section of the cavernous body at the root of the penis is shown. Bars are 100 mm. (C) Traces of ASC injected into the cavernous body. ASC cultured in EGM for 1 week were labeled with PKH26 and injected into the cavernous body of STZ-treated rats. The penis was isolated 1 and 4 weeks after ASC injection and fluorescence of PKH26 was analyzed under a fluorescent microscope. The penis injected with saline was used as the negative control (NC). The same fields were photographed with a light microscope and shown in the lower columns. Arrowheads indicate PKH26 positive cells. Bars are 40 mm.
body at the root of the penis largely consisted of collagen fibers, and elastin fibers were barely detected. The trabeculae of the cavernous body in STZ-injected diabetic rats appeared to be remarkJ Sex Med 2012;9:482–493
ably small and sparsely distributed especially at the root of the penis as compared with the positive control age-matched Wistar rats that were not injected with STZ. When ASC cultured either in
Adrenomedullin Secretion from ASC EBM or in EGM were injected, the trabeculae of the cavernous body became larger and were distributed more densely in the cavernous body. We, next, examined the expression of VE-cadherin, a marker of VEC, by immunohistochemistry (Figure 2B). The trabeculae of the cavernous body of the negative control STZ-injected rats were also surrounded by VE-cadherin-positive VEC to a similar extent as those of ASC (cultured either in EBM or in EGM)-injected rats. However, because the trabeculae were smaller and distributed more sparsely in the negative control STZ-injected rats than in ASC-injected rats, the absolute area of VE-cadherin-positive endothelial layer surrounding the trabeculae was estimated to be decreased in the negative control rats compared with the STZ rats injected with ASC. Therefore, we performed Western blot analysis to quantify the amount of VE-cadherin expression in the penis (Figure 3). When ASC cultured either in EBM or in EGM were injected, VE-cadherin expression in the penis increased significantly compared to the negative control STZ rats, as expected from the results of the immunohistochemical analysis. These results suggested that ASC injection stimulated the regeneration of the vascular endothelial layer in the cavernous body, resulting in the formation of larger and more densely distributed trabeculae.
The Fate of ASC in the Penis It has been reported that ASC potentially differentiate into a variety of cells such as VEC and VSMC [13]. On the other hand, many reports have suggested that the potential of ASC to differentiate into many cell types is not so high, and ASC assist the regeneration of tissues via the secretion of many cytokines that stimulate angiogenesis and inhibit apoptosis [17,18]. We therefore examined how long injected ASC could remain in the cavernous body (Figure 2C). We labeled ASC cultured in EGM with PKH26 and injected the cells into the cavernous body. A small number of ASC could be detected in the cavernous body 1 week after the injection. However, ASC were barely detected in the cavernous body 4 weeks after the injection, the time point when ICP and VE-cadherin expression were restored. These results suggested that ASC secreted several cytokines that improved erectile function rather than ASC being engrafted and differentiating into the cavernous body. Therefore, we searched for cytokines that were implicated in ASC-induced restoration of erectile function.
487
Figure 3 Western blot analysis of VE-cadherin expression in the penis. (A) ASC cultured in EBM (EBM) or EGM (EGM) were injected into the cavernous body of STZ-treated rats, and the penis was isolated for protein extraction 4 weeks after ASC injection. Saline was also injected into the cavernous body as the negative control (NC). Proteins extracted from HUVEC were used as the positive control. The blotted membranes were incubated with anti-VEcadherin antibody, and then anti-b-actin antibody as the internal control. (B) Histograms showing relative intensity of the bands (N = 5 each).
ASC Produce AM As we previously reported, because EGM contains several growth factors for VEC, expression of EGF, VEGF-A, bFGF, and IGF-1 was rather suppressed in ASC cultured in EGM compared with those cultured in EBM [19]. During the screening of cytokines that ASC produce, we found that ASC produce AM especially when they were cultured in EGM. ASC secreted AM in the culture medium in a time-dependent fashion (Figure 4A). ASC cultured in EGM secreted a more significant amount of AM (approximately 20-fold increase) than those cultured in EBM. When ASC were infected with lentivirus that expresses AM siRNA and cultured in EGM for 1 week, AM secretion by ASC was significantly suppressed (Figure 4B). We also examined whether the AdAM we constructed J Sex Med 2012;9:482–493
488
Nishimatsu et al. Figure 4 AM production by ASC. (A) AM accumulates in the culture medium of ASC in a time-dependent manner. ASC were plated in 24-well plates and cultured in EBM (open circles) or EGM (closed circles) for 1 week. After washing the wells with phosphate-buffered saline (PBS), medium was replaced with serum-free DMEM and incubated for the indicated periods. AM accumulated in the medium was measured with a fluorescent immunoassay kit. *: P < 0.05 vs. 0 hour, **: P < 0.01 vs. 0 hour and #: P < 0.01 vs. EBM culture at each time point (N = 6 each). (B) Effect of AM siRNA infection on AM production. ASC were cultured in 60 mm dishes and infected with LV_NC siRNA (NCsiRNA) or LV_AM siRNA (AMsiRNA). Some dishes were not infected with lentivirus as the positive control (C). ASC were then cultured in EGM for 1 week. After washing ASC with PBS, the medium was replaced with serum-free DMEM and incubated for 4 hours. Medium was collected and AM was measured with a fluorescent immunoassay kit. *: P < 0.05 vs. NCsiRNA (N = 3 each). (C) Effect of AdAM infection on AM production. NRK-52E cells were plated in 24-well plates and infected with AdAM or AdGFP. Culture medium from AdAM-infected cells (closed squares) and AdGFP-infected cells (open squares) was collected to measure the AM content with a fluorescent immunoassay kit. **: P < 0.001 vs. AdGFP infection (N = 6 each). 䉳
expressed AM. Because ASC produce endogenous AM, we used NRK-52E cells that do not produce AM. We infected NRK-52E cells with AdAM (20 MOI) and measured immunoreactive AM in the culture medium. NRK-52E cells infected with AdAM secreted a significant amount of AM in the culture medium (Figure 4C).
Effects of AM Knockdown and Forced Expression of AM We used lentivirus expressing rat AM siRNA and AdAM, and examined whether AM produced by J Sex Med 2012;9:482–493
ASC played pivotal roles in ASC-induced restoration of erectile function. Because ASC cultured in EGM restored ICP/MAP and AUC more significantly and produced a more significant amount of AM than those cultured in EBM, we used EGMcultured ASC to examine the effects of AM knockdown in the following experiments. ASC were infected with lentiviruses expressing AM siRNA (LV_AM siRNA) or its negative control NC siRNA (LV_NC siRNA), cultured in EGM for 1 week, and injected in the cavernous body. When ASC were infected with LV_NC siRNA, they significantly restored erectile function, as assessed by ICP/MAP and AUC (Figure 5). In contrast, when ASC were infected with LV_AM siRNA, ASC-induced restoration of ICP/MAP and AUC was significantly diminished. When AdAM (3.3 ¥ 108 pfu) was injected in the cavernous body, ICP/MAP and AUC were significantly restored compared with AdGFP injection. These results suggested that AM produced by ASC was implicated in ASC-induced restoration of erectile function. We also examined the histology of the cavernous body (Figure 6). When ASC were infected with LV_NC siRNA, cultured in EGM and injected in the cavernous body, the trabeculae of the cavernous body became larger and were distributed more densely in the cavernous body than
Adrenomedullin Secretion from ASC
489 control STZ rats, and reached a similar level observed when ASC cultured in EGM were injected. However, VE-cadherin expression was significantly suppressed to the basal level when ASC were infected with LV_AM siRNA, cultured in EGM, and injected in the cavernous body. When AdAM was injected in the cavernous body, VE-cadherin expression in the penis increased significantly compared with the control STZ rats injected with AdGFP. We finally examined the expressions of totaleNOS and phospho-eNOS in the penis. Administration of EGM-cultured ASC significantly increased total-eNOS expression in the penis. When EGM-cultured ASC were preinfected with LV_NC siRNA, ASC administration also significantly increased total-eNOS expression, whereas EGM-cultured ASC did not significantly increase total-eNOS expression when they were preinfected with LV_AM siRNA. AdAM administration significantly increased total-eNOS expression, whereas AdGFP administration did not. The expression of phospho-eNOS changed to a similar direction with total-eNOS. Administration of EGM-cultured ASC significantly increased phospho-eNOS expression in the penis.
Figure 5 Effect of knockdown and overexpression of AM on erectile function. ASC were infected with LV_NC siRNA or LV_AM siRNA. ASC were cultured in EGM for 1 week, and those LV_NC siRNA-infected ASC (EGM_NCsiRNA) and LV_AM siRNA-infected ASC (EGM_AMsiRNA) were injected in the cavernous body. ICP was measured 4 weeks after the ASC injection. AdAM or AdGFP was also injected into the cavernous body, and ICP was measured 4 weeks after the infection. Nontreated STZ-injected diabetic rats were used as the negative control (NC). (A) Bar graphs comparing ICP/MAP among the groups (N = 5 each). (B) Bar graphs comparing AUC among the groups (N = 5 each).
those of the penis injected with ASC that had been infected with LV_AM siRNA. Furthermore, when AdAM was injected in the cavernous body, the trabeculae of the cavernous body became larger and were distributed more densely than those of penis injected with AdGFP. We next examined the expression of VEcadherin by Western blot analysis (Figure 7). When ASC were infected with LV_NC siRNA, cultured in EGM, and injected in the cavernous body, the expression of VE-cadherin in the penis increased significantly compared with the negative
Figure 6 Effect of knockdown and overexpression of AM on the morphology of the cavernous body. Experiments were performed in the same way as described in the legend for Figure 5. The cavernous body was stained by the Elastica van Gieson method. The histology of the root portion of the penis (longitudinal section) is shown. Bars are 200 mm.
J Sex Med 2012;9:482–493
490
Nishimatsu et al.
Figure 7 Effect of knockdown and overexpression of AM on the expression of VE-cadherin, total-eNOS and phospho-eNOS. Experiments were performed in the same way as described in the legend for Figure 5. The penis was isolated 4 weeks after lentivirus-infected ASC injection or adenoviral infection. Protein was extracted from the penis and subjected to Western blot analysis to detect VE-cadherin (VE-Cad), totaleNOS (T-eNOS) and phospho-eNOS (P-eNOS). (A) Representative photographs showing the expression of VE-cadherin, total-eNOS, phosphoeNOS and b-actin. (B) Histograms comparing relative intensity of the bands among the groups (N = 5 each). *: P < 0.05 vs. NC, #: P < 0.05 vs. EGM_NCsiRNA, †: P < 0.05 vs. AdGFP infection and ††: P < 0.01 vs. AdGFP infection.
Injection of LV_NC siRNA-infected ASC also significantly increased phospho-eNOS expression, whereas preinfection of ASC with LV_AM siRNA significantly suppressed the increase in phospho-eNOS expression. AdAM administration significantly increased phospho-eNOS expression, whereas AdGFP administration did not. Discussion
In this study, we showed that ASC, especially when cultured in EGM, restored erectile function in STZ-injected diabetic rats, as assessed by ICP J Sex Med 2012;9:482–493
measurement. ASC administration appeared to stimulate regeneration of VEC in the cavernous body, which was reflected by increases in VEcadherin and total eNOS expressions in the penis. Knockdown of AM production from ASC using lentiviral expression of AM siRNA significantly diminished ASC-induced restoration of erectile function. Overexpression of AM in the penis using adenoviral expression significantly restored erectile function. These results suggested that AM is implicated in ASC-induced recovery of erectile function, especially when ASC were cultured in EGM.
491
Adrenomedullin Secretion from ASC Although ASC reportedly have the potential to differentiate into a variety of tissues [13], whether ASC effectively differentiate into a variety of cell types in vivo where ASC are administered remains debated. It was originally reported that ASC were engrafted in vascular endothelial layer and stimulated angiogenesis in mouse hindlimb ischemia model [14–16], suggesting that ASC potentially differentiated in VEC in vivo. However, recent reports suggested that ASC stimulated angiogenesis in mouse hindlimb ischemia model without integration into the vascular endothelial layer [17,18], suggesting that ASC produced some cytokines that stimulated angiogenesis. Stem cells such as BMSC, ASC, BSC, and SMSC have been used in the field of erectile dysfunction treatment. Several reports have suggested that BMSC, BSC, and SMSC differentiated into VEC and VSMC in the cavernous body, and stimulated the regeneration of the cavernous body, resulting in the recovery of erectile function [5–8,12]. ASC have characteristics that are very similar to those of BMSC. However, several reports published so far suggested that although ASC did have the potential to restore erectile function, differentiation of ASC into the cavernous body in vivo occurred in, if any, minimal amounts [9–11]. In fact, it was reported that cell lysate of ASC had the same potential to recover erectile function as ASC per se [11], suggesting strongly that ASC restore erectile function via the production of cytokines that stimulate the regeneration of the cavernous body. Therefore, it is very important now to identify such cytokines that ASC produce to restore erectile function. AM was originally isolated from human pheochromocytoma [20]. However, it is widely distributed including VEC, VSMC, and macrophages [21–23], suggesting its roles as a local mediator rather than a circulating hormone. AM activates the Akt/eNOS-dependent pathway and induces endothelium-dependent vasorelaxation as well as endothelium-independent vasorelaxation that is caused by the direct effect of AM on vascular smooth muscle cells [20,24]. Because eNOS is implicated in ischemia-induced angiogenesis [29,30], AM was expected to stimulate angiogenesis. In fact, several reports clearly showed that AM stimulates angiogenesis [31–33]. Therefore, we propose that AM restores erectile function, at least in part, via stimulation of angiogenesis in the cavernous body and regeneration of the cavernous body. Interestingly, expression of phospho-eNOS as well as total-eNOS was significantly increased in
the penis after ASC injection. Knockdown of AM in ASC diminished the increase in phospho-eNOS expression, and AdAM infection significantly increased phospho-eNOS expression. Furthermore, the extent of the increase in phospho-eNOS expression was higher than that in total eNOS. These results suggested that AM not only stimulated angiogenesis, but also improved vascular endothelial function. Intravenous administration of AM or, if possible in the future, percutaneous administration of AM by topical application, will be a useful strategy to treat severe erectile dysfunction in which the effect of PDE5 is not expected. Although injected ASC were barely detected in the penis 4 weeks after injection, their effects on erectile function lasted for at least 4 weeks. It remains unclear why the effect of AM that was produced by ASC lasted until after ASC disappeared from the penis. It appeared that transient overexpression of AM could initiate the cascade of angiogenesis and regeneration of the cavernous body. It was shown that AM stimulated the production of VEGF and bFGF [34]. It was also reported that VEGF stimulated AM production [35]. Although we did not measure the expression of AM, VEGF or bFGF in the penis after ASC injection, we speculate that transient overexpression of AM from ASC stimulated not only angiogenesis but also production of VEGF and/or bFGF in the cavernous body, which further promoted angiogenesis and AM production from VEC located in the cavernous body in a paracrine fashion. Our results indicated that ASC cultured in EGM were apparently more effective to restore erectile function than those cultured in EBM. These results suggested that the culture condition of ASC critically affects their effects in cell therapy. Therefore, it will be possible to enhance the effect of ASC by modifying culture conditions or pretreatment of ASC with some chemical compounds. Future studies will be required to clarify this point. Conclusions
ASC restored erectile function, especially when ASC were cultured in a medium containing several growth factors for VEC. AM seems to play a major role in ASC-induced restoration of erectile function in the diabetic model. Administration of AM, together with PDE-5I, will be useful to improve the quality of life of diabetic patients. J Sex Med 2012;9:482–493
492 Corresponding Author: Etsu Suzuki, MD, PhD, Institute of Medical Science, St. Marianna University School of Medicine, 2-16-1 Sugao, Miyamae-ku, Kawasaki 216-8512, Japan. Tel: (044) 977-8111; Fax: (044) 9778361; E-mail: [email protected] Conflict of Interest: None declared. Statement of Authorship
Category 1 (a) Conception and Design Etsu Suzuki; Haruki Kume; Yukio Homma (b) Acquisition of Data Hiroaki Nishimatsu; Etsu Suzuki; Shintaro Kumano; Akira Nomiya; Miao Liu (c) Analysis and Interpretation of Data Hiroaki Nishimatsu; Etsu Suzuki; Akira Nomiya
Category 2 (a) Drafting the Article Etsu Suzuki (b) Revising It for Intellectual Content Etsu Suzuki; Hiroaki Nishimatsu
Category 3 (a) Final Approval of the Completed Article Hiroaki Nishimatsu; Etsu Suzuki; Shintaro Kumano; Akira Nomiya; Miao Liu; Haruki Kume; Yukio Homma References 1 Dey J, Shepherd MD. Evaluation and treatment of erectile dysfunction in men with diabetes mellitus. Mayo Clin Proc 2002;77:276–82. 2 Siroky MB, Azadzoi KM. Vasculogenic erectile dysfunction: Newer therapeutic strategies. J Urol 2003;170:S24–30. 3 Champion HC, Bivalacqua TJ, Hyman AL, Ignarro LJ, Hellstrom WJ, Kadowitz PJ. Gene transfer of endothelial nitric oxide synthase to the penis augments erectile responses in the aged rat. Proc Natl Acad Sci U S A 1999;96:11648–52. 4 Christ GJ, Day N, Santizo C, Sato Y, Zhao W, Sclafani T, Bakal R, Salman M, Davies K, Melman A. Intracorporal injection of hslo cdna restores erectile capacity in stz-diabetic f-344 rats in vivo. Am J Physiol Heart Circ Physiol 2004;287: H1544–53. 5 Bivalacqua TJ, Deng W, Kendirci M, Usta MF, Robinson C, Taylor BK, Murthy SN, Champion HC, Hellstrom WJ, Kadowitz PJ. Mesenchymal stem cells alone or ex vivo gene modified with endothelial nitric oxide synthase reverse ageassociated erectile dysfunction. Am J Physiol Heart Circ Physiol 2007;292:H1278–90. 6 Song YS, Lee HJ, Park IH, Kim WK, Ku JH, Kim SU. Potential differentiation of human mesenchymal stem cell transplanted in rat corpus cavernosum toward endothelial or smooth muscle cells. Int J Impot Res 2007;19:378–85. 7 Nolazco G, Kovanecz I, Vernet D, Gelfand RA, Tsao J, Ferrini MG, Magee T, Rajfer J, Gonzalez-Cadavid NF. Effect of muscle-derived stem cells on the restoration of corpora cavernosa smooth muscle and erectile function in the aged rat. BJU Int 2008;101:1156–64.
J Sex Med 2012;9:482–493
Nishimatsu et al. 8 Song Y, Mehta N, Sheh B, Saljooque F, U HS, Rajasekaran M. Transdifferentiation of rat fetal brain stem cells into penile smooth muscle cells. BJU Int 2009;104:257–62. 9 Garcia MM, Fandel TM, Lin G, Shindel AW, Banie L, Lin CS, Lue TF. Treatment of erectile dysfunction in the obese type 2 diabetic zdf rat with adipose tissue-derived stem cells. J Sex Med 2010;7:89–98. 10 Huang YC, Ning H, Shindel AW, Fandel TM, Lin G, Harraz AM, Lue TF, Lin CS. The effect of intracavernous injection of adipose tissue-derived stem cells on hyperlipidemia-associated erectile dysfunction in a rat model. J Sex Med 2010;7:1391–400. 11 Albersen M, Fandel TM, Lin G, Wang G, Banie L, Lin CS, Lue TF. Injections of adipose tissue-derived stem cells and stem cell lysate improve recovery of erectile function in a rat model of cavernous nerve injury. J Sex Med 2010;7:3331–40. 12 Qiu X, Lin H, Wang Y, Yu W, Chen Y, Wang R, Dai Y. Intracavernous transplantation of bone marrow-derived mesenchymal stem cells restores erectile function of streptozocininduced diabetic rats. J Sex Med 2011;8:427–36. 13 Gimble JM, Katz AJ, Bunnell BA. Adipose-derived stem cells for regenerative medicine. Circ Res 2007;100:1249–60. 14 Miranville A, Heeschen C, Sengenes C, Curat CA, Busse R, Bouloumie A. Improvement of postnatal neovascularization by human adipose tissue-derived stem cells. Circulation 2004; 110:349–55. 15 Planat-Benard V, Silvestre JS, Cousin B, Andre M, Nibbelink M, Tamarat R, Clergue M, Manneville C, Saillan-Barreau C, Duriez M, Tedgui A, Levy B, Penicaud L, Casteilla L. Plasticity of human adipose lineage cells toward endothelial cells: Physiological and therapeutic perspectives. Circulation 2004; 109:656–63. 16 Rehman J, Traktuev D, Li J, Merfeld-Clauss S, Temm-Grove CJ, Bovenkerk JE, Pell CL, Johnstone BH, Considine RV, March KL. Secretion of angiogenic and antiapoptotic factors by human adipose stromal cells. Circulation 2004;109:1292– 8. 17 Nakagami H, Maeda K, Morishita R, Iguchi S, Nishikawa T, Takami Y, Kikuchi Y, Saito Y, Tamai K, Ogihara T, Kaneda Y. Novel autologous cell therapy in ischemic limb disease through growth factor secretion by cultured adipose tissuederived stromal cells. Arterioscler Thromb Vasc Biol 2005;25: 2542–7. 18 Kondo K, Shintani S, Shibata R, Murakami H, Murakami R, Imaizumi M, Kitagawa Y, Murohara T. Implantation of adipose-derived regenerative cells enhances ischemia-induced angiogenesis. Arterioscler Thromb Vasc Biol 2009;29:61–6. 19 Takahashi M, Suzuki E, Oba S, Nishimatsu H, Kimura K, Nagano T, Nagai R, Hirata Y. Adipose tissue-derived stem cells inhibit neointimal formation in a paracrine fashion in rat femoral artery. Am J Physiol Heart Circ Physiol 2010;298: H415–H23. 20 Kitamura K, Kangawa K, Kawamoto M, Ichiki Y, Nakamura S, Matsuo H, Eto T. Adrenomedullin: A novel hypotensive peptide isolated from human pheochromocytoma. Biochem Biophys Res Commun 1993;192:553–60. 21 Sugo S, Minamino N, Kangawa K, Miyamoto K, Kitamura K, Sakata J, Eto T, Matsuo H. Endothelial cells actively synthesize and secrete adrenomedullin. Biochem Biophys Res Commun 1994;201:1160–6. 22 Sugo S, Minamino N, Shoji H, Kangawa K, Kitamura K, Eto T, Matsuo H. Production and secretion of adrenomedullin from vascular smooth muscle cells: Augmented production by tumor necrosis factor-alpha. Biochem Biophys Res Commun 1994;203:719–26. 23 Kubo A, Minamino N, Isumi Y, Katafuchi T, Kangawa K, Dohi K, Matsuo H. Production of adrenomedullin in macrophage cell line and peritoneal macrophage. J Biol Chem 1998;273:16730–8.
Adrenomedullin Secretion from ASC 24 Nishimatsu H, Suzuki E, Nagata D, Moriyama N, Satonaka H, Walsh K, Sata M, Kangawa K, Matsuo H, Goto A, Kitamura T, Hirata Y. Adrenomedullin induces endothelium-dependent vasorelaxation via the phosphatidylinositol 3-kinase/aktdependent pathway in rat aorta. Circ Res 2001;89:63–70. 25 Nishimatsu H, Hirata Y, Hayakawa H, Nagata D, Satonaka H, Suzuki E, Horie S, Takeuchi T, Ohta N, Homma Y, Minowada S, Nagai R, Kawabe K, Kitamura T. Effects of intracavernous administration of adrenomedullin on erectile function in rats. Peptides 2001;22:1913–8. 26 Suzuki E, Nagata D, Yoshizumi M, Kakoki M, Goto A, Omata M, Hirata Y. Reentry into the cell cycle of contact-inhibited vascular endothelial cells by a phosphatase inhibitor: Possible involvement of extracellular signal-regulated kinase and phosphatidylinositol 3-kinase. J Biol Chem 2000;275:3637– 44. 27 Kutner RH, Zhang XY, Reiser J. Production, concentration and titration of pseudotyped HIV-1-based lentiviral vectors. Nat Protoc 2009;4:495–505. 28 Suzuki E, Nishimatsu H, Satonaka H, Walsh K, Goto A, Omata M, Fujita T, Nagai R, Hirata Y. Angiotensin ii induces myocyte enhancer factor 2- and calcineurin/nuclear factor of activated t cell-dependent transcriptional activation in vascular myocytes. Circ Res 2002;90:1004–11. 29 Lee PC, Salyapongse AN, Bragdon GA, Shears L. L, 2nd, Watkins SC, Edington HD, Billiar TR. Impaired wound healing and angiogenesis in enos-deficient mice. Am J Physiol 1999;277:H1600–8.
493 30 Murohara T, Asahara T, Silver M, Bauters C, Masuda H, Kalka C, Kearney M, Chen D, Symes JF, Fishman MC, Huang PL, Isner JM. Nitric oxide synthase modulates angiogenesis in response to tissue ischemia. J Clin Invest 1998;101:2567–78. 31 Kim W, Moon SO, Sung MJ, Kim SH, Lee S, So JN, Park SK. Angiogenic role of adrenomedullin through activation of akt, mitogen-activated protein kinase, and focal adhesion kinase in endothelial cells. Faseb J 2003;17:1937–9. 32 Tokunaga N, Nagaya N, Shirai M, Tanaka E, Ishibashi-Ueda H, Harada-Shiba M, Kanda M, Ito T, Shimizu W, Tabata Y, Uematsu M, Nishigami K, Sano S, Kangawa K, Mori H. Adrenomedullin gene transfer induces therapeutic angiogenesis in a rabbit model of chronic hind limb ischemia: Benefits of a novel nonviral vector, gelatin. Circulation 2004;109:526–31. 33 Iimuro S, Shindo T, Moriyama N, Amaki T, Niu P, Takeda N, Iwata H, Zhang Y, Ebihara A, Nagai R. Angiogenic effects of adrenomedullin in ischemia and tumor growth. Circ Res 2004;95:415–23. 34 Maki T, Ihara M, Fujita Y, Nambu T, Harada H, Ito H, Nakao K, Tomimoto H, Takahashi R. Angiogenic roles of adrenomedullin through vascular endothelial growth factor induction. Neuroreport 2011;22:442–7. 35 Albertin G, Rucinski M, Carraro G, Forneris M, Andreis P, Malendowicz LK, Nussdorfer GG. Adrenomedullin and vascular endothelium growth factor genes are overexpressed in the regenerating rat adrenal cortex, and AM and VEGF reciprocally enhance their mRNA expression in cultured rat adrenocortical cells. Int J Mol Med 2005;16:431–5.
J Sex Med 2012;9:482–493