- Email: [email protected]
Affinity purification of HC-Pro of potyviruses with Ni2+-NTA resin
Journal of Virological Methods 76 (1998) 19 – 29
Affinity purification of HC-Pro of potyviruses with Ni2 + -NTA resin D. Kadouri, Yan-hua Peng, Y. Wang, S. Singer, H. Huet, B. Raccah, A. Gal-On * Department of Virology, Agricultural Research Organisation, The Volcani Center, PO Box 6, Bet Dagan 50 -250, Israel Received 26 May 1998; received in revised form 16 August 1998; accepted 16 August 1998
Abstract The HC-Pro of zucchini yellow mosiac virus (ZYMV) was found to bind to Ni2 + -NTA resin with or without His-tagging. The binding stringency was similar to that observed in proteins with a zinc finger motif like the HC-Pro. Using this characteristic we developed an efficient and rapid method (2 – 3 h) for purification of the HC-Pro of several potyviruses. A dominant protein of about 150 kDa was extracted and identified as the HC-Pro of ZYMV by means of immunoblotting. About 150 mg of HC-Pro were partially purified from the soluble fraction of 1 g of leaves. High titers of HC-Pro protein were obtained from plants infected with four potyviruses [ZYMV, watermelon mosaic virus II (WMVII), papaya ringspot virus (PRSV) and turnip mosaic virus (TuMV)]. The HC-Pros of potato virus Y (PVY) and tobacco vein mottling virus (TVMV) did not bind to the Ni2 + -NTA resin. The ZYMV-HC-Pro purified by the Ni2 + -NTA resin could bind in vitro to ZYMV virions blotted onto a membrane. All the HC-Pros which had been successfully purified by the Ni2 + -NTA resin were bound in vitro to membrane-blotted ZYMV coat protein. However, only the HC-Pros of ZYMV and WMVII were able to mediate aphid transmission of purified ZYMV virions. The purification procedure described herein is efficient and convenient, and enables HC-Pro for a number of potyviruses to be obtained in larger amounts and at higher purity than possible by means of most existing methods, based on ultracentrifugation. © 1998 Elsevier Science B.V. All rights reserved. Keywords: Potyvirus; Zinc finger; Purification; Resin
1. Introduction The helper phenomenon, in which a virus depends on another factor for its transmission by * Corresponding author. Tel.: +972-3-9683563; fax: +972-3-9683543; e-mail: [email protected].
aphids was first described in potyviruses by Kassanis (1961), and was characterized further by the sequential acquisition of transmissible and nontransmissible strains or viruses (Kassanis and Govier, 1971). Later, a component other than the virion itself was demonstrated to be involved in the assistance (Govier and Kassanis, 1974a), by
0166-0934/98/$ - see front matter © 1998 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 0 9 3 4 ( 9 8 ) 0 0 1 1 9 - 0
20
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
separation of the supernatant and the virions by means of ultracentrifugation. Successful transmission was shown to occur only when virions were mixed with the supernate, or when virions were acquired after aphids were fed with HC extract (Govier and Kassanis, 1974b; Sako and Ogata, 1981a). The proteinaceous nature of the helper was determined by Govier and Kassanis (1974a) and Govier et al. (1977) and the transmission characteristics were studied further for various potyviruses (Pirone and Thornbury, 1983; Raccah and Pirone, 1984; Antignus et al., 1989). Although the ultracentrifugation method produces biologically active HC-Pro, it leaves many other plant proteins in the preparation. Attempts to separate the HC-Pro from these other proteins have included the use of ion exchange (DEAE cellulose), sucrose gradient, and separation by SDS-PAGE (Thornbury and Pirone, 1983) or an oligo(dT) affinity column (Thornbury et al., 1985). Later, antisera were used for the identification of the HC-Pro (Hellmann et al., 1983; Hiebert et al., 1984; De Mejia et al., 1985). Use of these procedures allowed size determination of the HC-Pro (ranging between 50 and 60 kDa) and preparation of a highly specific serum against it. This antiserum made possible the unequivocal determination that the HC-Pro is a viral product rather than a host protein (Thornbury and Pirone, 1983). Thornbury et al. (1985) found that the highly purified HC-Pro had a specific activity in transmission 200 times that of the original supernatant. Unfortunately, the procedure adopted for purification of PVY HC-Pro from tobacco failed to purify the HC-Pro of other potyviruses in other hosts (Thornbury and Raccah, unpublished results) therefore, attempts were made to obtain partially purified HC-Pro by means of different protocols (Sako and Ogata, 1981b; Lecoq and Pitrat, 1985). In many plants infected with potyviruses, amorphous inclusion structures were formed from helper component subunits (Baunoch et al., 1990) which were probably not biologically active (Dougherty and Carrington, 1988). The HC-Pro activities of certain potyviruses have been demonstrated to function heterologously for transmission of potyviruses (Kassanis and Govier, 1971; Sako and Ogata,
1981b; Lecoq and Pitrat, 1985; Bourdin and Lecoq, 1991; Lecoq et al., 1993; Lopez et al., 1995). Attempts to purify HC-Pro from recombinant clones in bacterial (Gal-On, unpublished results) or baculovirus (Thornbury et al., 1993; Gal-On et al., unpublished results) expression systems yielded proteins that were biologically inactive. Sequence analysis and genetic manipulation of the HC-Pro of various potyvirus strains which are defective in transmission have revealed two motifs affecting aphid-mediated transmission: one located within the N-terminus (KITC) (Thornbury et al., 1990) and a second mapped within the central regions of the HC-Pro (Huet et al., 1994). Affinity purification of proteins with Ni2 + NTA resin has been used extensively for separating His-tagged viral proteins (Restrepo-Hartwig and Carrington, 1994). Moreover, Peng et al. (1998) adopted the Ni2 + -NTA affinity purification method for mapping a motif within the HCPro that bound to the zucchini yellow mosiac virus (ZYMV) virion. The present purification approach enables us to obtain relatively large quantities of pure helper component rapidly and simply. The HC-Pro obtained by this approach was compared with that obtained by the classic ultracentrifugation protocol and evaluated for biological activity.
2. Material and methods
2.1. Viruses, host plants and inoculation procedures The potyviruses tested comprised two zucchini yellow mosaic virus strains (ZYMV-AT, ZYMVNAT) (Antignus et al., 1989), watermelon mosaic virus II (WMVII), papaya ringspot virus (PRSV), potato virus Y (PVY), turnip mosaic virus (TuMV) and tobacco vein mottling virus (TVMV). All the viruses were isolated in Israel, except for TVMV that was kindly provided by Tom Pirone (University of Kentucky). The cucurbit viruses (ZYMV, WMVII and PRSV) were inoculated on squash (Cucurbita pepo L. cv. Ma’ayan). PVY and TVMV were inoculated on
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
tobacco (Nicotiana tabacum cv. Xanthi NN) and Nicotiana benthamina, and the TuMV was inoculated on Sinapis alba L. and Chenopodium quinoa. All plants were inoculated in the greenhouse by sap-inoculation at the cotyledon or first-leaf stage. After inoculation, the plants were maintained in a growth chamber under continuous light at about 25°C, they were examined daily for symptom development, and the first appearance of symptoms was recorded. ZYMV was purified from infected squash, as previously described by Antignus et al. (1989).
2.2. Site-directed mutagenesis and plasmid construction Clone pKSB16 of the 5% of ZYMV (Gal-On et al., 1991) served as the template for oligonucleotide-directed mutagenesis. Mutations were performed according to Kunkel et al. (1987), using an oligonucleotide that harbours the coding region for seven histidines. The oligonucleotide 5%GAAGTCGACCACTATTCGCACCACCATCA CCATCACCATTCGCAACCGGAAGTTCAG3% contains 21 nucleotides (nt) coding for seven histidines (underlined) between the sequences of the C-terminal of the P1, with a unique restriction endonuclease site SalI (bold) and the sequence encoding for the N-terminal of the HC-Pro. The mutated clone was digested by BstEII and BamHI and the mutated fragment (1.2 kb) was introduced into the appropriate sites within the full-length clone (FLC) pKS35SZYMVNOS (GalOn et al., 1995). The new clone, designated pKS35SZYMV-his-HC, was used for inoculation of squash seedlings by the bombardment method (Gal-On et al., 1996). The presence of the seven histidines in the FLC and within the progeny virions was confirmed by sequencing and by the unique restriction endonuclease SalI.
2.3. Affinity purification of the HC-Pro with Ni 2 + -NTA resin Squash seedlings were sap-inoculated with three cucurbit potyviruses, ZYMV, WMVII and PRSV. Samples of leaves (2 g) were taken 6 – 10 days post inoculation, and were homogenized by mortar
21
and pestle with 6 ml of chilled 0.3 M K2HPO4, pH 8.8 (designated HCB for HC-Pro buffer). The extract was separated from the plant debris by low-speed centrifugation at 2000× g for 10 min at 4°C. The supernatant (designated S1) was collected and mixed with 400 ml of a 50% slurry of Ni2 + -NTA that had been equilibrated with HCB prior to use (nickel–nitrilotriacetic acid resin was purchased either from Qiagen or as TALON from Clontech). The mixture was stirred for 60 min at 4°C, then centrifuged for 2 min at 1000 × g. The pellet (Ni2 + -NTA) was collected in a 1.5 ml tube and the unbound supernatant discarded. The Ni2 + -NTA resin was washed three times with chilled HCB. Elution of the pellet resin was done by mixing it with an elution buffer containing 50–200 mM of imidazole HCB (HCB-I). In a few experiments, the elution buffer included 200 mM EDTA instead of imidazole; this buffer was designated HCB-E. The eluent was incubated for 3–5 min with either HCB-I or HCB-E, the mixture was then centrifuged for 2 min at 1000× g and the supernatant containing the HC-Pro was collected in a new tube. The eluted fraction (400 ml) was kept in aliquots for further testing.
2.4. Measurement and biochemical analysis of the HC-Pro Total protein in the S1 solution and in the HC-Pro extract was measured by the method of Bradford (Sigma), according to the manufacturer’s procedures. The estimation of the HC-Pro content in the eluted extract was based on photography of the SDS-PAGE gel with a DC-40 digital camera (Kodak) and use of BioMax ID Image Analysis Software (Kodak) (Fig. 3). Plant samples and purified HC-Pro aliquots were boiled for 5 min after addition of 2× SDSpolyacrylamide gel electrophoresis (PAGE) sample buffer. Samples were separated on discontinuous 12% SDS-PAGE gels, and HC-Pro was visualized by Coomassie staining and identified by Western blotting, using an electro-blot apparatus (BIO-RAD) according to the manufacturer’s instructions. The membrane was blocked and probed with a 1:1500 dilution of primary antisera for 1 h at room temperature. The anti-
22
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
body used to detect ZYMV HC-Pro was prepared against amorphous inclusion protein of PRSV. This antibody had previously been shown to react with ZYMV and WMVII HC-Pros (Purcifull and Hiebert, 1992) The secondary antibody (1 mg/ml, anti-rabbit IgG alkaline phosphatase-conjugated (Promega) was used at a dilution of 1:5000 and the chromogenic reagents for development were nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Promega).
2.5. In 6itro binding of HC-Pros to dot-blotted 6irion of ZYMV Similar amounts (:40 mg) of Ni2 + -NTA resinpurified HC-Pro from various potyviruses were tested for binding to blotted ZYMV virion according to Blanc et al. (1997), as modified by Peng et al. (1998).
2.6. Aphid transmission Infected squash served as source plants for acquisition access feeding (AAF). Green peach aphids Myzus persicae were fasted for 1 h, then allowed a 5 min acquisition access feeding followed by an 18 h inoculation feeding on cucumber seedlings. Virus transmission from Parafilm membranes was performed by allowing a 10 min AAF from a mixture of 40 ml of Ni2 + -NTApurified HC-Pro containing 20% sucrose with 100 mg of purified ZYMV virion in 10 ml 0.1 M borate buffer, pH 8.0, as described elsewhere (Raccah and Pirone, 1984; Antignus et al., 1989).
3. Results An His-tag (7× histidine) sequence was inserted into the N%-terminus of the HC-Pro gene within the infectious clone of ZYMV (pks35SZYMVNOS) (Gal-On et al., 1995) in order to achieve highly specific purification of biological function of HC-Pro. Unexpectedly, the His-tagged HC-Pro of ZYMV which had been purified by means of the Ni2 + -NTA resin was bound to the Ni2 + -NTA resin in about the same amount and at about the same affinity (Fig. 1A,
B) as the non-tagged HC-Pro obtained from the wild-type ZYMV isolate. However, extraction of the HC-Pro under denaturing conditions revealed that only the His-tagged HC-Pro was bound to the Ni2 + -NTA resin (data not shown). A small amount of HC-Pro did not bind to the Ni2 + NTA resin and was washed out with fraction S1 (Fig. 1b). This preliminary result led us to develop a simple and fast purification methods of HC-Pro protein from various potyviruses with Ni2 + -NTA resin. The specific binding of the HC-Pro of ZYMV to the Ni2 + -NTA resin (Figs. 1 and 2) enabled us to develop a purification method that uses a small amount of infected plant tissue (e.g. 2 g of leaves). The purification procedure is based on four steps (see details in Section 2): 1. Preparation of the plant sample by grinding the tissue and collecting the soluble protein S1 (supernatant material) after low-speed centrifugation. 2. Binding step, in which the Ni2 + -NTA resin was agitated with the plant soluble protein (S1) as a batch. 3. Washing off the non-specific bound proteins. 4. Elution of the bound HC-Pro from the Ni2 + NTA resin by a competitor such as imidazole or EDTA. The purification steps last 2–3 h without the use of ultracentrifugation. The fractions eluted from the affinity Ni2 + NTA resin comprised a major band of about 50 kDa (Figs. 1–3), which was identified as HC-Pro by immune blotting with polyclonal antibody of PRSV-W to HC-Pro (Fig. 1B, Fig. 3B). In order to determine the binding stringency of the HC-Pro to the Ni2 + -NTA resin, the bound HC-Pro was eluted with increasing concentrations of imidazole. Most of the HC was eluted at concentrations of 50–75 mM of imidazole and a small amount at 100 mM (Fig. 2). No detectable amounts of HC were found using 10 mM (Fig. 2) and 25 mM (data not shown) of imidazole in the eluted fraction. Semi-quantitative analysis of the eluted HC-Pro was performed by comparison with known amounts of bovine serum albumin (BSA) (Fig. 4). The eluted extracts contained : 180–250 mg of proteins per gram of leaf tissue. The HC-Pro
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
23
Fig. 1. SDS-PAGE gel (A) and Western blot (B) analysis of total proteins from squash plants infected by the tagged ZYMV-HIS and non-tagged ZYMV during affinity purification of the HC-Pro by Ni2 + -NTA resin. H, healthy plant; I, infected plant; S1, non-bound washed protein; Ni2 + , protein eluted from the Ni2 + -NTA resin; M, prestained protein marker. The protein markers and the putative HC-Pro are labelled on the left and right sides, respectively. Proteins were stained with Coomassie brilliant blue (A) and detection of HC-Pro was performed with anti-PRSV-HC-Pro antiserum (B).
content in this extract (130 – 180 mg/g tissue) was estimated to range between 72 and 82% of the total protein (Table 1). The conventional purification method of HCPro purification used for biological transmission assay (Govier and Kassanis, 1974b; Sako and Ogata, 1981a) is based on an ultracentrifugation step for precipitation of virions and on the concentration of the soluble proteins with polyethylene glycol or ammonium sulphate (designated below as UltC). Comparison of the purity and amount of HC-Pro obtained by UltC with that obtained by the Ni2 + -NTA affinity purification method is presented in Fig. 3., in which it can be seen that many soluble proteins remained in
the extract. However, the eluate of Ni2 + -NTA contained significantly less host proteins than the extract from the UltC. Furthermore, the amount of HC-Pro extracted by UltC was small and could barely be visualized by means of Coomassie blue staining (Fig. 3A), apparently being masked by other host proteins, including the dominant ribulose bisphosphate carboxylase (Fig. 3A, lane I and UltC). In both procedures the completion of removal of virions from the extracts was determined by Western blotting and transmission tests (data not shown). Although the amount of the HC-Pro extracted by the Ni2 + -NTA was about ten times greater than that obtained by the UltC (Fig. 3B), the ability of the HC-Pro to assist transmission
24
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
from membranes (from comparable plant tissue) was about the same (85%) in the Ni2 + -NTA extraction and in the UltC extraction (Table 1) Surprisingly, all the attempts to examine the effect of dilution of the Ni2 + -NTA resin-purified HCPro resulted in sharp loss of transmission-mediating activity. The transmission efficiency was reduced to 35% after 1:1 dilution of the extract, and transmission was eliminated by 1:5 dilution. The ease of HC-Pro extraction and purification by the Ni2 + -NTA affinity method enabled us to determine the time dependence of HC-Pro accumulation in plants (Fig. 5). A high titer of soluble HC-Pro was detected in the early stage [5 days post inoculation (dpi), data not shown] and it remained at this high level for 2 weeks. A slight increase was recorded after 20 dpi, but the extract seemed to contain more non-related proteins (Fig. 5A). The major band in healthy plants (H) and in plants after 3 dpi seems to be a result of the non-specific binding of rubisco (Fig. 5B). The upper band, which reacted positively with HC-Pro antiserum (Fig. 5B) could be a dimer of HC-Pro, or HC-Pro in the partially processed polyprotein. In the light of the ease of HC-Pro purification by the Ni2 + -NTA resin, it was considered important to determine if this technique could be applied to other potyviruses. The HC-Pros of two additional cucurbit potyviruses (WMVII and PRSV) and of a cruciferous potyvirus (TuMV) were found to bind to the Ni2 + -NTA resin, their HC-Pros were rendered visible in SDS-PAGE by Coomassie brilliant blue staining (data not pre-
Fig. 2. Analysis of the stringency of binding of the HC-Pro to the Ni2 + -NTA resin. Bound proteins were eluted with various concentrations (10, 50, 75, 100, 200 mM) of imidazole as a competitor. Aliquots of 5 ml were loaded on a 12% SDSPAGE gel. The size of the protein marker (M) is labelled in kDa on the left side.
Fig. 3. SDS-PAGE gel (A) and Western blot (B) analysis of total proteins from infected squash (I) and from HC purification from 2 and 10 g of squash leaves by affinity purification by Ni2 + -NTA resin (Ni2 + ) method or by the centrifugation method (UltC), respectively. Equivalent quantities of plant tissue (from total of 400 ml of HC-Pro extruction) were loaded on the gel. The sizes of the proteins marker (M) and of the putative HC-Pro are indicated in kDa on the left and right sides, respectively. Proteins were stained with Coomassie brilliant blue (A), and detection of HC-Pro was performed with anti-PRSV HC-Pro antiserum (B).
sented) and by Western blot analysis (Fig. 6Table 2). In view of the differing accumulation of each of the three potyviruses ZYMV, WMVII and PRSV in squash (data not presented), comparison among the amounts of purified HC-Pro was not established. Interestingly, the HC-Pro of the two potyviruses that infect solanaceae (TVMV and PVY) and which were extracted from various hosts, did not bind to the Ni2 + -NTA resin (data not presented), even when the binding pH and buffers were altered.
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
Fig. 4. Semi-quantitative analysis of HC-Pro eluted from the Ni2 + -NTA resin.HC-Pro extracts in eluates (1 and 2 ml) were loaded for comparison with known quantities of BSA (0.1 and 0.5 mg) on SDS-PAGE, for estimation of the HC-Pro content within the eluted extracts. Proteins were stained with Coomassie brilliant blue. The sizes of the protein marker (M) and the putative HC-Pro and BSA are indicated in kDa on the left and right sides, respectively.
The HC-Pros of transmissible strains of ZYMV and WMVII that had been purified by Ni2 + -NTA resin (whether eluted by imidazole or by EDTA), were able to mediate transmission of ZYMV virions from membranes at efficiencies of 85 (Table 1) and 74% (52 out of 70 plants infected with WMVII), respectively. However, the HC-Pros of a non-transmissible strain of PRSV and a trans-
25
Fig. 5. Time-course analysis of the accumulation of the HCPro in ZYMV-infected squash seedlings. HC-Pro was affinitypurified at different times post inoculation (H, healthy; 3, 6, 14, 20 days) and loaded on 12% SDS-PAGE gel. Proteins were stained with Coomassie brilliant blue (A) and detection of HC-Pro was performed with anti-PRSV-HC-Pro antiserum (B). The sizes of the protein markers (M) and of the putative HC-Pro are indicated on the left and right sides, respectively.
missible strain of TuMV did not assist transmission of the ZYMV virion (Table 2).All the four purified HC-Pros (ZYMV, WMVII, PRSV and
Table 1 HC-Pro concentration at each step in the affinity Ni2+-NTA purification processes, and efficiency of transmission Purification step
Volume (ml)
Low-speed supernatant After passage through Ni NTA resin a
6 2+
-
0.4
Protein yield mg/g tissue
30 0.18–0.25
a
HC-Pro from total (mg/g tissue)
b
Aphid transmission efficiency (%) Ni2+
UtlC
n.d.
–
–
0.13–0.18
85 [109/128]
85 [69/81]
The amount of the purified HC-Pros within the extract (protein yield) were estimated by comparison with BSA as a standard (Fig. 4) (calculated with the BioMax software). b About 100 mg/ml of HC-Pro extracts and 1 mg/ml of purified ZYMV were used for aphid transmission on parafilm membrane. Numbers are of infected total seedlings. The sum represents four separating experiments with HC-Pro extracted from Ni2+-NTA or UltC. n.d., Not determined.
26
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
Fig. 6. Western blot analysis of HC-Pro extracted from squash plants infected with ZYMV, WMVII and PRSV, and from Chenopodium quinoa infected with TuMV. The sizes of the protein markers (M) in kDa are marked on the left side. HC-Pro verification was performed with anti-PRSV-HC-Pro antiserum.
TuMV) were efficiently bound to the dot-blotted ZYMV virion (Table 2) by mean of variants of methods of Peng et al. (1998).
4. Discussion HC-Pro is a multifunctional protein (see reviews: Maia, et al., 1996; Pirone and Blanc, 1996; Rojas et al., 1997; Kasschau et al., 1997) with sequence homology between potyviruses (Granier et al., 1993). Development of an efficient and simple purification method for this key potyviral encoded protein would provide an important tool for its characterization. For this reason we at-
tempted to tag the HC-Pro with a polyhistidine tail as previously demonstrated for the 6 kDa and the HC-Pro proteins of tobacco etch virus (TEV) (Restrepo-Hartwig and Carrington, 1994). The present study demonstrated that the HCPro of ZYMV can be modified at the N-terminus by the insertion of a sequence encoded for seven histidine residues. The sequence maintained stability in the viral genome and displayed no discernible effects on either virus accumulation or symptom development. The fact that HC-Pros deriving from an Histagged virus and from a non-tagged HC-Pro show similar binding stringency (50–70 mM imidazole) to Ni2 + -NTA indicates that the principal binding characteristic depends on the protein structure motif and not on the His-tagging at its N%-terminus. This result may imply that the N%-terminus may be located within the core of the protein and not exposed on the protein surface. The domain of the HC-Pro that binds to the Ni2 + -NTA is probably the putative ‘zinc-finger’ structure, that has been described near the N-terminus of the HC-Pro of potyviruses (Robaglia et al., 1989; Granier et al., 1993). It is known that proteins that harbour zinc finger motifs may bind to the Ni2 + -NTA matrix, but will then be eluted with an imidazole concentration lower than that required for His-tagged proteins (unpublished observations in the Qiagen Handbook ‘The QIA Expressionist’). Thus, the affinity of HC-Pro to Ni2 + -NTA resin provides an additional approach to HC-Pro purification, as an alternative to the ultracentrifu-
Table 2 Characteristics of the potyviral HC-Pro purified by affinity binding to Ni2+-NTA resin Source of HC-Pro purified by Ni2+
Affinity to Ni2+ resin
a
Mediation of ZYMV transmission from membranes
Binding to ZYMV virion
ZYMV WMVII PRSV TuMV PVY TVMV
+ + + + − −
+ + − − n.d. n.d.
+ + + + n.d. n.d.
a + and − indicate positive or negative HC-Pros purification with Ni2+-NTA resin, binding to ZYMV virion blotted on membrane and biological activity in transmission. n.d., Not determined.
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
gation methods developed for PVY (Govier et al., 1977), TuMV (Sako and Ogata 1981a), TVMV and PVY (Thornbury et al., 1985), and WMV II and ZYMV (Lecoq and Pitrat, 1985). A comparison of the two methods shows that the HC-Pro eluted from the Ni2 + -NTA resin is less contaminated with non-related host proteins than that obtained by ultracentrifugation as described by Govier et al. (1977), and is comparable in purity with the preparation obtained by Thornbury et al. (1985) by means of oligo(dT) cellulosepurification (Thornbury et al., 1990). The TVMV and PVY HC-Pros, extracted from tobacco, did not bind to the Ni2 + -NTA resin. This was in contrast to the efficient binding of HC-Pros extracted from cucurbits (ZYMV, WMVII and PRSV) or cruciferous mustard (TuMV). The simplest explanation could be in terms of a host effect that might affect the binding capacity of the HC-Pro. However, HC-Pro of PVY extracted from several different hosts (N. tabacum cv. Xanthi NN, N. benthamina; C. amaranticolor) also did not bind to Ni2 + -NTA resin. Another explanation could be a difference in the kinetics of soluble HC-Pro accumulation and/or in the rate of amorphous inclusion formation. It is also possible that the binding conditions needed for purification of PVY and TVMV HC-Pro by the Ni2 + -NTA method differ from those required for purification of ZYMV-HC (Sako and Ogata, 1981b). The HC-Pros of four potyviruses, ZYMV, WMVII, PRSV and TuMV, were successfully purified with the Ni2 + -NTA resin. Successful heterologous transmission of ZYMV virions with HC-Pro of WMVII and PRSV, by aphids and with other potyviruses, has been reported (Kassanis and Govier, 1971; Sako and Ogata, 1981b; Lecoq et al., 1993; Lopez et al., 1995). Therefore, it was expected that the Ni2 + -NTA resin-purified HC-Pro would assist transmission of ZYMV. However, in the present study, ZYMV was transmitted only when transmission was assisted by the HC-Pro of ZYMV or WMVII but not by that of PRSV or TuMV. The PRSV was a non-transmissible isolate (tested only in cucurbits), therefore, the inability to transmit ZYMV virion could be explained by biological inactivity of PRSV
27
HC-Pro. However, the ability of PRSV HC-Pro to mediate transmission of ZYMV was previously reported by Bourdin and Lecoq (1991), and the possibility that the inability to mediate aphid transmission is related to mutation(s) within the HC-Pro requires further study. On the other hand, the HC-Pro of PRSV was bound to virions in vitro, and this binding of purified HC-Pro of PRSV to blotted ZYMV coat protein may only indicate an association between the two proteins in vitro. The HC-Pro of transmissible TuMV virus could not mediate transmission of the ZYMV virion (Table 2), which was similar to the results obtained by Sako and Ogata (1981b), who could not achieve transmission of WMVII virions with TuMV HC-Pro extracts. Therefore, we consider that the two viruses ZYMV and TuMV are phylogenically too distant to assist in heterologous transmission. We did not test the transmissibility by membrane feeding of TuMV HC-Pro in transmission of the homologous virion, as we were unable to purify the virion of TuMV sufficiently for membrane transmission experiments. The high yield of HC-Pro purified by Ni2 + NTA affinity (150 mg/g) was not correlated with the rapid reduction of aphid transmission efficiency from 77 to 0% obtained on membrane feeding after 1:5 dilution. It is, therefore, possible that during purification most of the HC-Pro lost its native structure and function. The potyviral HC-Pro probably functions in aphid transmission as a dimer (Thornbury et al., 1985). In heterologous systems in which HC-Pro was expressed in E. coli (Gal-On, unpublished results), or in insect cells (Thornbury et al., 1993; Gal-On et al., unpublished results) no activity of aphid-mediated transmission was obtained, probably because of inability to form a proper functional conformation of the expressed protein. However, in cauliflower mosaic virus, a biological function of HC-Pro obtained from such a heterologous expression system has been reported (Schmidt et al., 1994). We assume that the relatively low efficiency of aphid transmission obtained from the HC-Pro extracted by Ni2 + -NTA resin could be due to incomplete folding of the eluted HC-Pro molecule from the Ni2 + -NTA resin.
28
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
If formation of HC-Pro dimer and the affinity binding of HC-Pro to the Ni2 + -NTA resin arise from the same putative zinc finger motif (Robaglia et al., 1989) then we may deduce that most of the HC-Pro extracted from the Ni2 + NTA resin is in monomer form which seems to be a biologically inactive molecule.
Acknowledgements This work was supported in part by grants from the US–Israel Binational Research and Development Fund (US-2666-95R and US-254195R) and the Chief Scientist of the Ministry of Agriculture (135-1070-97). Contribution from the Agricultural Research Organisation, No. 518/98. PRSV-HC-Pro antibody was kindly given by Dr D.E. Purcifull and Dr E. Hiebert of the University of Florida, USA.
References Antignus, Y., Raccah, B., Gal-On, A., Cohen, S., 1989. Biological and serological characterization of zucchini yellow mosaic and watermelon virus 2 isolates in Israel. Phytoparasitica 17, 289 – 298. Baunoch, D. A., Das, P., Hari, V., 1990. Potato virus Y helper component protein is associated with amorphous inclusions. J. Gen. Virol. 71, 2479–2482. Blanc, S., Lopez-Moya, J-J., Wang, R., Garcia-Lampasone, S., Thornbury, D.W., Pirone, T.P., 1997. A specific interaction between coat-protein and helper component correlates with aphid transmission of a potyvirus. Virology 231, 141 – 147. Bourdin, D., Lecoq, H., 1991. Evidence that heteroencapsidation between two potyviruses is involved in aphid transmission of a non-transmissible isolate from mixed infections. Phytopathology 81, 1459–1464. De Mejia, M.V.G., Hiebert, E., Purcifull, D.E., Thornbury, D.W., Pirone, T.P., 1985. Identification of potyviral amorphous inclusion protein as a non-structural virus-specific protein related to helper component. Virology 142, 34–43. Dougherty, W.G., Carrington, J.C., 1988. Expression and function of potyviral gene products. Ann. Rev. Phytopathol. 26, 123 – 143. Gal-On, A., Antignus, Y., Rosner, A., Raccah, B., 1991. Infectious in vitro RNA transcripts derived from the cloned cDNA of the cucurbit potyvirus, zucchini yellow mosaic virus. J. Gen. Virol. 72, 2639–2643.
Gal-On, A., Meiri, E., Huet, H., Hua, W.J., Raccah, B., Gaba, V., 1995. Particle bombardment drastically increases the infectivity of cloned DNA of zucchini yellow mosaic potyvirus. J. Gen. Virol. 76, 3223 – 3227. Gal-On, A., Meiri, E., Elman, C., Gray, D.J., Gaba, V., 1996. Simple hand-held devices for the efficient infection of plants with viral-encoding constructs by particle bombardment. J. Virol. Methods. 64, 103 – 110. Govier, D.A., Kassanis, B., 1974. Evidence that a component other than the virus particle is needed for aphid transmission of potato virus Y. Virology 57, 285 – 286. Govier, D.A., Kassanis, B., 1974. A virus induced component of plant sap needed when aphids acquire potato virus Y from purified preparations. Virology 61, 420 – 426. Govier, D.A., Kassanis, B., Pirone, T.P., 1977. Partial purification and characterization of potato virus Y helper component. Virology 78, 306 – 314. Granier, F., Durand-Tardif, M., Casse-Delbart, F., Lecoq, H., Robaglia, C., 1993. Mutations in zucchini yellow mosaic virus helper component protein associated with loss of aphid transmissibility. J. Gen. Virol. 74, 2737 – 2742. Hellmann, G.M., Thornbury, D.W., Hiebert, E., Shaw, J.G., Pirone, T.P., Rhoads, R.E., 1983. Cell-free translation of tobacco vein mottling virus RNA. II: immunoprecipitation of products by antisera to cylindrical inclusion, nuclear inclusion, and helper component proteins. Virology 124, 434 – 444. Hiebert, E., Thornbury, D.W., Pirone, T.P., 1984. Immunoprecipitation analysis of potyviral in vitro translation products using antisera to helper component of tobacco vein mottling virus and potato virus Y. Virology 135, 1 – 9. Huet, H., Gal-On, A., Meir, E., Lecoq, H., Raccah, B., 1994. Mutations in the helper component (HC) gene of zucchini yellow mosaic virus (ZYMV) affect aphid transmissibility. J. Gen. Virol. 75, 1407 – 1414. Kassanis, B., 1961. The transmission of potato aucuba mosaic virus by aphids from plants also infected by potato viruses A or Y. Virology 13, 93 – 97. Kassanis, B., Govier, D.A., 1971. The role of helper virus in aphid transmission of potato aucuba mosaic virus and potato virus C. J. Gen. Virol. 13, 221 – 228. Kasschau, K.D., Cronin, S., Carrington, J.C., 1997. Genome amplification and long-distance movement functions associated with the central domain of tobacco etch potyvirus helper component-proteinase. Virology 228, 251 – 262. Kunkel, T.A., Roberts, J.D., Zakour, R.A., 1987. Rapid and efficient site-specific mutagensis without phenotypic selection. Meth. Enzymol. 154, 367 – 382. Lecoq, H., Pitrat, M., 1985. Specificity of the helper-component-mediated aphid transmission of three potyviruses infecting muskmelon. Phytopathology 75, 890 – 893. Lecoq, H., Ravelonandro, M., Wipf-Scheibel, C., Monsion, M., Raccah, B., Dunez, J., 1993. Aphid transmission of a non-aphid-transmissible strain of zucchini yellow mosaic potyvirus from transgenic plants expressing the capsid protein of plum pox potyvirus. Mol. Plant – Microbe Interact. 6, 403 – 406.
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29 Lopez, M.J.J., Canto, T., Diaz, R.J.R., Lopez, A.D., 1995. Transmission by aphids of a naturally non-transmissible plum pox virus isolate with the aid of potato virus Y helper component. J. Gen. Virol. 76, 2293–2297. Maia, I.G., Haenni, A.L., Bernardi, F., 1996. Potyviral HCPro: a multifunctional protein. J. Gen. Virol. 77, 1335– 1341. Peng, Y.H., Kadoury, D., Gal-On, A., Heut, H., Wang, Y., Raccah, B., 1998. Mutation in the HC-Pro gene of the zucchini yellow mosaic potyvirus: effects on aphid transmission and on binding to purified virions. J. Gen. Virol. 79, 897 – 904. Pirone, T.P., Thornbury, D.W., 1983. Role of virion and helper component in regulating aphid transmission of tobacco etch virus. Phytopathology 83, 872–875. Pirone, T.P., Blanc, S., 1996. Helper-dependent vector transmission of plant viruses. Ann. Rev. Phytopathol. 34, 227– 247. Purcifull, D., Hiebert, E., 1992. Serological relationships involving potyviral non-structural proteins. In: Barnett, O.W. (Ed.), Potyvirus Taxonomy: Archives of Virology (Suppl. 5). Springer, Vienna and New York, pp. 97–122. Raccah, B., Pirone, T.P., 1984. Characteristics of factors affecting helper-component-mediated aphid transmission of a potyvirus. Phytopathology 74, 303–308. Restrepo-Hartwig, M.A., Carrington, C.J., 1994. The tobacco etch potyvirus 6-kilodalton protein is membrane associated and involved in viral replication. J. Virol. 68, 2388–2397. Robaglia, C., Durand-Tardiff, M., Tronchet, M., Boudazin, G., Astier-Manifacier, S., Casse-Delbart, F., 1989. Nucle-
otide sequence of potato virus Y (N strain) genomic RNA. J. Gen. Virol. 70, 935 – 947. Rojas, M.R., Zerbini, F.M., Allison, R.F., Gilbertson, R.L., Lucas, W.J., 1997. Capsid protein and helper componentproteinase function as potyvirus cell-to-cell movement proteins. Virology 237, 283 – 295. Sako, N., Ogata, K., 1981. A helper factor essential for aphid transmissibility of turnip mosaic virus. Ann. Phytopath. Soc. Japan 47, 68 – 70. Sako, N., Ogata, K., 1981. Different helper factors associated with aphid transmission of some potyviruses. Virology 112, 762 – 765. Schmidt, I., Blanc, S., Esperandieu, P., et al., 1994. Interaction between the aphid transmission factor and virus particles is part of the molecular mechanism of cauliflower mosaic virus aphid transmission. Proc. Natl. Acad. Sci. USA 91, 8885 – 8889. Thornbury, D.W., Pirone, T.P., 1983. Helper components of two potyviruses are serologically distinct. Virology 125, 487 – 490. Thornbury, D.W., Hellmann, G.M., Rhoads, R.E., Pirone, T.P., 1985. Purification and characterization of potyvirus helper component. Virology 144, 260 – 267. Thornbury, D.W., Patterson, C.A., Dessens, J.T., Pirone, T.P., 1990. Comparative sequence of the helper component (HC) region of potato virus Y and a HC-defective strain, potato virus C. Virology 178, 573 – 578. Thornbury, D.W., Heuvel, J.F.J.M. v.d., Lesnaw, J.A., Pirone, T.P., 1993. Expression of potyvirus proteins in insect cells infected with a recombinant baculovirus. J. Gen. Virol. 74, 2731 – 2735.
. .
29
Affinity purification of HC-Pro of potyviruses with Ni2 + -NTA resin D. Kadouri, Yan-hua Peng, Y. Wang, S. Singer, H. Huet, B. Raccah, A. Gal-On * Department of Virology, Agricultural Research Organisation, The Volcani Center, PO Box 6, Bet Dagan 50 -250, Israel Received 26 May 1998; received in revised form 16 August 1998; accepted 16 August 1998
Abstract The HC-Pro of zucchini yellow mosiac virus (ZYMV) was found to bind to Ni2 + -NTA resin with or without His-tagging. The binding stringency was similar to that observed in proteins with a zinc finger motif like the HC-Pro. Using this characteristic we developed an efficient and rapid method (2 – 3 h) for purification of the HC-Pro of several potyviruses. A dominant protein of about 150 kDa was extracted and identified as the HC-Pro of ZYMV by means of immunoblotting. About 150 mg of HC-Pro were partially purified from the soluble fraction of 1 g of leaves. High titers of HC-Pro protein were obtained from plants infected with four potyviruses [ZYMV, watermelon mosaic virus II (WMVII), papaya ringspot virus (PRSV) and turnip mosaic virus (TuMV)]. The HC-Pros of potato virus Y (PVY) and tobacco vein mottling virus (TVMV) did not bind to the Ni2 + -NTA resin. The ZYMV-HC-Pro purified by the Ni2 + -NTA resin could bind in vitro to ZYMV virions blotted onto a membrane. All the HC-Pros which had been successfully purified by the Ni2 + -NTA resin were bound in vitro to membrane-blotted ZYMV coat protein. However, only the HC-Pros of ZYMV and WMVII were able to mediate aphid transmission of purified ZYMV virions. The purification procedure described herein is efficient and convenient, and enables HC-Pro for a number of potyviruses to be obtained in larger amounts and at higher purity than possible by means of most existing methods, based on ultracentrifugation. © 1998 Elsevier Science B.V. All rights reserved. Keywords: Potyvirus; Zinc finger; Purification; Resin
1. Introduction The helper phenomenon, in which a virus depends on another factor for its transmission by * Corresponding author. Tel.: +972-3-9683563; fax: +972-3-9683543; e-mail: [email protected].
aphids was first described in potyviruses by Kassanis (1961), and was characterized further by the sequential acquisition of transmissible and nontransmissible strains or viruses (Kassanis and Govier, 1971). Later, a component other than the virion itself was demonstrated to be involved in the assistance (Govier and Kassanis, 1974a), by
0166-0934/98/$ - see front matter © 1998 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 0 9 3 4 ( 9 8 ) 0 0 1 1 9 - 0
20
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
separation of the supernatant and the virions by means of ultracentrifugation. Successful transmission was shown to occur only when virions were mixed with the supernate, or when virions were acquired after aphids were fed with HC extract (Govier and Kassanis, 1974b; Sako and Ogata, 1981a). The proteinaceous nature of the helper was determined by Govier and Kassanis (1974a) and Govier et al. (1977) and the transmission characteristics were studied further for various potyviruses (Pirone and Thornbury, 1983; Raccah and Pirone, 1984; Antignus et al., 1989). Although the ultracentrifugation method produces biologically active HC-Pro, it leaves many other plant proteins in the preparation. Attempts to separate the HC-Pro from these other proteins have included the use of ion exchange (DEAE cellulose), sucrose gradient, and separation by SDS-PAGE (Thornbury and Pirone, 1983) or an oligo(dT) affinity column (Thornbury et al., 1985). Later, antisera were used for the identification of the HC-Pro (Hellmann et al., 1983; Hiebert et al., 1984; De Mejia et al., 1985). Use of these procedures allowed size determination of the HC-Pro (ranging between 50 and 60 kDa) and preparation of a highly specific serum against it. This antiserum made possible the unequivocal determination that the HC-Pro is a viral product rather than a host protein (Thornbury and Pirone, 1983). Thornbury et al. (1985) found that the highly purified HC-Pro had a specific activity in transmission 200 times that of the original supernatant. Unfortunately, the procedure adopted for purification of PVY HC-Pro from tobacco failed to purify the HC-Pro of other potyviruses in other hosts (Thornbury and Raccah, unpublished results) therefore, attempts were made to obtain partially purified HC-Pro by means of different protocols (Sako and Ogata, 1981b; Lecoq and Pitrat, 1985). In many plants infected with potyviruses, amorphous inclusion structures were formed from helper component subunits (Baunoch et al., 1990) which were probably not biologically active (Dougherty and Carrington, 1988). The HC-Pro activities of certain potyviruses have been demonstrated to function heterologously for transmission of potyviruses (Kassanis and Govier, 1971; Sako and Ogata,
1981b; Lecoq and Pitrat, 1985; Bourdin and Lecoq, 1991; Lecoq et al., 1993; Lopez et al., 1995). Attempts to purify HC-Pro from recombinant clones in bacterial (Gal-On, unpublished results) or baculovirus (Thornbury et al., 1993; Gal-On et al., unpublished results) expression systems yielded proteins that were biologically inactive. Sequence analysis and genetic manipulation of the HC-Pro of various potyvirus strains which are defective in transmission have revealed two motifs affecting aphid-mediated transmission: one located within the N-terminus (KITC) (Thornbury et al., 1990) and a second mapped within the central regions of the HC-Pro (Huet et al., 1994). Affinity purification of proteins with Ni2 + NTA resin has been used extensively for separating His-tagged viral proteins (Restrepo-Hartwig and Carrington, 1994). Moreover, Peng et al. (1998) adopted the Ni2 + -NTA affinity purification method for mapping a motif within the HCPro that bound to the zucchini yellow mosiac virus (ZYMV) virion. The present purification approach enables us to obtain relatively large quantities of pure helper component rapidly and simply. The HC-Pro obtained by this approach was compared with that obtained by the classic ultracentrifugation protocol and evaluated for biological activity.
2. Material and methods
2.1. Viruses, host plants and inoculation procedures The potyviruses tested comprised two zucchini yellow mosaic virus strains (ZYMV-AT, ZYMVNAT) (Antignus et al., 1989), watermelon mosaic virus II (WMVII), papaya ringspot virus (PRSV), potato virus Y (PVY), turnip mosaic virus (TuMV) and tobacco vein mottling virus (TVMV). All the viruses were isolated in Israel, except for TVMV that was kindly provided by Tom Pirone (University of Kentucky). The cucurbit viruses (ZYMV, WMVII and PRSV) were inoculated on squash (Cucurbita pepo L. cv. Ma’ayan). PVY and TVMV were inoculated on
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
tobacco (Nicotiana tabacum cv. Xanthi NN) and Nicotiana benthamina, and the TuMV was inoculated on Sinapis alba L. and Chenopodium quinoa. All plants were inoculated in the greenhouse by sap-inoculation at the cotyledon or first-leaf stage. After inoculation, the plants were maintained in a growth chamber under continuous light at about 25°C, they were examined daily for symptom development, and the first appearance of symptoms was recorded. ZYMV was purified from infected squash, as previously described by Antignus et al. (1989).
2.2. Site-directed mutagenesis and plasmid construction Clone pKSB16 of the 5% of ZYMV (Gal-On et al., 1991) served as the template for oligonucleotide-directed mutagenesis. Mutations were performed according to Kunkel et al. (1987), using an oligonucleotide that harbours the coding region for seven histidines. The oligonucleotide 5%GAAGTCGACCACTATTCGCACCACCATCA CCATCACCATTCGCAACCGGAAGTTCAG3% contains 21 nucleotides (nt) coding for seven histidines (underlined) between the sequences of the C-terminal of the P1, with a unique restriction endonuclease site SalI (bold) and the sequence encoding for the N-terminal of the HC-Pro. The mutated clone was digested by BstEII and BamHI and the mutated fragment (1.2 kb) was introduced into the appropriate sites within the full-length clone (FLC) pKS35SZYMVNOS (GalOn et al., 1995). The new clone, designated pKS35SZYMV-his-HC, was used for inoculation of squash seedlings by the bombardment method (Gal-On et al., 1996). The presence of the seven histidines in the FLC and within the progeny virions was confirmed by sequencing and by the unique restriction endonuclease SalI.
2.3. Affinity purification of the HC-Pro with Ni 2 + -NTA resin Squash seedlings were sap-inoculated with three cucurbit potyviruses, ZYMV, WMVII and PRSV. Samples of leaves (2 g) were taken 6 – 10 days post inoculation, and were homogenized by mortar
21
and pestle with 6 ml of chilled 0.3 M K2HPO4, pH 8.8 (designated HCB for HC-Pro buffer). The extract was separated from the plant debris by low-speed centrifugation at 2000× g for 10 min at 4°C. The supernatant (designated S1) was collected and mixed with 400 ml of a 50% slurry of Ni2 + -NTA that had been equilibrated with HCB prior to use (nickel–nitrilotriacetic acid resin was purchased either from Qiagen or as TALON from Clontech). The mixture was stirred for 60 min at 4°C, then centrifuged for 2 min at 1000 × g. The pellet (Ni2 + -NTA) was collected in a 1.5 ml tube and the unbound supernatant discarded. The Ni2 + -NTA resin was washed three times with chilled HCB. Elution of the pellet resin was done by mixing it with an elution buffer containing 50–200 mM of imidazole HCB (HCB-I). In a few experiments, the elution buffer included 200 mM EDTA instead of imidazole; this buffer was designated HCB-E. The eluent was incubated for 3–5 min with either HCB-I or HCB-E, the mixture was then centrifuged for 2 min at 1000× g and the supernatant containing the HC-Pro was collected in a new tube. The eluted fraction (400 ml) was kept in aliquots for further testing.
2.4. Measurement and biochemical analysis of the HC-Pro Total protein in the S1 solution and in the HC-Pro extract was measured by the method of Bradford (Sigma), according to the manufacturer’s procedures. The estimation of the HC-Pro content in the eluted extract was based on photography of the SDS-PAGE gel with a DC-40 digital camera (Kodak) and use of BioMax ID Image Analysis Software (Kodak) (Fig. 3). Plant samples and purified HC-Pro aliquots were boiled for 5 min after addition of 2× SDSpolyacrylamide gel electrophoresis (PAGE) sample buffer. Samples were separated on discontinuous 12% SDS-PAGE gels, and HC-Pro was visualized by Coomassie staining and identified by Western blotting, using an electro-blot apparatus (BIO-RAD) according to the manufacturer’s instructions. The membrane was blocked and probed with a 1:1500 dilution of primary antisera for 1 h at room temperature. The anti-
22
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
body used to detect ZYMV HC-Pro was prepared against amorphous inclusion protein of PRSV. This antibody had previously been shown to react with ZYMV and WMVII HC-Pros (Purcifull and Hiebert, 1992) The secondary antibody (1 mg/ml, anti-rabbit IgG alkaline phosphatase-conjugated (Promega) was used at a dilution of 1:5000 and the chromogenic reagents for development were nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Promega).
2.5. In 6itro binding of HC-Pros to dot-blotted 6irion of ZYMV Similar amounts (:40 mg) of Ni2 + -NTA resinpurified HC-Pro from various potyviruses were tested for binding to blotted ZYMV virion according to Blanc et al. (1997), as modified by Peng et al. (1998).
2.6. Aphid transmission Infected squash served as source plants for acquisition access feeding (AAF). Green peach aphids Myzus persicae were fasted for 1 h, then allowed a 5 min acquisition access feeding followed by an 18 h inoculation feeding on cucumber seedlings. Virus transmission from Parafilm membranes was performed by allowing a 10 min AAF from a mixture of 40 ml of Ni2 + -NTApurified HC-Pro containing 20% sucrose with 100 mg of purified ZYMV virion in 10 ml 0.1 M borate buffer, pH 8.0, as described elsewhere (Raccah and Pirone, 1984; Antignus et al., 1989).
3. Results An His-tag (7× histidine) sequence was inserted into the N%-terminus of the HC-Pro gene within the infectious clone of ZYMV (pks35SZYMVNOS) (Gal-On et al., 1995) in order to achieve highly specific purification of biological function of HC-Pro. Unexpectedly, the His-tagged HC-Pro of ZYMV which had been purified by means of the Ni2 + -NTA resin was bound to the Ni2 + -NTA resin in about the same amount and at about the same affinity (Fig. 1A,
B) as the non-tagged HC-Pro obtained from the wild-type ZYMV isolate. However, extraction of the HC-Pro under denaturing conditions revealed that only the His-tagged HC-Pro was bound to the Ni2 + -NTA resin (data not shown). A small amount of HC-Pro did not bind to the Ni2 + NTA resin and was washed out with fraction S1 (Fig. 1b). This preliminary result led us to develop a simple and fast purification methods of HC-Pro protein from various potyviruses with Ni2 + -NTA resin. The specific binding of the HC-Pro of ZYMV to the Ni2 + -NTA resin (Figs. 1 and 2) enabled us to develop a purification method that uses a small amount of infected plant tissue (e.g. 2 g of leaves). The purification procedure is based on four steps (see details in Section 2): 1. Preparation of the plant sample by grinding the tissue and collecting the soluble protein S1 (supernatant material) after low-speed centrifugation. 2. Binding step, in which the Ni2 + -NTA resin was agitated with the plant soluble protein (S1) as a batch. 3. Washing off the non-specific bound proteins. 4. Elution of the bound HC-Pro from the Ni2 + NTA resin by a competitor such as imidazole or EDTA. The purification steps last 2–3 h without the use of ultracentrifugation. The fractions eluted from the affinity Ni2 + NTA resin comprised a major band of about 50 kDa (Figs. 1–3), which was identified as HC-Pro by immune blotting with polyclonal antibody of PRSV-W to HC-Pro (Fig. 1B, Fig. 3B). In order to determine the binding stringency of the HC-Pro to the Ni2 + -NTA resin, the bound HC-Pro was eluted with increasing concentrations of imidazole. Most of the HC was eluted at concentrations of 50–75 mM of imidazole and a small amount at 100 mM (Fig. 2). No detectable amounts of HC were found using 10 mM (Fig. 2) and 25 mM (data not shown) of imidazole in the eluted fraction. Semi-quantitative analysis of the eluted HC-Pro was performed by comparison with known amounts of bovine serum albumin (BSA) (Fig. 4). The eluted extracts contained : 180–250 mg of proteins per gram of leaf tissue. The HC-Pro
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
23
Fig. 1. SDS-PAGE gel (A) and Western blot (B) analysis of total proteins from squash plants infected by the tagged ZYMV-HIS and non-tagged ZYMV during affinity purification of the HC-Pro by Ni2 + -NTA resin. H, healthy plant; I, infected plant; S1, non-bound washed protein; Ni2 + , protein eluted from the Ni2 + -NTA resin; M, prestained protein marker. The protein markers and the putative HC-Pro are labelled on the left and right sides, respectively. Proteins were stained with Coomassie brilliant blue (A) and detection of HC-Pro was performed with anti-PRSV-HC-Pro antiserum (B).
content in this extract (130 – 180 mg/g tissue) was estimated to range between 72 and 82% of the total protein (Table 1). The conventional purification method of HCPro purification used for biological transmission assay (Govier and Kassanis, 1974b; Sako and Ogata, 1981a) is based on an ultracentrifugation step for precipitation of virions and on the concentration of the soluble proteins with polyethylene glycol or ammonium sulphate (designated below as UltC). Comparison of the purity and amount of HC-Pro obtained by UltC with that obtained by the Ni2 + -NTA affinity purification method is presented in Fig. 3., in which it can be seen that many soluble proteins remained in
the extract. However, the eluate of Ni2 + -NTA contained significantly less host proteins than the extract from the UltC. Furthermore, the amount of HC-Pro extracted by UltC was small and could barely be visualized by means of Coomassie blue staining (Fig. 3A), apparently being masked by other host proteins, including the dominant ribulose bisphosphate carboxylase (Fig. 3A, lane I and UltC). In both procedures the completion of removal of virions from the extracts was determined by Western blotting and transmission tests (data not shown). Although the amount of the HC-Pro extracted by the Ni2 + -NTA was about ten times greater than that obtained by the UltC (Fig. 3B), the ability of the HC-Pro to assist transmission
24
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
from membranes (from comparable plant tissue) was about the same (85%) in the Ni2 + -NTA extraction and in the UltC extraction (Table 1) Surprisingly, all the attempts to examine the effect of dilution of the Ni2 + -NTA resin-purified HCPro resulted in sharp loss of transmission-mediating activity. The transmission efficiency was reduced to 35% after 1:1 dilution of the extract, and transmission was eliminated by 1:5 dilution. The ease of HC-Pro extraction and purification by the Ni2 + -NTA affinity method enabled us to determine the time dependence of HC-Pro accumulation in plants (Fig. 5). A high titer of soluble HC-Pro was detected in the early stage [5 days post inoculation (dpi), data not shown] and it remained at this high level for 2 weeks. A slight increase was recorded after 20 dpi, but the extract seemed to contain more non-related proteins (Fig. 5A). The major band in healthy plants (H) and in plants after 3 dpi seems to be a result of the non-specific binding of rubisco (Fig. 5B). The upper band, which reacted positively with HC-Pro antiserum (Fig. 5B) could be a dimer of HC-Pro, or HC-Pro in the partially processed polyprotein. In the light of the ease of HC-Pro purification by the Ni2 + -NTA resin, it was considered important to determine if this technique could be applied to other potyviruses. The HC-Pros of two additional cucurbit potyviruses (WMVII and PRSV) and of a cruciferous potyvirus (TuMV) were found to bind to the Ni2 + -NTA resin, their HC-Pros were rendered visible in SDS-PAGE by Coomassie brilliant blue staining (data not pre-
Fig. 2. Analysis of the stringency of binding of the HC-Pro to the Ni2 + -NTA resin. Bound proteins were eluted with various concentrations (10, 50, 75, 100, 200 mM) of imidazole as a competitor. Aliquots of 5 ml were loaded on a 12% SDSPAGE gel. The size of the protein marker (M) is labelled in kDa on the left side.
Fig. 3. SDS-PAGE gel (A) and Western blot (B) analysis of total proteins from infected squash (I) and from HC purification from 2 and 10 g of squash leaves by affinity purification by Ni2 + -NTA resin (Ni2 + ) method or by the centrifugation method (UltC), respectively. Equivalent quantities of plant tissue (from total of 400 ml of HC-Pro extruction) were loaded on the gel. The sizes of the proteins marker (M) and of the putative HC-Pro are indicated in kDa on the left and right sides, respectively. Proteins were stained with Coomassie brilliant blue (A), and detection of HC-Pro was performed with anti-PRSV HC-Pro antiserum (B).
sented) and by Western blot analysis (Fig. 6Table 2). In view of the differing accumulation of each of the three potyviruses ZYMV, WMVII and PRSV in squash (data not presented), comparison among the amounts of purified HC-Pro was not established. Interestingly, the HC-Pro of the two potyviruses that infect solanaceae (TVMV and PVY) and which were extracted from various hosts, did not bind to the Ni2 + -NTA resin (data not presented), even when the binding pH and buffers were altered.
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
Fig. 4. Semi-quantitative analysis of HC-Pro eluted from the Ni2 + -NTA resin.HC-Pro extracts in eluates (1 and 2 ml) were loaded for comparison with known quantities of BSA (0.1 and 0.5 mg) on SDS-PAGE, for estimation of the HC-Pro content within the eluted extracts. Proteins were stained with Coomassie brilliant blue. The sizes of the protein marker (M) and the putative HC-Pro and BSA are indicated in kDa on the left and right sides, respectively.
The HC-Pros of transmissible strains of ZYMV and WMVII that had been purified by Ni2 + -NTA resin (whether eluted by imidazole or by EDTA), were able to mediate transmission of ZYMV virions from membranes at efficiencies of 85 (Table 1) and 74% (52 out of 70 plants infected with WMVII), respectively. However, the HC-Pros of a non-transmissible strain of PRSV and a trans-
25
Fig. 5. Time-course analysis of the accumulation of the HCPro in ZYMV-infected squash seedlings. HC-Pro was affinitypurified at different times post inoculation (H, healthy; 3, 6, 14, 20 days) and loaded on 12% SDS-PAGE gel. Proteins were stained with Coomassie brilliant blue (A) and detection of HC-Pro was performed with anti-PRSV-HC-Pro antiserum (B). The sizes of the protein markers (M) and of the putative HC-Pro are indicated on the left and right sides, respectively.
missible strain of TuMV did not assist transmission of the ZYMV virion (Table 2).All the four purified HC-Pros (ZYMV, WMVII, PRSV and
Table 1 HC-Pro concentration at each step in the affinity Ni2+-NTA purification processes, and efficiency of transmission Purification step
Volume (ml)
Low-speed supernatant After passage through Ni NTA resin a
6 2+
-
0.4
Protein yield mg/g tissue
30 0.18–0.25
a
HC-Pro from total (mg/g tissue)
b
Aphid transmission efficiency (%) Ni2+
UtlC
n.d.
–
–
0.13–0.18
85 [109/128]
85 [69/81]
The amount of the purified HC-Pros within the extract (protein yield) were estimated by comparison with BSA as a standard (Fig. 4) (calculated with the BioMax software). b About 100 mg/ml of HC-Pro extracts and 1 mg/ml of purified ZYMV were used for aphid transmission on parafilm membrane. Numbers are of infected total seedlings. The sum represents four separating experiments with HC-Pro extracted from Ni2+-NTA or UltC. n.d., Not determined.
26
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
Fig. 6. Western blot analysis of HC-Pro extracted from squash plants infected with ZYMV, WMVII and PRSV, and from Chenopodium quinoa infected with TuMV. The sizes of the protein markers (M) in kDa are marked on the left side. HC-Pro verification was performed with anti-PRSV-HC-Pro antiserum.
TuMV) were efficiently bound to the dot-blotted ZYMV virion (Table 2) by mean of variants of methods of Peng et al. (1998).
4. Discussion HC-Pro is a multifunctional protein (see reviews: Maia, et al., 1996; Pirone and Blanc, 1996; Rojas et al., 1997; Kasschau et al., 1997) with sequence homology between potyviruses (Granier et al., 1993). Development of an efficient and simple purification method for this key potyviral encoded protein would provide an important tool for its characterization. For this reason we at-
tempted to tag the HC-Pro with a polyhistidine tail as previously demonstrated for the 6 kDa and the HC-Pro proteins of tobacco etch virus (TEV) (Restrepo-Hartwig and Carrington, 1994). The present study demonstrated that the HCPro of ZYMV can be modified at the N-terminus by the insertion of a sequence encoded for seven histidine residues. The sequence maintained stability in the viral genome and displayed no discernible effects on either virus accumulation or symptom development. The fact that HC-Pros deriving from an Histagged virus and from a non-tagged HC-Pro show similar binding stringency (50–70 mM imidazole) to Ni2 + -NTA indicates that the principal binding characteristic depends on the protein structure motif and not on the His-tagging at its N%-terminus. This result may imply that the N%-terminus may be located within the core of the protein and not exposed on the protein surface. The domain of the HC-Pro that binds to the Ni2 + -NTA is probably the putative ‘zinc-finger’ structure, that has been described near the N-terminus of the HC-Pro of potyviruses (Robaglia et al., 1989; Granier et al., 1993). It is known that proteins that harbour zinc finger motifs may bind to the Ni2 + -NTA matrix, but will then be eluted with an imidazole concentration lower than that required for His-tagged proteins (unpublished observations in the Qiagen Handbook ‘The QIA Expressionist’). Thus, the affinity of HC-Pro to Ni2 + -NTA resin provides an additional approach to HC-Pro purification, as an alternative to the ultracentrifu-
Table 2 Characteristics of the potyviral HC-Pro purified by affinity binding to Ni2+-NTA resin Source of HC-Pro purified by Ni2+
Affinity to Ni2+ resin
a
Mediation of ZYMV transmission from membranes
Binding to ZYMV virion
ZYMV WMVII PRSV TuMV PVY TVMV
+ + + + − −
+ + − − n.d. n.d.
+ + + + n.d. n.d.
a + and − indicate positive or negative HC-Pros purification with Ni2+-NTA resin, binding to ZYMV virion blotted on membrane and biological activity in transmission. n.d., Not determined.
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
gation methods developed for PVY (Govier et al., 1977), TuMV (Sako and Ogata 1981a), TVMV and PVY (Thornbury et al., 1985), and WMV II and ZYMV (Lecoq and Pitrat, 1985). A comparison of the two methods shows that the HC-Pro eluted from the Ni2 + -NTA resin is less contaminated with non-related host proteins than that obtained by ultracentrifugation as described by Govier et al. (1977), and is comparable in purity with the preparation obtained by Thornbury et al. (1985) by means of oligo(dT) cellulosepurification (Thornbury et al., 1990). The TVMV and PVY HC-Pros, extracted from tobacco, did not bind to the Ni2 + -NTA resin. This was in contrast to the efficient binding of HC-Pros extracted from cucurbits (ZYMV, WMVII and PRSV) or cruciferous mustard (TuMV). The simplest explanation could be in terms of a host effect that might affect the binding capacity of the HC-Pro. However, HC-Pro of PVY extracted from several different hosts (N. tabacum cv. Xanthi NN, N. benthamina; C. amaranticolor) also did not bind to Ni2 + -NTA resin. Another explanation could be a difference in the kinetics of soluble HC-Pro accumulation and/or in the rate of amorphous inclusion formation. It is also possible that the binding conditions needed for purification of PVY and TVMV HC-Pro by the Ni2 + -NTA method differ from those required for purification of ZYMV-HC (Sako and Ogata, 1981b). The HC-Pros of four potyviruses, ZYMV, WMVII, PRSV and TuMV, were successfully purified with the Ni2 + -NTA resin. Successful heterologous transmission of ZYMV virions with HC-Pro of WMVII and PRSV, by aphids and with other potyviruses, has been reported (Kassanis and Govier, 1971; Sako and Ogata, 1981b; Lecoq et al., 1993; Lopez et al., 1995). Therefore, it was expected that the Ni2 + -NTA resin-purified HC-Pro would assist transmission of ZYMV. However, in the present study, ZYMV was transmitted only when transmission was assisted by the HC-Pro of ZYMV or WMVII but not by that of PRSV or TuMV. The PRSV was a non-transmissible isolate (tested only in cucurbits), therefore, the inability to transmit ZYMV virion could be explained by biological inactivity of PRSV
27
HC-Pro. However, the ability of PRSV HC-Pro to mediate transmission of ZYMV was previously reported by Bourdin and Lecoq (1991), and the possibility that the inability to mediate aphid transmission is related to mutation(s) within the HC-Pro requires further study. On the other hand, the HC-Pro of PRSV was bound to virions in vitro, and this binding of purified HC-Pro of PRSV to blotted ZYMV coat protein may only indicate an association between the two proteins in vitro. The HC-Pro of transmissible TuMV virus could not mediate transmission of the ZYMV virion (Table 2), which was similar to the results obtained by Sako and Ogata (1981b), who could not achieve transmission of WMVII virions with TuMV HC-Pro extracts. Therefore, we consider that the two viruses ZYMV and TuMV are phylogenically too distant to assist in heterologous transmission. We did not test the transmissibility by membrane feeding of TuMV HC-Pro in transmission of the homologous virion, as we were unable to purify the virion of TuMV sufficiently for membrane transmission experiments. The high yield of HC-Pro purified by Ni2 + NTA affinity (150 mg/g) was not correlated with the rapid reduction of aphid transmission efficiency from 77 to 0% obtained on membrane feeding after 1:5 dilution. It is, therefore, possible that during purification most of the HC-Pro lost its native structure and function. The potyviral HC-Pro probably functions in aphid transmission as a dimer (Thornbury et al., 1985). In heterologous systems in which HC-Pro was expressed in E. coli (Gal-On, unpublished results), or in insect cells (Thornbury et al., 1993; Gal-On et al., unpublished results) no activity of aphid-mediated transmission was obtained, probably because of inability to form a proper functional conformation of the expressed protein. However, in cauliflower mosaic virus, a biological function of HC-Pro obtained from such a heterologous expression system has been reported (Schmidt et al., 1994). We assume that the relatively low efficiency of aphid transmission obtained from the HC-Pro extracted by Ni2 + -NTA resin could be due to incomplete folding of the eluted HC-Pro molecule from the Ni2 + -NTA resin.
28
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29
If formation of HC-Pro dimer and the affinity binding of HC-Pro to the Ni2 + -NTA resin arise from the same putative zinc finger motif (Robaglia et al., 1989) then we may deduce that most of the HC-Pro extracted from the Ni2 + NTA resin is in monomer form which seems to be a biologically inactive molecule.
Acknowledgements This work was supported in part by grants from the US–Israel Binational Research and Development Fund (US-2666-95R and US-254195R) and the Chief Scientist of the Ministry of Agriculture (135-1070-97). Contribution from the Agricultural Research Organisation, No. 518/98. PRSV-HC-Pro antibody was kindly given by Dr D.E. Purcifull and Dr E. Hiebert of the University of Florida, USA.
References Antignus, Y., Raccah, B., Gal-On, A., Cohen, S., 1989. Biological and serological characterization of zucchini yellow mosaic and watermelon virus 2 isolates in Israel. Phytoparasitica 17, 289 – 298. Baunoch, D. A., Das, P., Hari, V., 1990. Potato virus Y helper component protein is associated with amorphous inclusions. J. Gen. Virol. 71, 2479–2482. Blanc, S., Lopez-Moya, J-J., Wang, R., Garcia-Lampasone, S., Thornbury, D.W., Pirone, T.P., 1997. A specific interaction between coat-protein and helper component correlates with aphid transmission of a potyvirus. Virology 231, 141 – 147. Bourdin, D., Lecoq, H., 1991. Evidence that heteroencapsidation between two potyviruses is involved in aphid transmission of a non-transmissible isolate from mixed infections. Phytopathology 81, 1459–1464. De Mejia, M.V.G., Hiebert, E., Purcifull, D.E., Thornbury, D.W., Pirone, T.P., 1985. Identification of potyviral amorphous inclusion protein as a non-structural virus-specific protein related to helper component. Virology 142, 34–43. Dougherty, W.G., Carrington, J.C., 1988. Expression and function of potyviral gene products. Ann. Rev. Phytopathol. 26, 123 – 143. Gal-On, A., Antignus, Y., Rosner, A., Raccah, B., 1991. Infectious in vitro RNA transcripts derived from the cloned cDNA of the cucurbit potyvirus, zucchini yellow mosaic virus. J. Gen. Virol. 72, 2639–2643.
Gal-On, A., Meiri, E., Huet, H., Hua, W.J., Raccah, B., Gaba, V., 1995. Particle bombardment drastically increases the infectivity of cloned DNA of zucchini yellow mosaic potyvirus. J. Gen. Virol. 76, 3223 – 3227. Gal-On, A., Meiri, E., Elman, C., Gray, D.J., Gaba, V., 1996. Simple hand-held devices for the efficient infection of plants with viral-encoding constructs by particle bombardment. J. Virol. Methods. 64, 103 – 110. Govier, D.A., Kassanis, B., 1974. Evidence that a component other than the virus particle is needed for aphid transmission of potato virus Y. Virology 57, 285 – 286. Govier, D.A., Kassanis, B., 1974. A virus induced component of plant sap needed when aphids acquire potato virus Y from purified preparations. Virology 61, 420 – 426. Govier, D.A., Kassanis, B., Pirone, T.P., 1977. Partial purification and characterization of potato virus Y helper component. Virology 78, 306 – 314. Granier, F., Durand-Tardif, M., Casse-Delbart, F., Lecoq, H., Robaglia, C., 1993. Mutations in zucchini yellow mosaic virus helper component protein associated with loss of aphid transmissibility. J. Gen. Virol. 74, 2737 – 2742. Hellmann, G.M., Thornbury, D.W., Hiebert, E., Shaw, J.G., Pirone, T.P., Rhoads, R.E., 1983. Cell-free translation of tobacco vein mottling virus RNA. II: immunoprecipitation of products by antisera to cylindrical inclusion, nuclear inclusion, and helper component proteins. Virology 124, 434 – 444. Hiebert, E., Thornbury, D.W., Pirone, T.P., 1984. Immunoprecipitation analysis of potyviral in vitro translation products using antisera to helper component of tobacco vein mottling virus and potato virus Y. Virology 135, 1 – 9. Huet, H., Gal-On, A., Meir, E., Lecoq, H., Raccah, B., 1994. Mutations in the helper component (HC) gene of zucchini yellow mosaic virus (ZYMV) affect aphid transmissibility. J. Gen. Virol. 75, 1407 – 1414. Kassanis, B., 1961. The transmission of potato aucuba mosaic virus by aphids from plants also infected by potato viruses A or Y. Virology 13, 93 – 97. Kassanis, B., Govier, D.A., 1971. The role of helper virus in aphid transmission of potato aucuba mosaic virus and potato virus C. J. Gen. Virol. 13, 221 – 228. Kasschau, K.D., Cronin, S., Carrington, J.C., 1997. Genome amplification and long-distance movement functions associated with the central domain of tobacco etch potyvirus helper component-proteinase. Virology 228, 251 – 262. Kunkel, T.A., Roberts, J.D., Zakour, R.A., 1987. Rapid and efficient site-specific mutagensis without phenotypic selection. Meth. Enzymol. 154, 367 – 382. Lecoq, H., Pitrat, M., 1985. Specificity of the helper-component-mediated aphid transmission of three potyviruses infecting muskmelon. Phytopathology 75, 890 – 893. Lecoq, H., Ravelonandro, M., Wipf-Scheibel, C., Monsion, M., Raccah, B., Dunez, J., 1993. Aphid transmission of a non-aphid-transmissible strain of zucchini yellow mosaic potyvirus from transgenic plants expressing the capsid protein of plum pox potyvirus. Mol. Plant – Microbe Interact. 6, 403 – 406.
D. Kadouri et al. / Journal of Virological Methods 76 (1998) 19–29 Lopez, M.J.J., Canto, T., Diaz, R.J.R., Lopez, A.D., 1995. Transmission by aphids of a naturally non-transmissible plum pox virus isolate with the aid of potato virus Y helper component. J. Gen. Virol. 76, 2293–2297. Maia, I.G., Haenni, A.L., Bernardi, F., 1996. Potyviral HCPro: a multifunctional protein. J. Gen. Virol. 77, 1335– 1341. Peng, Y.H., Kadoury, D., Gal-On, A., Heut, H., Wang, Y., Raccah, B., 1998. Mutation in the HC-Pro gene of the zucchini yellow mosaic potyvirus: effects on aphid transmission and on binding to purified virions. J. Gen. Virol. 79, 897 – 904. Pirone, T.P., Thornbury, D.W., 1983. Role of virion and helper component in regulating aphid transmission of tobacco etch virus. Phytopathology 83, 872–875. Pirone, T.P., Blanc, S., 1996. Helper-dependent vector transmission of plant viruses. Ann. Rev. Phytopathol. 34, 227– 247. Purcifull, D., Hiebert, E., 1992. Serological relationships involving potyviral non-structural proteins. In: Barnett, O.W. (Ed.), Potyvirus Taxonomy: Archives of Virology (Suppl. 5). Springer, Vienna and New York, pp. 97–122. Raccah, B., Pirone, T.P., 1984. Characteristics of factors affecting helper-component-mediated aphid transmission of a potyvirus. Phytopathology 74, 303–308. Restrepo-Hartwig, M.A., Carrington, C.J., 1994. The tobacco etch potyvirus 6-kilodalton protein is membrane associated and involved in viral replication. J. Virol. 68, 2388–2397. Robaglia, C., Durand-Tardiff, M., Tronchet, M., Boudazin, G., Astier-Manifacier, S., Casse-Delbart, F., 1989. Nucle-
otide sequence of potato virus Y (N strain) genomic RNA. J. Gen. Virol. 70, 935 – 947. Rojas, M.R., Zerbini, F.M., Allison, R.F., Gilbertson, R.L., Lucas, W.J., 1997. Capsid protein and helper componentproteinase function as potyvirus cell-to-cell movement proteins. Virology 237, 283 – 295. Sako, N., Ogata, K., 1981. A helper factor essential for aphid transmissibility of turnip mosaic virus. Ann. Phytopath. Soc. Japan 47, 68 – 70. Sako, N., Ogata, K., 1981. Different helper factors associated with aphid transmission of some potyviruses. Virology 112, 762 – 765. Schmidt, I., Blanc, S., Esperandieu, P., et al., 1994. Interaction between the aphid transmission factor and virus particles is part of the molecular mechanism of cauliflower mosaic virus aphid transmission. Proc. Natl. Acad. Sci. USA 91, 8885 – 8889. Thornbury, D.W., Pirone, T.P., 1983. Helper components of two potyviruses are serologically distinct. Virology 125, 487 – 490. Thornbury, D.W., Hellmann, G.M., Rhoads, R.E., Pirone, T.P., 1985. Purification and characterization of potyvirus helper component. Virology 144, 260 – 267. Thornbury, D.W., Patterson, C.A., Dessens, J.T., Pirone, T.P., 1990. Comparative sequence of the helper component (HC) region of potato virus Y and a HC-defective strain, potato virus C. Virology 178, 573 – 578. Thornbury, D.W., Heuvel, J.F.J.M. v.d., Lesnaw, J.A., Pirone, T.P., 1993. Expression of potyvirus proteins in insect cells infected with a recombinant baculovirus. J. Gen. Virol. 74, 2731 – 2735.
. .
29