- Email: [email protected]
Age-related changes of gene expression in mouse kidney: fluorescence differential display — PCR analyses
Mechanisms of Ageing and Development 113 (2000) 135 – 144 www.elsevier.com/locate/mechagedev
Age-related changes of gene expression in mouse kidney: fluorescence differential display — PCR analyses R. Iida a,*, T. Yasuda b, M. Aoyama c, E. Tsubota a, T. Matsuki a, K. Kishi b b
a Department of Forensic Medicine, Fukui Medical Uni6ersity, Fukui 910 -1193, Japan Department of Legal Medicine, Gunma Uni6ersity School of Medicine, Gunma 371 -8511, Japan c Department of Internal Medicine, National Takasaki Hospital, Gunma 370 -0829, Japan
Received 21 September 1999; received in revised form 28 October 1999; accepted 2 November 1999
Abstract We used a fluorescence differential display — PCR (FDD-PCR) technique to analyze the genes expressed in mouse kidneys collected at nine different developmental stages ranging from 3 days to 15 months after birth. We found ten genes that were age-dependent and differentially-expressed in the kidneys during our experimental period. We confirmed by comparative RT-PCR that of the ten cDNAs, seven showed reproducible age-dependent expression. Four of the nucleotide sequences of these cDNA clones, had high homology with known genes (fibronectin, soluble guanylyl cyclase a-1 subunit, cytosolic aldehyde dehydrogenase and mitochondrial DNA), and three with expressed sequence tags of unknown genes. The FDD-PCR method was very useful for detecting new age-related genes expressed differentially in the mouse kidney. © 2000 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Age-related; Differential display-PCR; Gene expression; RT-PCR; Mouse kidney
1. Introduction Recently, a number of mammalian genes that are differentially-expressed in the process of development (Adati et al., 1995; Gupta et al., 1998) or senescence (West, * Corresponding author. Tel.: +81-776-61-3111; fax: +81-776-61-8108. E-mail address: [email protected] (R. Iida) 0047-6374/00/$ - see front matter © 2000 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 0 4 7 - 6 3 7 4 ( 9 9 ) 0 0 1 0 4 - 9
136
R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
1994; Linskens et al., 1995) have been reported. However, studies of these genes have been limited to clarification of the short-term changes occurring over their lifetimes. Our interest lies, in identifying new differentially-expressed genes and in examining changes in their levels of expression over longer periods; we intend to apply these expression changes as stage markers for age estimation; age is very difficult to read from biological samples, soft tissues and body fluids. In a previous study, we found a human young age-related glycoprotein (Ugl-Y) that is secreted into the urine of children aged 17 years or less (Kishi and Iseki, 1982; Iida et al., 1987). Since Ugl-Y is not detected in the plasma, we assume that it may originate from the kidney. Recently, it has been demonstrated that age-related increases of several proteins occur in the rat kidney, including transforming growth factor-b1 (Ruiz-Torres et al., 1998), clusterin (Laping et al., 1998), heatshock protein 47 (Razzaque et al., 1998) and thrombospondin 1 (Olson et al., 1999). However, the gene expression profile of the aging process in the kidney, has not been analyzed systematically. Therefore, we chose the mouse kidney as the model organ. As a preliminary study to isolate age-related genes, we performed fluorescence differential display (FDD)-PCR and comparative RT-PCR testing on total RNA extracted from mouse kidneys from the third day to the fifteenth month after birth. In this paper, we report the high efficiency of our experimental procedure, that used FDD-PCR for the identification of age-related or age-dependent genes of the mouse kidney.
2. Materials and methods
2.1. RNA isolation from mouse kidneys C57BL/6 mice were used in this study. They were tested on the third day, or the first, second, fourth or sixth week, or the fourth, sixth, ninth or fifteenth month after birth. The kidneys were dissected while the mice were under anesthesia with pentobarbital, then frozen immediately in dry-ice-ethanol and kept at − 80°C until RNA preparation. All manipulations involving the mice, were reviewed and approved by the institutional animal care and use committee. Total RNA was isolated according to the acid guanidium thiocyanate-phenol-chloroform extraction procedure (Chomczynski and Sacchi, 1987). Possible DNA contamination was removed by treatment with RNase-free DNase I (Stratagene).
2.2. Fluorescence differential display-PCR Fluorescence differential display-PCR (FDD-PCR) was performed as described previously (Ito et al., 1994; Adati et al., 1995) with the following minor modifications. The total RNA (2 mg) was reverse-transcribed using three 3%-anchored oligo-dT primers (GT15A, GT15C and GT15G). Thirty different sets of primers — the combination of ten arbitrary primers (Operon, Alameda, CA; OP-26-01:
R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
137
TACAACGAGG, OP-26-02: TGGATTGGTC, OP-26-03: CTTTCTACCC, OP26-04: TTTTGGCTCC, OP-26-05: GGAACCAATC, OP-25-06: AAACTCCGTC, OP-26-07: TCGATACAGG, OP-26-08: TGGTAAAGGG, OP-26-09: TCGGTCATAG, and OP-26-10: GGTACTAAGG) and the 3%-anchored oligo-dT primers (see above) — were used for PCR amplification of cDNA. PCR amplification was carried out in a total volume of 20 ml, containing 2 ml of cDNA solution, 10 mM Tris – HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM of each dNTP, 0.25 mM of 3%-anchored oligo-dT primer, 0.5 mM of arbitrary primer and one unit of Taq polymerase (AmpliTaq, Perkin – Elmer Applied Biosystems), using a DNA thermal cycler (GeneAmp PCR system 9700, Perkin–Elmer Applied Biosystems). The PCR cycling conditions were 94°C for 3 min, 40°C for 5 min and 72°C for 5 min, then 25 cycles (95°C for 15 s, 40°C for 2 min and 72°C for 1 min), followed by 72°C for 5 min. The amplified cDNAs were separated on a native 7% polyacrylamide gel (200× 300 ×0.35) in 0.375 M Tris-HCl (pH 8.9) using 0.025 M Tris-0.192 M glycine running buffer at Vmax 1000V, Imax 40 mA, Pmax 50 W for 1 h at 30°C. After electrophoresis, the gel was stained with SYBR Green I (Molecular Probes), and the band pattern was observed using a fluorescence image analyzer (FluorImager SI, Molecular Dynamics).
2.3. Cloning and sequencing of differentially displayed products The gel region corresponding to the differentially displayed band was excised and added directly to 100 ml of PCR reaction mixture. After reamplification, the amplified cDNA was subcloned and sequenced. Clones bearing the bands of interest were identified by two methods: a comparison test of the fragment sizes with the original cDNAs and a co-migration test with the original cDNA on DD gels. The nucleotide sequences were tested for homology, to known sequences in the DNA database of the NCBI by BLAST search. New DNA sequences of cDNA clones, identified in our study, were submitted to the GenBank database (accession nos. AI482564-AI482567).
2.4. Comparati6e RT-PCR Comparative RT-PCR was performed according to the methods reported previously (Yokoi et al., 1993; Kojima et al. 1994), with modifications. DNA-free total RNAs (3.5 mg) were reverse-transcribed using Superscript II and oligo(dT)12 – 18 (GIBCO BRL). The sense and the antisense primers for mouse glyceraldehyde-3phosphate dehydrogenase (GAPDH) were purchased from Clontech. The yield of PCR product, reflects the amount of template DNA, only under conditions in which amplification proceeds exponentially; therefore, the optimum PCR cycle numbers for quantification of respective target cDNAs, were determined by examining the correlation between PCR cycle numbers and the yield of PCR products. The primer sequences, the annealing temperature and the optimum number of PCR cycles are summarized in Table 1. The times used for denaturing, annealing and extension at each cycle were established as 0.5, 0.5 and 1 min, respectively. For the
138
R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
analysis of the expression pattern, the concentration of each template cDNA was normalized against GAPDH. After amplification of the optimum number of cycles, all of the PCR product was separated on 2% (w/v) agarose gels and stained with ethidium bromide; the intensity of the fluorescence was then measured by a CCD imaging system (AE-6910 BXII, Atto, Tokyo, Japan). Each assay was performed in triplicate. The intra- and inter-assay variabilities were B 7 and B 10%, respectively.
2.5. Quantitati6e TaqMan RT-PCR TaqMan RT-PCR was performed with GAPDH and two of the differentially-expressed genes (K6 and K9) on a Model 7700 Sequence Detector System (Perkin– Elmer Applied Biosystems) according to the method previously described (Kruse et al., 1997; Luoh et al., 1997), with slight modifications. The primers and the TaqMan probes for GAPDH (TaqMan Rodent GAPDH control reagents) were supplied by Perkin – Elmer Applied Biosystems, and those for K6 and K9 were designed using the primer design software Primer Express™ (Perkin–Elmer Applied Biosystems) as follows: K6, sense primer: TGAGCAAAGACAGCATCCCAG, antisense primer: GGGACCACTTTACATATGCAACG, TaqMan Table 1 Primers and conditions for comparative RT-PCR cDNA
GAPDH K1 K2 K3 K4 K5 K6 K7 K8 K9 K10
Primers Sense
Antisense
TGAAGGTCGGTGTGAACGGATTTGGC TACCGGTGACTGGAAGGGTC TTTCTTTTGCCATCTGAC ATTAATTCCCCACCGTCTTT AGACAAGAAATGCCCCTTCA GACCAGGTGCTTTCCATT AGACATAGCTAGACGCAAAG TTCCTGGAGTCCGCTTTA AATAAAGTTTTGCCGCAGAA CAGGTGCCAATAAGACATT AATTTTTACAGCGGGAGTA
CATGTAGGCCATGAGGTCCACCAC GCCGGGCAATGTAGACAATC ACACTTGTCTTTCCCAGTAG CACAGGCGACACAAGTGA TGGCCAGAGTCCCCTTAGA CAAGCAGGCATGACATTCTA GAAGGGTAAGCCAAGG TGATCTTGGCCTTTCTTTCT CAGAGTCCCGTAATGCTGTC CGCAGTAGGAACAGTGATTT AGAAATAAGAGGGCTTGAAC
Annealing temperature (°C)
Number of cycles
50
28
50
23
55
28
50
28
50
22
50
28
50
28
50
22
50
24
50
23
50
22
R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
139
probe: ATGGGTGCGTTCACGGTGGATTCA; K9, sense primer: GCACTACACTGATGGAGGAAGTTATC, antisense primer: GGAACAGTGATTTTTATTTACAAAGATTGC, TaqMan probe: TCAAGTGAGAATTGTTTGTGGTTTTCAAAA. Amplifications of cDNA were performed according to the manufacturer’s instructions. Serial 1:4 dilutions of cDNA, which was reversetranscribed from the 3-day-old mouse kidney total RNA, were analyzed for each target cDNA. These served as standard curves from which to determine the rates of change of the values. All PCR assays were performed in triplicate. The inter-assay variability was B 9%.
3. Results
3.1. Screening of differentially expressed genes by FDD-PCR To identify age-related genes expressed in the mouse kidney from the third day to the fifteenth month after birth, we performed FDD-PCR using total RNA. Our protocol gave fingerprints composed of : 50 bands in the size range of 120 – 1500 bp in a reproducible fashion. Using 30 sets of primers (ten arbitrary primers, OP-26-1 to OP-26-10, in combination with three anchor primers), we could find ten differentially-expressed bands, which were designated K1–K10. All of these cDNA were excised from the gel, re-amplified, cloned into plasmid vectors and then sequenced.
3.2. Confirmation of differential expression by comparati6e RT-PCR In order to confirm the differential expression of the cDNAs detected by FDD-PCR, we performed comparative RT-PCR using GAPDH as an endogenous RNA standard. Of the ten cDNAs, seven (K2, K3, K5, K6, K8, K9 and K10) were found to express age-dependent patterns (Fig. 1); the patterns were similar to those detected on the DD gels. The remaining three (K1, K4 and K7) showed age-independent patterns throughout the experimental period (data not shown) and had significant homology with the mRNAs of the ribosomal proteins L12, S11 and S23, respectively. The expression of three genes (K5, K8 and K10) increased with age, whereas the other four (K2, K3, K6 and K9) decreased. Interestingly, expression of K8 was observed only after the fourth month. From nucleotide sequence analyses, K2 showed high homology to mouse fibronectin (FN), K3 to the Rattus nor6egicus soluble guanylyl cyclase (sGC)− 1 subunit, K5 to mouse cytosolic aldehyde dehydrogenase, K10 to Mus domesticus strain NZB/BINJ mitochondrion genome, and K6, K8 and K9 to mouse expressed sequence tags of unknown genes (Table 2). The new sequences identified in our study were submitted to the GenBank database (accession nos.: K3, AI482567; K6, AI482566; K8, AI482564; and K9, AI482565).
140 R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
Fig. 1. Expression of differentially-expressed genes during aging, detected by comparative RT-PCR. The nucleotide sequence of the primers and the optimum conditions for PCR are shown in Table 1 and in Section 2. The PCR product was separated on 2% (w/v) agarose gels and stained with ethidium bromide; the intensity of the luminescence was measured with a CCD imaging system. Each value was measured in triplicate, and the results are expressed as a percentage of the maximum mean value.
R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
141
Table 2 Summary of differentially displayed cDNAs during development and aging cDNA (accession no.)
Corresponding sequence (accession no.)
Identities (% homology)
K2 K3 (AI482567)
Mouse fibronectin mRNA (GenBank M18194) Rattus nor6egicus soluble guanylyl cyclase a 1 subunit mRNA (GenBank U60835) Mouse aldehyde dehydrogenase mRNA (GenBank M74570) Mouse ESTs AA041942, AA914549, AA003197, etc. Mouse ESTs AA986921, AA289345, AI226933 Mouse ESTs AI314031, AA276435, AA497564, etc. Mus domesticus strain NZB/BINJ mitocondrion genome (GenBank L07095)
314/319 (98) 349/393 (89)
K5 K6 (AI482566) K8 (AI482564) K9 (AI482565) K10
237/238 (99)
218/218 (100)
Fig. 2. Quantification of mRNAs of the two differentially-expressed genes of mouse kidney, K6 (A) and K9 (B), by the TaqMan-PCR method (black bars) and comparative RT-PCR analysis using a CCD imaging system (white bars). The amount of mRNA was normalized to the internal control GAPDH. The results are expressed as a ratio relative to the value of 3D (mouse kidney mRNA at the third day after birth). D, day; W, week; M, month.
3.3. Quantification of mRNA by TaqMan PCR method To examine the quantitative accuracy of the comparative RT-PCR, we performed quantification of the transcripts of two unknown genes, K6 and K9, using the TaqMan fluorogenic detection system. The expression profiles of both genes, obtained by the use of the TaqMan PCR method, fitted well with those of the comparative RT-PCR, indicating the validity of the comparative RT-PCR method (Fig. 2A, B).
142
R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
4. Discussion We applied the FDD-PCR method to the analysis of mouse kidney mRNAs and succeeded in obtaining seven genes that had age-dependent expression patterns. Of these genes, four (K2, K3, K5 and K10) are known, and are almost identical to FN, sGC, cytosolic aldehyde dehydrogenase and mitochondrial DNA, respectively. FN is a glycoprotein, localized in the extracellular matrix of most tissues. It has been shown to mediate diverse cellular functions (Mosher, 1989). A decreasing pattern was observed in the expression of FN during aging (Fig. 1, lane K2); it was similar to those found in previous observations of the rat heart (Mamuya et al., 1992) and liver (Singh and Kanungo, 1993). In contrast, an increasing pattern has been observed in the rat aorta (Takasaki et al., 1990). These inconsistent experimental results suggest strongly that FN expression, is influenced by tissuespecific regulatory factors (Mamuya et al., 1992; Singh and Kanungo, 1993). GC is an enzyme that produces cyclic GMP and exists in two isoforms: membranebound isoform and soluble isoform (sGC); the latter is composed of an a and a b subunit. K3 was found to show a high homology (89% in 393 nt) with the rat sGC a1 subunit, and we observed a gentle decrease during aging (Fig. 1, lane K3). This finding concurs with those of previous reports that sGC activity in the rat brain is high immediately after birth and decreases during the early postnatal weeks (De Vente and Steinbusch, 1992; Van Eden et al., 1996). Cytosolic aldehyde dehydrogenase, one of the three major aldehyde dehydrogenase isozymes that participate in acetaldehyde metabolism, was found in this study to be up-regulated during aging (Fig. 1, lane K5); this finding correlates well with previous observations of the mouse liver (Rout et al., 1987). Interestingly, the expression of K10, which was found to be identical to mouse mitochondrial DNA, was shown to increase with age (Fig. 1, lane K10). Considering that all mitochondrial transcripts are transcribed as a single RNA precursor (Ojala et al., 1981), this observation is in contrast to that of previous reports, which have found that the concentration of mitochondrial RNA declines with age (Fernandez-Silva et al., 1991; Barrientos et al., 1997). This indicates the possibility that age-dependent differential expression of K10 is influenced by post transcriptional mechanisms such as stabilization or degradation. In our laboratory, we are investigating the three unknown genes (K6, K8 and K9) that showed age-dependent expression patterns, in order to determine their origins and functions. DD-PCR has been shown to be a powerful tool for discovering differentially-expressed genes; however, DD-PCR has technical limitations, including a high incidence of false positives, a bias for abundant transcripts and a highly laborious methodology. In this study, the application of two non isotopic techniques — FDD-PCR to the first screening and the comparative RT-PCR to the subsequent confirmation — enabled us to reduce greatly the labor, expenditure and time needed. In conclusion, the protocol described above is applicable to the rapid identification of genes that are differentially-expressed during aging.
R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
143
Acknowledgements We are grateful to Dr H. Naiki for his useful advice and encouragement. We wish to thank F. Nakamura for her secretarial assistance. This study was supported in part by grants-in-aid for scientific research from the ministry of education, science, sports and culture of Japan (09877090 to RI, 11897010, 10307010 and 09357004 to KK, and 09470122 to TY). References Adati, N., Ito, T., Koga, C., et al., 1995. Differential display analysis of gene expression in developing embryos of Xenopus lae6is. Biochim. Biophys. Acta 1262, 43 – 51. Barrientos, A., Casademont, J., Cardellach, F., et al., 1997. Reduced steady-state levels of mitochondrial RNA and increased mitochondrial DNA amount in human brain with aging. Mol. Brain. Res. 52, 284–289. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156 – 159. De Vente, J., Steinbusch, H.W.M., 1992. On the stimulation of soluble and particulate guanylate cyclase in the rat brain and the involvement of nitric oxide as studied by cGMP immunocytochemistry. Acta Histochem. 92, 13–38. Fernandez-Silva, P., Petruzzella, V., Fracasso, F., Gadaleta, M.N., Cantatore, P., 1991. Reduced synthesis of mtRNA in isolated mitochondria of senescent rat brain. Biochem. Biophys. Res. Commun. 176, 645–653. Gupta, R., Thomas, P., Beddington, R.S.P., Rigby, W.J., 1998. Isolation of developmentally regulated genes by differential display screening of cDNA libraries. Nucleic Acids Res. 26, 4538 – 4539. Iida, R., Yasuda, T., Kishi, K., 1987. Purification of a young age-related glycoprotein (Ugl-Y) from normal human urine. J. Biochem. 101, 357 – 363. Ito, T., Kito, K., Adati, N., et al., 1994. Fluorescent differential display: arbitrarily primed RT-PCR fingerprinting on an automated DNA sequencer. FEBS Lett. 351, 231 – 236. Kishi, K., Iseki, S., 1982. Young age-related glycoproteins revealed in normal human by isoelectric focusing. Proc. Japan Acad. 58B, 229 – 231. Kojima, K., Kanzaki, H., Iwai, M., et al., 1994. Expression of leukemia inhibitory factor in human endometrium and placenta. Biol. Reprod. 50, 882 – 887. Kruse, N., Pette, M., Toyka, K., Rieckmann, P., 1997. Quantification of cytokine mRNA expression by RT PCR in samples of previously frozen blood. J. Immunol. Methods 210, 195 – 203. Laping, N.J., Olson, B.A., Day, J.R., et al., 1998. The age-related increase in renal clusterin mRNA is accelerated in obese Zucker rats. J. Am. Soc. Nephrol. 9, 38 – 45. Linskens, M.H.K., Feng, J., Andrews, W.H., et al., 1995. Cataloging altered gene expression in young and senescent cells using enhanced differential display. Nucleic Acids Res. 23, 3244 – 3251. Luoh, S.M., Di Marco, F., Levin, N., et al., 1997. Clonimg and characterization of a human leptin receptor using a biologically active leptin immunoadhesin. J. Mol. Endcrinol. 18, 77 – 85. Mamuya, W., Chobanian, A., Brecher, P., 1992. Age-related changes in fibronectin expression in spontaneously hypertensive, Wistar – Kyoto, and Wistar rat hearts. Circ. Res. 71, 1341 – 1350. Mosher, D.F., 1989. Fibronectin. Academic Press, San Diego, CA. Ojala, D., Montoya, J., Attardi, G., 1981. tRNA punctuation model of RNA processing in human mitochondria. Nature 290, 470–474. Olson, B.A., Day, J.R., Laping, N.J., 1999. Age-related expression of renal thrombospondin 1 mRNA in F344 rats: resemblance to diabetes-induced expression in obese Zucker rats. Pharmacology 58, 200–208.
144
R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
Razzaque, M.S., Shimokawa, I., Nazneen, A., Higami, Y., Taguchi, T., 1998. Age-related nephropathy in the Fischer 344 rat is associated with over expression of collagens and collagen-binding heat shock protein 47. Cell Tissue Res. 293, 471 – 478. Rout, U.K., Elkington, J.S.H., Holmes, R.S., 1987. Developmental changes in aldehyde dehydrogenases from mouse tissues. Mech. Age. Dev. 40, 103 – 113. Ruiz-Torres, M.P., Bosch, R.J., O’Valle, F., et al., 1998. Age-related increase in expression of TGF-beta1 in the rat kidney: relationship to morphologic changes. J. Am. Soc. Nephrol. 9, 782 – 791. Singh, S., Kanungo, M.S., 1993. Changes in expression and CRE binding proteins of the fibronectin gene during aging of the rat. Biochem. Biophys. Res. Commun. 193, 440 – 445. Takasaki, I., Chobanian, A.V., Sarzani, R., Brecher, P., 1990. Effect of hypertension on fibronectin expression in the rat aorta. J. Biol. Chem. 265, 21935 – 21939. Van Eden, C.G., Steinbusch, H.W.M., Rinkens, A., De Vente, J., 1996. Developmental pattern of NADPH-diaphorase activity and nitric oxide-stimulated cGMP immunoreactivity in the frontal rat cortex and its role in functional recovery from aspiration lesions. J. Chem. Neuroanat. 10, 279 – 286. West, M.D., 1994. The cellular and molecular biology of skin aging. Arch. Dermatol. 130, 87 – 95. Yokoi, H., Natsuyama, S., Iwai, M., et al., 1993. Non radioisotopic quantitative RT-PCR to detect changes in mRNA levels during early mouse embryo development. Biochem. Biophys. Res. Commun. 195, 769–775.
.
Age-related changes of gene expression in mouse kidney: fluorescence differential display — PCR analyses R. Iida a,*, T. Yasuda b, M. Aoyama c, E. Tsubota a, T. Matsuki a, K. Kishi b b
a Department of Forensic Medicine, Fukui Medical Uni6ersity, Fukui 910 -1193, Japan Department of Legal Medicine, Gunma Uni6ersity School of Medicine, Gunma 371 -8511, Japan c Department of Internal Medicine, National Takasaki Hospital, Gunma 370 -0829, Japan
Received 21 September 1999; received in revised form 28 October 1999; accepted 2 November 1999
Abstract We used a fluorescence differential display — PCR (FDD-PCR) technique to analyze the genes expressed in mouse kidneys collected at nine different developmental stages ranging from 3 days to 15 months after birth. We found ten genes that were age-dependent and differentially-expressed in the kidneys during our experimental period. We confirmed by comparative RT-PCR that of the ten cDNAs, seven showed reproducible age-dependent expression. Four of the nucleotide sequences of these cDNA clones, had high homology with known genes (fibronectin, soluble guanylyl cyclase a-1 subunit, cytosolic aldehyde dehydrogenase and mitochondrial DNA), and three with expressed sequence tags of unknown genes. The FDD-PCR method was very useful for detecting new age-related genes expressed differentially in the mouse kidney. © 2000 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Age-related; Differential display-PCR; Gene expression; RT-PCR; Mouse kidney
1. Introduction Recently, a number of mammalian genes that are differentially-expressed in the process of development (Adati et al., 1995; Gupta et al., 1998) or senescence (West, * Corresponding author. Tel.: +81-776-61-3111; fax: +81-776-61-8108. E-mail address: [email protected] (R. Iida) 0047-6374/00/$ - see front matter © 2000 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 0 4 7 - 6 3 7 4 ( 9 9 ) 0 0 1 0 4 - 9
136
R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
1994; Linskens et al., 1995) have been reported. However, studies of these genes have been limited to clarification of the short-term changes occurring over their lifetimes. Our interest lies, in identifying new differentially-expressed genes and in examining changes in their levels of expression over longer periods; we intend to apply these expression changes as stage markers for age estimation; age is very difficult to read from biological samples, soft tissues and body fluids. In a previous study, we found a human young age-related glycoprotein (Ugl-Y) that is secreted into the urine of children aged 17 years or less (Kishi and Iseki, 1982; Iida et al., 1987). Since Ugl-Y is not detected in the plasma, we assume that it may originate from the kidney. Recently, it has been demonstrated that age-related increases of several proteins occur in the rat kidney, including transforming growth factor-b1 (Ruiz-Torres et al., 1998), clusterin (Laping et al., 1998), heatshock protein 47 (Razzaque et al., 1998) and thrombospondin 1 (Olson et al., 1999). However, the gene expression profile of the aging process in the kidney, has not been analyzed systematically. Therefore, we chose the mouse kidney as the model organ. As a preliminary study to isolate age-related genes, we performed fluorescence differential display (FDD)-PCR and comparative RT-PCR testing on total RNA extracted from mouse kidneys from the third day to the fifteenth month after birth. In this paper, we report the high efficiency of our experimental procedure, that used FDD-PCR for the identification of age-related or age-dependent genes of the mouse kidney.
2. Materials and methods
2.1. RNA isolation from mouse kidneys C57BL/6 mice were used in this study. They were tested on the third day, or the first, second, fourth or sixth week, or the fourth, sixth, ninth or fifteenth month after birth. The kidneys were dissected while the mice were under anesthesia with pentobarbital, then frozen immediately in dry-ice-ethanol and kept at − 80°C until RNA preparation. All manipulations involving the mice, were reviewed and approved by the institutional animal care and use committee. Total RNA was isolated according to the acid guanidium thiocyanate-phenol-chloroform extraction procedure (Chomczynski and Sacchi, 1987). Possible DNA contamination was removed by treatment with RNase-free DNase I (Stratagene).
2.2. Fluorescence differential display-PCR Fluorescence differential display-PCR (FDD-PCR) was performed as described previously (Ito et al., 1994; Adati et al., 1995) with the following minor modifications. The total RNA (2 mg) was reverse-transcribed using three 3%-anchored oligo-dT primers (GT15A, GT15C and GT15G). Thirty different sets of primers — the combination of ten arbitrary primers (Operon, Alameda, CA; OP-26-01:
R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
137
TACAACGAGG, OP-26-02: TGGATTGGTC, OP-26-03: CTTTCTACCC, OP26-04: TTTTGGCTCC, OP-26-05: GGAACCAATC, OP-25-06: AAACTCCGTC, OP-26-07: TCGATACAGG, OP-26-08: TGGTAAAGGG, OP-26-09: TCGGTCATAG, and OP-26-10: GGTACTAAGG) and the 3%-anchored oligo-dT primers (see above) — were used for PCR amplification of cDNA. PCR amplification was carried out in a total volume of 20 ml, containing 2 ml of cDNA solution, 10 mM Tris – HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM of each dNTP, 0.25 mM of 3%-anchored oligo-dT primer, 0.5 mM of arbitrary primer and one unit of Taq polymerase (AmpliTaq, Perkin – Elmer Applied Biosystems), using a DNA thermal cycler (GeneAmp PCR system 9700, Perkin–Elmer Applied Biosystems). The PCR cycling conditions were 94°C for 3 min, 40°C for 5 min and 72°C for 5 min, then 25 cycles (95°C for 15 s, 40°C for 2 min and 72°C for 1 min), followed by 72°C for 5 min. The amplified cDNAs were separated on a native 7% polyacrylamide gel (200× 300 ×0.35) in 0.375 M Tris-HCl (pH 8.9) using 0.025 M Tris-0.192 M glycine running buffer at Vmax 1000V, Imax 40 mA, Pmax 50 W for 1 h at 30°C. After electrophoresis, the gel was stained with SYBR Green I (Molecular Probes), and the band pattern was observed using a fluorescence image analyzer (FluorImager SI, Molecular Dynamics).
2.3. Cloning and sequencing of differentially displayed products The gel region corresponding to the differentially displayed band was excised and added directly to 100 ml of PCR reaction mixture. After reamplification, the amplified cDNA was subcloned and sequenced. Clones bearing the bands of interest were identified by two methods: a comparison test of the fragment sizes with the original cDNAs and a co-migration test with the original cDNA on DD gels. The nucleotide sequences were tested for homology, to known sequences in the DNA database of the NCBI by BLAST search. New DNA sequences of cDNA clones, identified in our study, were submitted to the GenBank database (accession nos. AI482564-AI482567).
2.4. Comparati6e RT-PCR Comparative RT-PCR was performed according to the methods reported previously (Yokoi et al., 1993; Kojima et al. 1994), with modifications. DNA-free total RNAs (3.5 mg) were reverse-transcribed using Superscript II and oligo(dT)12 – 18 (GIBCO BRL). The sense and the antisense primers for mouse glyceraldehyde-3phosphate dehydrogenase (GAPDH) were purchased from Clontech. The yield of PCR product, reflects the amount of template DNA, only under conditions in which amplification proceeds exponentially; therefore, the optimum PCR cycle numbers for quantification of respective target cDNAs, were determined by examining the correlation between PCR cycle numbers and the yield of PCR products. The primer sequences, the annealing temperature and the optimum number of PCR cycles are summarized in Table 1. The times used for denaturing, annealing and extension at each cycle were established as 0.5, 0.5 and 1 min, respectively. For the
138
R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
analysis of the expression pattern, the concentration of each template cDNA was normalized against GAPDH. After amplification of the optimum number of cycles, all of the PCR product was separated on 2% (w/v) agarose gels and stained with ethidium bromide; the intensity of the fluorescence was then measured by a CCD imaging system (AE-6910 BXII, Atto, Tokyo, Japan). Each assay was performed in triplicate. The intra- and inter-assay variabilities were B 7 and B 10%, respectively.
2.5. Quantitati6e TaqMan RT-PCR TaqMan RT-PCR was performed with GAPDH and two of the differentially-expressed genes (K6 and K9) on a Model 7700 Sequence Detector System (Perkin– Elmer Applied Biosystems) according to the method previously described (Kruse et al., 1997; Luoh et al., 1997), with slight modifications. The primers and the TaqMan probes for GAPDH (TaqMan Rodent GAPDH control reagents) were supplied by Perkin – Elmer Applied Biosystems, and those for K6 and K9 were designed using the primer design software Primer Express™ (Perkin–Elmer Applied Biosystems) as follows: K6, sense primer: TGAGCAAAGACAGCATCCCAG, antisense primer: GGGACCACTTTACATATGCAACG, TaqMan Table 1 Primers and conditions for comparative RT-PCR cDNA
GAPDH K1 K2 K3 K4 K5 K6 K7 K8 K9 K10
Primers Sense
Antisense
TGAAGGTCGGTGTGAACGGATTTGGC TACCGGTGACTGGAAGGGTC TTTCTTTTGCCATCTGAC ATTAATTCCCCACCGTCTTT AGACAAGAAATGCCCCTTCA GACCAGGTGCTTTCCATT AGACATAGCTAGACGCAAAG TTCCTGGAGTCCGCTTTA AATAAAGTTTTGCCGCAGAA CAGGTGCCAATAAGACATT AATTTTTACAGCGGGAGTA
CATGTAGGCCATGAGGTCCACCAC GCCGGGCAATGTAGACAATC ACACTTGTCTTTCCCAGTAG CACAGGCGACACAAGTGA TGGCCAGAGTCCCCTTAGA CAAGCAGGCATGACATTCTA GAAGGGTAAGCCAAGG TGATCTTGGCCTTTCTTTCT CAGAGTCCCGTAATGCTGTC CGCAGTAGGAACAGTGATTT AGAAATAAGAGGGCTTGAAC
Annealing temperature (°C)
Number of cycles
50
28
50
23
55
28
50
28
50
22
50
28
50
28
50
22
50
24
50
23
50
22
R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
139
probe: ATGGGTGCGTTCACGGTGGATTCA; K9, sense primer: GCACTACACTGATGGAGGAAGTTATC, antisense primer: GGAACAGTGATTTTTATTTACAAAGATTGC, TaqMan probe: TCAAGTGAGAATTGTTTGTGGTTTTCAAAA. Amplifications of cDNA were performed according to the manufacturer’s instructions. Serial 1:4 dilutions of cDNA, which was reversetranscribed from the 3-day-old mouse kidney total RNA, were analyzed for each target cDNA. These served as standard curves from which to determine the rates of change of the values. All PCR assays were performed in triplicate. The inter-assay variability was B 9%.
3. Results
3.1. Screening of differentially expressed genes by FDD-PCR To identify age-related genes expressed in the mouse kidney from the third day to the fifteenth month after birth, we performed FDD-PCR using total RNA. Our protocol gave fingerprints composed of : 50 bands in the size range of 120 – 1500 bp in a reproducible fashion. Using 30 sets of primers (ten arbitrary primers, OP-26-1 to OP-26-10, in combination with three anchor primers), we could find ten differentially-expressed bands, which were designated K1–K10. All of these cDNA were excised from the gel, re-amplified, cloned into plasmid vectors and then sequenced.
3.2. Confirmation of differential expression by comparati6e RT-PCR In order to confirm the differential expression of the cDNAs detected by FDD-PCR, we performed comparative RT-PCR using GAPDH as an endogenous RNA standard. Of the ten cDNAs, seven (K2, K3, K5, K6, K8, K9 and K10) were found to express age-dependent patterns (Fig. 1); the patterns were similar to those detected on the DD gels. The remaining three (K1, K4 and K7) showed age-independent patterns throughout the experimental period (data not shown) and had significant homology with the mRNAs of the ribosomal proteins L12, S11 and S23, respectively. The expression of three genes (K5, K8 and K10) increased with age, whereas the other four (K2, K3, K6 and K9) decreased. Interestingly, expression of K8 was observed only after the fourth month. From nucleotide sequence analyses, K2 showed high homology to mouse fibronectin (FN), K3 to the Rattus nor6egicus soluble guanylyl cyclase (sGC)− 1 subunit, K5 to mouse cytosolic aldehyde dehydrogenase, K10 to Mus domesticus strain NZB/BINJ mitochondrion genome, and K6, K8 and K9 to mouse expressed sequence tags of unknown genes (Table 2). The new sequences identified in our study were submitted to the GenBank database (accession nos.: K3, AI482567; K6, AI482566; K8, AI482564; and K9, AI482565).
140 R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
Fig. 1. Expression of differentially-expressed genes during aging, detected by comparative RT-PCR. The nucleotide sequence of the primers and the optimum conditions for PCR are shown in Table 1 and in Section 2. The PCR product was separated on 2% (w/v) agarose gels and stained with ethidium bromide; the intensity of the luminescence was measured with a CCD imaging system. Each value was measured in triplicate, and the results are expressed as a percentage of the maximum mean value.
R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
141
Table 2 Summary of differentially displayed cDNAs during development and aging cDNA (accession no.)
Corresponding sequence (accession no.)
Identities (% homology)
K2 K3 (AI482567)
Mouse fibronectin mRNA (GenBank M18194) Rattus nor6egicus soluble guanylyl cyclase a 1 subunit mRNA (GenBank U60835) Mouse aldehyde dehydrogenase mRNA (GenBank M74570) Mouse ESTs AA041942, AA914549, AA003197, etc. Mouse ESTs AA986921, AA289345, AI226933 Mouse ESTs AI314031, AA276435, AA497564, etc. Mus domesticus strain NZB/BINJ mitocondrion genome (GenBank L07095)
314/319 (98) 349/393 (89)
K5 K6 (AI482566) K8 (AI482564) K9 (AI482565) K10
237/238 (99)
218/218 (100)
Fig. 2. Quantification of mRNAs of the two differentially-expressed genes of mouse kidney, K6 (A) and K9 (B), by the TaqMan-PCR method (black bars) and comparative RT-PCR analysis using a CCD imaging system (white bars). The amount of mRNA was normalized to the internal control GAPDH. The results are expressed as a ratio relative to the value of 3D (mouse kidney mRNA at the third day after birth). D, day; W, week; M, month.
3.3. Quantification of mRNA by TaqMan PCR method To examine the quantitative accuracy of the comparative RT-PCR, we performed quantification of the transcripts of two unknown genes, K6 and K9, using the TaqMan fluorogenic detection system. The expression profiles of both genes, obtained by the use of the TaqMan PCR method, fitted well with those of the comparative RT-PCR, indicating the validity of the comparative RT-PCR method (Fig. 2A, B).
142
R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
4. Discussion We applied the FDD-PCR method to the analysis of mouse kidney mRNAs and succeeded in obtaining seven genes that had age-dependent expression patterns. Of these genes, four (K2, K3, K5 and K10) are known, and are almost identical to FN, sGC, cytosolic aldehyde dehydrogenase and mitochondrial DNA, respectively. FN is a glycoprotein, localized in the extracellular matrix of most tissues. It has been shown to mediate diverse cellular functions (Mosher, 1989). A decreasing pattern was observed in the expression of FN during aging (Fig. 1, lane K2); it was similar to those found in previous observations of the rat heart (Mamuya et al., 1992) and liver (Singh and Kanungo, 1993). In contrast, an increasing pattern has been observed in the rat aorta (Takasaki et al., 1990). These inconsistent experimental results suggest strongly that FN expression, is influenced by tissuespecific regulatory factors (Mamuya et al., 1992; Singh and Kanungo, 1993). GC is an enzyme that produces cyclic GMP and exists in two isoforms: membranebound isoform and soluble isoform (sGC); the latter is composed of an a and a b subunit. K3 was found to show a high homology (89% in 393 nt) with the rat sGC a1 subunit, and we observed a gentle decrease during aging (Fig. 1, lane K3). This finding concurs with those of previous reports that sGC activity in the rat brain is high immediately after birth and decreases during the early postnatal weeks (De Vente and Steinbusch, 1992; Van Eden et al., 1996). Cytosolic aldehyde dehydrogenase, one of the three major aldehyde dehydrogenase isozymes that participate in acetaldehyde metabolism, was found in this study to be up-regulated during aging (Fig. 1, lane K5); this finding correlates well with previous observations of the mouse liver (Rout et al., 1987). Interestingly, the expression of K10, which was found to be identical to mouse mitochondrial DNA, was shown to increase with age (Fig. 1, lane K10). Considering that all mitochondrial transcripts are transcribed as a single RNA precursor (Ojala et al., 1981), this observation is in contrast to that of previous reports, which have found that the concentration of mitochondrial RNA declines with age (Fernandez-Silva et al., 1991; Barrientos et al., 1997). This indicates the possibility that age-dependent differential expression of K10 is influenced by post transcriptional mechanisms such as stabilization or degradation. In our laboratory, we are investigating the three unknown genes (K6, K8 and K9) that showed age-dependent expression patterns, in order to determine their origins and functions. DD-PCR has been shown to be a powerful tool for discovering differentially-expressed genes; however, DD-PCR has technical limitations, including a high incidence of false positives, a bias for abundant transcripts and a highly laborious methodology. In this study, the application of two non isotopic techniques — FDD-PCR to the first screening and the comparative RT-PCR to the subsequent confirmation — enabled us to reduce greatly the labor, expenditure and time needed. In conclusion, the protocol described above is applicable to the rapid identification of genes that are differentially-expressed during aging.
R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
143
Acknowledgements We are grateful to Dr H. Naiki for his useful advice and encouragement. We wish to thank F. Nakamura for her secretarial assistance. This study was supported in part by grants-in-aid for scientific research from the ministry of education, science, sports and culture of Japan (09877090 to RI, 11897010, 10307010 and 09357004 to KK, and 09470122 to TY). References Adati, N., Ito, T., Koga, C., et al., 1995. Differential display analysis of gene expression in developing embryos of Xenopus lae6is. Biochim. Biophys. Acta 1262, 43 – 51. Barrientos, A., Casademont, J., Cardellach, F., et al., 1997. Reduced steady-state levels of mitochondrial RNA and increased mitochondrial DNA amount in human brain with aging. Mol. Brain. Res. 52, 284–289. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156 – 159. De Vente, J., Steinbusch, H.W.M., 1992. On the stimulation of soluble and particulate guanylate cyclase in the rat brain and the involvement of nitric oxide as studied by cGMP immunocytochemistry. Acta Histochem. 92, 13–38. Fernandez-Silva, P., Petruzzella, V., Fracasso, F., Gadaleta, M.N., Cantatore, P., 1991. Reduced synthesis of mtRNA in isolated mitochondria of senescent rat brain. Biochem. Biophys. Res. Commun. 176, 645–653. Gupta, R., Thomas, P., Beddington, R.S.P., Rigby, W.J., 1998. Isolation of developmentally regulated genes by differential display screening of cDNA libraries. Nucleic Acids Res. 26, 4538 – 4539. Iida, R., Yasuda, T., Kishi, K., 1987. Purification of a young age-related glycoprotein (Ugl-Y) from normal human urine. J. Biochem. 101, 357 – 363. Ito, T., Kito, K., Adati, N., et al., 1994. Fluorescent differential display: arbitrarily primed RT-PCR fingerprinting on an automated DNA sequencer. FEBS Lett. 351, 231 – 236. Kishi, K., Iseki, S., 1982. Young age-related glycoproteins revealed in normal human by isoelectric focusing. Proc. Japan Acad. 58B, 229 – 231. Kojima, K., Kanzaki, H., Iwai, M., et al., 1994. Expression of leukemia inhibitory factor in human endometrium and placenta. Biol. Reprod. 50, 882 – 887. Kruse, N., Pette, M., Toyka, K., Rieckmann, P., 1997. Quantification of cytokine mRNA expression by RT PCR in samples of previously frozen blood. J. Immunol. Methods 210, 195 – 203. Laping, N.J., Olson, B.A., Day, J.R., et al., 1998. The age-related increase in renal clusterin mRNA is accelerated in obese Zucker rats. J. Am. Soc. Nephrol. 9, 38 – 45. Linskens, M.H.K., Feng, J., Andrews, W.H., et al., 1995. Cataloging altered gene expression in young and senescent cells using enhanced differential display. Nucleic Acids Res. 23, 3244 – 3251. Luoh, S.M., Di Marco, F., Levin, N., et al., 1997. Clonimg and characterization of a human leptin receptor using a biologically active leptin immunoadhesin. J. Mol. Endcrinol. 18, 77 – 85. Mamuya, W., Chobanian, A., Brecher, P., 1992. Age-related changes in fibronectin expression in spontaneously hypertensive, Wistar – Kyoto, and Wistar rat hearts. Circ. Res. 71, 1341 – 1350. Mosher, D.F., 1989. Fibronectin. Academic Press, San Diego, CA. Ojala, D., Montoya, J., Attardi, G., 1981. tRNA punctuation model of RNA processing in human mitochondria. Nature 290, 470–474. Olson, B.A., Day, J.R., Laping, N.J., 1999. Age-related expression of renal thrombospondin 1 mRNA in F344 rats: resemblance to diabetes-induced expression in obese Zucker rats. Pharmacology 58, 200–208.
144
R. Iida et al. / Mechanisms of Ageing and De6elopment 113 (2000) 135–144
Razzaque, M.S., Shimokawa, I., Nazneen, A., Higami, Y., Taguchi, T., 1998. Age-related nephropathy in the Fischer 344 rat is associated with over expression of collagens and collagen-binding heat shock protein 47. Cell Tissue Res. 293, 471 – 478. Rout, U.K., Elkington, J.S.H., Holmes, R.S., 1987. Developmental changes in aldehyde dehydrogenases from mouse tissues. Mech. Age. Dev. 40, 103 – 113. Ruiz-Torres, M.P., Bosch, R.J., O’Valle, F., et al., 1998. Age-related increase in expression of TGF-beta1 in the rat kidney: relationship to morphologic changes. J. Am. Soc. Nephrol. 9, 782 – 791. Singh, S., Kanungo, M.S., 1993. Changes in expression and CRE binding proteins of the fibronectin gene during aging of the rat. Biochem. Biophys. Res. Commun. 193, 440 – 445. Takasaki, I., Chobanian, A.V., Sarzani, R., Brecher, P., 1990. Effect of hypertension on fibronectin expression in the rat aorta. J. Biol. Chem. 265, 21935 – 21939. Van Eden, C.G., Steinbusch, H.W.M., Rinkens, A., De Vente, J., 1996. Developmental pattern of NADPH-diaphorase activity and nitric oxide-stimulated cGMP immunoreactivity in the frontal rat cortex and its role in functional recovery from aspiration lesions. J. Chem. Neuroanat. 10, 279 – 286. West, M.D., 1994. The cellular and molecular biology of skin aging. Arch. Dermatol. 130, 87 – 95. Yokoi, H., Natsuyama, S., Iwai, M., et al., 1993. Non radioisotopic quantitative RT-PCR to detect changes in mRNA levels during early mouse embryo development. Biochem. Biophys. Res. Commun. 195, 769–775.
.