AICAR prolongs corneal allograft survival via the AMPK-mTOR signaling pathway in mice

Biomedicine & Pharmacotherapy 113 (2019) 108558

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

AICAR prolongs corneal allograft survival via the AMPK-mTOR signaling pathway in mice Li Jiang1, Tingting Liu1, Lijie Xie, Chen Ouyang, Jianping Ji, Ting Huang

T

⁎

State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou, Guangdong 510060, PR China

A R T I C LE I N FO

A B S T R A C T

Keywords: AICAR Immune rejection Corneal transplantation AMPK mTOR

Immune rejection is a critical complication that results in the graft failure after corneal transplantation. Thus, there remains a need for new therapies for allograft rejection. AICAR (aminoimidazole-4-carboxamide ribonucleoside) is an, as adenosine monophosphate–activated protein kinase (AMPK) activator and a purine nucleoside with a wide range of metabolic effects, including activation of AMPK. More recently, it was reported that it is possible to inhibiting organs rejection and prolong the graft survival time in various models of organ transplantation. In this study, we systematically evaluated the efficacy of AICAR as a treatment modality for inhibiting allograft rejection in a mouse model of corneal transplantation. We found that AICAR significantly suppressed the opacity, edema, and vascularization of the graft, resulting in prolonged corneal allograft survival. AICAR treatment also significantly decreased central corneal thickness. Moreover, the AICAR-treated group showed decreased expression of IB4 and VEGF as compared to the control group. In addition, the mRNA expression of T helper 1 cytokines (IL-2, INF-γ, and TNF-α) was suppressed, and the expression of T helper 2 cytokines (IL-4, IL-5, and IL-13) was elevated by AICAR. Furthermore, the western blotting results revealed that AICAR stimulated AMPK activation and inhibited angiogenesis and inflammation possibly by subsequently suppressing mTOR phosphorylation. By contrast, the AMPK inhibitor Compound C (also called dorsomorphin) had the opposite effect. Our results showed that Compound C blocked AMPK-mTOR signaling and promoted the angiogenesis and inflammation, thus compromising the graft survival. These results suggest that AICAR may be a potential option for inhibiting the corneal graft rejection and for prolonging the graft survival.

1. Introduction Corneal transplantation is the most successful type among tissue and organ transplantations. In spite of conventional immunosuppressive treatments such as corticosteroids, cyclosporin A, and tacrolimus (FK506), immunological allograft rejection remains the main complication and results in the transplant failure [1]. The incidence of rejections has been reported to range from 10% to 30% [2,3]. Moreover, in case of high-risk conditions such as a severe infection, grafts that have a prevascularized graft bed and undergo reoperation for transplantation have rejection rates are up to 60% [3,4]. Challenges exist in the management of corneal rejection. As an engergy sensor, adenosine monophosphate–activated protein kinase (AMPK) regulates various aspects of cellular fundamental functions, including survival, metabolism, and proliferation [5–8]. Aminoimidazole-4-carboxamide ribonucleoside (AICAR), as a pharmacological activator of AMPK, was the first identified AMPK activator to

enhance AMPK phosphorylation (p-AMPK) and subsequently to inhibit inflammation, oxidation, and angiogenesis in a variety of cell types [9–11]. To further assess the AMPK dependence of the AICAR-mediated effects, the well-known AMPK inhibitor Compound C (dorsomorphin) has also been used in the studies. Compound C treatment inhibits AICAR-induced AMPK activation, judging by measurements of AMPK phosphorylation [10,12]. For clinical purposes, AICAR is employed to reduce myocardial ischemic injury for myocardial protection in patients undergoing coronary artery bypass graft surgery and is proven safe [13–15]. The effects of AICAR are negated by cotreatment with Compound C [10,12]. Moreover, AICAR is applied to treat chronic lymphocytic leukemia because of targeting both resting and proliferating cells [15–17]. Recently, much attention has been given to its potential suppression of the immune rejection after organ transplantation[18]. Additionally, the release of TNF-α, INF-γ and other cytokines are also affected by AICAR [19]. AICAR-initiated AMPK activation may act as a central downregulator of ongoing innate and adaptive immune

⁎

Corresponding author. E-mail address: [email protected] (T. Huang). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.biopha.2019.01.019 Received 5 October 2018; Received in revised form 6 January 2019; Accepted 6 January 2019 0753-3322/ © 2019 Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Biomedicine & Pharmacotherapy 113 (2019) 108558

L. Jiang, et al.

responses in murine colitis. Moreover, AICAR is therapeutically effective because it ameliorates colitis-associated inflammation and reduces levels of T helper 1 (Th1)-type cytokines [20]. The mechanisms of AICAR-driven inhibition of inflammation, neovascularization, and metastasis involve the activation of AMPK with subsequent inhibition of downstream targets of the mammalian target of rapamycin (mTOR) activity [21–23]. The mTOR cascade is a major growth-regulatory pathway, and regulates the downstream effectors of AMPK signaling. It is well documented that activation of mTOR is inhibited by an AMPK activator [24,25]. The AMPK-mTOR pathway antagonists, such as AICAR, decreased angiogenesis, and this pathway may be an attractive target for cancer therapy via a decrease in the phosphorylation of mTOR and an increase in the phosphorylation of mTOR (p-mTOR) [21]. Studies suggested that suppression of mTOR may inhibit an immune reaction after an allogeneic corneal transplantation [26,27]. Nonetheless, the effect of AICAR on the immune reaction of the corneal transplantation remains unclear. In this study, mice served as a model of penetrating keratoplasty model to study the inhibitory effect of application of AICAR on corneal allograft rejection, to provide a possible new basis for its clinical applications of AICAR.

Table 1 Corneal Grafts Survival Assessment. Standard

Score

Clarity

0 1 2

Sign

Clear cornea Slight haze Increased haze but anterior chamber structures still clear 3 Advanced haze with difficult view of anterior chamber 4 Opaque cornea without view of anterior chamber Edema 0 No stromal or epithelial edema 1 Slight stromal thickness 2 Diffuse stromal edema 3 Diffuse stromal edema with microcystic edema of the epithelium 4 Bullous keratopathy Neovascularization 0 No vascularization 1 Vascularization of the peripheral cornea 2 Vascularization to the corneal wound 3 Vascularization of the peripheral graft 4 Vascularization of the entire graft The grafts showing a score of RI ≥ 6 were defined as rejected.

this mouse was excluded and another one added to the respective group. The rejection index (RI) in the range of 0–12 was calculated based on the sum of scores on three allograft indicators: clarity, edema, and neovascularization [30,31] (Table 1).

2. Methods 2.1. Animals and anaesthesia

2.4. Central corneal thickness (CCT) measured by anterior segment optical coherence tomography (AS-OC−OCT)

In this study, male C57BL/6 and BALB/c mice (6–8 weeks old) were used. All animal experiments were performed according to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research, and the protocols were approved by the Institutional Animal Care and Use Committee of Zhongshan Ophthalmic Center, Sun Yat-Sen University, Guangzhou, China. For all animal, general anesthesia was administered by intraperitoneal injection of 1% pentobarbital sodium (40–50 mg/kg).

CCT was measured longitudinally by noninvasive AS-OCT (Spectralis HRA + OCT, Heidelberg Engineering, Heidelberg, Germany) at 14 days after corneal transplantation. After general anesthesia was administered, the central corneal cross-sectional scans were performed in radial scan mode with automatic real-time eye tracking software to decrease speckle noise. To ensure scanning through the central cornea, the cornea was adjusted until detecting maximum corneal thickness was detected. The AS-OCT data were then processed and analyzed for CCT by means of the supplied software.

2.2. Corneal transplantation and the pharmaceutical intervention Allogenic corneal transplantation was performed as described previously [28,29]. In brief, the central cornea from the donor (C57BL/6) was marked with a trephine of a 2 mm diameter (Suzhou Mingren Medical Equipment Co., Ltd, China) and collected with Vannas scissors (Suzhou Mingren Medical Equipment Co., Ltd, China). The recipient (BALB/c) graft bed was prepared by excising a piece of tissue with a 1.5 mm diameter in the central cornea after dilating the pupil. Then, the donor button was fixed in the graft bed by eight interrupted sutures (110 nylon, B. Braun Surgical SA, Spain). Antibiotic eye ointment was administered at the end of the procedure and once a day for three consecutive days. Seven days post-transplantation, the sutures were removed. Recipient mice were randomized into three groups (12 mice per group) each as follows: a control group (allograft group, recipients received intraperitoneal injections of an equal volume saline), AICAR (Selleckchem, Houston, TX, USA)-treated group [recipients received intraperitoneal injections of AICAR (50 mg/kg)], and a Compound C (Selleckchem) (6-[4-(2-Piperidin-1-ylethoxy) phenyl]-3-pyridin-4-ylpyrazolo [1,5-a] pyrimidine)-treated group [recipients received intraperitoneal injections of Compound C (100 mg/kg) once per day].

2.5. An immunofluorescent assay Seven-days post-transplantation, five mice from each group were killed, and eyeballs were removed and fixed in 4% paraformaldehyde (PFA) for 2 h at room temperature followed by dehydration in 15% and 30% sucrose solution sequentially. Then, the eyeballs were embedded in optimum cutting temperature compound (OCT, Sakura Finetek, Tokyo, Japan) overnight and sectioned at a thickness of 6 μm. Frozen sections were permeabilized with 0.5% Triton X-100 for 20 min and blocked with 5% bovine serum albumin (BSA) for 2 h at room temperature. After that, the slides were incubated with red-light-absorbing dye (Alexa Fluor 568)-labeled Griffonia simplicifolia isolectin B4 (IB4, 1:50; a marker of vessels; Invitrogen, Carlsbad, CA, USA, 1579027) and a rabbit monoclonal anti-VEGF antibody (1:200, Abcam, Cambridge, MA, USA, ab46154) (a primary antibody). After a wash with PBS, the slides were incubated for 2 h with a goat anti-rabbit IgG antibodiy conjugated to Alexa Fluor 488 (a secondary antibody; 1:1000, Abcam) and the nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; 1:800, Biosharp, Beijing, China) for 5 min at room temperature. All the samples were analyzed by a confocal microscopy (LSM 510; Carl Zeiss Meditec, Oberkochen, Germany).

2.3. Clinical evaluation Corneal grafts were assessed for graft survival with a slit-lamp biomicroscope. All the grafts were evaluated every other day. For clinical evaluation of the cornea and for taking anterior segment photographs every day, we applied isoflurane for inhalation anesthesia. Once a recipient developed a severe complication such as synechia, hyphema, or infection, we regarded this case as a surgical failure, then

2.6. Western blotting The whole-mount corneas were excised and cut into pieces. Then, ultrasonication was conducted to cracked the corneal tissues on ice 2

Biomedicine & Pharmacotherapy 113 (2019) 108558

L. Jiang, et al.

differences between two groups, and when data from multiple–time point experiments were subjected to one-way ANOVA analysis. The Kaplan–Meier survival curves were constructed to assessed corneal graft survival. GraphPad Prism software (v6.0, GraphPad Software Inc.) was used for all statistical calculations. A difference with P ≤ 0.05 was considered statistically significant difference.

followed by centrifugation at 12,000 × g and 4 °C for 10 min. The supernatant was collected, and protein concentration was quantified by a BCA protein assay (Biosharp, Beijing, China). 10% SDS-PAGE in a 10% gel was performed to fractionate total protein, and the proteins were next transferred to polyvinylidene difluoride (PVDF) filter membranes (Millipore, Bedford, MA). After blockage with 5% skimmed milk in Tris-buffered saline containing 0.1% Tween 20 (TBST) for 2 h, the membranes were incubated with primary antibodies including antiAMPK alpha 1 + AMPK alpha 2 (AMPK; rabbit antibody, 1:1000, Abcam, ab80039), anti-AMPK alpha 1 (phospho T183) + AMPK alpha 2 (phospho T172) (p-AMPK; mouse antibody, 1:1000, Abcam, ab23875), anti-mTOR(rabbit antibody, 1:500, Cell Signaling Technology, Beverly, CA, USA, #2983), anti-phospho-mTOR (rabbit antibody, 1:500, Cell Signaling Technology, #5536), and anti-GAPDH (rabbit antibody, 1:1000, Cell Signaling Technology, #5174) at 4 °C overnight. Then, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Abclonal, USA) for 2 h at room temperature. The immunoreactive bands were visualized by imaging on a Tanon-5200 Chemiluminescent Imaging System (Tanon, China), and grayscale density of the protein bands was calculated and analyzed in the Image J software (NIH, USA).

3. Results 3.1. AICAR suppresses the opacity, edema, and vascularization of the graft, results in promoting corneal transplant survival To assess the effect of the AMPK agonist AICAR on the immune rejection after corneal transplantation, we administrated AICAR, Compound C, or saline (intraperitoneal injection) to BALB/c recipients respectively. Fig. 1A shows the color photographs with ophthalmic slitlamp microscopy images at different time points after transplantation. Before day 3, all the grafts developed light stromal opacity and edema as an early-stage inflammatory response, and these problems decreased on days 3–5 after the surgical procedure. Then, the grafts developed obvious stromal edema and opacity, moreover, there was a high degree of hemangiogenesis. After suture removal (on day 7 after the operation), AICAR treatment of grafts had noticeable effects, and hemangiogenesis declined. In contrast, we observed that the opacity and edema were significantly greater, hemangiogenesis extended to the graft in the groups treated with Compound C or saline. Mean clinical scores for stromal opacity (Fig. 1C), corneal edema (Fig. 1D), and neovascularization (Fig. 1E) were generally lower for AICAR treatment than the control group and greater for Compound C treatment. As shown in Fig. 1B (Kaplan–Meier survival curves), AICAR reduced the graft rejection rate from 100% in control and Compound C groups to 66.67% (n = 12 per group). It was found that in the Compound C group, graft rejection started the earliest (day 7) and next was the control group (day 9), the AICAR group (day 14) was the last. AICAR administration [median survival time (MST) 22.5 days, P < 0.01] prolonged the graft survival time as compared to the control group (MST 15 days); however, Compound C (MST 10 days, P < 0.01) reduced the graft survival time.

2.7. Quantitative reverse-transcription PCR (RT-PCR) After the cornea was excised and lysed, the total RNA was isolated using the TRIzol Reagent (Invitrogen) and converted to complementary DNA (cDNA) with the PrimeScriptTM RT reagent Kit (Takara, Dalian, China). RT-PCR was performed using the SYBR Green I qPCR Master Mix on a Roche LightCycler® 480Ⅱ machine (Roche Biosystems, Indianapolis, IN). Each group of RNA samples were analyzed in triplicate. The relative amounts of mRNAs were normalized to GAPDH expression and subjected to relative quantification by the 2―ΔΔCt method. The PCR primers were uploaded to the NCBI GeneBank database. The primer sequences for murine genes IL-2, INF-γ, TNF-α, IL-4, IL-5, IL13and GAPDH are given in Table 2. 2.8. Statistical analysis Results were expressed as mean ± standard error of mean (SEM). Student’s t-test was carried out to evaluate the statistical significance of

3.2. Graft CCT after transplantation

Table 2 The primer sequences of the related genes.

GAPDH Forward Reverse VEGF Forward Reverse IL-2 Forward Reverse INF-γ Forward Reverse TNF-α Forward Reverse IL-4 Forward Reverse IL-5 Forward Reverse IL-13 Forward Reverse

Corneal transplantation surgery is associated with corneal thickening and edema. CCT was measured by AS−OCT every third day. As presented in Fig. 2(A–E), all CTT of all the grafts increased after the surgical procedure as compared with the normal cornea (162.2 ± 3.167 μm). In the control group, the mean CCT was 260.0 ± 10.35 μm at 14 days after the operation. In the AICAR treated group, the mean CCT was significantly thicker thinner relative to the control group (209.0 ± 6.340 μm vs. 260.0 ± 10.35 μm, P < 0.01). By contrast, the grafts in Compound C treatment group had a significantly greater CCT as compared to the control grafts (323.8 ± 10.50 μm vs. 260.0 ± 10.35 μm, P < 0.01).

AAATGGTGAAGGTCGGTGTGAAC CAACAATCTCCACTTTGCCACTG ACATTGGCTCACTTCCAGAAACAC TGGTTGGAACCGGCATCTTTA CCCAGGATGCTCACCTTCA CCGCAGAGGTCCAAGTTCA CGGCACAGTCATTGAAAGCCTA GTTGCTGATGGCCTGATTGTC

3.3. AICAR inhibits corneal graft hemangiogenesis To investigate the effect of AICAR treatment on corneal hemangiogenesis, corneal grafts were evaluated for vascularization and the score was recorded. Mean scores of vascularization were reduced after AICAR treated and greater after Compound C treated. Moreover, the staining for IB4 at 14 days after the surgeical procedure and analyzed by confocal laser microscopy. We found a significant decrease in graft hemangiogenesis after AICAR treatment (Fig. 3A). In contrast, after Compound C treatment, grafts hemangiogenesis were a significant increase. These results suggested that AICAR significantly inhibited cornea grafts hemangiogenesis.

ACTCCAGGCGGTGCCTATGT GTGAGGGTCTGGGCCATAGAA ACGGAGATGGATGTGCCAAAC AGCACCTTGGAAGCCCTACAGA TGAGGCTTCCTGTCCCTACTCATAA TTGGAATAGCATTTCCACAGTACCC CGGCAGCATGGTATGGAGTG ATTGCAATTGGAGATGTTGGTCAG

3

Biomedicine & Pharmacotherapy 113 (2019) 108558

L. Jiang, et al.

Fig. 1. AICAR suppressed the opacity, edema, and vascularization of the graft, resulting in promoted corneal graft survival. (A). Representative slit-lamp images obtained during examination of rejected and surviving grafts in the control group, AICAR treatment group, and Compound C treatment group at 3, 7, and 14 days after corneal transplantation (magnification ×40). (B). Kaplan–Meier survival curves show significantly increased of survival of AICAR treated grafts compared with control grafts. (C). The mean corneal clarity scores of the grafts in different groups per day. (D). The mean corneal edema scores of the grafts in different groups per day. (E). The mean corneal vescularization scores of the grafts in different groups per day. (log-rank [Mantel-Cox] test, n = 12 per group)

4

Biomedicine & Pharmacotherapy 113 (2019) 108558

L. Jiang, et al.

Fig. 2. CCT was significantly decreased after AICAR administration according to AS−OCT. (A). An AS−OCT image of a normal cornea. Representative AS−OCT images from the control group (B), AICAR treatment group (C), and Compound C treatment group (D) at 14 days post-transplantation. (E). Quantification of CCT. CCT in the AICAR group is significantly thinner than that in the control group. Nonetheless, CCT in the Compound C group is significantly greater. Data are shown as mean ± SEM (n = 3 per group; **p < 0.01 as compared to the control group).

4. Discussion

3.4. AICAR inhibited inflammation and immunorejection of corneal transplants

In our present study, we provided evidence supporting that (1) AICAR directly reduced corneal opacity, edema, and neovascularization, and prolonged corneal graft survival time; (2) AICAR alleviated inflammatory and immune responses after corneal transplantation; (3) AICAR might play the effects above by downregulating the AMPKmTOR signaling pathway in the murine model of corneal transplantation. In general, this is the first study to describe the inhibition effect of AICAR in corneal graft immunorejection in mice. Graft immunorejection remains the main cause of for corneal graft failure [1]. The underlying molecular mechanism is still not fully understood and attracts more and more attentions. Corneal immune privilege is tightly bound to angiogenic privilege because the blood vessels constitute the afferent arms of an immune reflex arc [32,33]. The inflow of inflammatory cells through the blood vessel consequently induces an inflammatory and rejection response [33]. AMPK, as a ubiquitously expressed heterotrimeric kinase, is activated by phosphorylation, which is essential for AMPK activation. On the other hand, other studies suggest that AMPK also performs a crucial function in modulation of an inflammatory response and angiogenesis in different tissues and cell lines [5–8]. AICAR or Compound C is commonly used as an agonist or antagonist to study AMPK-dependent signaling cascades. As an AMPK-activating compound, AICAR has been reported to activate AMPK and to have anticancer, antiinflammatory, antioxidantion, and antiangiogenesis properties [9–11,34]. Studies indicated that perioperative use of AICAR is safe and protects against cardiac ischemic injury and improves myocardial protection [13,14]. Moreover, much attention has been focused on AICAR and its potential suppression of the immune rejection after organ transplantation [18,35–38]. Carrasco et. al have suggested the use of AICAR as a new pharmacological treatment for protection against hepatic injury after liver transplantation [18]. Here, we tried to reveal the effects of AICAR on the immune reaction to a corneal graft. AICAR or Compound C was administered after corneal transplantation in mice. Next, the correlation between AICAR treatment and graft survival time was analyzed. As expected, we found that AICAR suppresses the opacity, edema, and vascularization of the graft, results in promoting corneal transplant survival. In addition, we detect the corneal center thickness (CCT) of the graft with OCT and found that AICAR treatment significantly reduced the CCT. By contrast, Compound C had the opposite effect and

After corneal transplantation, Th1 cells secrete cytokines (IL-2, INFγ, and TNF-α) to promote an immune response. In contrast, Th2 cells secrete cytokines (IL-4, IL-5, and IL-13) to ensure immune tolerance. To further investigate the influence of AICAR treatment on immunorejection of corneal transplantation, cellular mRNA expression of IL-2, INF-γ, TNF-α, IL-4, IL-5, and IL-13 (Fig. 4A–F) was determined in groups “AICAR” and “Compound C”. The mRNA expression of VEGF (Fig. 3 E), IL-2, INF-γ, and TNF-α was significantly inhibited after treatment with AICAR as compared with the control grafts, thus revealing that inflammation was substantially suppressed. In contrast, the mRNA expression of IL-4, IL-5, and IL-13 increased after AICAR treatment, apparently to enhance immune tolerance. Moreover, the immunostaining results indicated that expression of VEGF proteins were significantly declined (Fig. 3E). In addition, these pro-inflammatory cytokines (VEGF, IL-2, INF-γ, TNF-α) were strongly upregulated, and the Th2 cells secrete cytokines (IL-4, IL-5, IL-13) were decreased after Compound C treatment (Fig. 4 A–F).

3.5. Anti-inflammatory and Anti-immunorejection Effects of AICAR after corneal transplantation via the AMPK–mTOR signaling pathway Our study dissected the potential mechanism of AICAR action: regulation of the AMPK–mTOR signaling pathway during immunorejection after corneal transplantation. The levels of p-AMPK, AMPK, p-mTOR, and mTOR in groups AICAR and Compound C were analyzed by western blotting. The relative amount of p-AMPK, normalized to total AMPK as a loading control, was calculated as a ratio to the data from the normal cornea. The results showed that AICAR activated AMPK and slightly increased levels of p-AMPK as compared with control grafts (Fig. 5 B). In contrast, Compound C significantly decreased the level of p-AMPK (Fig. 5 B). Activation of AMPK may subsequently regulated mTOR activity because the expression of p-mTOR was slightly decreased (Fig. 5 C) but not statistically significant by AICAR treatment and increased significantly by Compound C treatment. The study demonstrated that AICAR induces the activation of AMPK but inhibition of mTOR signaling pathway in corneal grafts. In contrast, Compound C can reverse the effect of AICAR on the AMPK–mTOR signaling pathway(Fig. 5 B, C). 5

Biomedicine & Pharmacotherapy 113 (2019) 108558

L. Jiang, et al.

Fig. 3. AICAR inhibited graft hemeangiogenesis at 14 days after corneal transplantation. (A). Representative micrographs show the effect of AICAR on corneal hemangiogenesis. Corneal whole mounts were collected at 14 days after corneal transplantation and immunohistochemically stained for IB4 (red). The corneal epithelium shows a strong, nonspecific staining. (C). IB4 fluorescence intensities in the different groups were quantified, and the AICAR treatment group manifested a significant reduction whereas the Compound C treatment group showed a significant increase. (B). Representative immunohistochemical staining graphs for VEGF (green) in the corneal graft of different groups. AICAR treatment significantly reduced VEGF expression, and Compound C treatment increased it. (D). VEGF fluorescence intensities in the different groups were quantified, and it was significantly inhibited after AICAR treated, and significantly elevated after Compound C treated. (E) Expression levels of genes VEGF in the corneal grafts after different treatments were analyzed by RT-PCR.

with those of Theodoropoulou et. al., which show that AICAR was downregulates VEGF and inhibites neovascularization [21]. Generally, it is thought that after corneal transplantation, Th1 cells secrete cytokines (IL-2, INF-γ and TNF-α) to promote the immune response. In contrast, Th2 cells secrete cytokines (IL-4, IL-5, and IL-13) to ensure immune tolerance [47,48]. In addition, previous studied demonstrated that both types of cells are in responsive to inflammatory cytokines INF-γ and TNF-α, which substantially participate in corneal inflammation and graft rejection [19]. In the present study, our results indicated that Th1 cells secrete cytokines (IL-2, INF-γ and TNF-α) were significantly inhibited after treatment with AICAR treated, and Th2 cells secrete cytokines (IL-4, IL-5, and IL-13) increased, resulted in suppressing the corneal graft immune response. We reported for the first time that intraperitoneal injection of AICAR has anti-inflammatory and anti-angiogenic actions that help to inhibiting immunorejection of a corneal allograft. Bai, et, al. reported that AICAR-initiated AMPK activation may act as a central downregulator of ongoing innate and adaptive immune responses in murine colitis. Moreover, AICAR is therapeutically effective at ameliorating colitis-associated inflammation and at reducing the levels of Th1-type cytokines [20]. These results

reduced the grafts survival time. Our results were accordant with the studies mentioned above, AICAR suppress the immune rejection after organ transplantation. Therefore, we hypothesized that AICAR exerts inhibitory effects on corneal graft immunorejection. Moreover, the mechanism of AICAR action on graft immunorejection was investigated subsequently. Several approaches indicate that AICAR could be a novel therapeutic agent with anti-inflammatory and anti-angiogenesis properties [9–11]. The blood vessels inflows the inflammatory cells and consequently induces an inflammatory and rejection response [33]. There is a notion that inhibiting blood vessels in the cornea may play a central role in the promotion of graft tolerance [39,40]. A vascularized and inflamed recipient bed provides a conduit for the vascular systems to bring immune cells and other factors to the cornea, thereby contributing to subsequently graft immunorejection [32,41–43]. Recently, studies revealed that inhibition of angiogenesis and inflammation may be a new potential pharmacotherapy for graft immune rejections [44–46]. To investigate the influence of AICAR on corneal transplantation, we first assessed the expression of IB4 and VEGF to evaluate the postoperative corneal neovascularization. Our findings are consistent 6

Biomedicine & Pharmacotherapy 113 (2019) 108558

L. Jiang, et al.

Fig. 4. AICAR inhibited inflammation and immune response of the grafts at 14 days after corneal transplantation. Expression levels of inflammation- and immunoregulation-related genes IL-2 (A), INF-γ (B), TNF-α (C), IL-4 (D), IL-5 (E), IL-13 (F) in the corneal grafts after different treatments were analyzed by RT-PCR. Data are presented as mean ± SEM (n = 3 per group; #p > 0.05 as compared to the control group; *p < 0.05 as compared to the control group; **p < 0.01 as compared to the control group).

anti-inflammatory benefits and prolongation of the graft survival [56]. Therefore, suppression of mTOR phosphorylation might be another AMPK-independent anti-inflammatory mechanism of action of AICAR. The latter increases phosphorylation of AMPK possibly via inhibition of phosphorylation of mTOR and attenuates immunorejection after corneal transplantation. In conclusion, our study provides the first evidence that AICAR could be a valuable therapeutic agent that inhibits expression of inflammatory factors, reduces angiogenesis, suppresses immunorejection of a corneal transplantat, and prolongs graft survival time via the AMPK–mTOR signaling pathway.

were consistent with our founding. AMPK has been recognized as a pivotal upstream signaling protein, and its downstream targets include a negative regulator of mTOR [49,50]. MTOR plays a crucial role by modulating multiple cellular activities [51,52]. In clinical transplantation, the mTOR inhibitor was administrated to suppresse the organ transplant rejection. Recently studies showed that activation of APMK-mTOR signaling pathway and its downstream targets promoting the grafts survival after orgain or stem cells transplantation [36–38]. Inhibiting activation of mTOR has been reported as an effective and novel immunosuppressive agent for corneal transplant rejection [53–55]. Consistent with the studies above suggesting that phosphorylation of AMPK and reducing phosphorylation of mTOR might be important mechanisms underlying the anti-inflammatory and anti-immunorejection effects of AICAR. Our results indicate that AICAR significantly increased the levels of p-AMPK and slightly decreased the p-mTOR amount but not statistically significant. By contrast, the levels of p-AMPK was significantly inhibited and the levels of p-mTOR was significantly enhanced after Compound C treated. Besides, the important roles of mTOR in liver transplantation have been reported previously and provides a mechanistic explanation for the

Conflicts of interest The authors declare that they have no competing interests. Acknowledgment This research was supported by funding from the Natural Science Foundation of China (grant No. 81870628). 7

Biomedicine & Pharmacotherapy 113 (2019) 108558

L. Jiang, et al.

Fig. 5. Effects of AICAR on the phosphorylation of AMPK and mTOR in corneal grafts at 14 days after corneal transplantation. (A). Western blotting analysis of the protein levels of AMPK, p-AMPK, mTOR, and p-mTOR. (B) and (C) Quantification of protein levels of p-AMPK and p-mTOR normalized to total AMPK or mTOR. AICAR treatment significantly increased AMPK phosphorylation and slightly inhibited mTOR phosphorylation but not statistically significant. Compound C treatment had the opposite effects. Data are shown as mean ± SEM (n = 3 per group; #p > 0.05 as compared to the control group; *p < 0.05 as compared to the control group).

References

hematologic malignancies, Expert Opin. Investig. Drugs 19 (4) (2010) 571–578. [16] C. Campas, J.M. Lopez, A.F. Santidrian, M. Barragan, B. Bellosillo, D. Colomer, J. Gil, Acadesine activates AMPK and induces apoptosis in B-cell chronic lymphocytic leukemia cells but not in T lymphocytes, Blood 101 (9) (2003) 3674–3680. [17] A.F. Santidrian, D.M. Gonzalez-Girones, D. Iglesias-Serret, L. Coll-Mulet, A.M. Cosialls, M. de Frias, C. Campas, E. Gonzalez-Barca, E. Alonso, V. Labi, B. Viollet, A. Benito, G. Pons, A. Villunger, J. Gil, AICAR induces apoptosis independently of AMPK and p53 through up-regulation of the BH3-only proteins BIM and NOXA in chronic lymphocytic leukemia cells, Blood 116 (16) (2010) 3023–3032. [18] E. Carrasco-Chaumel, J. Rosello-Catafau, R. Bartrons, R. Franco-Gou, C. Xaus, A. Casillas, E. Gelpi, J. Rodes, C. Peralta, Adenosine monophosphate-activated protein kinase and nitric oxide in rat steatotic liver transplantation, J. Hepatol. 43 (6) (2005) 997–1006. [19] R. Dana, Comparison of topical interleukin-1 vs tumor necrosis factor-alpha blockade with corticosteroid therapy on murine corneal inflammation, neovascularization, and transplant survival (an American Ophthalmological Society thesis), Trans. Am. Ophthalmol. Soc. 105 (2007) 330–343. [20] A. Bai, A.G. Ma, M. Yong, C.R. Weiss, Y. Ma, Q. Guan, C.N. Bernstein, Z. Peng, AMPK agonist downregulates innate and adaptive immune responses in TNBS-induced murine acute and relapsing colitis, Biochem. Pharmacol. 80 (11) (2010) 1708–1717. [21] S. Theodoropoulou, K. Brodowska, M. Kayama, Y. Morizane, J.W. Miller, E.S. Gragoudas, D.G. Vavvas, Aminoimidazole carboxamide ribonucleotide (AICAR) inhibits the growth of retinoblastoma in vivo by decreasing angiogenesis and inducing apoptosis, PLoS One 8 (1) (2013) e52852. [22] W.R. Chen, H.B. Liu, Y.D. Chen, Y. Sha, Q. Ma, P.J. Zhu, Y. Mu, Melatonin attenuates myocardial ischemia/reperfusion injury by inhibiting autophagy Via an AMPK/mTOR signaling pathway, Cell. Physiol. Biochem. 47 (5) (2018) 2067–2076. [23] R. Rattan, R.P. Graham, J.L. Maguire, S. Giri, V. Shridhar, Metformin suppresses ovarian cancer growth and metastasis with enhancement of cisplatin cytotoxicity in vivo, Neoplasia 13 (5) (2011) 483–491. [24] Y. Liu, H. Yu, X. Zhang, Y. Wang, Z. Song, J. Zhao, H. Shi, R. Li, Y. Wang, L.W. Zhang, The protective role of autophagy in nephrotoxicity induced by bismuth nanoparticles through AMPK/mTOR pathway, Nanotoxicology 12 (6) (2018) 586–601. [25] L. Sun, S. Zhang, C. Yu, Z. Pan, Y. Liu, J. Zhao, X. Wang, F. Yun, H. Zhao, S. Yan, Y. Yuan, D. Wang, X. Ding, G. Liu, W. Li, X. Zhao, Z. Liu, Y. Li, Hydrogen sulfide reduces serum triglyceride by activating liver autophagy via the AMPK-mTOR pathway, Am. J. Physiol. Endocrinol. Metab. 309 (11) (2015) E925–35. [26] V. Vilchez, L. Turcios, D.A. Butterfield, M.I. Mitov, C.L. Coquillard, J.A. Brandon, V. Cornea, R. Gedaly, F. Marti, Evidence of the immunomodulatory role of dual PI3K/mTOR inhibitors in transplantation: an experimental study in mice, Transpl. Int. 30 (10) (2017) 1061–1074. [27] S. Stanojlovic, S. Schlickeiser, C. Appelt, K. Vogt, I. Schmitt-Knosalla, S. Haase, T. Ritter, B. Sawitzki, U. Pleyer, Influence of combined treatment of low dose rapamycin and cyclosporin A on corneal allograft survival, Graefes Arch. Clin. Exp. Ophthalmol. 248 (10) (2010) 1447–1456. [28] A.R. Hajrasouliha, T. Funaki, Z. Sadrai, T. Hattori, S.K. Chauhan, R. Dana, Vascular endothelial growth factor-C promotes alloimmunity by amplifying antigen-presenting cell maturation and lymphangiogenesis, Invest. Ophthalmol. Vis. Sci. 53 (3) (2012) 1244–1250.

[1] D.T.H. Tan, J.K.G. Dart, E.J. Holland, S. Kinoshita, Corneal transplantation, Lancet 379 (9827) (2012) 1749–1761. [2] The collaborative corneal transplantation studies (CCTS), Effectiveness of histocompatibility matching in high-risk corneal transplantation. The Collaborative Corneal Transplantation Studies Research Group, Arch. Ophthalmol. 110 (10) (1992) 1392–1403. [3] K.A. Williams, M. Lowe, C. Bartlett, T.L. Kelly, D.J. Coster, A. Contributors, Risk factors for human corneal graft failure within the australian corneal graft registry, Transplantation 86 (12) (2008) 1720–1724. [4] M.G. Maguire, W.J. Stark, J.D. Gottsch, R.D. Stulting, A. Sugar, N.E. Fink, A. Schwartz, Risk factors for corneal graft failure and rejection in the collaborative corneal transplantation studies. Collaborative Corneal Transplantation Studies Research Group, Ophthalmology 101 (9) (1994) 1536–1547. [5] B.E. Kemp, D. Stapleton, D.J. Campbell, Z.P. Chen, S. Murthy, M. Walter, A. Gupta, J.J. Adams, F. Katsis, B. van Denderen, I.G. Jennings, T. Iseli, B.J. Michell, L.A. Witters, AMP-activated protein kinase, super metabolic regulator, Biochem. Soc. Trans. 31 (Pt 1) (2003) 162–168. [6] S. Fogarty, D.G. Hardie, Development of protein kinase activators: AMPK as a target in metabolic disorders and cancer, Bba-Proteins Proteom 1804 (3) (2010) 581–591. [7] D.G. Hardie, AMP-activated protein kinase-an energy sensor that regulates all aspects of cell function, Gene Dev 25 (18) (2011) 1895–1908. [8] B. Viollet, S. Horman, J. Leclerc, L. Lantier, M. Foretz, M. Billaud, S. Giri, F. Andreelli, AMPK inhibition in health and disease, Crit. Rev. Biochem. Mol. Biol. 45 (4) (2010) 276–295. [9] O. Awwad, F. Coperchini, P. Pignatti, M. Denegri, S. Massara, L. Croce, C.A. Di Buduo, V. Abbonante, A. Balduini, L. Chiovato, M. Rotondi, The AMPK-activator AICAR in thyroid cancer: effects on CXCL8 secretion and on CXCL8-induced neoplastic cell migration, J. Endocrinol. Invest. (2018). [10] D.T. Hall, T. Griss, J.F. Ma, B.J. Sanchez, J. Sadek, A.M.K. Tremblay, S. Mubaid, A. Omer, R.J. Ford, N. Bedard, A. Pause, S.S. Wing, S. Di Marco, G.R. Steinberg, R.G. Jones, I.E. Gallouzi, The AMPK agonist 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR), but not metformin, prevents inflammation-associated cachectic muscle wasting, EMBO Mol. Med. 10 (7) (2018). [11] S. Kubota, Y. Ozawa, T. Kurihara, M. Sasaki, K. Yuki, S. Miyake, K. Noda, S. Ishida, K. Tsubota, Roles of AMP-activated protein kinase in diabetes-induced retinal inflammation, Invest. Ophthalmol. Vis. Sci. 52 (12) (2011) 9142–9148. [12] J.E. Jang, J.I. Eom, H.K. Jeung, J.W. Cheong, J.Y. Lee, J.S. Kim, Y.H. Min, AMPKULK1-Mediated autophagy confers resistance to BET inhibitor JQ1 in acute myeloid leukemia stem cells, Clin. Cancer Res. 23 (11) (2017) 2781–2794. [13] J.M. Leung, T. Stanley 3rd, J. Mathew, P. Curling, P. Barash, M. Salmenpera, J.G. Reves, M. Hollenberg, D.T. Mangano, An initial multicenter, randomized controlled trial on the safety and efficacy of acadesine in patients undergoing coronary artery bypass graft surgery. SPI Research Group, Anesth. Analg. 78 (3) (1994) 420–434. [14] P. Menasche, W.R. Jamieson, W. Flameng, M.K. Davies, Acadesine: a new drug that may improve myocardial protection in coronary artery bypass grafting. Results of the first international multicenter study. Multinational Acadesine Study Group, J. Thorac. Cardiovasc. Surg. 110 (4 Pt 1) (1995) 1096–1106. [15] E. Van Den Neste, G. Van den Berghe, F. Bontemps, AICA-riboside (acadesine), an activator of AMP-activated protein kinase with potential for application in

8

Biomedicine & Pharmacotherapy 113 (2019) 108558

L. Jiang, et al.

[29] X. Zhang, L. Shen, Y. Jin, D.R. Saban, S.K. Chauhan, R. Dana, Depletion of passenger leukocytes from corneal grafts: an effective means of promoting transplant survival? Invest. Ophthalmol. Vis. Sci. 50 (7) (2009) 3137–3144. [30] E.J. Holland, C.C. Chan, R.P. Wetzig, A.G. Palestine, R.B. Nussenblatt, Clinical and immunohistologic studies of corneal rejection in the rat penetrating keratoplasty model, Cornea 10 (5) (1991) 374–380. [31] E.J. Holland, T.W. Olsen, J. Sterrer, J.M. Ketchum, E.A. Mindrup, S.A. Gruber, Suppression of graft rejection using 15-deoxyspergualin in the allogeneic rat penetrating keratoplasty model, Cornea 13 (1) (1994) 28–32. [32] J.Y. Niederkorn, Immune mechanisms of corneal allograft rejection, Curr. Eye Res. 32 (12) (2007) 1005–1016. [33] A. Panda, M. Vanathi, A. Kumar, Y. Dash, S. Priya, Corneal graft rejection, Surv. Ophthalmol. 52 (4) (2007) 375–396. [34] Y. Xu, X. Lu, Y. Hu, B. Yang, C.K. Tsui, S. Yu, L. Lu, X. Liang, Melatonin attenuated retinal neovascularization and neuroglial dysfunction by inhibition of HIF-1alphaVEGF pathway in oxygen-induced retinopathy mice, J. Pineal Res. 64 (4) (2018) e12473. [35] P. Erpicum, J.M. Krzesinski, F. Jouret, [Role of AMP-activated protein kinase in renal ischemic preconditioning], Nephrol. Ther. 10 (1) (2014) 17–24. [36] D. Liang, D. Han, W. Fan, R. Zhang, H. Qiao, M. Fan, T. Su, S. Ma, X. Li, J. Chen, Y. Wang, J. Ren, F. Cao, Therapeutic efficacy of apelin on transplanted mesenchymal stem cells in hindlimb ischemic mice via regulation of autophagy, Sci. Rep. 6 (2016) 21914. [37] X. He, M.W. Yao, M. Zhu, D.L. Liang, W. Guo, Y. Yang, R.S. Zhao, T.T. Ren, X. Ao, W. Wang, C.Y. Zeng, H.P. Liang, D.P. Jiang, J. Yu, X. Xu, Metformin induces apoptosis in mesenchymal stromal cells and dampens their therapeutic efficacy in infarcted myocardium, Stem Cell Res. Ther. 9 (1) (2018) 306. [38] M. He, X. Shi, M. Yang, T. Yang, T. Li, J. Chen, Mesenchymal stem cells-derived IL-6 activates AMPK/mTOR signaling to inhibit the proliferation of reactive astrocytes induced by hypoxic-ischemic brain damage, Exp. Neurol. 311 (2019) 15–32. [39] T. Hattori, H. Takahashi, R. Dana, Novel insights into the immunoregulatory function and localization of dendritic cells, Cornea 35 (Suppl 1) (2016) S49–S54. [40] P. Hamrah, M.R. Dana, Corneal antigen-presenting cells, Chem. Immunol. Allergy 92 (2007) 58–70. [41] J.Y. Niederkorn, High-risk corneal allografts and why they lose their immune privilege, Curr. Opin. Allergy Clin. Immunol. 10 (5) (2010) 493–497. [42] Y. Xu, Q. Cheng, B. Yang, S. Yu, F. Xu, L. Lu, X. Liang, Increased sCD200 levels in vitreous of patients with proliferative diabetic retinopathy and its correlation with VEGF and proinflammatory cytokines, Invest. Ophthalmol. Vis. Sci. 56 (11) (2015) 6565–6572. [43] Y. Xu, B. Yang, Y. Hu, L. Lu, X. Lu, J. Wang, Q. Shu, Q. Cheng, S. Yu, F. Xu,

[44]

[45]

[46]

[47]

[48]

[49]

[50] [51] [52] [53]

[54]

[55]

[56]

9

J. Huang, X. Liang, Secretion of down syndrome critical region 1 Isoform 4 in ischemic retinal ganglion cells displays anti-angiogenic properties via NFATc1-dependent pathway, Mol. Neurobiol. 54 (8) (2017) 6556–6571. Y. Hou, V.N.H. Le, G. Toth, S. Siebelmann, J. Horstmann, T. Gabriel, F. Bock, C. Cursiefen, UV light crosslinking regresses mature corneal blood and lymphatic vessels and promotes subsequent high-risk corneal transplant survival, Am. J. Transplant. 18 (12) (2018) 2873–2884. W. Zhong, M. Montana, S.M. Santosa, I.D. Isjwara, Y.H. Huang, K.Y. Han, C. O’Neil, A. Wang, M.S. Cortina, J. de la Cruz, Q. Zhou, M.I. Rosenblatt, J.H. Chang, D.T. Azar, Angiogenesis and lymphangiogenesis in corneal transplantation-a review, Surv. Ophthalmol. 63 (4) (2018) 453–479. B. Bachmann, R.S. Taylor, C. Cursiefen, Corneal neovascularization as a risk factor for graft failure and rejection after keratoplasty an evidence-based meta-analysis, Ophthalmology 117 (7) (2010) 1300–U42. J. Yamada, K. Maruyama, Y. Sano, S. Kinoshita, Y. Murata, J. Hamuro, Promotion of corneal allograft survival by the induction of oxidative macrophages, Invest. Ophthalmol. Vis. Sci. 45 (2) (2004) 448–454. J.Y. Niederkorn, P.W. Chen, J. Mellon, C. Stevens, E. Mayhew, Allergic conjunctivitis exacerbates corneal allograft rejection by activating Th1 and th2 alloimmune responses, J. Immunol. 184 (11) (2010) 6076–6083. Y. Yang, J.F. Gao, Y. Zhang, W.P. Xu, Y.W. Hao, Z.P. Xu, L.M. Tao, Natural pyrethrins induce autophagy of HepG2 cells through the activation of AMPK/mTOR pathway, Environ Pollut 241 (2018) 1091–1097. G. Cavalli, C.A. Dinarello, Suppression of inflammation and acquired immunity by IL-37, Immunol. Rev. 281 (1) (2018) 179–190. M.H. Noureldein, A.A. Eid, Gut microbiota and mTOR signaling: Insight on a new pathophysiological interaction, Microb Pathogenesis 118 (2018) 98–104. H.W. Li, mTOR inhibition for transplantation: more may not be better, Transplantation 101 (12) (2017) 2816–2817. C. Wei, Y. Wang, L. Ma, X. Wang, H. Chi, S. Zhang, T. Liu, Z. Li, D. Xiang, Y. Dong, X. Wu, W. Shi, H. Gao, Rapamycin nano-micelle ophthalmic solution reduces corneal allograft rejection by potentiating myeloid-derived suppressor cells’ function, Front. Immunol. 9 (2018) 2283. W. Shi, H. Gao, L. Xie, S. Wang, Sustained intraocular rapamycin delivery effectively prevents high-risk corneal allograft rejection and neovascularization in rabbits, Invest. Ophthalmol. Vis. Sci. 47 (8) (2006) 3339–3344. J. Zhu, Y. Liu, Y. Pi, L. Jia, L. Wang, Y. Huang, Systemic application of sphingosine 1-phosphate receptor 1 immunomodulator inhibits corneal allograft rejection in mice, Acta Ophthalmol. (Copenh) 92 (1) (2014) e12–21. J. Levitsky, S. Feng, Sirolimus and mTOR inhibitors in liver transplantation: the wheel has come full circle, Am. J. Transplant. 14 (2) (2014) 249–250.