- Email: [email protected]
AIRE gene polymorphisms in systemic sclerosis associated with autoimmune thyroiditis
Clinical Immunology (2007) 122, 13—17
a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m
w w w. e l s e v i e r. c o m / l o c a t e / y c l i m
RAPID COMMUNICATION
AIRE gene polymorphisms in systemic sclerosis associated with autoimmune thyroiditis F. Ferrera a,⁎,1 , M. Rizzi a,⁎,1 , B. Sprecacenere b , P. Balestra a , M. Sessarego b , A. Di Carlo c , G. Filaci a,b , A. Gabrielli c , R. Ravazzolo a,d,e , F. Indiveri a,b a
Centre of Excellence for Biomedical Research, University of Genoa, Viale Benedetto XV, 7 16132 Genoa, Italy Department of Internal Medicine, University of Genoa, Italy c Department of Medical and Surgical Sciences, University of Ancona, Italy d Giannina Gaslini Institute, Genoa, Italy e Department of Pediatrics, University of Genoa, Italy b
Received 28 April 2006; accepted with revision 28 September 2006 Available online 13 November 2006 KEYWORDS AIRE; Systemic sclerosis; Polymorphisms; Genetic susceptibility; Autoimmunity
Abstract Mutations in the autoimmune regulator (AIRE) gene are responsible for autoimmune polyendocrinopathy–candidiasis–ectodermal dystrophy (APECED). Systemic sclerosis (SSc) is a non-organ-specific autoimmune disease mainly characterized by cutaneous involvement, that is frequently associated with other autoimmune manifestations common to APECED. Nineteen SSc patients, 22 patients affected by SSc associated with autoimmune thyroiditis, and 100 healthy controls were analyzed. We identified 11 AIRE gene variants, one of which has never previously been described. Intronic polymorphism G11107A was significantly correlated to SSc/thyroiditis. Data show that variants of the AIRE gene might be correlated to different clinical manifestations in SSc patients. © 2006 Elsevier Inc. All rights reserved.
Introduction Systemic sclerosis (SSc) is a rare autoimmune disease of unknown aetiology which occurs more frequently in females than in males (ratio 9:1). SSc is characterized by severe, Abbreviations: AIRE, autoimmune regulator; SSc, systemic sclerosis; APECED, autoimmune polyendocrinopathy–candidiasis– ectodermal dystrophy; ACR, American College of Rheumatology. ⁎ Corresponding authors. E-mail addresses: [email protected] (F. Ferrera), [email protected] (M. Rizzi). 1 These two authors contributed equally to this work.
progressive cutaneous and visceral fibrosis, alterations in the small vessels, and frequent cellular and humoral immunity abnormalities including the presence of auto-antibodies belonging to the IgG subclass that are induced by antigendriven Th cell-mediated immune responses. Therefore, autoreactive T cell clones are believed to be involved in the pathogenesis of the disease [1]. Among systemic autoimmune diseases, SSc has peculiar characteristics: its manifestations are prevalently cutaneous and it is associated with other endocrine organ-specific autoimmune diseases (Sjögren Syndrome, thyroid disease, type I diabetes, vitiligo, etc.). A correlation between SSc and gene mutations or polymorphisms has been found for several genes, such as
1521-6616/$ – see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.clim.2006.09.013
14
Rapid Communication
MCP-1 [2], fibrillin-1 [3], angiotensin converting enzyme [4], endothelial nitric oxide synthetase [4], transforming growth factor β [5], interleukin-1 [6], and transcription regulators, such as Smad 7 [7]. The commonly observed co-occurrence of various autoimmune diseases in the same individual has prompted researchers to carry out several studies aimed at identifying shared patho-physiological mechanisms. Thus, identification of the autoimmune regulator (AIRE) gene as a regulator of central tolerance [8] has opened new perspectives. AIRE has been identified as the disease locus for autoimmune polyendocrinopathy–candidiasis–ectodermal dystrophy (APECED), also known as autoimmune polyglandular syndrome type 1 [9]. APECED is characterized by at least two of the following conditions: chronic mucocutaneous candidiasis, hypoparathyroidism and Addison′s disease. Furthermore, APECED patients have a high incidence of many endocrine autoimmune diseases, such as thyroid autoimmune disease, diabetes mellitus type I, gonad failure, as well as extraendocrine autoimmune diseases such as hepatitis, vitiligo, alopecia, pernicious anemia, intestinal maladsorption, keratinopathy, and dystrophy of dental enamel and nails. It follows that SSc and APECED share some similarities since they both mainly involve the skin, and the endocrine organs also show autoimmune manifestations. Moreover, AIRE gene expression has recently been observed in the fibroblasts and keratinocytes of cultured skin samples [10], thus suggesting that the skin may play a role in immune regulation. Therefore, we felt it would be worthwhile investigating whether AIRE gene variants are related to the development of SSc, be it associated to autoimmune thyroiditis or not. Such a finding could be of both pathogenic and clinical relevance since it might provide us with further insight into clustering of autoimmune manifestations in some patients. Furthermore, upon diagnosis of SSc, we might be able to identify which patients will likely develop other autoimmune diseases.
Table 1
Materials and methods Patients and controls Twenty-two female patients affected by SSc and autoimmune thyroiditis (mean age 50), 19 female patients affected by SSc alone (mean age 54) and 100 age and sex matched healthy subjects as controls were enrolled in the casecontrol study at the Department of Internal Medicine of the University of Genoa. Diagnosis of SSc was made according to the American College of Rheumatology (ACR) criteria and association with autoimmune thyroiditis was defined by clinical evaluation, assessment of FT3, FT4, and TSH levels, and detection of anti-thyroglobulin, anti-thyroperoxidase antibodies. None of the patients were diagnosed with APECED, while some patients presented with associated autoimmune diseases (Sjögren Syndrome, vitiligo, primary biliary cirrhosis, and autoimmune polyneuropathy). All patients and controls were Caucasian females living in Italy. The study was approved by the University of Genoa Ethical Committee, and informed consent was obtained from all enrolled subjects.
Genetic analysis Genomic DNA was extracted from 300 μl of peripheral blood in Sodium Citrate using the Puregene DNA Purification System (Gentra Systems, Minneapolis, MN). Primers were designed to amplify each of the 14 exons of the AIRE gene and its intronic flanking sequences (GenBank accession no. AB006684). PCR conditions were optimized using various magnesium concentrations and annealing temperatures (Table 1). 40 ng of genomic DNA was run in each PCR reaction. PCR products were then purified from agarose gel by a QIAquick Gel Extraction kit (Qiagen, Hilden, Germany), automatically sequenced using Big Dye terminator (Applied
PCR and RFLP-PCR conditions
Exon
Forward primer
Reverse primer
Annealing temp. (°C)
Magnesium conc. (mM)
1 2 3 4 5 6 7 8 9 10 11 12 13 14
CTTTGCTCTTTGCGTGGTCG CACCCTCTAGTCATGATGGAGAT GTCTGGCCAAGGTGTCCAGTTCTG CCACTGAGAGGGGAGGCCAGGCTG CTGCTTCTGGCATAGAGTATGTGC GGCCTACACGACTGCCAAGGCAGG CTGCTGCCGAGAGACGC AGTTCAGGTACCCAGAGATGCTGC GATCTGTCACCCGCTGTC CAGCAGTCACTGACTCCTG GTGAGGCTCCTCACTTGCGCCTAG CATACCCCGGAGGTGGCATCCTG CCACCAGGGCTGTGGGAGTTGG TGACTTCTTGTAACGATGGCCATG
GACTATCCCTGGCTCACAG CCACTCCGGTTCCAGTCCTGC GGGAAGACTGGAGTCCCTGGCTGG CTCAGAGGGCAGGCCCTGCTCTGA GTGGTCCTCCTTCCATCTTGGAGC GCGTCTCTCGGCAGCAG GACCTCACTTTCTCTGAC GTGGCTTCCCTTCAGGGTCACTGG GACATAGTGCTATGGCTG GCTCCTTGAAGAGCCCAC TGTGGTTGTGGGCTGTATGATGTG AGGGTCTGCCCTGAGATGTGCTCC AGCCTGGGTGCCGGCTGAGGCAGG CTCCACCTCCCGAGTTCAAGTG
60 60 60 65 60 60 60 60 59 60 61 61 62 65
1.5 1.5 2 1.5 1.5 2 1.5 2 1.5 2.5 1.5 1.5 1.5 1.5
Restriction enzymes
BtgI, MspI BstXI Fnu4HI NlaIII HaeIII HaeIII BaeI/ RsaI
Hpy99I
PCR cycle: 1 cycle at 95°C for 3 min; 35 cycles at 94°C for 30 s, annealing temperature as indicated for 30 s, 72°C for 45 s; elongation cycle at 72°C for 5 min; maintain at 4°C. Primers were synthesized by TibMolBiol facility S.r.l. (ABC, Genoa).
Rapid Communication
15
Biosystems, Foster City, CA), and then run on an ABI 3100 machine (Applied Biosystems). Restriction fragment length polymorphism (RFLP)-PCR was performed on genomic DNA from healthy controls in order to screen allelic frequency of AIRE polymorphisms in the healthy control population. Ten to 20 μl of the PCR product was digested overnight in a 30 μl reaction containing 10 U of the selected enzyme (New England Biolabs, Beverly, MA) (Table 1). Allelic discrimination was performed by 2% agarose or 15% polyacrylamide gel electrophoresis.
Statistical analysis Disease and control populations were compared using 2 × 2 tables, by grouping the individuals that were heterozygous and homozygous for the alternative allele and comparing their risk versus individuals who were homozygous for wildtype allele. Chi-square test was performed, while for small numbers of samples we carried out Chi-square test with Yates correction and/or Fisher Exact Test.
Results and discussion AIRE protein is expressed by medullary epithelial cells in the thymus and by blood monocytes and dendritic cells (DC) [11] in the periphery. It has been demonstrated that in the thymus, AIRE regulates the expression of several messenger RNAs coding for ectopic peripheral proteins [8]. Furthermore, recent studies have shown that AIRE positively controls the expression of genes involved in antigen processing and presentation as well as genes coding for chemokines [12]. Altogether, these findings suggest that AIRE plays an important role in maintaining central immune tolerance by regulating intrathymic antigen presentation. Recent data showing differential transcript expression by peripheral DC in AIRE-null mice [13], suggest that AIRE may also participate in the induction and maintenance of peripheral immune tolerance. AIRE gene homozygous mutations in patients affected by APECED are considered responsible for changes in the AIRE protein function Table 2
leading to disease onset [14]. Indeed, demonstration that AIRE acts in a dosage-dependent mechanism [15] supports the view that a slight decrease in the AIRE gene function (as in mutations in heterozygosis) can lead to a decreased intrathymic presentation of endogenous proteins, thus allowing maturation and delivery of autoreactive T cell clones in the periphery, and therefore predisposing to autoimmune disease. To date, there are no reports in the literature regarding the search for AIRE gene variants in SSc patients. Therefore, our study focused on an analysis of the presence of AIRE gene variants in a population of 22 patients affected by SSc and autoimmune thyroiditis, 19 patients affected by SSc alone, and 100 healthy controls. We identified two mutations, i.e., V301M and T441M in patients affected by both SSc and autoimmune thyroiditis, as well as 9 polymorphisms (one of which, S278R, was found to lead to an amino acid change) in patients with SSc, regardless of whether it was associated with autoimmune thyroiditis or not (Table 2). The V301M mutation was found in an SSc female patient who was also affected by autoimmune thyroiditis. The same mutation was previously reported, in heterozygosis, in a Norwegian woman affected by Addison's disease, autoimmune thyroiditis, and gonad failure, whose diagnosis did not fulfill the criteria for APECED disease [16]. The T441M mutation was found in an SSc female patient who was affected by autoimmune thyroiditis and Sjogren syndrome with no manifestations correlated to APECED. To our knowledge, this mutation has never been described in the literature. The T441M variant could be specific for SSc, or it could be a mutation that induces AIRE malfunctioning, thus predisposing to the onset of multi-organ autoimmune diseases, as is likely the case for the V301M mutation. Although statistical analyses did not reveal a significant association between the presence of either the V301M or T441M variant and SSc, the possible pathogenic relevance of these mutations cannot be ruled out in selected subgroups of patients due to the rarity of both SSc and AIRE mutations. Interestingly, both mutations are located in functional regions of the protein (the PHD2 domain that is essential for transcriptional activation [17,18] and the PHD1 domain
Genome localization and allelic frequency of AIRE gene variants in patient and control groups
Location
Genomic change
Amino acid change
SSc with associated thyroiditis allelic frequency *
SS c alone allelic frequency*
Healthy controls allelic frequency*
Notes
7 exon 8 exon 11 exon 4 intron 5 exon 6 exon 7 intron 9 intron 10 exon 11 intron 14 exon
C8723G G9816A C12532T G7014A C7094T C8385T T8924C G11107A T11794C 12697insC T16366C
S278R V301M T441M
0.04 0.02 0.02 0.07 0.27 0.14 0.22 0.34 0.43 0.70 0.39
0.08 0.0 0.0 0.08 0.18 0.21 – 0.13 0.26 – 0.34
0.13 0.0 0.0 0.06 0.23 0.18 – 0.15 0.34 – 0.38
a, b, d c –
silent silent
insertion silent
a. Also reported in Scott et al. [23]. b. Also reported in Wang et al. [24]. c. Also reported in Soderbergh et al. [20]. d. Also reported in Tazi –Ahnini [22]. ⁎ Determined in a sample of 44 alleles, 38 alleles, 200 alleles, respectively.
a, a, a, a, a, – a,
d d d b, d b, d b, d
16 which is involved in protein–protein interaction with a possible E3 ubiquitin ligase function [17,19], for T441M and V301M respectively). Neither mutation proved to be specific for APECED disease, as they were found in patients affected by different autoimmune manifestations. This finding suggests that different mutations of the AIRE gene may be correlated to clinical phenotypes, such as SSc and other organ-specific autoimmune diseases, that are diverse from those typically described as APECED. Concerning AIRE polymorphisms, G7014A, G11107A, T11794C, T16366C, were found in homozygosis. The only detected AIRE polymorphism causing amino acid change is S278R, which is located within the SAND domain. It is likely responsible for DNA binding [20] and for the nuclear localization of AIRE [21]. An association has been found between S278R and alopecia areata [22]. Statistical analysis suggests that S278R is not correlated to SSc, regardless of whether it is associated with autoimmune thyroiditis or not (p = 0.26). The fact that it has been found more often in healthy subjects than in patients could support the view that this polymorphism may have a ‘protective’ effect against SSc and autoimmune thyroiditis. Polymorphism G11107A is strongly associated with the concomitance of SSc and thyroiditis. In fact, a significant difference was found in the frequency of such variant between patients with SSc and associated thyroiditis and patients with SSc alone (p = 0.02) or healthy subjects (p = 0.003). On the contrary, no differences in G11107A variant frequency were detected between SSc patients and healthy subjects. Thus, polymorphism G11107A could predispose to developing SSc-associated thyroiditis. Even though such polymorphism is located in an intronic region, it could be in linkage disequilibrium with other regions of the genome (containing predisposing haplotypes) or other variants that are more directly involved in the pathogenesis of the disease. In conclusion, our study shows that AIRE gene mutations may be present in patients with SSc and with SSc associated with thyroiditis. Analyses in wider series of patients are needed to uncover statistically significant associations between the frequencies of such variants in SSc patients, with or without thyroiditis, and healthy subjects. However, for the first time, our results indicate that AIRE gene alterations may be involved in the pathogenesis of a systemic autoimmune disease.
Acknowledgments We thank Prof. Giuseppe Ferrera for his support in the statistical analysis. The study has been supported by a grant from Compagnia di San Paolo entitled "Tolerogenic gene immunization and adoptive suppressor cell transfer as therapies for systemic lupus erythematosus".
References [1] M. Kuwana, T.A. Medsger Jr., T.M. Wright, T and B cell collaboration is essential for the autoantibody response to DNA topoisomerase I in systemic sclerosis, J. Immunol. 155 (1995) 2703–2714.
Rapid Communication [2] S. Karrer, A.K. Bosserhoff, P. Weiderer, O. Distler, M. Landthaler, R.M. Szeimies, U. Muller-Ladner, J. Scholmerich, C. Hellerbrand, The − 2518 promotor polymorphism in the MCP-1 gene is associated with systemic sclerosis, J. Invest. Dermatol. 124 (2005) 92–98. [3] F.K. Tan, N. Wang, M. Kuwana, R. Chakraborty, C.A. Bona, D. M. Milewicz, F.C. Arnett, Association of fibrillin 1 singlenucleotide polymorphism haplotypes with systemic sclerosis in Choctaw and Japanese populations, Arthritis Rheum. 44 (2001) 893–901. [4] C. Fatini, F. Gensini, E. Sticchi, B. Battaglini, C. Angotti, M.L. Conforti, S. Generini, A. Pignone, R. Abbate, M. MatucciCerinic, High prevalence of polymorphisms of angiotensinconverting enzyme (I/D) and endothelial nitric oxide synthase (Glu298Asp) in patients with systemic sclerosis, Am. J. Med. 112 (2002) 540–544. [5] A. Crilly, J. Hamilton, C.J. Clark, A. Jardine, R. Madhok, Analysis of transforming growth factor beta1 gene polymorphisms in patients with systemic sclerosis, Ann. Rheum. Dis. 61 (2002) 678–681. [6] B. Hutyrova, J. Lukac, V. Bosak, M. Buc, R. du Bois, M. Petrek, Interleukin 1alpha single-nucleotide polymorphism associated with systemic sclerosis, J. Rheumatol. 31 (2004) 81–84. [7] C. Dong, S. Zhu, T. Wang, W. Yoon, Z. Li, R.J. Alvarez, P. ten Dijke, B. White, F.M. Wigley, P.J. Goldschmidt-Clermont, Deficient Smad7 expression: a putative molecular defect in scleroderma, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 3908–3913. [8] M.S. Anderson, E.S. Venanzi, L. Klein, Z. Chen, S.P. Berzins, S.J. Turley, H. Boehmer, R. Bronson, A. Dierich, C. Benoist, D. Mathis, Projection of an immunological self shadow within the thymus by the AIRE protein, Science 298 (2002) 1395–1401. [9] K. Nagamine, P. Peterson, K.S. Scott, J. Kudoh, S. Minoshima, M. Heino, K.J. Krohn, M.D. Lalioti, P.E. Mullis, S.E. Antonarakis, K. Kawasaki, S. Asakawa, F. Ito, N. Shimizu, Positional cloning of the APECED gene, Nat. Genet. 17 (1997) 393–398. [10] R.A. Clark, K. Yamanaka, M. Bai, R. Dowgiert, T.S. Kupper, Human skin cells support thymus-independent T cell development, J. Clin. Invest. 115 (2005) 3239–3249. [11] K. Kogawa, S. Nagafuchi, H. Katsuta, J. Kudoh, S. Tamiya, Y. Sakai, N. Shimizu, M. Harada, Expression of AIRE gene in peripheral monocyte/dendritic cell lineage, Immunol. Lett. 80 (2002) 195–198. [12] M.S. Anderson, E.S. Venanzi, Z. Chen, S.P. Berzins, C. Benoist, D. Mathis, The cellular mechanism of Aire control of T cell tolerance, Immunity 23 (2005) 227–239. [13] C. Ramsey, S. Hassler, P. Marits, O. Kampe, C.D. Surh, L. Peltonen, O. Winqvist, Increased antigen presenting cellmediated T cell activation in mice and patients without the autoimmune regulator, Eur. J. Immunol. 36 (2006) 305–317. [14] P. Bjorses, M. Halonen, J.J. Palvimo, M. Kolmer, J. Aaltonen, P. Ellonen, J. Perheentupa, I. Ulmanen, L. Peltonen, Mutations in the AIRE gene: effects on subcellular location and transactivation function of the autoimmune polyendocrinopathy–candidiasis–ectodermal dystrophy protein, Am. J. Hum. Genet. 66 (2000) 378–392. [15] A. Liston, D.H. Gray, S. Lesage, A.L. Fletcher, J. Wilson, K.E. Webster, H.S. Scott, R.L. Boyd, L. Peltonen, C.C. Goodnow, Gene dosage–limiting role of Aire in thymic expression, clonal deletion, and organ-specific autoimmunity, J. Exp. Med. 200 (2004) 1015–1026. [16] A. Soderbergh, F. Rorsman, M. Halonen, O. Ekwall, P. Bjorses, O. Kampe, E.S. Husebye, Autoantibodies against aromatic Lamino acid decarboxylase identifies a subgroup of patients with Addison's disease, J. Clin. Endocrinol. Metab. 85 (2000) 460–463. [17] D. Uchida, S. Hatakeyama, A. Matsushima, H. Han, S. Ishido, H. Hotta, J. Kudoh, N. Shimizu, V. Doucas, K.I. Nakayama, N.
Rapid Communication Kuroda, M. Matsumoto, AIRE functions as an E3 ubiquitin ligase, J. Exp. Med. 199 (2004) 167–172. [18] J. Pitkanen, V. Doucas, T. Sternsdorf, T. Nakajima, S. Aratani, K. Jensen, H. Will, P. Vahamurto, J. Ollila, M. Vihinen, H.S. Scott, S.E. Antonarakis, J. Kudoh, N. Shimizu, K. Krohn, P. Peterson, The autoimmune regulator protein has transcriptional transactivating properties and interacts with the common coactivator CREB-binding protein, J. Biol. Chem. 275 (2000) 16802–16809. [19] M.J. Bottomley, G. Stier, D. Pennacchini, G. Legube, B. Simon, A. Akhtar, M. Sattler, G. Musco, NMR structure of the first PHD finger of autoimmune regulator protein (AIRE1). Insights into autoimmune polyendocrinopathy–candidiasis–ectodermal dystrophy (APECED) disease, J. Biol. Chem. 280 (2005) 11505–11512. [20] T.J. Gibson, C. Ramu, C. Gemund, R. Aasland, The APECED polyglandular autoimmune syndrome protein, AIRE-1, contains the SAND domain and is probably a transcription factor, Trends. Biochem. Sci. 23 (1998) 242–244.
17 [21] C. Ramsey, A. Bukrinsky, L. Peltonen, Systematic mutagenesis of the functional domains of AIRE reveals their role in intracellular targeting, Hum. Mol. Genet. 11 (2002) 3299–3308. [22] R. Tazi-Ahnini, M.J. Cork, D.J. Gawkrodger, M.P. Birch, D. Wengraf, A.J. McDonagh, A.G. Messenger, Role of the autoimmune regulator (AIRE) gene in alopecia areata: strong association of a potentially functional AIRE polymorphism with alopecia universalis, Tissue Antigens 60 (2002) 489–495. [23] H.S. Scott, M. Heino, P. Peterson, L. Mittaz, M.D. Lalioti, C. Betterle, A. Cohen, M. Seri, M. Lerone, G. Romeo, P. Collin, M. Salo, R. Metcalfe, A. Weetman, M.P. Papasavvas, C. Rossier, K. Nagamine, J. Kudoh, N. Shimizu, K.J. Krohn, S.E. Antonarakis, Common mutations in autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy patients of different origins, Mol. Endocrinol. 12 (1998) 1112–1119. [24] C.Y. Wang, A. Davoodi-Semiromi, W. Huang, E. Connor, J.D. Shi, J.X. She, Characterization of mutations in patients with autoimmune polyglandular syndrome type 1 (APS1), Hum. Genet. 103 (1998) 681–685.
a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m
w w w. e l s e v i e r. c o m / l o c a t e / y c l i m
RAPID COMMUNICATION
AIRE gene polymorphisms in systemic sclerosis associated with autoimmune thyroiditis F. Ferrera a,⁎,1 , M. Rizzi a,⁎,1 , B. Sprecacenere b , P. Balestra a , M. Sessarego b , A. Di Carlo c , G. Filaci a,b , A. Gabrielli c , R. Ravazzolo a,d,e , F. Indiveri a,b a
Centre of Excellence for Biomedical Research, University of Genoa, Viale Benedetto XV, 7 16132 Genoa, Italy Department of Internal Medicine, University of Genoa, Italy c Department of Medical and Surgical Sciences, University of Ancona, Italy d Giannina Gaslini Institute, Genoa, Italy e Department of Pediatrics, University of Genoa, Italy b
Received 28 April 2006; accepted with revision 28 September 2006 Available online 13 November 2006 KEYWORDS AIRE; Systemic sclerosis; Polymorphisms; Genetic susceptibility; Autoimmunity
Abstract Mutations in the autoimmune regulator (AIRE) gene are responsible for autoimmune polyendocrinopathy–candidiasis–ectodermal dystrophy (APECED). Systemic sclerosis (SSc) is a non-organ-specific autoimmune disease mainly characterized by cutaneous involvement, that is frequently associated with other autoimmune manifestations common to APECED. Nineteen SSc patients, 22 patients affected by SSc associated with autoimmune thyroiditis, and 100 healthy controls were analyzed. We identified 11 AIRE gene variants, one of which has never previously been described. Intronic polymorphism G11107A was significantly correlated to SSc/thyroiditis. Data show that variants of the AIRE gene might be correlated to different clinical manifestations in SSc patients. © 2006 Elsevier Inc. All rights reserved.
Introduction Systemic sclerosis (SSc) is a rare autoimmune disease of unknown aetiology which occurs more frequently in females than in males (ratio 9:1). SSc is characterized by severe, Abbreviations: AIRE, autoimmune regulator; SSc, systemic sclerosis; APECED, autoimmune polyendocrinopathy–candidiasis– ectodermal dystrophy; ACR, American College of Rheumatology. ⁎ Corresponding authors. E-mail addresses: [email protected] (F. Ferrera), [email protected] (M. Rizzi). 1 These two authors contributed equally to this work.
progressive cutaneous and visceral fibrosis, alterations in the small vessels, and frequent cellular and humoral immunity abnormalities including the presence of auto-antibodies belonging to the IgG subclass that are induced by antigendriven Th cell-mediated immune responses. Therefore, autoreactive T cell clones are believed to be involved in the pathogenesis of the disease [1]. Among systemic autoimmune diseases, SSc has peculiar characteristics: its manifestations are prevalently cutaneous and it is associated with other endocrine organ-specific autoimmune diseases (Sjögren Syndrome, thyroid disease, type I diabetes, vitiligo, etc.). A correlation between SSc and gene mutations or polymorphisms has been found for several genes, such as
1521-6616/$ – see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.clim.2006.09.013
14
Rapid Communication
MCP-1 [2], fibrillin-1 [3], angiotensin converting enzyme [4], endothelial nitric oxide synthetase [4], transforming growth factor β [5], interleukin-1 [6], and transcription regulators, such as Smad 7 [7]. The commonly observed co-occurrence of various autoimmune diseases in the same individual has prompted researchers to carry out several studies aimed at identifying shared patho-physiological mechanisms. Thus, identification of the autoimmune regulator (AIRE) gene as a regulator of central tolerance [8] has opened new perspectives. AIRE has been identified as the disease locus for autoimmune polyendocrinopathy–candidiasis–ectodermal dystrophy (APECED), also known as autoimmune polyglandular syndrome type 1 [9]. APECED is characterized by at least two of the following conditions: chronic mucocutaneous candidiasis, hypoparathyroidism and Addison′s disease. Furthermore, APECED patients have a high incidence of many endocrine autoimmune diseases, such as thyroid autoimmune disease, diabetes mellitus type I, gonad failure, as well as extraendocrine autoimmune diseases such as hepatitis, vitiligo, alopecia, pernicious anemia, intestinal maladsorption, keratinopathy, and dystrophy of dental enamel and nails. It follows that SSc and APECED share some similarities since they both mainly involve the skin, and the endocrine organs also show autoimmune manifestations. Moreover, AIRE gene expression has recently been observed in the fibroblasts and keratinocytes of cultured skin samples [10], thus suggesting that the skin may play a role in immune regulation. Therefore, we felt it would be worthwhile investigating whether AIRE gene variants are related to the development of SSc, be it associated to autoimmune thyroiditis or not. Such a finding could be of both pathogenic and clinical relevance since it might provide us with further insight into clustering of autoimmune manifestations in some patients. Furthermore, upon diagnosis of SSc, we might be able to identify which patients will likely develop other autoimmune diseases.
Table 1
Materials and methods Patients and controls Twenty-two female patients affected by SSc and autoimmune thyroiditis (mean age 50), 19 female patients affected by SSc alone (mean age 54) and 100 age and sex matched healthy subjects as controls were enrolled in the casecontrol study at the Department of Internal Medicine of the University of Genoa. Diagnosis of SSc was made according to the American College of Rheumatology (ACR) criteria and association with autoimmune thyroiditis was defined by clinical evaluation, assessment of FT3, FT4, and TSH levels, and detection of anti-thyroglobulin, anti-thyroperoxidase antibodies. None of the patients were diagnosed with APECED, while some patients presented with associated autoimmune diseases (Sjögren Syndrome, vitiligo, primary biliary cirrhosis, and autoimmune polyneuropathy). All patients and controls were Caucasian females living in Italy. The study was approved by the University of Genoa Ethical Committee, and informed consent was obtained from all enrolled subjects.
Genetic analysis Genomic DNA was extracted from 300 μl of peripheral blood in Sodium Citrate using the Puregene DNA Purification System (Gentra Systems, Minneapolis, MN). Primers were designed to amplify each of the 14 exons of the AIRE gene and its intronic flanking sequences (GenBank accession no. AB006684). PCR conditions were optimized using various magnesium concentrations and annealing temperatures (Table 1). 40 ng of genomic DNA was run in each PCR reaction. PCR products were then purified from agarose gel by a QIAquick Gel Extraction kit (Qiagen, Hilden, Germany), automatically sequenced using Big Dye terminator (Applied
PCR and RFLP-PCR conditions
Exon
Forward primer
Reverse primer
Annealing temp. (°C)
Magnesium conc. (mM)
1 2 3 4 5 6 7 8 9 10 11 12 13 14
CTTTGCTCTTTGCGTGGTCG CACCCTCTAGTCATGATGGAGAT GTCTGGCCAAGGTGTCCAGTTCTG CCACTGAGAGGGGAGGCCAGGCTG CTGCTTCTGGCATAGAGTATGTGC GGCCTACACGACTGCCAAGGCAGG CTGCTGCCGAGAGACGC AGTTCAGGTACCCAGAGATGCTGC GATCTGTCACCCGCTGTC CAGCAGTCACTGACTCCTG GTGAGGCTCCTCACTTGCGCCTAG CATACCCCGGAGGTGGCATCCTG CCACCAGGGCTGTGGGAGTTGG TGACTTCTTGTAACGATGGCCATG
GACTATCCCTGGCTCACAG CCACTCCGGTTCCAGTCCTGC GGGAAGACTGGAGTCCCTGGCTGG CTCAGAGGGCAGGCCCTGCTCTGA GTGGTCCTCCTTCCATCTTGGAGC GCGTCTCTCGGCAGCAG GACCTCACTTTCTCTGAC GTGGCTTCCCTTCAGGGTCACTGG GACATAGTGCTATGGCTG GCTCCTTGAAGAGCCCAC TGTGGTTGTGGGCTGTATGATGTG AGGGTCTGCCCTGAGATGTGCTCC AGCCTGGGTGCCGGCTGAGGCAGG CTCCACCTCCCGAGTTCAAGTG
60 60 60 65 60 60 60 60 59 60 61 61 62 65
1.5 1.5 2 1.5 1.5 2 1.5 2 1.5 2.5 1.5 1.5 1.5 1.5
Restriction enzymes
BtgI, MspI BstXI Fnu4HI NlaIII HaeIII HaeIII BaeI/ RsaI
Hpy99I
PCR cycle: 1 cycle at 95°C for 3 min; 35 cycles at 94°C for 30 s, annealing temperature as indicated for 30 s, 72°C for 45 s; elongation cycle at 72°C for 5 min; maintain at 4°C. Primers were synthesized by TibMolBiol facility S.r.l. (ABC, Genoa).
Rapid Communication
15
Biosystems, Foster City, CA), and then run on an ABI 3100 machine (Applied Biosystems). Restriction fragment length polymorphism (RFLP)-PCR was performed on genomic DNA from healthy controls in order to screen allelic frequency of AIRE polymorphisms in the healthy control population. Ten to 20 μl of the PCR product was digested overnight in a 30 μl reaction containing 10 U of the selected enzyme (New England Biolabs, Beverly, MA) (Table 1). Allelic discrimination was performed by 2% agarose or 15% polyacrylamide gel electrophoresis.
Statistical analysis Disease and control populations were compared using 2 × 2 tables, by grouping the individuals that were heterozygous and homozygous for the alternative allele and comparing their risk versus individuals who were homozygous for wildtype allele. Chi-square test was performed, while for small numbers of samples we carried out Chi-square test with Yates correction and/or Fisher Exact Test.
Results and discussion AIRE protein is expressed by medullary epithelial cells in the thymus and by blood monocytes and dendritic cells (DC) [11] in the periphery. It has been demonstrated that in the thymus, AIRE regulates the expression of several messenger RNAs coding for ectopic peripheral proteins [8]. Furthermore, recent studies have shown that AIRE positively controls the expression of genes involved in antigen processing and presentation as well as genes coding for chemokines [12]. Altogether, these findings suggest that AIRE plays an important role in maintaining central immune tolerance by regulating intrathymic antigen presentation. Recent data showing differential transcript expression by peripheral DC in AIRE-null mice [13], suggest that AIRE may also participate in the induction and maintenance of peripheral immune tolerance. AIRE gene homozygous mutations in patients affected by APECED are considered responsible for changes in the AIRE protein function Table 2
leading to disease onset [14]. Indeed, demonstration that AIRE acts in a dosage-dependent mechanism [15] supports the view that a slight decrease in the AIRE gene function (as in mutations in heterozygosis) can lead to a decreased intrathymic presentation of endogenous proteins, thus allowing maturation and delivery of autoreactive T cell clones in the periphery, and therefore predisposing to autoimmune disease. To date, there are no reports in the literature regarding the search for AIRE gene variants in SSc patients. Therefore, our study focused on an analysis of the presence of AIRE gene variants in a population of 22 patients affected by SSc and autoimmune thyroiditis, 19 patients affected by SSc alone, and 100 healthy controls. We identified two mutations, i.e., V301M and T441M in patients affected by both SSc and autoimmune thyroiditis, as well as 9 polymorphisms (one of which, S278R, was found to lead to an amino acid change) in patients with SSc, regardless of whether it was associated with autoimmune thyroiditis or not (Table 2). The V301M mutation was found in an SSc female patient who was also affected by autoimmune thyroiditis. The same mutation was previously reported, in heterozygosis, in a Norwegian woman affected by Addison's disease, autoimmune thyroiditis, and gonad failure, whose diagnosis did not fulfill the criteria for APECED disease [16]. The T441M mutation was found in an SSc female patient who was affected by autoimmune thyroiditis and Sjogren syndrome with no manifestations correlated to APECED. To our knowledge, this mutation has never been described in the literature. The T441M variant could be specific for SSc, or it could be a mutation that induces AIRE malfunctioning, thus predisposing to the onset of multi-organ autoimmune diseases, as is likely the case for the V301M mutation. Although statistical analyses did not reveal a significant association between the presence of either the V301M or T441M variant and SSc, the possible pathogenic relevance of these mutations cannot be ruled out in selected subgroups of patients due to the rarity of both SSc and AIRE mutations. Interestingly, both mutations are located in functional regions of the protein (the PHD2 domain that is essential for transcriptional activation [17,18] and the PHD1 domain
Genome localization and allelic frequency of AIRE gene variants in patient and control groups
Location
Genomic change
Amino acid change
SSc with associated thyroiditis allelic frequency *
SS c alone allelic frequency*
Healthy controls allelic frequency*
Notes
7 exon 8 exon 11 exon 4 intron 5 exon 6 exon 7 intron 9 intron 10 exon 11 intron 14 exon
C8723G G9816A C12532T G7014A C7094T C8385T T8924C G11107A T11794C 12697insC T16366C
S278R V301M T441M
0.04 0.02 0.02 0.07 0.27 0.14 0.22 0.34 0.43 0.70 0.39
0.08 0.0 0.0 0.08 0.18 0.21 – 0.13 0.26 – 0.34
0.13 0.0 0.0 0.06 0.23 0.18 – 0.15 0.34 – 0.38
a, b, d c –
silent silent
insertion silent
a. Also reported in Scott et al. [23]. b. Also reported in Wang et al. [24]. c. Also reported in Soderbergh et al. [20]. d. Also reported in Tazi –Ahnini [22]. ⁎ Determined in a sample of 44 alleles, 38 alleles, 200 alleles, respectively.
a, a, a, a, a, – a,
d d d b, d b, d b, d
16 which is involved in protein–protein interaction with a possible E3 ubiquitin ligase function [17,19], for T441M and V301M respectively). Neither mutation proved to be specific for APECED disease, as they were found in patients affected by different autoimmune manifestations. This finding suggests that different mutations of the AIRE gene may be correlated to clinical phenotypes, such as SSc and other organ-specific autoimmune diseases, that are diverse from those typically described as APECED. Concerning AIRE polymorphisms, G7014A, G11107A, T11794C, T16366C, were found in homozygosis. The only detected AIRE polymorphism causing amino acid change is S278R, which is located within the SAND domain. It is likely responsible for DNA binding [20] and for the nuclear localization of AIRE [21]. An association has been found between S278R and alopecia areata [22]. Statistical analysis suggests that S278R is not correlated to SSc, regardless of whether it is associated with autoimmune thyroiditis or not (p = 0.26). The fact that it has been found more often in healthy subjects than in patients could support the view that this polymorphism may have a ‘protective’ effect against SSc and autoimmune thyroiditis. Polymorphism G11107A is strongly associated with the concomitance of SSc and thyroiditis. In fact, a significant difference was found in the frequency of such variant between patients with SSc and associated thyroiditis and patients with SSc alone (p = 0.02) or healthy subjects (p = 0.003). On the contrary, no differences in G11107A variant frequency were detected between SSc patients and healthy subjects. Thus, polymorphism G11107A could predispose to developing SSc-associated thyroiditis. Even though such polymorphism is located in an intronic region, it could be in linkage disequilibrium with other regions of the genome (containing predisposing haplotypes) or other variants that are more directly involved in the pathogenesis of the disease. In conclusion, our study shows that AIRE gene mutations may be present in patients with SSc and with SSc associated with thyroiditis. Analyses in wider series of patients are needed to uncover statistically significant associations between the frequencies of such variants in SSc patients, with or without thyroiditis, and healthy subjects. However, for the first time, our results indicate that AIRE gene alterations may be involved in the pathogenesis of a systemic autoimmune disease.
Acknowledgments We thank Prof. Giuseppe Ferrera for his support in the statistical analysis. The study has been supported by a grant from Compagnia di San Paolo entitled "Tolerogenic gene immunization and adoptive suppressor cell transfer as therapies for systemic lupus erythematosus".
References [1] M. Kuwana, T.A. Medsger Jr., T.M. Wright, T and B cell collaboration is essential for the autoantibody response to DNA topoisomerase I in systemic sclerosis, J. Immunol. 155 (1995) 2703–2714.
Rapid Communication [2] S. Karrer, A.K. Bosserhoff, P. Weiderer, O. Distler, M. Landthaler, R.M. Szeimies, U. Muller-Ladner, J. Scholmerich, C. Hellerbrand, The − 2518 promotor polymorphism in the MCP-1 gene is associated with systemic sclerosis, J. Invest. Dermatol. 124 (2005) 92–98. [3] F.K. Tan, N. Wang, M. Kuwana, R. Chakraborty, C.A. Bona, D. M. Milewicz, F.C. Arnett, Association of fibrillin 1 singlenucleotide polymorphism haplotypes with systemic sclerosis in Choctaw and Japanese populations, Arthritis Rheum. 44 (2001) 893–901. [4] C. Fatini, F. Gensini, E. Sticchi, B. Battaglini, C. Angotti, M.L. Conforti, S. Generini, A. Pignone, R. Abbate, M. MatucciCerinic, High prevalence of polymorphisms of angiotensinconverting enzyme (I/D) and endothelial nitric oxide synthase (Glu298Asp) in patients with systemic sclerosis, Am. J. Med. 112 (2002) 540–544. [5] A. Crilly, J. Hamilton, C.J. Clark, A. Jardine, R. Madhok, Analysis of transforming growth factor beta1 gene polymorphisms in patients with systemic sclerosis, Ann. Rheum. Dis. 61 (2002) 678–681. [6] B. Hutyrova, J. Lukac, V. Bosak, M. Buc, R. du Bois, M. Petrek, Interleukin 1alpha single-nucleotide polymorphism associated with systemic sclerosis, J. Rheumatol. 31 (2004) 81–84. [7] C. Dong, S. Zhu, T. Wang, W. Yoon, Z. Li, R.J. Alvarez, P. ten Dijke, B. White, F.M. Wigley, P.J. Goldschmidt-Clermont, Deficient Smad7 expression: a putative molecular defect in scleroderma, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 3908–3913. [8] M.S. Anderson, E.S. Venanzi, L. Klein, Z. Chen, S.P. Berzins, S.J. Turley, H. Boehmer, R. Bronson, A. Dierich, C. Benoist, D. Mathis, Projection of an immunological self shadow within the thymus by the AIRE protein, Science 298 (2002) 1395–1401. [9] K. Nagamine, P. Peterson, K.S. Scott, J. Kudoh, S. Minoshima, M. Heino, K.J. Krohn, M.D. Lalioti, P.E. Mullis, S.E. Antonarakis, K. Kawasaki, S. Asakawa, F. Ito, N. Shimizu, Positional cloning of the APECED gene, Nat. Genet. 17 (1997) 393–398. [10] R.A. Clark, K. Yamanaka, M. Bai, R. Dowgiert, T.S. Kupper, Human skin cells support thymus-independent T cell development, J. Clin. Invest. 115 (2005) 3239–3249. [11] K. Kogawa, S. Nagafuchi, H. Katsuta, J. Kudoh, S. Tamiya, Y. Sakai, N. Shimizu, M. Harada, Expression of AIRE gene in peripheral monocyte/dendritic cell lineage, Immunol. Lett. 80 (2002) 195–198. [12] M.S. Anderson, E.S. Venanzi, Z. Chen, S.P. Berzins, C. Benoist, D. Mathis, The cellular mechanism of Aire control of T cell tolerance, Immunity 23 (2005) 227–239. [13] C. Ramsey, S. Hassler, P. Marits, O. Kampe, C.D. Surh, L. Peltonen, O. Winqvist, Increased antigen presenting cellmediated T cell activation in mice and patients without the autoimmune regulator, Eur. J. Immunol. 36 (2006) 305–317. [14] P. Bjorses, M. Halonen, J.J. Palvimo, M. Kolmer, J. Aaltonen, P. Ellonen, J. Perheentupa, I. Ulmanen, L. Peltonen, Mutations in the AIRE gene: effects on subcellular location and transactivation function of the autoimmune polyendocrinopathy–candidiasis–ectodermal dystrophy protein, Am. J. Hum. Genet. 66 (2000) 378–392. [15] A. Liston, D.H. Gray, S. Lesage, A.L. Fletcher, J. Wilson, K.E. Webster, H.S. Scott, R.L. Boyd, L. Peltonen, C.C. Goodnow, Gene dosage–limiting role of Aire in thymic expression, clonal deletion, and organ-specific autoimmunity, J. Exp. Med. 200 (2004) 1015–1026. [16] A. Soderbergh, F. Rorsman, M. Halonen, O. Ekwall, P. Bjorses, O. Kampe, E.S. Husebye, Autoantibodies against aromatic Lamino acid decarboxylase identifies a subgroup of patients with Addison's disease, J. Clin. Endocrinol. Metab. 85 (2000) 460–463. [17] D. Uchida, S. Hatakeyama, A. Matsushima, H. Han, S. Ishido, H. Hotta, J. Kudoh, N. Shimizu, V. Doucas, K.I. Nakayama, N.
Rapid Communication Kuroda, M. Matsumoto, AIRE functions as an E3 ubiquitin ligase, J. Exp. Med. 199 (2004) 167–172. [18] J. Pitkanen, V. Doucas, T. Sternsdorf, T. Nakajima, S. Aratani, K. Jensen, H. Will, P. Vahamurto, J. Ollila, M. Vihinen, H.S. Scott, S.E. Antonarakis, J. Kudoh, N. Shimizu, K. Krohn, P. Peterson, The autoimmune regulator protein has transcriptional transactivating properties and interacts with the common coactivator CREB-binding protein, J. Biol. Chem. 275 (2000) 16802–16809. [19] M.J. Bottomley, G. Stier, D. Pennacchini, G. Legube, B. Simon, A. Akhtar, M. Sattler, G. Musco, NMR structure of the first PHD finger of autoimmune regulator protein (AIRE1). Insights into autoimmune polyendocrinopathy–candidiasis–ectodermal dystrophy (APECED) disease, J. Biol. Chem. 280 (2005) 11505–11512. [20] T.J. Gibson, C. Ramu, C. Gemund, R. Aasland, The APECED polyglandular autoimmune syndrome protein, AIRE-1, contains the SAND domain and is probably a transcription factor, Trends. Biochem. Sci. 23 (1998) 242–244.
17 [21] C. Ramsey, A. Bukrinsky, L. Peltonen, Systematic mutagenesis of the functional domains of AIRE reveals their role in intracellular targeting, Hum. Mol. Genet. 11 (2002) 3299–3308. [22] R. Tazi-Ahnini, M.J. Cork, D.J. Gawkrodger, M.P. Birch, D. Wengraf, A.J. McDonagh, A.G. Messenger, Role of the autoimmune regulator (AIRE) gene in alopecia areata: strong association of a potentially functional AIRE polymorphism with alopecia universalis, Tissue Antigens 60 (2002) 489–495. [23] H.S. Scott, M. Heino, P. Peterson, L. Mittaz, M.D. Lalioti, C. Betterle, A. Cohen, M. Seri, M. Lerone, G. Romeo, P. Collin, M. Salo, R. Metcalfe, A. Weetman, M.P. Papasavvas, C. Rossier, K. Nagamine, J. Kudoh, N. Shimizu, K.J. Krohn, S.E. Antonarakis, Common mutations in autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy patients of different origins, Mol. Endocrinol. 12 (1998) 1112–1119. [24] C.Y. Wang, A. Davoodi-Semiromi, W. Huang, E. Connor, J.D. Shi, J.X. She, Characterization of mutations in patients with autoimmune polyglandular syndrome type 1 (APS1), Hum. Genet. 103 (1998) 681–685.