- Email: [email protected]
Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan
International Biodeterioration & Biodegradation xxx (2017) 1e8
Contents lists available at ScienceDirect
International Biodeterioration & Biodegradation journal homepage: www.elsevier.com/locate/ibiod
Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan Sha Tsao a, Da-Jiun Wei a, Yi-Tang Chang a, *, Jiunn-Fwu Lee b, ** a b
Department of Microbiology, Soochow University, 70, LinXi Rd., Shinlin Dist., Taipei, 11102, Taiwan Graduate Institute of Environmental Engineering, National Central University, 300, Zhongda Rd., Zhongli Dist., Taoyuan City, 32001, Taiwan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 13 February 2017 Received in revised form 16 April 2017 Accepted 16 April 2017 Available online xxx
Microcystins (MCs) are commonly found in eutrophicated waterbodies such as lakes, ponds and reservoirs. MCs are hepatotoxins and create a high risk of liver tumors and cancer when MC-polluted water is drunk. Since MC-polluted waterbodies can form a normal part of many drinkiing water system, aggressive treatment to remove MC-LR type compounds has become an important issue worldwide. The objective of this study was to develop a method for the removal of high concentrations of MC-LRs (ppm level) by biodegradation using an indigious bacterial mixed culture isolated in Tawian. Using this culturebased biodegradation system, MC-LR removal of >99% is able to be achieved with the final concentration of MC-LR being measured to be 0.324 mg L1 after 16 days. The pseudo-first rate constant of the MC-LR biodegradation was 876 mg L1 day1 during the first 4 days. The bacterial biodiversity during biodegradation was found to decrease during the first stage (Day 0e4) and then increased again during the second stage (Day 5e16), based on the Richness Index and Shannon-Wiener Diversity Index. The bacterial species identified in the mixed culture included Sphingomonas spp., Pseudoxanthomonas spp., Hyphomicrobium aestuarii, Sphingobium spp., Rhizobium spp., Steroidobacter spp. and Acinetobacter spp, all of which seem to. play important roles in MC-LR biodegradation. The genes mlrB and mlrC, which encodes proteins involved in various aspects of MC-LR biodegradation, were found to be present in the mixed cultures and are capable of being used as a biomarker for the MC-LR biodegradation process in Taiwanese reservoirs. © 2017 Elsevier Ltd. All rights reserved.
Keywords: Microcystin Richness Index Shannon-Wiener Diversity Index mlrB mlrC Biomarker
1. Introduction Increasingly, eutrophication has becomes a serious problem due to the intensification of agriculture and this has generated the widespread occurrence of cyanobacterial blooms in natural lakes and human constructed reservoirs. Global climate change is also contributing to this as water temperatures rise and severe droughts occur. The result of the above changes has been massive cyanobacterial booms in many water bodies that have previously been free of such a problem. Cyanobacteria in fresh water, even when killed, can release a number of toxins, including a family of hepatotoxic cyclic heaptpeptides, the microcystins (MCs). MCs are among the most frequently observed toxins in the world (Zurawell
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected], [email protected] (Y.-T. Chang), jfl[email protected] (J.-F. Lee).
et al., 2005). The structure of MCs has been defined as cyclo-(-DAla-X-D-MeAsp-Y-Adda-D- Glu-Mdha), where X and Y are variable amino acids. Generally, X is one of the following L-amino acids, leucine (L), arginine (R), tyrosine (Y), tryptophan (W), or phenylalanine (F), while Y is one of the following L-amino acids, arginine (R), alanine (A), or methionine (M). Due to the two variable amino acids, as well as methylation/demethylation of the other amino acids, more than a hundred MCs have been identified to date. An unusual B-amino acid (3-amino-9-methoxy-10-phenyl-2, 3, 8trimethyl-deca-4,6-dienoic acid, which is called “Adda”) is found in MCs and contributes to their toxicity. Many algal genera, including Microcysits, Anabaena, Oscilator, Nostoc, Chroococcus, Planktothrix, Aphanizomenou, Melosira, etc., are able to produce MCs in fresh and brackish waters (Gagala and Mankiewiez-Boczek, 2012). One of the most commonly occurring MCs is the MC-LR, which has as the X and Y amino acids, leucine and arginine, respectively; this MC is highly toxic. In Taiwan, many nutrientscontaining effluents are discharged into reservoirs that serve as resources for drinking water and these events can give rise to major
http://dx.doi.org/10.1016/j.ibiod.2017.04.011 0964-8305/© 2017 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Tsao, S., et al., Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan, International Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.04.011
2
S. Tsao et al. / International Biodeterioration & Biodegradation xxx (2017) 1e8
cyanobacterial blooms. For example, four dominant Microcysits spp. were recorded in the Feitsui Reservoir between 1997 and 2005 (Wu and Kow, 2010), while the Moo-Tan Reservoir and the Tseng-Wen Reservoir have been measured as having MC-LR present in their waters in the range 0.12e2.4 mg L1. Toxigenic Microcystis spp. in reservoirs have been reported to be able to penetrate the water supply treatment process in Taiwan (Yen et al., 2007, 2012). The high risk to mammalian health when there is exposure to drinking water contaminated with MC-LR has been widely reported. MC-LR can affect the kidneys, the gastrointestinal tract and the colon and cause a wide range of illnesses including allergy, nausea, vomiting, fever, and gastroenteritis (Gagala and Mankiewiez-Boczek, 2012). At the biomolecular level, MC-LR is a potential tumor promoter and is able to target the liver where it inhibits various serine/threonine specific protein phosphatases such as PP-1, PP-2A, PPP4 and PPP5 in the cytoplasm of liver cells causing serious damage. Tumors of the liver and gastrointestinal tract are increased when humans are in contact with MC-LR for a long time (Bell and Codd, 1994; Zurawell et al., 2005). MC-LR is classified as possibly carcinogenic in humans (Group 2B) by the International Agency for Research on Cancer (IARC). To avoid adverse health effects affecting individuals, the World Health Origination (WHO) has proposed a guideline for drinking water, namely that the maximum concentration allowable is 1 ìg L1 MCL. Many traditional methods are available to control cyanobacterial blooms and to reduce the presence of MC-LR. However, these treatment processes are not efficient at removing all types of MCs and thus in some cases the output still poses a potential risk to human health when used for drinking water. For example, 20% MCLR residues (ppb level) have been measured in a drinking water system after slow sand filtration (Bourne et al., 2006). In a previous study we have shown that MC-LR degradation can be brought about using a photocatalytic irradiation system at 254 UVA nm, which was able to reduce the concentration of MC-LR from 1500 mg L1 to below 150 mg L1 within 60 min (Munusamy et al., 2012). Recently, an advanced treatment approach that combined a number of different processes for MC-LR removal has been developed. A TiO2 photocatalytic decomposition system was used to treat 350 ng mL1 MC-LR and it was found to be able to degrade 90% of the MC-LR present within 25 min (Liu et al., 2009). In addition, a combined UV/H2O2 system has been shown to be able to degrade MC-LR efficiently; in this system the major degradation pathways that affect MC-LR are initiated by OH attack on the benzene ring and on the diene of the Adda side chain (Liu et al., 2016). When these above-mentioned processes are combined they are able to destroy the structure of MC-LR in a short time, but such approaches to potable water treatment require the development of sophisticated techniques when used on the large scale needed for a drinking water system. MC biodegradation is an easy and cost-effective treatment when used to treat drinking water compared to any of the conventional physical/chemical methods. Biological methods of MCs removal, such as aerobic biodegradation of MC by a single isolated bacterial species, have being widely investigated. A large group of Spingomonas spp. and Sphingopyxis spp. have been identified as having significant ability to biodegrade MCs (Crettaz-Minaglia et al., 2015). In practice, however, using pure bacterial stains for MC removal from polluted reservoirs or lakes is difficult. The activity of pure stains can easily decrease and disappear because there are complicated interactions between the various bacterial species present in a nutrient-rich environment. Little information is available on the biodegradation of MCs by bacterial mixed cultures in either natural surface water or in drinking water supplying systems. The objective of this study is to isolate an indigenous bacterial
mixed culture that is capable of biodegrading the MC-LR present in the polluted reservoirs of Taiwan. The experiments exploring MCLR biodegradation were executed at ppm-level concentrations. The changes in the bacterial community and in dominant species present in the system were measured by denaturing gradient gel electrophoresis (DGGE) and cloning, respectively. The presence of functionally representative genes that encode proteins involved in the MC-LR biodegradation process were also measured during MCLR biodegradation. Our findings suggest that an effective biological treatment process can be designed that will be capable of carrying out the full-scale aerobic biodegradation of the MCs present in the water from Taiwan's eutrophicated reservoirs. 2. Materials and methods 2.1. Chemicals MC-LR (C49H74N10O12, FW ¼ 995.2) was obtained from the Biorich Biotechnology Co., Ltd. Taiwan and had been extracted from a Microcystis aeruginosa TY-1 isolated in Taiwan. The extraction and isolation procedure for MC-LR followed the approach described in a previous study (Lee et al., 1998). The purity of the MC-LR was greater than 95% as determined by HPLC. Deionized distilled water was used to prepare all solutions and all media. All other chemicals in this study were of analytical grade. 2.2. Microorganisms The bacterial mixed culture was obtained by collecting MCpolluted surface water from the Shi-Men Reservoir (24 480 41.000 N 12115015.900 E), Taoyuan City, Taiwan, and mixing it with a similar sample obtained from the Bao-shan II Reservoir (2400 440 35.500 N 121020 44.400 E), Hsinchu County, in a ratio 1/1 v/v. The method of sampling the bacterial mixed culture followed the procedure outlined in the Taiwan EPA standard method NIEA W104.51C. A bacterial mixed culture capable of biodegrading MC-LR was obtained by aerobically incubating this culture with 5 mg L1 MC-LR dissolved in B11 medium in a dark reactor at room temperature for 3 months. The B11 medium contained per liter the following 0.690 g MgSO4, 0.500 g KH2PO4, 4.000 g K2HPO4, 1.000 g NaCl, 20 mg CaCl2, 9.788 mg FeSO4 2H2O, 5.0 mg MnCl2 4H2O, 0.63 mg CuCl2 2H2O and 5.0 mg NH4Cl; the medium, including the MC-LR, sterilized using a 0.22 mm filter before use. During microbial acclimatization and enrichment, a half volume of the culture was discarded every two weeks and the culture refreshed with the same amount of 0.22 mmfiltered 5 mg L1 MC-LR B11 media in order to keep the volume constant. 2.3. MC-LR biodegradation experiments Batch biodegradation in aerobic microcosms was carried out in 150-mL Erlenmeyer flasks containing 0.25 mg MC-LR (dried base) dissolved in 50 mL 0.22 mm-filtered B11 media. At the beginning of experiments, a concentrated inoculum created by centrifugation of the contents of the dark reactor described in the previous paragraph (optical density at 600 nm of 1.82 ± 0.18, which is about 1106 CFU mL1 on nutrient agar, unpublished data) was added to the medium in the twelve Erlenmeyer flasks. The microcosms were incubated under aerobic conditions on a horizontal shaker (BenYng, E600L Incubator, Taiwan) set at 100 rpm; this was carried out at 30 C for 16 days in the dark. Each test condition was duplicated. The controls were carried out under the same conditions but without the addition of the inoculum. Samples for analysis were taken from each individual microcosm at the appropriate times, including a series of samples collected individually at the
Please cite this article in press as: Tsao, S., et al., Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan, International Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.04.011
S. Tsao et al. / International Biodeterioration & Biodegradation xxx (2017) 1e8
start of the experiments. After analysis the samples were sterilized and discarded. 2.4. MC-LR analysis The biodegradation experiments used a protein phosphatase inhibition assay and an ELISA test kit (Microcystins/Nodularins-DM ELISA kit, ABRAXIS®) to measure the congener-independent MC-LR toxin levels present in the experimental samples. The principle of the test kit involves a monoclonal antibody binding to the MCs and nodularins present and this allows the level of these toxins and their many congeners to be measured. The system does not crossreact with any other non-related toxins or compounds. Samples containing MC within the range 0.15e5 mg L1 were directly tested after 0.22 mm filtration and appropriate dilution using this assay system. 2.5. Analysis of the bacterial community present during MC-LR biodegradation 2.5.1. PCR-DGGE PCR-DGGE was used to measure the bacterial diversity during MC-LR biodegradation. DNA was extracted from aerobic microcosms using a Soil Genomic DNA Purification Kit (Gene Mark, Taiwan). Bacterial 16S rDNA was selectively amplified from the purified DNA by PCR using the V6-V8 region primers 968F and 1392R. The conditions for PCR amplification have been described previously (Muyzer et al., 1993). The purified DNA products (8 mg) were loaded onto an 8% denaturing gradient polyacrylamide linear porosity gradient gel with the denaturing gradient ranging from 30% to 80%. The electrophoresis used a Dcode system (Bio-Rad, USA) at 100 V for 16 h at 60 C and 1 Tris-acetate-EDTA (TAE) running buffer. 2.5.2. Phylogenetic tree analysis of the MC-LR biodegrading microorganisms Clone libraries were constructed after amplifying the full-length rRNA sequence (including the V1eV8 region) of the 16S rRNA gene using the forward and reverse primers: E9F and U1510R (Chudobova et al., 2015). Amplicons were purified from the bands separated by DGGE using an EasyPure PCR/Gel Extraction kit (Bioman, Taiwan). The clean products were then individually cloned using a pGEM-T Easy Vector Systems kit (Promega, Madison, Wisconsin, USA) and transformed into competent Escherichia coli DH5a cells as described by the manufacturer. The transformed E. coli was grown on LB agar plates at 37 C overnight and the next day the blue-white screening method was used to select all white colonies present on each plate from each population. Plasmids with the correct DNA insert were identified by PCR using the primers M13-F (50 -GTT-TTC-CCA-GTC- ACG-AC-30 ) and M13-R (50 -ACAGGA-AAC-AGC-TAT-GA-30 ). These PCR products were sequenced by Genomics Co., Taiwan. All sequences were compared with those of reference microorganisms from GenBank by BLAST search. The 16S rDNA sequences closest to the 16S rRNA sequences obtained from the bacteria identified during biodegradation were retrieved and all sequences were aligned using ClustalX. A phylogenetic tree was constructed by the neighbor-joining method using the program Molecular Evolutionary Genetics Analysis 5 (MEGA 5.1 Beta 3). Bootstrap values of >1500 (from 5000 replicates) are indicated at the nodes within the phylogenic analysis. 2.6. Detection of the presence of genes involved in MC-LR biodegradation during aerobic biodegradation Genomic DNA samples were analyzed in order to detect the
3
presence of the mlr gene cluster; this cluster encodes proteins that are known to be involved in the aerobic biodegradation of MC-LR. Table 1 shows the primer sequence pairs used in this part of the study to detect the presence of the MC-LR biodegradation genes; the gene cluster analyzed consists of four genes, mlrA, mlrB, mlrC and mlrD. 3. Results 3.1. MC-LR biodegradation Fig. 1 shows the ppm-level concentrations of MC-LR that can be biodegraded effectively by the indigenous bacterial mixed culture. The concentration of MC-LR was degraded effectively decreased from 4546 mg L1 to 0.324 mg L1 over 16 days. The removal efficiency of MC-LR achieved by the mixed culture was 99.99%. The residual MC-LR was below the 1 mg L1 level that is the WHO recommended standard for drinking water. The concentration of MCLR was found to decrease slowly from 6262 mg L1 to 2514 mg L1 in the control experiments, which might possibly be ascribed to abiotic losses in the aerobic microcosm system; the mechanisms that bring this about could include both physical and chemical decomposition, namely for example photolysis and adsorption. The biodegradation rate of persistent organic pollutants (POPs) can normally be fitted to a pseudo-first-order equation (Chou et al., 2016). The overall first-order rate constant for MC-LR biodegradation was calculated to be 597 mg L1day1. Moreover, the MC-LR biodegradation process can be divided into two stages with different rate constants. The first-stage rate constant for initial 4 days (0e4 days) was calculated to be 876 mg L1day1, while the second stage rate constant for the last 12 days (5e16 days) was calculated to be 504 mg L1day1. 3.2. Changes in the biodiversity and identification of the bacterial species present Fig. 2 shows the fluctuated DGGE profile of the microbial community during the MC-LR biodegradation. Each band on the DGGE profile represents one bacterial species and based on these results some bacterial species can be found to be consistently present throughout the biodegradation. For example, six specific bands on day 4, four specific bands on day 7, five specific bands on day 10, five specific bands on day 13 and four bands on day 16 can be identified consistently by comparing all DGGE bands in the experiments. Overall, a total of four patterns seemed to be present during MC-LR biodegradation and these can be summarized as following: (1) the three red-marked bands appeared as the process starts and these disappeared during the middle period (day 4, day 7 and day 10), but then reappeared at the end of the process (day 13 and day 16); (2) the three light-blue-mark bands appeared as the process starts and these disappeared during the end period (day 13 and day 16); (3) one dark-blue-mark band appears in all samples except for day 10; and (4) one green-mark band appears in all samples except day 16. The richness biodiversity indices (RI) for day 0, 4, 7, 10, 13, and 16 were measured as 14, 12, 8, 13, 12, and 9, respectively. The same trend can be seen for the Shannon-Wiener Diversity Index (SWI), with day 0, 4, 7, 10, 13, and 16 being measured as 0.2058, 0.1765, 0.1176, 0.1912, 0.1765, and 0.1324, respectively. Table 2 shows the bacterial species identified from the DGGE profile. Fig. 3 shows the phylogenetic tree of the MC-LR-biodegrading species. Alphaproteobacteria and gamma-proteobacteria dominate the bacterial community. Specifically, a species very similar to Hyphomicrobium aestuarii (DGGE Band No. 1-5, similarity 99%), a Sphingomonas sp. (DGGE Band No. 2-2, similarity 98%), a Sphingobium sp. (DGGE Band No. 3-1, similarity 98%), a Pseudoxanthomonas sp. (DGGE Band No.
Please cite this article in press as: Tsao, S., et al., Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan, International Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.04.011
4
S. Tsao et al. / International Biodeterioration & Biodegradation xxx (2017) 1e8 Table 1 Detection of functional genes involved in MC-LR biodegradation by PCR in this study. Primers
Sequences (30 -50 )
Reference
mlrA
MF2: GACCCGATGTTCAAGATACT mlrAR: TTAATCTTCATGCTGCTAGGAGC mlrBF: CGACGATGAGATACTGTCC mlrBR: CGTGCGGACTACTGTTGG mlrCF: TCCCCGAAACCGATTCTCCA mlrCR: CCGGCTCACTGATCCAAGGCT mlrDF: GTTCCTCGGCTAGCCT mlrDR: GCGACGA AGATCGTTGCT
(Saito et al., 2003; Chen et al., 2010)
mlrB mlrC mlrD
(Ho et al., 2007) (Ho et al., 2007) (Ho et al., 2007)
Fig. 1. Biodegradation of MC-LR by a bacterial mixed culture: (a) concentration range from 0 to 6000 mg L1 on the Y-axis with day 0 to day 16 on the X axis; (b) concentration range from 0 to 140 mg L1on the Y-axis with day 4 to day 16 on the X axis. The concentration of MC-LR was almost the same in the duplicate experiments; the standard deviation obtained by statistical analysis was ignored.
4-2, similarity 89%), an Acinetobacter sp. (DGGE Band No. 4-1-2, similarity 93%), a Steroidobacter sp. (DGGE Band No. 4-3, similarity 97%), and a Rhizobium sp. (DGGE Band No. 6-2, similarity 98%) were found to be present during the aerobic biodegradation of MC-LR.
enzyme, which has been identified as a putative oligopeptide transporter, and is encoded by the mlrD, is thought to be involved in the uptake of MC-LR into the bacterial cell. 4. Discussion
3.3. Functional genes present during MC-LR biodegradation 4.1. Two-stages of rate constant during the MC-LR biodegradation Figure 4 shows the presence of the 5.8 kb mlr gene cluster, which consists of mlrA, mlrB, mlrC and mlrD; this cluster is thought to be involved in the aerobic biodegradation of AMC-LR by a Sphingomonas sp. The genes mlrB and mlrC were clearly detected. A putative serine peptidase 2, MlrB, is encoded by the mlrB gene, and is thought to catalyze hydrolysis at the Ala-Leu peptide bond in linearized MC-LR. A putative metalloprotease 3, MlrC, is encoded by the mlrC gene and is thought to catalyze further hydrolysis of MCLR into smaller peptides and then into amino acids. By way of contrast, the mlrA and mlrD genes, were not detected in the microcosms during this study. The MlrA enzyme, which has been identified as a putative metalloprotease (microcystinase and is encoded by mlrA), is believed to catalyze the hydrolysis and opening of the ring at the Adda-Arg peptide bond. The MlrD
Two-stages of rate constant for the MC-LR biodegradation occurred during this investigation. MC-LR biodegradation during the first stage (0e4 days, k ¼ 876 mg L1 day1) was noticeably faster than during the second stage (5e16 days, k ¼ 504 mg L1 day1). The same trend in terms of a two-stage biodegradation was identified when Sphingomonas isolate NV-3 stain was used as sole carbon source for the biodegradation of MC-LR at the organism's optimal temperature (30 C) and at the optimal concentration of MC-LR (25 mg mL1) (Somdee et al., 2013). The rate of MC-LR biodegradation seems to be affected by interactions between various biometabolites present and the MC-LR concentration in the aerobic microcosms during the present study. If we examine the bacterial community, the bacterial mixed culture during the first
Please cite this article in press as: Tsao, S., et al., Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan, International Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.04.011
S. Tsao et al. / International Biodeterioration & Biodegradation xxx (2017) 1e8
5
The RI therefore during this period began to increase from 8 on the 7th day reaching 13 on the 16th day. These findings imply that, while MC-LR is biodegraded by various specific bacterial species, the mineralization of the MC-LR breakdown products would seem to require a different group of bacterial species. As a whole, this results in a two stage process. 4.2. Identified bacterial species present during the MC-LR biodegradation in the aerobic microcosms
Fig. 2. The 16S rDNA DGGE profiles obtained using DNA extracted from the samples at various times during the MC-LR biodegradation. N ¼ negative control; Well numbers 1, 2, 3, 4, 5, and 6 contain the amplified DNA from samples collected on the 0th, 4th, 7th, 10th, 13th, and 16th days, respectively; Bands number. 1, 2, 3, 4, 5, and 6 were used for bacterial species identification.
stage was the same that obtained during the bacterial isolation. This specific bacterial mixed culture is able to produce a number of mlr enzymes that allow the degradation of MC-LR. However, it should be noted that the RI decreased from 14 at time zero to 8 on the 7th day when ppm-levels of MC-LR are being utilized as the sole carbon source. Once the concentration of MC-LR had decreased to the ppb level (mg L1), more species of bacteria are present in the mixed culture and these would seem to be utilizing all of the possibly less toxic biometabolites that are now present in the medium. These will include linear MC-LR, various tetrapeptides and a number of smaller peptides, all of which can act as carbon sources.
The dominant bacteria present in the bacterial mixed culture during aerobic MC-LR biodegradation were identified. Members of the genus Sphingomonas, which were present throughout the microcosms during this study, have been reported to degrade various different types of MC using various different groups of intracellular hydrolytic enzymes. For example, 20 mg L1 MC-LR and MC-RR have been shown to be biodegraded by Sphingomonas sp. Y2 with the highest rates being 13 and 5.4 mg L1 day1, respectively (Park et al., 2001). A Sphingomonas sp. CBA4 isolate was capable of degrading completely 200 mg L1 MC-RR within 36 h (Valeria et al., 2006). Similarly, Sphingomonas sp. NV3 was able to biodegrade a 25 mg mL1 mixture of [Dha7] MC-LR and MC-LR at a maximum rate of 8.33 mg mL1 day1 (Somdee et al., 2013). Sphingobium sp. commonly isolated from soil was found to be able to degrade aromatic and chloroaromatic compounds, phenols, herbicides and polycyclic aromatic hydrocarbons. An Acinetobacter sp. was also identified as present during MC-LR biodegradation in our microcosms. Interestingly, this genus has been reported to be able to control the growth of Microcystis aeruginosa and to biodegrade MCs. Specifically, when a 10% (v/v) of Acinetobacter guillouiae A2 was co-incubated with M. aeruginosa then the algaecide compound 4-hydroxyphenethylamine was generated; the algaecide efficiency reached 91.6% after 7 days (Yi et al., 2015). Furthermore, Acinetobacter sp. WC-5 has been shown to remove 100% of 171.84 mg mL1 MC-LR by day 6. When the concentration of MC-LR was increased to 1025.76 mg mL1, the WC-5 strain was still able to remove 92.73% of the MC-LR by day 18 (Li and Pan, 2014). Furthermore, Rhizobium spp. seem to play an important role in the degrading MC and members of this genus were also identified in the microcosms during this study. Rhizobium gallicum DC7 was isolated from a bacterial consortium that was able to degrade MC (0.25 mg mL1) in freshwater from Florida (Ramani et al., 2012). A novel isolate, Rhizobium sp. TH, was found to degrade MC-LR; this was the first alphaproteobacteria other than Sphingomonadales found to be able to degrade MCs and it was able to biodegrade 8.3 mg L1 MC-LR under near-natural conditions at 30 C (Zhu et al., 2016). Moreover, the presence of MC-tolerant Rhizobium sp. has been shown to protect Faba bean plants (Vicia faba) and improve nitrogen metabolism if the plants are being irrigated with water polluted containing 100 mg L1 MC (Lahrouni et al., 2016). Pseudoxanthomonas spp. of the gamma proteobacteria have been found to be prominently represented in the rhizosphere of aquatic plants (Medicago sativa) if their roots are exposed to an algal
Table 2 Bacterial species present during MC-LR biodegradation identified based on their 16S rDNA sequences obtained from the bands isolated from the DGGE profiles. DGGE Band No.
Bacterial species
Similarity (%)
NCBI Gen Bank No.
1e5 2e2 3e1 4-1-2 4e2 4e3 6e2
Hyphomicrobium aestuarii Sphingomonas sp. Sphingobium sp. Acinetobacter sp. Pseudoxanthomonas sp. Steroidobacter flavus Rhizobium sp.
99% 98% 98% 93% 89% 97% 98%
NR104954.1 KF681175.1 KM253072.1 KM021049.1 LC065211.1 KU195414.1 JQ316287.1
Please cite this article in press as: Tsao, S., et al., Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan, International Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.04.011
6
S. Tsao et al. / International Biodeterioration & Biodegradation xxx (2017) 1e8
Fig. 3. A phylogenetic tree of the cloned 16S rRNA sequences obtained from the bacterial populations present during MC-LR biodegradation.
bloom that was extracted from a waterbody containing MCs (Khalloufi et al., 2016). A bacterial strain EMS, with the capability of degrading MC-LR/MC-RR, was isolated from Lake Taihu, China; this was part of a big cluster of genera, Stenotrophomonas, Pseudoxanthomonas and Xanthomonas, associated with MC degradation (Chen et al., 2010). Among the other bacteria of interest related to those isolated during the present study, it is known that Hyphomicrobium aestuarii is able to degrade POPs, including methamidophos (Wang et al., 2010), dichloromethane (Layton et al., 2000), chlortetracycline (Zheng et al., 2016) and fluoranthene (Zhao et al., 2016), while Steroidobacter flavus is a Gram negative rod-shaped non-endospore-forming bacterium that is motile and has a polar flagellum. S. flavus has been reported to be a microcystin-degrading Gammaproteobacterium, having been isolated from forest soil collected on Hainan Island in the south of the People's Republic of China (Gong et al., 2016). 4.3. The presence of genes from the mlr cluster in the genomes of microorganisms involved in MC-LR biodegradation The mlr gene cluster, which consists of mlrA, mlrB, mlrC and mlrD, has been identified as involved in the enzymatic biodegradation of MC-LR by Sphingomonas sp. (Bourne et al., 2001). MlrA is the key enzyme that catalyzes the initial hydrolytic cleavage of the cyclic MC structure (ring-opening at the Adda-Arg peptide bond); this generates linearized MC (NH2-Adda-Glu-Mdha-Ala-LeuMeAsp-Arg-OH). MlrA is a neutral protease with optimal pH of 7.6 and a half-saturation constant in the micromolar range. In this study, the presence of mlrA genes was initially monitored at the DNA level during the isolation process of MC-LR biodegrading mixed culture (data not shown) and the results for the presence of mlrA during this phase of MC-LR biodegradation was consistently negative. Possible reasons for this include the following. (1) mlrA genes seem to occur in a specific group of closely related species with the ability to remove MCs (Manage et al., 2009) and in previous studies the biodegradation of MC-LR by MlrA has been directly linked to the presence of specific alphaproteobacteria, namely Sphingomonas spp. The lack of a mlrA signal may indicate that species other than Sphingomonas are involved in the initial step of MC-LR removal in our system and that linearization occurs via an unknown mechanism. (2) In our system the population of Sphingomonas spp. that are present in our indigenous bacterial mixed culture might be quite small and this would make detection of the mlrA gene during MC-LR biodegradation difficult. (3) The cyclic structure of MC-LR is known to be able to be linearized by other genera bacteria. A previous study has indicated that, while the
alpha-proteobacterial MC-degradation pathway seems to have evolved by vertical evolution (Zhu et al., 2016), the betaproteobacterial and gamma-proteobacterial MC-degradation pathways seem to have evolved by horizontal gene transfer from the alpha-proteobacteria. After ring breakage, the linear MC-LR is then sequentially hydrolyzed into peptides by enzymes encoded by the mlrB and mlrC genes; these initially produce a tetrapeptide (Glu-Mdha-Ala-LeuMeAsp-Arg-OH) and then smaller peptides. Recently, the MlrB and MlrC enzymes have been proposed to play an important role in a novel biochemical pathway involved in MC-LR biodegradation (Dziga et al., 2016). Two byproducts, linearized MC and the heptapeptide, were obtained from bacterial strains possessing the mlr cluster and MlrB activity. First, MlrB seems to linearize MC. Secondly, the linearized MC can independently be hydrolyzed by MlrB at the peptide bond between Adda and Glu, resulting in Adda and heptapeptides as metabolites. The heptapeptides can then be decomposed by MlrC into smaller peptides and amino acids. In this study, the presence of a strong positive signal for mlr B and mlrC seems to support the idea of two different pathways for MC-LR biodegradation with the major pathway in our system involving only mlrB and mlrC. This is supported by the absence of signals for mlrA and mlrD. In the absence of mlrD, how MC-LR enters the bacterial cell remains open; it is possible that these enzymes are extracellular in our system. Finally, the dominant species of MC-degrading bacteria, as well as other non-MC-degrading bacteria, may then use the various byproducts, including the linearized heptapeptides, Adda tetra peptides, etc., as carbon/nitrogen sources. The potential novel pathway for MC-LR biodegradation outlined above will require further in-depth research, including studies aimed at identifying the presence of the various proposed byproducts during the MC-LR biodegradation as well as attempts to pinpoint the various enzymes involved in the different steps. 5. Conclusion Concentrations of MC-LR at the ppm-level were successfully biodegraded by a bacterial mixed culture newly isolated in Taiwan. A two-stage rate constant profile for the MC-LR biodegradation was identified. The first stage of the MC-LR biodegradation proceeds significantly faster than the second stage. The interaction between the concentration of MC-LR present in the culture and the biometabolites produced during MC-LR biodegradation seem to bring about changes in the bacterial community. The dominant bacterial species include Sphingomonas spp., Sphingobium spp., Rhizobium
Please cite this article in press as: Tsao, S., et al., Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan, International Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.04.011
S. Tsao et al. / International Biodeterioration & Biodegradation xxx (2017) 1e8
7
Fig. 4. The presence of functional genes related to MC-LR biodegradation (a) mlr A; (b) mlr B; (c) mlr C; (d) mlr D. Well number 1 ¼ marker; number 2 ¼ negative control; numbers 3, 4, 5, 6, 7 and 8 show the samples collected on the 0th, 4th, 7th, 10th, 13th, and 16th days, respectively.
spp., and Hyphomicrobium spp. and these were selected out of the bacterial population present in eutrophicated water bodies in Taiwan. These species are able to degrade MC-LR under the culture conditions used here. Strong signals for the presence of mlrB and mlrC were detected in the microcosm and it seems likely that these genes can be used as biomarkers for the biodegradation of MC-LR when monitoring reservoirs in Taiwan. Although these findings are preliminary and only involve laboratory scale experiments, the practical application of this process to the aerobic large-scale biodegradation of MC-LR warrants future investigation. Conflict of interests The authors declare no conflict of interests regarding the publication of this paper.
Acknowledgements This work was supported by a MOST (previously called an NSC) project NSC97-2221-E-008-028-MY3. Part of the results/discussion was presented at the 9th International Conference on Challenges in Environmental Science & Engineering (CESE-2016) in 2016. References Bell, S.G., Codd, G.A., 1994. Cyanobacterial toxins and human health. Rev. Med. Microbiol. 5, 256e264. Bourne, D.G., Riddles, P., Jones, G.J., Smith, W., Blakeley, R.L., 2001. Characterisation of a gene cluster involved in bacterial degradation of the cyanobacterial toxin microcystin LR. Environ. Toxicol. 16, 523e534. Bourne, D.G., Blakeley, R.L., Riddles, P., Jonesa, G.J., 2006. Biodegradation of the cyanobacterial toxin microcystin LR in natural water and biologically active slow sand filters. Water Res. 40, 1294e1302.
Please cite this article in press as: Tsao, S., et al., Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan, International Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.04.011
8
S. Tsao et al. / International Biodeterioration & Biodegradation xxx (2017) 1e8
Chen, J., Hu, L.B., Zhou, W., Yan, S.H., Yang, J.D., Xue, Y.F., Shi, Z.Q., 2010. Degradation of microcystin-LR and RR by a Stenotrophomonas sp. strain EMS isolated from Lake Taihu, China. Int. J. Mol. Sci. 11, 896e911. Chou, H.-L., Hwa, M.-Y., Lee, Y.-C., Chang, Y.-J., Chang, Y.-T., 2016. Microbial degradation of decabromodiphenyl ether (DBDE) in soil slurry microcosms. Environ. Sci. Pollut. Res. Int. 23, 5255e5267. Chudobova, D., Cihalova, K., Guran, R., Dostalova, S., Smerkova, K., Vesely, R., Crettaz-Minaglia, M.C., Andrinolo, D., Giannuzzi, L., 2015. Review: advances in microbiological degradation of microcystins. In: Davison, D. (Ed.), Cyanobacteria. Nova Science Publishers, Inc.. ISBN: 978-1-61470-925-1. Crettaz-Minaglia, M.C., Andrinolo, D., Giannuzzi, L., 2015. Review: advances in microbiological degradation of microcystins. In: Davison, D. (Ed.), Cyanobacteria. Nova Science Publishers, Inc., ISBN 978-1-61470-925-1 Dziga, D., Zielinska, G., Wladyka, B., Bochenska, O., Maksylewicz, A., Strzalka, W., Meriluoto, J., 2016. Characterization of enzymatic activity of MlrB and mlrC proteins involved in batreial degradation of cyanotoxins microcystins. Toxins (Basel) 8, 76. http://dx.doi.org/10.3390/toxins8030076. Gagala, H., Mankiewiez-Boczek, J., 2012. The natural degradation of microcystins (cyanobacterial hepatotoxins) in fresh water-the future of modern treatment systems and water quality imorvement. Pol. J. Environ. Stud. 21, 1125e1139. Gong, Z.L., Zhang, C.F., Jin, R., Zhang, Y.Q., 2016. Steroidobacter flavus sp. nov., a microcystin-degrading Gammaproteobacterium isolated from soil. Ant. Van Leeuwenhoek 109, 1073e1079. Ho, L., Hoefel, D., Saint, C.P., Newcombe, G., 2007. Isolation and identification of a novel microcystin-degrading bacterium from a biological sand filter. Water Res. 41, 4685e4695. Khalloufi, F.E., Oufdou, K., Bertrand, M., Lahrouni, M., Oudra, B., Ortet, P., Barakat, M., Heulin, T., Achouak, W., 2016. Microbiote shift in the Medicago sativa rhizosphere in response to cyanotoxins extract exposure. Sci. Total Environ. 539, 135e142. €ttfert, M., Lahrouni, M., Oufdou, K., El Khalloufi, F., Benidire, L., Albert, S., Go Caviedes, M.A., Rodriguez-Llorente, I.D., Oudra, B., Pajuelo, E., 2016. Microcystin-tolerant Rhizobium protects plants and improves nitrogen assimilation in Vicia faba irrigated with microcystin-containing waters. Environ. Sci. Pollut. Res. 23, 10037e10049. Layton, A.C., Karanth, P.N., Lajoie, C.A., Meyers, A.J., Gregory, I.R., Stapleton, R.D., Taylor, D.E., Sayler, G.S., 2000. Quantification of Hyphomicrobium populations in activated sludge from an industrial wastewater treatment system as determined by 16S rRNA analysis. Appl. Environ. Microbiol. 66, 1167e1174. Lee, T.-H., Chen, Y.-M., Chou, H.-N., 1998. First report of microcystins in Tawian. Toxicon 36, 247e255. Li, H., Pan, G., 2014. Enhanced and continued degradation of microcystins using microorganisms obtained through natural media. J. Microbiol. Methods 96, 73e80. Liu, I., Lawton, L.A., Bahnemann, D.W., Liu, L., Proft, B., Robertson, P.K., 2009. The photocatalytic decomposition of microcystin-LR using selected titanium dioxide materials. Chemosphere 76, 549e553. Liu, Y., Ren, J., Wang, X., Fan, Z., 2016. Mechanism and reaction pathways for microcystin LR degradation through UV/H2O2 treatment. PLoS One 11, e0156236. http://dx.doi.org/10.1371/journal.pone.0156236. Manage, P.M., Edwards, C., Singh, B.K., Lawton, L.A., 2009. Isolation and
identification of novel microcystin-degrading bacteria. Appl. Environ. Microbiol. 75, 6924e6928. Munusamy, T., Hu, Y.-L., Lee, J.-F., 2012. Adsorption and photodegradation of microcystin-LR onto sediments collected from reservoirs and rivers in Taiwan: a laboratory study to investigate the fate, transfer, and degradation of microcystin-LR. Environ. Sci. Pollut. Res. 19, 2390e2399. Muyzer, G., de Waal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59, 695e700. Park, H.D., Sasaki, Y., Maruyama, T., Yanagisawa, E., Hiraishi, A., Kato, K., 2001. Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake. Environ. Toxicol. 16, 337e343. Ramani, A., Rein, K., Shetty, K.G., Jayachandran, K., 2012. Microbial degradation of microcystin in Florida's freshwaters. Biodegradation 23, 35e45. Saito, T., Okano, K., Park, H.-D., Itayama, T., Inamori, Y., Neilan, B.A., Burns, B.P., Sugiura, N., 2003. Detection and sequencing of the microcystin LR-degrading gene, mlrA, from new bacteria isolated from Japanese lakes. FEMS Microbiol. Lett. 229, 271e276. Somdee, T., Peekan, A., Somdee, A., 2013. Bacterial degradation of microcystins within a biologically active sand filter. J. Life Sci. Technol. 1, 147e149. Valeria, A.M., Ricardo, E.J., Stephan, P., Alberto, W.D., 2006. Degradation of microcystin-RR by Sphingomonas sp. CBA4 isolated from San Roque reservoir rdoba - Argentina). Biodegradation 17, 447e455. (Co Wang, L., Wen, Y., Guo, X., Wang, G., Li, S., Jiang, J., 2010. Degradation of methamidophos by Hyphomicrobium species MAP-1 and the biochemical degradation pathway. Biodegradation 21, 513e523. Wu, J.-T., Kow, L.-C., 2010. Alteration of phytoplankton assemblages caused by changes in water hardness in Feitsui Reservoir. Taiwan. Bot. Stud. 51, 521e529. Yen, H., Lin, T., Tseng, I., Tung, S., Hsu, M., 2007. Correlating 2-MIB and microcystin concentrations with environmental parameters in two reservoirs in south Taiwan. Water Sci. Technol. 55, 33e41. Yen, H.-K., Lin, T.-F., Tseng, I.-C., 2012. Detection and quantification of major toxigenic microcystis genotypes in Moo-Tan reservoir and associated water treatment plant. J. Environ. Monit. 14, 687e696. Yi, Y.L., Yu, X.B., Zhang, C., Wang, G.X., 2015. Growth inhibition and microcystin degradation effects of Acinetobacter guillouiae A2 on Microcystis aeruginosa. Res. Microbiol. 166, 93e101. Zhao, J.K., Li, X.M., Ai, G.M., Deng, Y., Liu, S.J., Jiang, C.Y., 2016. Reconstruction of metabolic networks in a fluoranthene-degrading enrichments from polycyclic aromatic hydrocarbon polluted soil. J. Hazard. Mater 318, 90e98. Zheng, D., Chang, Q., Gao, M., She, Z., Jin, C., Guo, L., Zhao, Y., Wang, S., Wang, X., 2016. Performance evaluation and microbial community of a sequencing batch biofilm reactor (SBBR) treating mariculture wastewater at different chlortetracycline concentrations. J. Environ. Manage. 182, 496e504. Zhu, X., Shen, Y., Chen, X., Hu, Y.O.O., Xiang, H., Tao, J., Ling, Y., 2016. Biodegradation mechanism of microcystin-LR by a novel isolate of Rhizobium sp. TH and the evolutionary origin of the mlrA gene. Int. Biodeterior. Biodegr. 115, 17e25. Zurawell, R.W., Chen, H., Burke, J.M., Prepas, E.E., 2005. Hepatotoxic cyanobacteria: a review of the biological importance of microcystins in freshwater environments. J. Toxicol. Environ. Health B Crit. Rev. 8, 1e37.
Please cite this article in press as: Tsao, S., et al., Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan, International Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.04.011
Contents lists available at ScienceDirect
International Biodeterioration & Biodegradation journal homepage: www.elsevier.com/locate/ibiod
Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan Sha Tsao a, Da-Jiun Wei a, Yi-Tang Chang a, *, Jiunn-Fwu Lee b, ** a b
Department of Microbiology, Soochow University, 70, LinXi Rd., Shinlin Dist., Taipei, 11102, Taiwan Graduate Institute of Environmental Engineering, National Central University, 300, Zhongda Rd., Zhongli Dist., Taoyuan City, 32001, Taiwan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 13 February 2017 Received in revised form 16 April 2017 Accepted 16 April 2017 Available online xxx
Microcystins (MCs) are commonly found in eutrophicated waterbodies such as lakes, ponds and reservoirs. MCs are hepatotoxins and create a high risk of liver tumors and cancer when MC-polluted water is drunk. Since MC-polluted waterbodies can form a normal part of many drinkiing water system, aggressive treatment to remove MC-LR type compounds has become an important issue worldwide. The objective of this study was to develop a method for the removal of high concentrations of MC-LRs (ppm level) by biodegradation using an indigious bacterial mixed culture isolated in Tawian. Using this culturebased biodegradation system, MC-LR removal of >99% is able to be achieved with the final concentration of MC-LR being measured to be 0.324 mg L1 after 16 days. The pseudo-first rate constant of the MC-LR biodegradation was 876 mg L1 day1 during the first 4 days. The bacterial biodiversity during biodegradation was found to decrease during the first stage (Day 0e4) and then increased again during the second stage (Day 5e16), based on the Richness Index and Shannon-Wiener Diversity Index. The bacterial species identified in the mixed culture included Sphingomonas spp., Pseudoxanthomonas spp., Hyphomicrobium aestuarii, Sphingobium spp., Rhizobium spp., Steroidobacter spp. and Acinetobacter spp, all of which seem to. play important roles in MC-LR biodegradation. The genes mlrB and mlrC, which encodes proteins involved in various aspects of MC-LR biodegradation, were found to be present in the mixed cultures and are capable of being used as a biomarker for the MC-LR biodegradation process in Taiwanese reservoirs. © 2017 Elsevier Ltd. All rights reserved.
Keywords: Microcystin Richness Index Shannon-Wiener Diversity Index mlrB mlrC Biomarker
1. Introduction Increasingly, eutrophication has becomes a serious problem due to the intensification of agriculture and this has generated the widespread occurrence of cyanobacterial blooms in natural lakes and human constructed reservoirs. Global climate change is also contributing to this as water temperatures rise and severe droughts occur. The result of the above changes has been massive cyanobacterial booms in many water bodies that have previously been free of such a problem. Cyanobacteria in fresh water, even when killed, can release a number of toxins, including a family of hepatotoxic cyclic heaptpeptides, the microcystins (MCs). MCs are among the most frequently observed toxins in the world (Zurawell
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected], [email protected] (Y.-T. Chang), jfl[email protected] (J.-F. Lee).
et al., 2005). The structure of MCs has been defined as cyclo-(-DAla-X-D-MeAsp-Y-Adda-D- Glu-Mdha), where X and Y are variable amino acids. Generally, X is one of the following L-amino acids, leucine (L), arginine (R), tyrosine (Y), tryptophan (W), or phenylalanine (F), while Y is one of the following L-amino acids, arginine (R), alanine (A), or methionine (M). Due to the two variable amino acids, as well as methylation/demethylation of the other amino acids, more than a hundred MCs have been identified to date. An unusual B-amino acid (3-amino-9-methoxy-10-phenyl-2, 3, 8trimethyl-deca-4,6-dienoic acid, which is called “Adda”) is found in MCs and contributes to their toxicity. Many algal genera, including Microcysits, Anabaena, Oscilator, Nostoc, Chroococcus, Planktothrix, Aphanizomenou, Melosira, etc., are able to produce MCs in fresh and brackish waters (Gagala and Mankiewiez-Boczek, 2012). One of the most commonly occurring MCs is the MC-LR, which has as the X and Y amino acids, leucine and arginine, respectively; this MC is highly toxic. In Taiwan, many nutrientscontaining effluents are discharged into reservoirs that serve as resources for drinking water and these events can give rise to major
http://dx.doi.org/10.1016/j.ibiod.2017.04.011 0964-8305/© 2017 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Tsao, S., et al., Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan, International Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.04.011
2
S. Tsao et al. / International Biodeterioration & Biodegradation xxx (2017) 1e8
cyanobacterial blooms. For example, four dominant Microcysits spp. were recorded in the Feitsui Reservoir between 1997 and 2005 (Wu and Kow, 2010), while the Moo-Tan Reservoir and the Tseng-Wen Reservoir have been measured as having MC-LR present in their waters in the range 0.12e2.4 mg L1. Toxigenic Microcystis spp. in reservoirs have been reported to be able to penetrate the water supply treatment process in Taiwan (Yen et al., 2007, 2012). The high risk to mammalian health when there is exposure to drinking water contaminated with MC-LR has been widely reported. MC-LR can affect the kidneys, the gastrointestinal tract and the colon and cause a wide range of illnesses including allergy, nausea, vomiting, fever, and gastroenteritis (Gagala and Mankiewiez-Boczek, 2012). At the biomolecular level, MC-LR is a potential tumor promoter and is able to target the liver where it inhibits various serine/threonine specific protein phosphatases such as PP-1, PP-2A, PPP4 and PPP5 in the cytoplasm of liver cells causing serious damage. Tumors of the liver and gastrointestinal tract are increased when humans are in contact with MC-LR for a long time (Bell and Codd, 1994; Zurawell et al., 2005). MC-LR is classified as possibly carcinogenic in humans (Group 2B) by the International Agency for Research on Cancer (IARC). To avoid adverse health effects affecting individuals, the World Health Origination (WHO) has proposed a guideline for drinking water, namely that the maximum concentration allowable is 1 ìg L1 MCL. Many traditional methods are available to control cyanobacterial blooms and to reduce the presence of MC-LR. However, these treatment processes are not efficient at removing all types of MCs and thus in some cases the output still poses a potential risk to human health when used for drinking water. For example, 20% MCLR residues (ppb level) have been measured in a drinking water system after slow sand filtration (Bourne et al., 2006). In a previous study we have shown that MC-LR degradation can be brought about using a photocatalytic irradiation system at 254 UVA nm, which was able to reduce the concentration of MC-LR from 1500 mg L1 to below 150 mg L1 within 60 min (Munusamy et al., 2012). Recently, an advanced treatment approach that combined a number of different processes for MC-LR removal has been developed. A TiO2 photocatalytic decomposition system was used to treat 350 ng mL1 MC-LR and it was found to be able to degrade 90% of the MC-LR present within 25 min (Liu et al., 2009). In addition, a combined UV/H2O2 system has been shown to be able to degrade MC-LR efficiently; in this system the major degradation pathways that affect MC-LR are initiated by OH attack on the benzene ring and on the diene of the Adda side chain (Liu et al., 2016). When these above-mentioned processes are combined they are able to destroy the structure of MC-LR in a short time, but such approaches to potable water treatment require the development of sophisticated techniques when used on the large scale needed for a drinking water system. MC biodegradation is an easy and cost-effective treatment when used to treat drinking water compared to any of the conventional physical/chemical methods. Biological methods of MCs removal, such as aerobic biodegradation of MC by a single isolated bacterial species, have being widely investigated. A large group of Spingomonas spp. and Sphingopyxis spp. have been identified as having significant ability to biodegrade MCs (Crettaz-Minaglia et al., 2015). In practice, however, using pure bacterial stains for MC removal from polluted reservoirs or lakes is difficult. The activity of pure stains can easily decrease and disappear because there are complicated interactions between the various bacterial species present in a nutrient-rich environment. Little information is available on the biodegradation of MCs by bacterial mixed cultures in either natural surface water or in drinking water supplying systems. The objective of this study is to isolate an indigenous bacterial
mixed culture that is capable of biodegrading the MC-LR present in the polluted reservoirs of Taiwan. The experiments exploring MCLR biodegradation were executed at ppm-level concentrations. The changes in the bacterial community and in dominant species present in the system were measured by denaturing gradient gel electrophoresis (DGGE) and cloning, respectively. The presence of functionally representative genes that encode proteins involved in the MC-LR biodegradation process were also measured during MCLR biodegradation. Our findings suggest that an effective biological treatment process can be designed that will be capable of carrying out the full-scale aerobic biodegradation of the MCs present in the water from Taiwan's eutrophicated reservoirs. 2. Materials and methods 2.1. Chemicals MC-LR (C49H74N10O12, FW ¼ 995.2) was obtained from the Biorich Biotechnology Co., Ltd. Taiwan and had been extracted from a Microcystis aeruginosa TY-1 isolated in Taiwan. The extraction and isolation procedure for MC-LR followed the approach described in a previous study (Lee et al., 1998). The purity of the MC-LR was greater than 95% as determined by HPLC. Deionized distilled water was used to prepare all solutions and all media. All other chemicals in this study were of analytical grade. 2.2. Microorganisms The bacterial mixed culture was obtained by collecting MCpolluted surface water from the Shi-Men Reservoir (24 480 41.000 N 12115015.900 E), Taoyuan City, Taiwan, and mixing it with a similar sample obtained from the Bao-shan II Reservoir (2400 440 35.500 N 121020 44.400 E), Hsinchu County, in a ratio 1/1 v/v. The method of sampling the bacterial mixed culture followed the procedure outlined in the Taiwan EPA standard method NIEA W104.51C. A bacterial mixed culture capable of biodegrading MC-LR was obtained by aerobically incubating this culture with 5 mg L1 MC-LR dissolved in B11 medium in a dark reactor at room temperature for 3 months. The B11 medium contained per liter the following 0.690 g MgSO4, 0.500 g KH2PO4, 4.000 g K2HPO4, 1.000 g NaCl, 20 mg CaCl2, 9.788 mg FeSO4 2H2O, 5.0 mg MnCl2 4H2O, 0.63 mg CuCl2 2H2O and 5.0 mg NH4Cl; the medium, including the MC-LR, sterilized using a 0.22 mm filter before use. During microbial acclimatization and enrichment, a half volume of the culture was discarded every two weeks and the culture refreshed with the same amount of 0.22 mmfiltered 5 mg L1 MC-LR B11 media in order to keep the volume constant. 2.3. MC-LR biodegradation experiments Batch biodegradation in aerobic microcosms was carried out in 150-mL Erlenmeyer flasks containing 0.25 mg MC-LR (dried base) dissolved in 50 mL 0.22 mm-filtered B11 media. At the beginning of experiments, a concentrated inoculum created by centrifugation of the contents of the dark reactor described in the previous paragraph (optical density at 600 nm of 1.82 ± 0.18, which is about 1106 CFU mL1 on nutrient agar, unpublished data) was added to the medium in the twelve Erlenmeyer flasks. The microcosms were incubated under aerobic conditions on a horizontal shaker (BenYng, E600L Incubator, Taiwan) set at 100 rpm; this was carried out at 30 C for 16 days in the dark. Each test condition was duplicated. The controls were carried out under the same conditions but without the addition of the inoculum. Samples for analysis were taken from each individual microcosm at the appropriate times, including a series of samples collected individually at the
Please cite this article in press as: Tsao, S., et al., Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan, International Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.04.011
S. Tsao et al. / International Biodeterioration & Biodegradation xxx (2017) 1e8
start of the experiments. After analysis the samples were sterilized and discarded. 2.4. MC-LR analysis The biodegradation experiments used a protein phosphatase inhibition assay and an ELISA test kit (Microcystins/Nodularins-DM ELISA kit, ABRAXIS®) to measure the congener-independent MC-LR toxin levels present in the experimental samples. The principle of the test kit involves a monoclonal antibody binding to the MCs and nodularins present and this allows the level of these toxins and their many congeners to be measured. The system does not crossreact with any other non-related toxins or compounds. Samples containing MC within the range 0.15e5 mg L1 were directly tested after 0.22 mm filtration and appropriate dilution using this assay system. 2.5. Analysis of the bacterial community present during MC-LR biodegradation 2.5.1. PCR-DGGE PCR-DGGE was used to measure the bacterial diversity during MC-LR biodegradation. DNA was extracted from aerobic microcosms using a Soil Genomic DNA Purification Kit (Gene Mark, Taiwan). Bacterial 16S rDNA was selectively amplified from the purified DNA by PCR using the V6-V8 region primers 968F and 1392R. The conditions for PCR amplification have been described previously (Muyzer et al., 1993). The purified DNA products (8 mg) were loaded onto an 8% denaturing gradient polyacrylamide linear porosity gradient gel with the denaturing gradient ranging from 30% to 80%. The electrophoresis used a Dcode system (Bio-Rad, USA) at 100 V for 16 h at 60 C and 1 Tris-acetate-EDTA (TAE) running buffer. 2.5.2. Phylogenetic tree analysis of the MC-LR biodegrading microorganisms Clone libraries were constructed after amplifying the full-length rRNA sequence (including the V1eV8 region) of the 16S rRNA gene using the forward and reverse primers: E9F and U1510R (Chudobova et al., 2015). Amplicons were purified from the bands separated by DGGE using an EasyPure PCR/Gel Extraction kit (Bioman, Taiwan). The clean products were then individually cloned using a pGEM-T Easy Vector Systems kit (Promega, Madison, Wisconsin, USA) and transformed into competent Escherichia coli DH5a cells as described by the manufacturer. The transformed E. coli was grown on LB agar plates at 37 C overnight and the next day the blue-white screening method was used to select all white colonies present on each plate from each population. Plasmids with the correct DNA insert were identified by PCR using the primers M13-F (50 -GTT-TTC-CCA-GTC- ACG-AC-30 ) and M13-R (50 -ACAGGA-AAC-AGC-TAT-GA-30 ). These PCR products were sequenced by Genomics Co., Taiwan. All sequences were compared with those of reference microorganisms from GenBank by BLAST search. The 16S rDNA sequences closest to the 16S rRNA sequences obtained from the bacteria identified during biodegradation were retrieved and all sequences were aligned using ClustalX. A phylogenetic tree was constructed by the neighbor-joining method using the program Molecular Evolutionary Genetics Analysis 5 (MEGA 5.1 Beta 3). Bootstrap values of >1500 (from 5000 replicates) are indicated at the nodes within the phylogenic analysis. 2.6. Detection of the presence of genes involved in MC-LR biodegradation during aerobic biodegradation Genomic DNA samples were analyzed in order to detect the
3
presence of the mlr gene cluster; this cluster encodes proteins that are known to be involved in the aerobic biodegradation of MC-LR. Table 1 shows the primer sequence pairs used in this part of the study to detect the presence of the MC-LR biodegradation genes; the gene cluster analyzed consists of four genes, mlrA, mlrB, mlrC and mlrD. 3. Results 3.1. MC-LR biodegradation Fig. 1 shows the ppm-level concentrations of MC-LR that can be biodegraded effectively by the indigenous bacterial mixed culture. The concentration of MC-LR was degraded effectively decreased from 4546 mg L1 to 0.324 mg L1 over 16 days. The removal efficiency of MC-LR achieved by the mixed culture was 99.99%. The residual MC-LR was below the 1 mg L1 level that is the WHO recommended standard for drinking water. The concentration of MCLR was found to decrease slowly from 6262 mg L1 to 2514 mg L1 in the control experiments, which might possibly be ascribed to abiotic losses in the aerobic microcosm system; the mechanisms that bring this about could include both physical and chemical decomposition, namely for example photolysis and adsorption. The biodegradation rate of persistent organic pollutants (POPs) can normally be fitted to a pseudo-first-order equation (Chou et al., 2016). The overall first-order rate constant for MC-LR biodegradation was calculated to be 597 mg L1day1. Moreover, the MC-LR biodegradation process can be divided into two stages with different rate constants. The first-stage rate constant for initial 4 days (0e4 days) was calculated to be 876 mg L1day1, while the second stage rate constant for the last 12 days (5e16 days) was calculated to be 504 mg L1day1. 3.2. Changes in the biodiversity and identification of the bacterial species present Fig. 2 shows the fluctuated DGGE profile of the microbial community during the MC-LR biodegradation. Each band on the DGGE profile represents one bacterial species and based on these results some bacterial species can be found to be consistently present throughout the biodegradation. For example, six specific bands on day 4, four specific bands on day 7, five specific bands on day 10, five specific bands on day 13 and four bands on day 16 can be identified consistently by comparing all DGGE bands in the experiments. Overall, a total of four patterns seemed to be present during MC-LR biodegradation and these can be summarized as following: (1) the three red-marked bands appeared as the process starts and these disappeared during the middle period (day 4, day 7 and day 10), but then reappeared at the end of the process (day 13 and day 16); (2) the three light-blue-mark bands appeared as the process starts and these disappeared during the end period (day 13 and day 16); (3) one dark-blue-mark band appears in all samples except for day 10; and (4) one green-mark band appears in all samples except day 16. The richness biodiversity indices (RI) for day 0, 4, 7, 10, 13, and 16 were measured as 14, 12, 8, 13, 12, and 9, respectively. The same trend can be seen for the Shannon-Wiener Diversity Index (SWI), with day 0, 4, 7, 10, 13, and 16 being measured as 0.2058, 0.1765, 0.1176, 0.1912, 0.1765, and 0.1324, respectively. Table 2 shows the bacterial species identified from the DGGE profile. Fig. 3 shows the phylogenetic tree of the MC-LR-biodegrading species. Alphaproteobacteria and gamma-proteobacteria dominate the bacterial community. Specifically, a species very similar to Hyphomicrobium aestuarii (DGGE Band No. 1-5, similarity 99%), a Sphingomonas sp. (DGGE Band No. 2-2, similarity 98%), a Sphingobium sp. (DGGE Band No. 3-1, similarity 98%), a Pseudoxanthomonas sp. (DGGE Band No.
Please cite this article in press as: Tsao, S., et al., Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan, International Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.04.011
4
S. Tsao et al. / International Biodeterioration & Biodegradation xxx (2017) 1e8 Table 1 Detection of functional genes involved in MC-LR biodegradation by PCR in this study. Primers
Sequences (30 -50 )
Reference
mlrA
MF2: GACCCGATGTTCAAGATACT mlrAR: TTAATCTTCATGCTGCTAGGAGC mlrBF: CGACGATGAGATACTGTCC mlrBR: CGTGCGGACTACTGTTGG mlrCF: TCCCCGAAACCGATTCTCCA mlrCR: CCGGCTCACTGATCCAAGGCT mlrDF: GTTCCTCGGCTAGCCT mlrDR: GCGACGA AGATCGTTGCT
(Saito et al., 2003; Chen et al., 2010)
mlrB mlrC mlrD
(Ho et al., 2007) (Ho et al., 2007) (Ho et al., 2007)
Fig. 1. Biodegradation of MC-LR by a bacterial mixed culture: (a) concentration range from 0 to 6000 mg L1 on the Y-axis with day 0 to day 16 on the X axis; (b) concentration range from 0 to 140 mg L1on the Y-axis with day 4 to day 16 on the X axis. The concentration of MC-LR was almost the same in the duplicate experiments; the standard deviation obtained by statistical analysis was ignored.
4-2, similarity 89%), an Acinetobacter sp. (DGGE Band No. 4-1-2, similarity 93%), a Steroidobacter sp. (DGGE Band No. 4-3, similarity 97%), and a Rhizobium sp. (DGGE Band No. 6-2, similarity 98%) were found to be present during the aerobic biodegradation of MC-LR.
enzyme, which has been identified as a putative oligopeptide transporter, and is encoded by the mlrD, is thought to be involved in the uptake of MC-LR into the bacterial cell. 4. Discussion
3.3. Functional genes present during MC-LR biodegradation 4.1. Two-stages of rate constant during the MC-LR biodegradation Figure 4 shows the presence of the 5.8 kb mlr gene cluster, which consists of mlrA, mlrB, mlrC and mlrD; this cluster is thought to be involved in the aerobic biodegradation of AMC-LR by a Sphingomonas sp. The genes mlrB and mlrC were clearly detected. A putative serine peptidase 2, MlrB, is encoded by the mlrB gene, and is thought to catalyze hydrolysis at the Ala-Leu peptide bond in linearized MC-LR. A putative metalloprotease 3, MlrC, is encoded by the mlrC gene and is thought to catalyze further hydrolysis of MCLR into smaller peptides and then into amino acids. By way of contrast, the mlrA and mlrD genes, were not detected in the microcosms during this study. The MlrA enzyme, which has been identified as a putative metalloprotease (microcystinase and is encoded by mlrA), is believed to catalyze the hydrolysis and opening of the ring at the Adda-Arg peptide bond. The MlrD
Two-stages of rate constant for the MC-LR biodegradation occurred during this investigation. MC-LR biodegradation during the first stage (0e4 days, k ¼ 876 mg L1 day1) was noticeably faster than during the second stage (5e16 days, k ¼ 504 mg L1 day1). The same trend in terms of a two-stage biodegradation was identified when Sphingomonas isolate NV-3 stain was used as sole carbon source for the biodegradation of MC-LR at the organism's optimal temperature (30 C) and at the optimal concentration of MC-LR (25 mg mL1) (Somdee et al., 2013). The rate of MC-LR biodegradation seems to be affected by interactions between various biometabolites present and the MC-LR concentration in the aerobic microcosms during the present study. If we examine the bacterial community, the bacterial mixed culture during the first
Please cite this article in press as: Tsao, S., et al., Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan, International Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.04.011
S. Tsao et al. / International Biodeterioration & Biodegradation xxx (2017) 1e8
5
The RI therefore during this period began to increase from 8 on the 7th day reaching 13 on the 16th day. These findings imply that, while MC-LR is biodegraded by various specific bacterial species, the mineralization of the MC-LR breakdown products would seem to require a different group of bacterial species. As a whole, this results in a two stage process. 4.2. Identified bacterial species present during the MC-LR biodegradation in the aerobic microcosms
Fig. 2. The 16S rDNA DGGE profiles obtained using DNA extracted from the samples at various times during the MC-LR biodegradation. N ¼ negative control; Well numbers 1, 2, 3, 4, 5, and 6 contain the amplified DNA from samples collected on the 0th, 4th, 7th, 10th, 13th, and 16th days, respectively; Bands number. 1, 2, 3, 4, 5, and 6 were used for bacterial species identification.
stage was the same that obtained during the bacterial isolation. This specific bacterial mixed culture is able to produce a number of mlr enzymes that allow the degradation of MC-LR. However, it should be noted that the RI decreased from 14 at time zero to 8 on the 7th day when ppm-levels of MC-LR are being utilized as the sole carbon source. Once the concentration of MC-LR had decreased to the ppb level (mg L1), more species of bacteria are present in the mixed culture and these would seem to be utilizing all of the possibly less toxic biometabolites that are now present in the medium. These will include linear MC-LR, various tetrapeptides and a number of smaller peptides, all of which can act as carbon sources.
The dominant bacteria present in the bacterial mixed culture during aerobic MC-LR biodegradation were identified. Members of the genus Sphingomonas, which were present throughout the microcosms during this study, have been reported to degrade various different types of MC using various different groups of intracellular hydrolytic enzymes. For example, 20 mg L1 MC-LR and MC-RR have been shown to be biodegraded by Sphingomonas sp. Y2 with the highest rates being 13 and 5.4 mg L1 day1, respectively (Park et al., 2001). A Sphingomonas sp. CBA4 isolate was capable of degrading completely 200 mg L1 MC-RR within 36 h (Valeria et al., 2006). Similarly, Sphingomonas sp. NV3 was able to biodegrade a 25 mg mL1 mixture of [Dha7] MC-LR and MC-LR at a maximum rate of 8.33 mg mL1 day1 (Somdee et al., 2013). Sphingobium sp. commonly isolated from soil was found to be able to degrade aromatic and chloroaromatic compounds, phenols, herbicides and polycyclic aromatic hydrocarbons. An Acinetobacter sp. was also identified as present during MC-LR biodegradation in our microcosms. Interestingly, this genus has been reported to be able to control the growth of Microcystis aeruginosa and to biodegrade MCs. Specifically, when a 10% (v/v) of Acinetobacter guillouiae A2 was co-incubated with M. aeruginosa then the algaecide compound 4-hydroxyphenethylamine was generated; the algaecide efficiency reached 91.6% after 7 days (Yi et al., 2015). Furthermore, Acinetobacter sp. WC-5 has been shown to remove 100% of 171.84 mg mL1 MC-LR by day 6. When the concentration of MC-LR was increased to 1025.76 mg mL1, the WC-5 strain was still able to remove 92.73% of the MC-LR by day 18 (Li and Pan, 2014). Furthermore, Rhizobium spp. seem to play an important role in the degrading MC and members of this genus were also identified in the microcosms during this study. Rhizobium gallicum DC7 was isolated from a bacterial consortium that was able to degrade MC (0.25 mg mL1) in freshwater from Florida (Ramani et al., 2012). A novel isolate, Rhizobium sp. TH, was found to degrade MC-LR; this was the first alphaproteobacteria other than Sphingomonadales found to be able to degrade MCs and it was able to biodegrade 8.3 mg L1 MC-LR under near-natural conditions at 30 C (Zhu et al., 2016). Moreover, the presence of MC-tolerant Rhizobium sp. has been shown to protect Faba bean plants (Vicia faba) and improve nitrogen metabolism if the plants are being irrigated with water polluted containing 100 mg L1 MC (Lahrouni et al., 2016). Pseudoxanthomonas spp. of the gamma proteobacteria have been found to be prominently represented in the rhizosphere of aquatic plants (Medicago sativa) if their roots are exposed to an algal
Table 2 Bacterial species present during MC-LR biodegradation identified based on their 16S rDNA sequences obtained from the bands isolated from the DGGE profiles. DGGE Band No.
Bacterial species
Similarity (%)
NCBI Gen Bank No.
1e5 2e2 3e1 4-1-2 4e2 4e3 6e2
Hyphomicrobium aestuarii Sphingomonas sp. Sphingobium sp. Acinetobacter sp. Pseudoxanthomonas sp. Steroidobacter flavus Rhizobium sp.
99% 98% 98% 93% 89% 97% 98%
NR104954.1 KF681175.1 KM253072.1 KM021049.1 LC065211.1 KU195414.1 JQ316287.1
Please cite this article in press as: Tsao, S., et al., Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan, International Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.04.011
6
S. Tsao et al. / International Biodeterioration & Biodegradation xxx (2017) 1e8
Fig. 3. A phylogenetic tree of the cloned 16S rRNA sequences obtained from the bacterial populations present during MC-LR biodegradation.
bloom that was extracted from a waterbody containing MCs (Khalloufi et al., 2016). A bacterial strain EMS, with the capability of degrading MC-LR/MC-RR, was isolated from Lake Taihu, China; this was part of a big cluster of genera, Stenotrophomonas, Pseudoxanthomonas and Xanthomonas, associated with MC degradation (Chen et al., 2010). Among the other bacteria of interest related to those isolated during the present study, it is known that Hyphomicrobium aestuarii is able to degrade POPs, including methamidophos (Wang et al., 2010), dichloromethane (Layton et al., 2000), chlortetracycline (Zheng et al., 2016) and fluoranthene (Zhao et al., 2016), while Steroidobacter flavus is a Gram negative rod-shaped non-endospore-forming bacterium that is motile and has a polar flagellum. S. flavus has been reported to be a microcystin-degrading Gammaproteobacterium, having been isolated from forest soil collected on Hainan Island in the south of the People's Republic of China (Gong et al., 2016). 4.3. The presence of genes from the mlr cluster in the genomes of microorganisms involved in MC-LR biodegradation The mlr gene cluster, which consists of mlrA, mlrB, mlrC and mlrD, has been identified as involved in the enzymatic biodegradation of MC-LR by Sphingomonas sp. (Bourne et al., 2001). MlrA is the key enzyme that catalyzes the initial hydrolytic cleavage of the cyclic MC structure (ring-opening at the Adda-Arg peptide bond); this generates linearized MC (NH2-Adda-Glu-Mdha-Ala-LeuMeAsp-Arg-OH). MlrA is a neutral protease with optimal pH of 7.6 and a half-saturation constant in the micromolar range. In this study, the presence of mlrA genes was initially monitored at the DNA level during the isolation process of MC-LR biodegrading mixed culture (data not shown) and the results for the presence of mlrA during this phase of MC-LR biodegradation was consistently negative. Possible reasons for this include the following. (1) mlrA genes seem to occur in a specific group of closely related species with the ability to remove MCs (Manage et al., 2009) and in previous studies the biodegradation of MC-LR by MlrA has been directly linked to the presence of specific alphaproteobacteria, namely Sphingomonas spp. The lack of a mlrA signal may indicate that species other than Sphingomonas are involved in the initial step of MC-LR removal in our system and that linearization occurs via an unknown mechanism. (2) In our system the population of Sphingomonas spp. that are present in our indigenous bacterial mixed culture might be quite small and this would make detection of the mlrA gene during MC-LR biodegradation difficult. (3) The cyclic structure of MC-LR is known to be able to be linearized by other genera bacteria. A previous study has indicated that, while the
alpha-proteobacterial MC-degradation pathway seems to have evolved by vertical evolution (Zhu et al., 2016), the betaproteobacterial and gamma-proteobacterial MC-degradation pathways seem to have evolved by horizontal gene transfer from the alpha-proteobacteria. After ring breakage, the linear MC-LR is then sequentially hydrolyzed into peptides by enzymes encoded by the mlrB and mlrC genes; these initially produce a tetrapeptide (Glu-Mdha-Ala-LeuMeAsp-Arg-OH) and then smaller peptides. Recently, the MlrB and MlrC enzymes have been proposed to play an important role in a novel biochemical pathway involved in MC-LR biodegradation (Dziga et al., 2016). Two byproducts, linearized MC and the heptapeptide, were obtained from bacterial strains possessing the mlr cluster and MlrB activity. First, MlrB seems to linearize MC. Secondly, the linearized MC can independently be hydrolyzed by MlrB at the peptide bond between Adda and Glu, resulting in Adda and heptapeptides as metabolites. The heptapeptides can then be decomposed by MlrC into smaller peptides and amino acids. In this study, the presence of a strong positive signal for mlr B and mlrC seems to support the idea of two different pathways for MC-LR biodegradation with the major pathway in our system involving only mlrB and mlrC. This is supported by the absence of signals for mlrA and mlrD. In the absence of mlrD, how MC-LR enters the bacterial cell remains open; it is possible that these enzymes are extracellular in our system. Finally, the dominant species of MC-degrading bacteria, as well as other non-MC-degrading bacteria, may then use the various byproducts, including the linearized heptapeptides, Adda tetra peptides, etc., as carbon/nitrogen sources. The potential novel pathway for MC-LR biodegradation outlined above will require further in-depth research, including studies aimed at identifying the presence of the various proposed byproducts during the MC-LR biodegradation as well as attempts to pinpoint the various enzymes involved in the different steps. 5. Conclusion Concentrations of MC-LR at the ppm-level were successfully biodegraded by a bacterial mixed culture newly isolated in Taiwan. A two-stage rate constant profile for the MC-LR biodegradation was identified. The first stage of the MC-LR biodegradation proceeds significantly faster than the second stage. The interaction between the concentration of MC-LR present in the culture and the biometabolites produced during MC-LR biodegradation seem to bring about changes in the bacterial community. The dominant bacterial species include Sphingomonas spp., Sphingobium spp., Rhizobium
Please cite this article in press as: Tsao, S., et al., Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan, International Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.04.011
S. Tsao et al. / International Biodeterioration & Biodegradation xxx (2017) 1e8
7
Fig. 4. The presence of functional genes related to MC-LR biodegradation (a) mlr A; (b) mlr B; (c) mlr C; (d) mlr D. Well number 1 ¼ marker; number 2 ¼ negative control; numbers 3, 4, 5, 6, 7 and 8 show the samples collected on the 0th, 4th, 7th, 10th, 13th, and 16th days, respectively.
spp., and Hyphomicrobium spp. and these were selected out of the bacterial population present in eutrophicated water bodies in Taiwan. These species are able to degrade MC-LR under the culture conditions used here. Strong signals for the presence of mlrB and mlrC were detected in the microcosm and it seems likely that these genes can be used as biomarkers for the biodegradation of MC-LR when monitoring reservoirs in Taiwan. Although these findings are preliminary and only involve laboratory scale experiments, the practical application of this process to the aerobic large-scale biodegradation of MC-LR warrants future investigation. Conflict of interests The authors declare no conflict of interests regarding the publication of this paper.
Acknowledgements This work was supported by a MOST (previously called an NSC) project NSC97-2221-E-008-028-MY3. Part of the results/discussion was presented at the 9th International Conference on Challenges in Environmental Science & Engineering (CESE-2016) in 2016. References Bell, S.G., Codd, G.A., 1994. Cyanobacterial toxins and human health. Rev. Med. Microbiol. 5, 256e264. Bourne, D.G., Riddles, P., Jones, G.J., Smith, W., Blakeley, R.L., 2001. Characterisation of a gene cluster involved in bacterial degradation of the cyanobacterial toxin microcystin LR. Environ. Toxicol. 16, 523e534. Bourne, D.G., Blakeley, R.L., Riddles, P., Jonesa, G.J., 2006. Biodegradation of the cyanobacterial toxin microcystin LR in natural water and biologically active slow sand filters. Water Res. 40, 1294e1302.
Please cite this article in press as: Tsao, S., et al., Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan, International Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.04.011
8
S. Tsao et al. / International Biodeterioration & Biodegradation xxx (2017) 1e8
Chen, J., Hu, L.B., Zhou, W., Yan, S.H., Yang, J.D., Xue, Y.F., Shi, Z.Q., 2010. Degradation of microcystin-LR and RR by a Stenotrophomonas sp. strain EMS isolated from Lake Taihu, China. Int. J. Mol. Sci. 11, 896e911. Chou, H.-L., Hwa, M.-Y., Lee, Y.-C., Chang, Y.-J., Chang, Y.-T., 2016. Microbial degradation of decabromodiphenyl ether (DBDE) in soil slurry microcosms. Environ. Sci. Pollut. Res. Int. 23, 5255e5267. Chudobova, D., Cihalova, K., Guran, R., Dostalova, S., Smerkova, K., Vesely, R., Crettaz-Minaglia, M.C., Andrinolo, D., Giannuzzi, L., 2015. Review: advances in microbiological degradation of microcystins. In: Davison, D. (Ed.), Cyanobacteria. Nova Science Publishers, Inc.. ISBN: 978-1-61470-925-1. Crettaz-Minaglia, M.C., Andrinolo, D., Giannuzzi, L., 2015. Review: advances in microbiological degradation of microcystins. In: Davison, D. (Ed.), Cyanobacteria. Nova Science Publishers, Inc., ISBN 978-1-61470-925-1 Dziga, D., Zielinska, G., Wladyka, B., Bochenska, O., Maksylewicz, A., Strzalka, W., Meriluoto, J., 2016. Characterization of enzymatic activity of MlrB and mlrC proteins involved in batreial degradation of cyanotoxins microcystins. Toxins (Basel) 8, 76. http://dx.doi.org/10.3390/toxins8030076. Gagala, H., Mankiewiez-Boczek, J., 2012. The natural degradation of microcystins (cyanobacterial hepatotoxins) in fresh water-the future of modern treatment systems and water quality imorvement. Pol. J. Environ. Stud. 21, 1125e1139. Gong, Z.L., Zhang, C.F., Jin, R., Zhang, Y.Q., 2016. Steroidobacter flavus sp. nov., a microcystin-degrading Gammaproteobacterium isolated from soil. Ant. Van Leeuwenhoek 109, 1073e1079. Ho, L., Hoefel, D., Saint, C.P., Newcombe, G., 2007. Isolation and identification of a novel microcystin-degrading bacterium from a biological sand filter. Water Res. 41, 4685e4695. Khalloufi, F.E., Oufdou, K., Bertrand, M., Lahrouni, M., Oudra, B., Ortet, P., Barakat, M., Heulin, T., Achouak, W., 2016. Microbiote shift in the Medicago sativa rhizosphere in response to cyanotoxins extract exposure. Sci. Total Environ. 539, 135e142. €ttfert, M., Lahrouni, M., Oufdou, K., El Khalloufi, F., Benidire, L., Albert, S., Go Caviedes, M.A., Rodriguez-Llorente, I.D., Oudra, B., Pajuelo, E., 2016. Microcystin-tolerant Rhizobium protects plants and improves nitrogen assimilation in Vicia faba irrigated with microcystin-containing waters. Environ. Sci. Pollut. Res. 23, 10037e10049. Layton, A.C., Karanth, P.N., Lajoie, C.A., Meyers, A.J., Gregory, I.R., Stapleton, R.D., Taylor, D.E., Sayler, G.S., 2000. Quantification of Hyphomicrobium populations in activated sludge from an industrial wastewater treatment system as determined by 16S rRNA analysis. Appl. Environ. Microbiol. 66, 1167e1174. Lee, T.-H., Chen, Y.-M., Chou, H.-N., 1998. First report of microcystins in Tawian. Toxicon 36, 247e255. Li, H., Pan, G., 2014. Enhanced and continued degradation of microcystins using microorganisms obtained through natural media. J. Microbiol. Methods 96, 73e80. Liu, I., Lawton, L.A., Bahnemann, D.W., Liu, L., Proft, B., Robertson, P.K., 2009. The photocatalytic decomposition of microcystin-LR using selected titanium dioxide materials. Chemosphere 76, 549e553. Liu, Y., Ren, J., Wang, X., Fan, Z., 2016. Mechanism and reaction pathways for microcystin LR degradation through UV/H2O2 treatment. PLoS One 11, e0156236. http://dx.doi.org/10.1371/journal.pone.0156236. Manage, P.M., Edwards, C., Singh, B.K., Lawton, L.A., 2009. Isolation and
identification of novel microcystin-degrading bacteria. Appl. Environ. Microbiol. 75, 6924e6928. Munusamy, T., Hu, Y.-L., Lee, J.-F., 2012. Adsorption and photodegradation of microcystin-LR onto sediments collected from reservoirs and rivers in Taiwan: a laboratory study to investigate the fate, transfer, and degradation of microcystin-LR. Environ. Sci. Pollut. Res. 19, 2390e2399. Muyzer, G., de Waal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59, 695e700. Park, H.D., Sasaki, Y., Maruyama, T., Yanagisawa, E., Hiraishi, A., Kato, K., 2001. Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake. Environ. Toxicol. 16, 337e343. Ramani, A., Rein, K., Shetty, K.G., Jayachandran, K., 2012. Microbial degradation of microcystin in Florida's freshwaters. Biodegradation 23, 35e45. Saito, T., Okano, K., Park, H.-D., Itayama, T., Inamori, Y., Neilan, B.A., Burns, B.P., Sugiura, N., 2003. Detection and sequencing of the microcystin LR-degrading gene, mlrA, from new bacteria isolated from Japanese lakes. FEMS Microbiol. Lett. 229, 271e276. Somdee, T., Peekan, A., Somdee, A., 2013. Bacterial degradation of microcystins within a biologically active sand filter. J. Life Sci. Technol. 1, 147e149. Valeria, A.M., Ricardo, E.J., Stephan, P., Alberto, W.D., 2006. Degradation of microcystin-RR by Sphingomonas sp. CBA4 isolated from San Roque reservoir rdoba - Argentina). Biodegradation 17, 447e455. (Co Wang, L., Wen, Y., Guo, X., Wang, G., Li, S., Jiang, J., 2010. Degradation of methamidophos by Hyphomicrobium species MAP-1 and the biochemical degradation pathway. Biodegradation 21, 513e523. Wu, J.-T., Kow, L.-C., 2010. Alteration of phytoplankton assemblages caused by changes in water hardness in Feitsui Reservoir. Taiwan. Bot. Stud. 51, 521e529. Yen, H., Lin, T., Tseng, I., Tung, S., Hsu, M., 2007. Correlating 2-MIB and microcystin concentrations with environmental parameters in two reservoirs in south Taiwan. Water Sci. Technol. 55, 33e41. Yen, H.-K., Lin, T.-F., Tseng, I.-C., 2012. Detection and quantification of major toxigenic microcystis genotypes in Moo-Tan reservoir and associated water treatment plant. J. Environ. Monit. 14, 687e696. Yi, Y.L., Yu, X.B., Zhang, C., Wang, G.X., 2015. Growth inhibition and microcystin degradation effects of Acinetobacter guillouiae A2 on Microcystis aeruginosa. Res. Microbiol. 166, 93e101. Zhao, J.K., Li, X.M., Ai, G.M., Deng, Y., Liu, S.J., Jiang, C.Y., 2016. Reconstruction of metabolic networks in a fluoranthene-degrading enrichments from polycyclic aromatic hydrocarbon polluted soil. J. Hazard. Mater 318, 90e98. Zheng, D., Chang, Q., Gao, M., She, Z., Jin, C., Guo, L., Zhao, Y., Wang, S., Wang, X., 2016. Performance evaluation and microbial community of a sequencing batch biofilm reactor (SBBR) treating mariculture wastewater at different chlortetracycline concentrations. J. Environ. Manage. 182, 496e504. Zhu, X., Shen, Y., Chen, X., Hu, Y.O.O., Xiang, H., Tao, J., Ling, Y., 2016. Biodegradation mechanism of microcystin-LR by a novel isolate of Rhizobium sp. TH and the evolutionary origin of the mlrA gene. Int. Biodeterior. Biodegr. 115, 17e25. Zurawell, R.W., Chen, H., Burke, J.M., Prepas, E.E., 2005. Hepatotoxic cyanobacteria: a review of the biological importance of microcystins in freshwater environments. J. Toxicol. Environ. Health B Crit. Rev. 8, 1e37.
Please cite this article in press as: Tsao, S., et al., Aerobic biodegradation of microcystin-LR by an indigenous bacterial mixed culture isolated in Taiwan, International Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.04.011