Alcohol consumption alters Gdnf promoter methylation and expression in rats

Journal of Psychiatric Research 121 (2020) 1–9

Contents lists available at ScienceDirect

Journal of Psychiatric Research journal homepage: www.elsevier.com/locate/jpsychires

Alcohol consumption alters Gdnf promoter methylation and expression in rats

T

Hannah Benedictine Maiera,∗,1, Meraj Neyazia,1, Alexandra Neyazia, Thomas Hillemachera,c, Hansi Pathaka, Mathias Rheina, Stefan Bleicha, Koral Goltsekerb, Yossi Sadot-Sogrinb, Oren Even-Chenb, Helge Frielinga,2, Segev Barakb,2 a

Department of Psychiatry, Social Psychiatry, and Psychotherapy, Hannover Medical School, Hannover, Germany School of Psychological Sciences, The Sagol School of Neuroscience, Tel Aviv University, Tel Aviv, Israel c Department of Psychiatry and Psychotherapy, Paracelsus Medical University, Nuremberg, Germany b

A R T I C LE I N FO

A B S T R A C T

Keywords: Glial cell line-derived neurotrophic factor (Gdnf) Alcohol addiction Epigenetics Neurotrophic factors Ventral tegmental area Nucleus accumbens

Alcohol use disorder is one of the most disabling diseases worldwide. Glial-cell derived neurotrophic factor (Gdnf) shows promising results concerning the inhibition of alcohol consumption in rodent models. We investigated the epigenetic regulation of Gdnf following ethanol consumption and withdrawal in a rat model. 32 Wistar rats underwent 7 weeks of intermittent access to alcohol in a 2-bottle choice (IA2BC). Whole blood, Nucleus Accumbens (NAc) and Ventral Tegmental Area (VTA) were collected immediately after the last 24 h of an alcohol-drinking session (alcohol group, AG) or 24 h after withdrawal (withdrawal group, WG). MRNA levels were measured using real-time quantitative PCR. Bisulfite-conversion of DNA and capillary sequencing was used to determine methylation levels of the core promoter (CP) and the negative regulatory element (NRE). The CP of the AG in the NAc was significantly less methylated compared to controls (p < 0.05). In the NAc, mRNA expression was significantly higher in the WG (p < 0.05). In the WG, mRNA expression levels in the VTA were significantly lower (p < 0.05) and showed significantly less methylation in the NRE in the VTA (p < 0.001) and the NAc (p < 0.01) compared to controls. Changes in the cerebral mRNA expression correspond to alterations in DNA methylation of the Gdnf promoter in a rodent model. Our results hold clinical relevance since differences in Gdnf mRNA expression and DNA methylation could be a target for pharmacological interventions.

1. Introduction According to the World Health Organization (WHO), 237 million men and 46 million women are affected by harmful alcohol use. Especially in the high-income countries the average alcohol consumption was 33g per day in 2018 (Global status report on a, 2018). 21,000 people die each year as a result of harmful alcohol consumption in Germany (Die Drogenbeauftragte der Bundesregierung [Editor], 2018). Additionally to the psychosocial burden such as society's stigma and blame in cases of increased alcohol consumption and alcohol dependence (Hammarlund et al., 2018; Giandinoto et al., 2018), there are somatic complications such as Polyneuropathy, Wernicke's encephalopathy, amnestic syndrome, liver disease and cirrhosis (Holst et al., 2017). Efforts to lower alcohol consumption and its associated

consequences have largely failed so far. In America, three drugs are approved for the treatment of alcohol dependence (disulfiram, naltrexone and acamprosate) (Kranzler and Soyka, 2018). Further options for pharmacological relapse prevention are urgently needed. Glial cell line-derived neurotrophic factor (Gdnf) is a homodimeric, glycosylated protein of approximately 39 kDa, which is primarily known for its critical role in the development and survival of dopaminergic neurons (DA) (Lin et al., 1993; Baecker et al., 1999; Airaksinen and Saarma, 2002; Pascual et al., 2008; Kramer and Liss, 2015). Gdnf is also crucial for other neuronal populations throughout the central and peripheral nervous system (Paratcha and Ledda, 2008), such as hippocampus, cortex, thalamus, striatum (dorsal striatum and nucleus accumbens) (Springer et al., 1994; Choi-Lundberg and Bohn, 1995; Nosrat et al., 1996; Pochon et al., 1997; Trupp et al., 1997; Golden

∗ Corresponding author. Department of Psychiatry, Social Psychiatry and Psychotherapy; Hannover Medical School, Carl-Neuberg-Str. 1, 30625, Hannover, Germany. E-mail address: [email protected] (H.B. Maier). 1 These authors contributed equally. 2 Equal senior authorship.

https://doi.org/10.1016/j.jpsychires.2019.10.020 Received 15 July 2019; Received in revised form 7 October 2019; Accepted 28 October 2019 0022-3956/ © 2019 Elsevier Ltd. All rights reserved.

Journal of Psychiatric Research 121 (2020) 1–9

H.B. Maier, et al.

methylation in blood and striatal tissue along with decreased Gdnf -gene expression (Mpofana et al., 2016; Uchida et al., 2011). Here, we analyzed alterations in the Gdnf mRNA expression and promoter methylation in alcohol-drinking rats after alcohol consumption and after withdrawal. We hypothesized that Gdnf expression changes will correspond to alterations in DNA methylation during alcohol consumption.

et al., 1998, 1999; Barroso-Chinea et al., 2005; Ledda et al., 2007), motoneurons (Henderson et al., 1994), and catecholaminergic neurons (Pascual et al., 2011). Gdnf can be transported reciprocally by dopaminergic neurons of the substantia nigra pars compacta, the ventral tegmental area (VTA), and the nucleus accumbens (NAc) (BarrosoChinea et al., 2005; Tomac et al., 1995; Lapchak et al., 1997; Kordower et al., 2000; Ai et al., 2003; Wang et al., 2010). Wang and colleagues demonstrated that when transported retrogradely, NAc-derived Gdnf enhances the spontaneous firing rate of dopaminergic neurons in the VTA and thus the activity of the mesocorticolimbic DA system (Wang et al., 2010). The mesolimbic pathway, projecting from the ventral tegmental area (VTA) to limbic regions including the nucleus accumbens (NAc), is a critical neural circuitry implicated in reward and drug/alcoholseeking behaviors (Koob and Volkow, 2010). Drugs of abuse, including alcohol, elevate extracellular DA in the striatum (Di Chiara and Imperato, 1988; Volkow et al., 2004), and striatal DA transmission regulates drug/alcohol-seeking behaviors (Barak et al., 2011a; Bossert et al., 2005; Everitt et al., 2008; Hyman et al., 2006; Koob et al., 1998; Robbins et al., 2008; Shalev et al., 2002). Infusion of Gdnf into the VTA of rodents increases dopamine levels in the NAc (Wang et al., 2010) and reduces alcohol intake, reward and relapse after withdrawal (Barak et al., 2011a, 2011b, 2015, 2018; Carnicella et al., 2008, 2009a, 2009b; Ron and Barak, 2016). Furthermore, Barak and colleagues were able to show that Gdnf reverses DA deficiency associated with alcohol withdrawal in a rodent model, without being rewarding (Barak et al., 2011a). Finally, Gdnf has been shown to be a negative modulator in addiction in animal models (Carnicella and Ron, 2009; Ghitza et al., 2010; Davies et al., 2013). Rodent studies indicate that the endogenous Gdnf levels fluctuate in response to alcohol exposure. Thus, one week of alcohol consumption in the intermittent access to alcohol in 2-bottle choice (IA2BC) procedure increased Gdnf mRNA levels in the VTA of rats when assessed at the end of the last drinking session, relative to water-drinking controls (Ahmadiantehrani et al., 2014). However, Gdnf levels in the VTA were reduced below baseline in response to 7 weeks of IA2BC, when tested after a 24-h withdrawal period (Ahmadiantehrani et al., 2014). Together, these findings suggest that Gdnf is an alcohol-responsive gene upregulated during short-term alcohol intake but downregulated during withdrawal from excessive alcohol intake (Barak et al., 2018). There are merely two studies concerning Gdnf and alcohol addiction in humans. Decreased serum levels of Gdnf have been reported to be associated with alcohol-dependence in humans (Heberlein et al., 2010). Additionally, Lhullier and colleagues conducted a study concerning the early stages of alcohol misuse, and found that Gdnf serum levels were significantly higher in a group that was positively screened for alcohol misuse and dependence (Lhullier et al., 2015). These findings go in line with the rodent data described above, showing an elevated Gdnf expression in the first week of ethanol-drinking (Ahmadiantehrani et al., 2014). Recent research emphasizes the importance of epigenetic mechanisms in the regulation of neurotrophic factors, such as brain-derived neurotrophic factor (Bdnf) in alcohol use disorder (Bird, 1986; Wolstenholme et al., 2011; Palmisano and Pandey, 2017). Epigenetic regulation (e.g. DNA methylation) of neurotrophic factors, such as the nerve growth factor (Ngf) and Bdnf are suggested to contribute to alcohol dependence and withdrawal (Heberlein et al., 2011, 2015). There are repeatedly reported associations between alterations of DNA methylation and the symptomatology of alcohol dependence, alcohol withdrawal and craving (Heberlein et al., 2013, 2015; Bleich et al., 2006; Hillemacher et al., 2009). Additionally, Wolstenholme and colleagues found a correlation between the expression of genes involved in methylation and the alcohol intake of rodents (Wolstenholme et al., 2011). Nevertheless, little is known about the underlying epigenetic regulation of Gdnf and alcohol consumption, withdrawal, and relapse. Rodent models show that early life stress leads to increased DNA

2. Methods 2.1. Animals 11 male and 13 female Wistar rats (175–200 g at the beginning of experiments) were bred in Tel-Aviv University animal facility and housed under a 12-h light/dark cycle (lights on at 7:00 a.m.) with food and water available ad libitum. Animals were individually housed. All experimental protocols conformed to the guidelines of the Institutional Animal Care and Use Committee of Tel Aviv University and the NIH. All efforts were made to minimize the number of animals and their suffering. 2.2. Intermittent-access to 20% alcohol in a 2-bottle choice drinking procedure After one week of habituation for individual housing, rats were trained to consume alcohol in the IA2BC procedure as previously described (Carnicella et al., 2014; Even-Chen et al., 2017). Briefly, rats received three 24-h sessions of free access to 2-bottle choice per week (tap water and 20% alcohol v\v) on Sundays, Tuesdays, and Thursdays, with 24 or 48 h of alcohol-deprivation periods between the alcoholdrinking sessions. During the withdrawal periods, animals received only water. The position (left or right) of each solution was alternated between each session to control for side preference. Water and alcohol bottles were weighed before and after each alcohol-drinking session, consumption levels were normalized to body weight. Training lasted seven weeks prior to the brain tissue collection. 2.3. Quantitative reverse transcriptase polymerase chain reaction (qRTPCR) Following brain dissection, tissue samples were immediately snapfrozen in liquid nitrogen and stored at −80 °C until use. Frozen tissues were mechanically homogenized in TRIzol reagent, and total RNA was isolated from each sample according to the manufacturer's recommended protocol. mRNA was reverse transcribed to cDNA using the Reverse Transcription System and RevertAid kit. Plates of 96 wells were prepared for the SYBR green cDNA analysis using Fast SYBR Master Mix. Samples were analyzed in triplicate with a Real-Time PCR System (StepOnePlus™; Applied Biosystems, Foster City, CA, USA), and quantified against an internal control gene, Gapdh. We used the following reaction primers sequences: Gdnf forward: 5′- GAC GTC ATG GAT TTT ATT CAA GCC-3’; reverse: 5′- CCG GTT CCT CTC TCT TCGAG-3’; Gapdh forward: 5′- GCA AGA GAG AGG CCC TCAG-3’; reverse: 5′- TGT GAG GGA GAT GCT CAGTG-3’. Thermal cycling was initiated with incubation at 95 °C for 20 s (for SYBR Green activation), followed by 40 cycles of PCR with the following conditions: heating at 95 °C for 3 s and then 30 s at 60 °C. Relative quantification was calculated using the ΔΔCt method. 2.4. Bisulfite-sequencing of the Gdnf core promoter and the negative regulatory element The genomic organization of the rat Gdnf gene was obtained from GenBank (Chromosome 2q16; GenBank access number: AJ011432.1; Fig. 1). Lamberti and colleagues identified the core promoter which is highly conserved between rat, mouse, and human (Lamberti and Vicini, 2014). A negative regulatory element (NRE) was first described by 2

Journal of Psychiatric Research 121 (2020) 1–9

H.B. Maier, et al.

Fig. 1. Extract of the genomic Gdnf-DNA with marked CpG's in red, the NRE, Core Promoter, Transcriptional Start Site (TSS), a TATA-Box and the putative cAMPresponsive element (CRE)-sites. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.) Table 1 Gdnf primers for Core Promoter and Negative Regulatory Element. Primer Name Core Promoter (−184bp/+100bp) GDNF_rat Prom1 F1 GDNF_rat Prom1 F2 GDNF_rat Prom1 R Negative Regulatory Element (+304/+808) GDNF_rat nProm A F1 GDNF_rat nProm A F2 GDNF_rat nProm A R GDNF_rat nProm B F1 GDNF_rat nProm B F2 GDNF_rat nProm B R

Primer Sequence 5‘-3‘

Position counting from TSS in bp 5’ to 3′

TTTTAAAAATTTTGAATAAAGGTAGGT TGATTTTGAATGTATGTGTTTATTTTA CTCTATCTACTAAAAACTACCT

−385/−358 −300/−273 +185/+163

GAGGTAGTTTTTAGTAGATAGA ATTGTTTTTTTGGGTTGTTGTGA CCTCACTCTACACCTCCT GTTTTTATGTTTTTAAGGGATTGT GAGGAGGTGTAGAGTGAG CCATCCAAAAAACCCATCC

+162/+184 +225/+248 +664/+646 +527/+551 +645/+663 +985/+966

DNA was then sodium bisulfite-converted to deaminate unmethylated cytosines to uracils using the EpiTect Bisulfite Kit (QIAGEN) according to the manufacturer's protocol. Primer sequences were designed to amplify CpG-sites within the core promoter (284bp) and the NRE

Tanaka and colleagues and also showed high conservation (Tanaka et al., 2000). Genomic DNA was extracted using the Nucleomag Blood DNA Purification Kit (Macherey and Nagel, Düren, Germany) from NAc, VTA, and whole blood according to manufacturer's protocol. Genomic 3

Journal of Psychiatric Research 121 (2020) 1–9

H.B. Maier, et al.

(504bp) of Gdnf (for primer sequences see Table 1). The primers were designed using the Software Geneious (Pro 5.4.6, Biomatters Ltd., Auckland, New Zealand). To check for melting temperatures, hairpins and self-dimers, the biocalculator from metabion (http://www. metabion.com/support-and-solution/biocalculator/) and Netprimer (http://www.premierbiosoft.com/NetPrimer/AnalyzePrimer.jsp) were used. To test for single nucleotide polymorphisms (SNPs), SNPcheck3 (https://secure.ngrl.org.uk/SNPCheck/snpcheck.htm) was conducted. For amplification of the product, semi-nested PCR's were performed. Agencourt AMPure XP (Beckman Coulter GmbH, Krefeld, Germany) was applied to purify the PCR product. To visualize each product, standard 2.0% agarose gel was used. After the sequencing-PCR (BigDye_Terminatorv3.1 Cycle Sequencing Kit, Life Technologies, Foster City, CA, USA) another purification of the PCR product performed with Agentcourt CleanSEQ (Beckman Coulter GmbH, Krefeld, Germany) was conducted. Sequencing in reverse direction was performed with a maximum of 30 ng of purified PCR product with the 3500xl Genetic Analyzer (Life Technologies) according to the manufacturer's instructions.

comparison, a one-way ANOVA was used. P-values were derived from Dunnet's post hoc test after mixed linear modelling. To test the potential association of methylation with the relative expression of Gdnf mRNA and the different alcohol intake during the trial, we used loglikelihood ratio tests comparing the different predictors against an empty model (including only CpG position as repeated measure and animal id as subject). Predictors were included one at a time to avoid overfitting of the models. Only for the association between mRNA expression and methylation we also tested for confounding effects of the factors group and sex. The results are presented as mean ± standard error of the mean (SEM). P-values of less than 0.05 (two-tailed) were considered to indicate statistical significance. The parameters were analyzed employing IBM SPSS Statistics for Windows, Version 21.0. (Armonk, NY: IBM Corp.). Graph Pad Prism 7 (Graph Pad Inc., San Diego, CA) was used for data presentation.

2.5. Experimental design and statistical analysis

First, we set out to replicate the results of Ahmadiantehrani and colleagues (Ahmadiantehrani et al., 2014). Rats were trained in the IA2BC procedure for seven weeks (average alcohol consumption in the last drinking session: Alcohol group = 3.92 ± 0.61 g/kg; Withdrawal group = 3.74 ± 0.53 g/kg). We found that withdrawal from long-term voluntary alcohol drinking was associated with a reduction in Gdnf expression in the VTA (Fig. 3). The levels of Gdnf mRNA in the VTA were upregulated back to baseline levels after a 24-h alcohol drinking session (Main effect of Group: F (2, 17) = 5.35, p < 0.05). Post-hoc analysis revealed that, compared to the Control group, the levels of Gdnf mRNA were reduced in the Withdrawal group (all p < 0.05), but not in the Alcohol group (p > 0.05). Next, we assessed the levels of Gdnf expression in the NAc (Fig. 4). We found that Gdnf expression in the NAc was upregulated following the withdrawal from alcohol drinking, whereas the resumption of alcohol drinking rapidly downregulated the levels of Gdnf mRNA back to the baseline level (Main effect of Group: F(2, 18) = 7.03, p < 0.01. Posthoc analysis: difference between Control and Withdrawal (p < 0.01), but not between Control and Alcohol group (p > 0.05)). Our findings suggest that acute withdrawal from alcohol following a prolonged period of voluntary alcohol-drinking is characterized by fluctuations in the Gdnf expression: downregulation in the VTA, and upregulation in the NAc, whereas resumption of alcohol drinking regulates Gdnf expression back to the baseline levels in both regions.

3. Results 3.1. Alcohol withdrawal alters the expression of Gdnf in the VTA

To assess the mRNA expression and the DNA methylation of the Gdnf gene, we trained rats to drink alcohol in the IA2BC procedure for 7 weeks. Age-matched rats consumed water only (“Control” group). The NAc and VTA of the rats were dissected at 2 time points in the drinking protocol, for which we randomly assigned rats to 2 experimental groups: "Alcohol" group – where rats were euthanized immediately after a 24-h drinking session; and "Withdrawal" group – where rats were euthanized immediately after the last 24-h withdrawal period (Fig. 2). 2.6. Gdnf mRNA expression In this experiment, we tested the effects of voluntary alcohol consumption on Gdnf expression in the VTA and NAc. The mRNA expression of Gdnf was normalized to Gapdh expression (Even-Chen et al., 2017; Zipori et al., 2017; Ziv et al., 2018), which we found to be unaffected by alcohol in this drinking protocol (see (Even-Chen et al., 2017)). Expression in each brain region was further normalized to its own control, water-treated group. Data were analyzed by one-way ANOVA, in a between-subjects factor of Group. ANOVA was followed by Fisher LSD post hoc tests. Sex distributed approximately equally across groups, and was initially analyzed as a factor; however, all analyzes did not yield a main effect of sex or any interaction with other factors (all p > 0.05). Therefore, data were collapsed across this factor.

3.2. Alcohol withdrawal alters the DNA methylation of the Gdnf gene 2.7. Gdnf DNA methylation 3.2.1. Gdnf promoter: negative regulatory element (NRE) When unmethylated, the NRE acts as a repressor of the Gdnf transcription and lies within exon 1 of the Gdnf genome (Tanaka et al., 2000). Methylation of the NRE significantly differed between the groups in both brain tissues but not in the blood: VTA: F (2, 19) = 21.16; p < 0.0001; NAc: F (2, 19) = 12.55; p < 0.0001; blood: F (2, 19) = 2.439; p = 0.085.

For analyzing the vast majority of regulative cytosine methylation of CpG's and CpG-Islands, Epigenetic Sequencing Methylation (ESME) Analysis Software (Lewin et al., 2004) was used. With ESME, levels of methylated and unmethylated CpG sites are put in relation, resulting in a percentage value between 0 and 1. Analysis of the CP and the NRE was performed using mixed linear models (fixed factors and their interaction with covariates: CpG-Position, group, and sex). For group

Fig. 2. Alcohol group (rats were euthanized immediately after a 24 h drinking session); Withdrawal group (rats were euthanized immediately after the last 24 h withdrawal period). 4

Journal of Psychiatric Research 121 (2020) 1–9

H.B. Maier, et al.

Fig. 6. Fig. 6 shows the estimated marginal means of the DNA methylation (CP = Core Promoter; NRE = negative regulatory element) levels of all three groups and the VTA. Error bars show the standard error of the mean (SEM), * indicates p < 0.05 in posthoc analysis.

Fig. 3. Fig. 3 shows the mRNA expression in the VTA. Error bars show the standard error of the mean (SEM), * indicates p < 0.05 in posthoc analysis.

3.2.2. Gdnf: core promoter The core promoter (CP) upstream of exon 1 initiates the transcription of the Gdnf gene (Lamberti and Vicini, 2014). Methylation of the core promoter significantly differed between the groups in both brain tissues and also in blood: VTA: F (2, 10) = 4.19; P = 0.015; NAC: F (2, 16) = 4.09; p = 0.016; blood: F (2, 16) = 4.36; p = 0.012. In the posthoc tests, we only detected a significant difference between the alcohol group and the control group in the NAc: q (16) = 3.421; p < 0.01 (Fig. 5). 3.3. Association between expression and methylation In control animals, we found a negative association between methylation of the core promoter and the mRNA expression in the VTA (parameter estimates: β = −0.64; T(18) = 3.50; p = 0.003) and in the NAc (parameter estimate: β = -0.442; T(18) = 2.36; p = 0.027), as well as a positive association between Gdnf expression in the NAc and methylation of the core promoter in the VTA (parameter estimate: β = 0.632; T(13) = 2.94; p = 0.011). Furthermore, we found a negative association between methylation of the NRE in the VTA with mRNA expression in the VTA (parameter estimate: β = -0.414; T(68) = 3.75; p = 0.0003) and a positive association between NRE methylation and mRNA expression in the NAc (parameter estimate: β = 0.177; T(68) = 2.204; p = 0.029). In the alcohol group, we found a negative association between methylation of the NRE in the VTA and Gdnf expression in the VTA (parameter estimate: β = -0.267; T(68) = 2.932; p = 0.004). Additionally, we found a negative association between the methylation of the NRE in the VTA and the Gdnf expression in the NAc (parameter estimate: β = -0.611; T(68) = 8.164; p < 0.0001). In the withdrawal group, we found a positive association between the NRE methylation and the Gdnf expression in the NAc (parameter estimate: β = 0.464; T(68) = 6.455; p < 0.0001).

Fig. 4. Fig. 4 shows the mRNA expression in the NAc. Error bars show the standard error of the mean (SEM), * indicates p < 0.05 in posthoc analysis.

Fig. 5. Fig. 5 shows the estimated marginal means of the DNA methylation (CP = Core Promoter; NRE = negative regulatory element) levels of all three groups and the NAc. Error bars show the standard error of the mean (SEM), * indicates p < 0.05 in posthoc analysis.

4. Discussion Our study aimed to analyze alterations in Gdnf promoter methylation and Gdnf mRNA expression in alcohol-drinking rats during alcohol consumption and withdrawal. In the NAc, a 24-h withdrawal period led to a significant increase in the expression of Gdnf mRNA and a decrease in methylation of the negative regulatory element (NRE). In the VTA, withdrawal led to a significant decrease of Gdnf mRNA expression and a reduction in the methylation of the NRE. Demethylation of the NRE with subsequent binding of repressor elements usually leads to a suppression of mRNA expression (Lamberti and Vicini, 2014; Tanaka et al., 2000). Indeed, the Gdnf mRNA expression in the VTA of the withdrawal group was reduced compared to

In the NAc, the NRE of the withdrawal group also showed significantly lower methylation compared to the control group: withdrawal vs. control q (19) = 3.606 p < 0.01 (Fig. 5). In the VTA, the NRE of the withdrawal group was less methylated compared to the control group: withdrawal vs. control q (19) = 5.677 p < 0.0001 (Fig. 6).

5

Journal of Psychiatric Research 121 (2020) 1–9

H.B. Maier, et al.

impairing gene transcription (Yang et al., 1998). Thus, it is possible that the effects of alcohol on Gdnf expression are mediated by the effects of alcohol on CREB (Fig. 7). Therefore, during alcohol consumption the usual pathway of Gdnf transcription via core promoter might be blocked and the NRE methylation seems to become the main regulatory route for Gdnf expression. Underlining this hypothesis, we found an association between Gdnf mRNA expression and lower methylation of the NRE in the VTA. Consequently, repressor elements can bind in the VTA, leading to a decreased Gdnf expression. Furthermore, we found a strong association between the Gdnf mRNA expression in the NAc and the reduced methylation of the NRE in the VTA. Since Gdnf was suggested to be transported retrogradely from the NAc to the VTA (Wang et al., 2010), our findings could point to a negative feedback loop within the VTA and the NAc-derived Gdnf during alcohol consumption (see Supplementary Figs. S2A and S2B). Additionally, Gdnf mRNA expression in the NAc was increased significantly in the withdrawal group, presumably due to the reduced core promoter methylation during alcohol consumption, and the loss of the blocking alcohol effect. It is possible that the retrograde transport of NAc-derived Gdnf to the VTA (Wang et al., 2010) leads to a downregulation of the methylation of the NRE in the VTA which therefore downregulates Gdnf mRNA expression in the VTA. We conclude from our findings that Gdnf transcription is most likely regulated via the core promoter, while alcohol consumption leads to a regulation via NRE through changes in the methylation pattern. These alterations are reversed after alcohol consumption is terminated. Furthermore, our findings could suggest the possibility of a negative feedback loop between the increase of Gdnf expression in the NAc and the decrease of methylation of the NRE in the VTA during withdrawal. However, our results are only preliminary, and further mechanistic studies are required. Interestingly, Barak and colleagues demonstrated a positive autoregulation of Gdnf levels locally in the VTA (Barak et al., 2011b). In that study, Barak and colleagues injected recombinant Gdnf into the VTA of male Long-Evans rats and were able to show the maintenance of de novo protein synthesis. Furthermore, they could even show a longlasting suppression of alcohol consumption (Barak et al., 2011b). They also stated, that the positive feedback cycle must be terminated at some point and that a positive and negative feedback loop must co-exist for the regulation of Gdnf. Thus, it is possible that the negative regulatory mechanisms we suggested here may be the mechanism that stops the positive autoregulation of Gdnf in the VTA. It is also possible that this difference could be due to the different rat strains (Long-Evans vs. Wistar) as we did not assess the protein complexes needed for transcription: Uchida and colleagues for example showed that chronic mild stress increased the DNA-methylation in two different mouse strains. Interestingly, the mouse strain that developed depressive behavior had decreased Gdnf expression levels. The other mouse strain – not susceptible to depressive behavior – had normal Gdnf expression levels. Uchida and colleagues furthermore hypothesized that Gdnf expression in the mouse strain not susceptible for

controls, an effect expected following reduced methylation in the NRE of the promoter. Moreover, the reduced Gdnf mRNA expression in the VTA after withdrawal is in line with previous findings (Barak et al., 2018; Ahmadiantehrani et al., 2014). This deficient Gdnf mRNA expression in the VTA was shown to cause increases in alcohol consumption (Barak et al., 2018; Ahmadiantehrani et al., 2014). We found that Gdnf mRNA expression in the NAc was significantly higher after a 24-h withdrawal period when compared to waterdrinking controls. Conversely, the methylation rate of the NRE was significantly lower in the withdrawal group, and there was no difference in the methylation rate of the core promoter. This discrepancy between the increased Gdnf mRNA expression and the decreased methylation rate in the NRE could reflect compensatory mechanisms during withdrawal to reverse the DA deficiency through Gdnf mRNA expression. Furthermore, our results may suggest that methylation of specific elements of the promoter region of the Gdnf gene are associated with opposite effects, since the reduced methylation of the NRE in both brain regions in the withdrawal group led to opposing mRNA expression levels. We found that in the control group, the core promoter methylation was negatively correlated with the Gdnf mRNA expression in both the NAc and VTA - suggesting a regulatory mechanism of core promoter methylation on expression levels in different regions (Fig. 7, for further details see Supplementary Fig. S1). One possible regulation mechanism could be the impairment through alcohol consumption: in the group taken after an alcohol-drinking session, the core promoter was significantly less methylated in the NAc, which would suggest higher Gdnf expression compared to the control group instead of same level. A potential mediator for the regulative effects of alcohol on the core promoter of Gdnf is cAMP-Responsive Element Binding Protein (CREB), one of the crucial transcription factors for the activation of gene transcription. In its phosphorylated state, CREB can bind to cAMP-Responsive Elements (CRE) in a gene's promoter and initiate its transcription (Rani et al., 2005; Bito, 1998; Weeber and Sweatt, 2002; Shaywitz and Greenberg, 1999). Additionally, CREB1 can bind to specific methylated non-CpG sites and activate the transcription of genes (Syed et al., 2016). Alcohol is known to interfere with CRE (Palmisano and Pandey, 2017), of which at least three putative sites exist in the core promoter of Gdnf, (Lamberti and Vicini, 2014). For example, Rani and colleagues showed an increase in CREB activity during long-term alcohol treatment in vitro (Rani et al., 2005), whereas Pandey and colleagues reported a significant decrease in phosphorylated CREB during withdrawal in specific brain regions (Pandey et al., 2001a, 2001b). Moreover, a decrease in the likelihood of forming of the CREBCRE complex was reported in G108-15 cells incubated in alcohol concentrations which are occurring in the blood of intoxicated humans (Osugi et al., 1991). Finally, acute exposure to alcohol increased CREB phosphorylation in the rat cerebellum, while no effect following chronic alcohol exposure was observed (Yang et al., 1996). In a later experiment, Yang and colleagues found that the CREB phosphorylation is altered by chronic alcohol exposure in the rat striatum, potentially

Fig. 7. Normal Regulation of the Gdnf gene with its core promoter (CP) and the Negative Regulatory Element (NRE) is shown. 6

Journal of Psychiatric Research 121 (2020) 1–9

H.B. Maier, et al.

neither of the fragments (data not shown). Unfortunately, there are no studies concerning the assessment of the Gdnf methylation and its relationship to peripheral Gdnf expression in humans. Interestingly, altered Gdnf serum levels in humans with alcohol addiction were reported (Heberlein et al., 2010; Lhullier et al., 2015), Importantly, the levels of alcohol consumed in the present study cannot reflect levels of consumption in alcohol use disorder, and it is possible that blood DNA methylation changes could only be detected at very high alcohol intake levels seen in alcohol addiction, rather than in moderate alcohol consumption. Additionally, it remains elusive whether the peripheral methylation rate reflects the brain Gdnf methylation rate, as the primary source of peripheral Gdnf are white blood cells (Otsuki et al., 2008). Besides, it is unclear whether plasma or serum Gdnf concentrations correlate with brain Gdnf concentrations. A clinical study examining patients with Alzheimer's disease indicates that peripheral and cerebral Gdnf levels in healthy controls do correlate, but not in patients with Alzheimer's disease (Straten et al., 2009). It is important to note that we did not assess the peripheral Gdnf mRNA levels or cerebrospinal fluid Gdnf mRNA levels so that this association remains elusive. Besides, changes in mRNA levels do not fully reflect changes in protein levels. Additionally, only a weak correlation between DNA methylation and gene-expression is possible. Another limitation of our study is the nonspecific bisulfite conversion as we cannot assess 5-hydroxymethylcytosine (5hmC) which is known as a precursor to demethylation. 5hmC levels range from approximately 0.4–0.7% of the total cytosine content in the brain (Kriaucionis and Heintz, 2009; Globisch et al., 2010; Munzel et al., 2010; Song et al., 2011). The function of 5hmC in gene regulation remains largely unknown (Guo et al., 2011). Taken together, our results indicate that the alteration of mesolimbic Gdnf mRNA expression during intermittent alcohol consumption and withdrawal correlates, and is possibly mediated by epigenetic changes in the DNA methylation at the core promoter and the NRE of the Gdnf gene. Moreover, our results point to a possible negative feedback loop within the VTA and NAc during alcohol consumption and withdrawal, although further studies are necessary to confirm these preliminary findings. Additionally, clinical studies are essential to investigate the role of Gdnf DNA methylation in individuals at risk of developing alcohol use disorder. Finally, our findings further mark Gdnf as a promising target for pharmacological intervention for people suffering from alcohol addiction.

depressive behavior was induced by the complex of MeCP2 (methyl CpG binding protein 2) - CREB (cAMP response element-binding protein) binding to the methylated CpG site. On the other hand; the repression of Gdnf in the mouse strain susceptible for depression could be caused by MeCP2 – HDAC2 (Histone deacetylase 2) (Uchida et al., 2011). MeCP2 was long thought of as a transcriptional repressor. In line with the findings of Uchida and colleagues, Chahrour and colleagues showed in their study that MeCP2 is associated with CREB and activated genes in an in vivo mouse model (Chahrour et al., 2008) and additionally they propose a negative regulatory loop in between MeCP2 and CREB (MeCP2 activates CREB1; CREB1 induces miR132 leading to a decrease of MeCP2). MeCP2 has multifunctional roles concerning gene expression and can operate as a transcription activator or repressor dependent from its environment (Li et al., 2014). In the IA2BC procedure, typically 60–70 percent of the rats become excessive drinkers, but others maintain moderate alcohol consumption (low drinkers) (Ahmadiantehrani et al., 2014; Carnicella et al., 2014). Low alcohol-drinking rats show higher levels of Gdnf expression in the VTA (Barak et al., 2018; Ahmadiantehrani et al., 2014). In the present study, the Wistar rats did not reach excessive alcohol drinking levels comparable to those of the Long-Evans rats in the previous study by Ahmadiantehrani and colleagues (Ahmadiantehrani et al., 2014). In fact, the rats in the present study are more likely to resemble the low drinker group of the aforementioned study (Ahmadiantehrani et al., 2014). An intriguing possibility is that the reason for the relatively low alcohol drinking in the present study lies in the NAc as the primary source of Gdnf in the mesolimbic system. Specifically, as Gdnf is already available during withdrawal (significantly higher mRNA expression in the NAc compared to controls), the Wistar rats in the present study drank lower quantities of alcohol compared to those consumed by the Long-Evans rats in the study by Ahmadiantehrani and colleagues (Ahmadiantehrani et al., 2014). Gdnf was suggested as an alcohol-responsive gene, which is upregulated in response to short-term alcohol intake but downregulated during withdrawal (Barak et al., 2018). This hypothesis is supported by our DNA methylation results, as we found lower methylation in the NRE in the VTA of the withdrawal group compared to controls. We found that a 24-h alcohol-drinking session after withdrawal led to a restoration of Gdnf mRNA expression in the VTA to levels similar to those of water-drinking controls. This finding is in line with the previous report of Ahmadiantehrani and colleagues (Ahmadiantehrani et al., 2014). These fluctuations in Gdnf expression during intermittent alcohol drinking were suggested to reflect a progressive dysregulation in the expression of Gdnf, in response to excessive alcohol drinking, and to contribute to the escalation in drinking (Barak et al., 2018). Thus, at the beginning of the alcohol-drinking protocol, alcohol intake leads to an elevation of Gdnf expression in the VTA, and presumably to protection from alcohol drinking escalation. However, the progressively increasing amounts of alcohol consumption are followed by downregulation in Gdnf expression in this brain region during withdrawal. Finally, Gdnf expression levels are restored to basal levels through excessive alcohol consumption (Barak et al., 2018). Deprivation of alcohol is a stressor for alcohol addicted humans and rodents. It has been shown that Gdnf expression and its promoter methylation is altered due to chronic stress in rodent models (Mpofana et al., 2016; Uchida et al., 2011) and in humans with alcohol exposure (Nesic and Duka, 2006) and without alcohol exposure (Lin and Tseng, 2015). Additionally, the mesolimbic dopamine system is likely involved in the formation of susceptibility and resistance responses to chronic stress (Uchida et al., 2011) and is known to play a vital role in alcohol addiction (Di Chiara and Imperato, 1988; Volkow et al., 2007). Therefore, the alteration of Gdnf expression and the epigenetic changes found in our study could indicate that there is interplay between stress and alcohol-induced modifications. We found no significant differences between the groups in the peripheral blood DNA methylation rates of the Gdnf gene promoter in

Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Declaration of competing interest The authors declare that they have no conflict of interest. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.jpsychires.2019.10.020. References Ahmadiantehrani, S., Barak, S., Ron, D., 2014. GDNF is a novel ethanol-responsive gene in the VTA: implications for the development and persistence of excessive drinking. Addict. Biol. 19, 623–633. Ai, Y., Markesbery, W., Zhang, Z., Grondin, R., Elseberry, D., Gerhardt, G.A., Gash, D.M., 2003. Intraputamenal infusion of GDNF in aged rhesus monkeys: distribution and dopaminergic effects. J. Comp. Neurol. 461, 250–261. Airaksinen, M.S., Saarma, M., 2002. The GDNF family: signalling, biological functions and therapeutic value. Nat. Rev. Neurosci. 3, 383–394. Baecker, P.A., Lee, W.H., Verity, A.N., Eglen, R.M., Johnson, R.M., 1999. Characterization of a promoter for the human glial cell line-derived neurotrophic factor gene. Brain Res. Mol. Brain Res. 69, 209–222.

7

Journal of Psychiatric Research 121 (2020) 1–9

H.B. Maier, et al.

decisions of individuals with drug- and alcohol-use disorders. Subst. Abus. Rehabil. 9, 115–136. Heberlein, A., Muschler, M., Wilhelm, J., Frieling, H., Lenz, B., Groschl, M., Kornhuber, J., Bleich, S., Hillemacher, T., 2010. BDNF and GDNF serum levels in alcohol-dependent patients during withdrawal. Prog. Neuropsychopharmacol. Biol. Psychiatr. 34, 1060–1064. Heberlein, A., Dursteler-MacFarland, K.M., Lenz, B., Frieling, H., Grosch, M., Bonsch, D., Kornhuber, J., Wiesbeck, G.A., Bleich, S., Hillemacher, T., 2011. Serum levels of BDNF are associated with craving in opiate-dependent patients. J. Psychopharmacol. 25, 1480–1484. Heberlein, A., Muschler, M., Frieling, H., Behr, M., Eberlein, C., Wilhelm, J., Groschl, M., Kornhuber, J., Bleich, S., Hillemacher, T., 2013. Epigenetic down regulation of nerve growth factor during alcohol withdrawal. Addict. Biol. 18, 508–510. Heberlein, A., Buscher, P., Schuster, R., Kleimann, A., Lichtinghagen, R., Rhein, M., Kornhuber, J., Bleich, S., Frieling, H., Hillemacher, T., 2015. Do changes in the BDNF promoter methylation indicate the risk of alcohol relapse? Eur. Neuropsychopharmacol. 25, 1892–1897. Henderson, C.E., Phillips, H.S., Pollock, R.A., Davies, A.M., Lemeulle, C., Armanini, M., Simmons, L., Moffet, B., Vandlen, R.A., 1994. Simpson LC corrected to Simmons,L., Koliatsos VE, Rosenthal A. GDNF: a potent survival factor for motoneurons present in peripheral nerve and muscle. Science 266, 1062–1064. Hillemacher, T., Frieling, H., Hartl, T., Wilhelm, J., Kornhuber, J., Bleich, S., 2009. Promoter specific methylation of the dopamine transporter gene is altered in alcohol dependence and associated with craving. J. Psychiatr. Res. 43, 388–392. Holst, C., Tolstrup, J.S., Sorensen, H.J., Becker, U., 2017. Alcohol dependence and risk of somatic diseases and mortality: a cohort study in 19 002 men and women attending alcohol treatment. Addiction 112, 1358–1366. Hyman, S.E., Malenka, R.C., Nestler, E.J., 2006. Neural mechanisms of addiction: the role of reward-related learning and memory. Annu. Rev. Neurosci. 29, 565–598. Koob, G.F., Volkow, N.D., 2010. Neurocircuitry of addiction. Neuropsychopharmacology 35, 217–238. Koob, G.F., Sanna, P.P., Bloom, F.E., 1998. Neuroscience of addiction. Neuron 21, 467–476. Kordower, J.H., Emborg, M.E., Bloch, J., Ma, S.Y., Chu, Y., Leventhal, L., McBride, J., Chen, E.Y., Palfi, S., Roitberg, B.Z., Brown, W.D., Holden, J.E., Pyzalski, R., Taylor, M.D., Carvey, P., Ling, Z., Trono, D., Hantraye, P., Deglon, N., Aebischer, P., 2000. Neurodegeneration prevented by lentiviral vector delivery of GDNF in primate models of Parkinson's disease. Science 290, 767–773. Kramer, E.R., Liss, B., 2015. GDNF-Ret signaling in midbrain dopaminergic neurons and its implication for Parkinson disease. FEBS Lett. 589, 3760–3772. Kranzler, H.R., Soyka, M., 2018. Diagnosis and pharmacotherapy of alcohol use disorder: a review. J. Am. Med. Assoc. 320, 815–824. Kriaucionis, S., Heintz, N., 2009. The nuclear DNA base 5-hydroxymethylcytosine is present in Purkinje neurons and the brain. Science 324, 929–930. Lamberti, D., Vicini, E., 2014. Promoter analysis of the gene encoding GDNF in murine Sertoli cells. Mol. Cell. Endocrinol. 394, 105–114. Lapchak, P.A., Araujo, D.M., Hilt, D.C., Sheng, J., Jiao, S., 1997. Adenoviral vectormediated GDNF gene therapy in a rodent lesion model of late stage Parkinson's disease. Brain Res. 777, 153–160. Ledda, F., Paratcha, G., Sandoval-Guzman, T., Ibanez, C.F., 2007. GDNF and GFRalpha1 promote formation of neuronal synapses by ligand-induced cell adhesion. Nat. Neurosci. 10, 293–300. Lewin, J., Schmitt, A.O., Adorjan, P., Hildmann, T., Piepenbrock, C., 2004. Quantitative DNA methylation analysis based on four-dye trace data from direct sequencing of PCR amplificates. Bioinformatics 20, 3005–3012. Lhullier, A.C., Moreira, F.P., da Silva, R.A., Marques, M.B., Bittencourt, G., Pinheiro, R.T., Souza, L.D., Portela, L.V., Lara, D.R., Jansen, K., Wiener, C.D., Oses, J.P., 2015. Increased serum neurotrophin levels related to alcohol use disorder in a young population sample. Alcohol Clin. Exp. Res. 39, 30–33. Li, C., Jiang, S., Liu, S.Q., Lykken, E., Zhao, L.T., Sevilla, J., Zhu, B., Li, Q.J., 2014. MeCP2 enforces Foxp3 expression to promote regulatory T cells' resilience to inflammation. Proc. Natl. Acad. Sci. U. S. A. 111, E2807–E2816. Lin, P.Y., Tseng, P.T., 2015. Decreased glial cell line-derived neurotrophic factor levels in patients with depression: a meta-analytic study. J. Psychiatr. Res. 63, 20–27. Lin, L.F., Doherty, D.H., Lile, J.D., Bektesh, S., Collins, F., 1993. GDNF: a glial cell linederived neurotrophic factor for midbrain dopaminergic neurons. Science 260, 1130–1132. Mpofana, T., Daniels, W.M., Mabandla, M.V., 2016. Exposure to early life stress results in epigenetic changes in neurotrophic factor gene expression in a parkinsonian rat model. Parkinsons Dis. 2016, 6438783. Munzel, M., Globisch, D., Bruckl, T., Wagner, M., Welzmiller, V., Michalakis, S., Muller, M., Biel, M., Carell, T., 2010. Quantification of the sixth DNA base hydroxymethylcytosine in the brain. Angew Chem. Int. Ed. Engl. 49, 5375–5377. Nesic, J., Duka, T., 2006. Gender specific effects of a mild stressor on alcohol cue reactivity in heavy social drinkers. Pharmacol. Biochem. Behav. 83, 239–248. Nosrat, C.A., Tomac, A., Lindqvist, E., Lindskog, S., Humpel, C., Stromberg, I., Ebendal, T., Hoffer, B.J., Olson, L., 1996. Cellular expression of GDNF mRNA suggests multiple functions inside and outside the nervous system. Cell Tissue Res. 286, 191–207. Osugi, T., Taniura, H., Ikemoto, M., Miki, N., 1991. Effects of chronic exposure of NG10815 cells to morphine or ethanol on binding of nuclear factors to cAMP-response element. Biochem. Biophys. Res. Commun. 174, 25–31. Otsuki, K., Uchida, S., Watanuki, T., Wakabayashi, Y., Fujimoto, M., Matsubara, T., Funato, H., Watanabe, Y., 2008. Altered expression of neurotrophic factors in patients with major depression. J. Psychiatr. Res. 42, 1145–1153. Palmisano, M., Pandey, S.C., 2017. Epigenetic mechanisms of alcoholism and stress-related disorders. Alcohol 60, 7–18.

Barak, S., Carnicella, S., Yowell, Q.V., Ron, D., 2011a. Glial cell line-derived neurotrophic factor reverses alcohol-induced allostasis of the mesolimbic dopaminergic system: implications for alcohol reward and seeking. J. Neurosci. 31, 9885–9894. Barak, S., Ahmadiantehrani, S., Kharazia, V., Ron, D., 2011b. Positive autoregulation of GDNF levels in the ventral tegmental area mediates long-lasting inhibition of excessive alcohol consumption. Transl. Psychiatry 1. https://doi.org/10.1038/tp. 2011.57. Barak, S., Wang, J., Ahmadiantehrani, S., Ben Hamida, S., Kells, A.P., Forsayeth, J., Bankiewicz, K.S., Ron, D., 2015. Glial cell line-derived neurotrophic factor (GDNF) is an endogenous protector in the mesolimbic system against excessive alcohol consumption and relapse. Addict. Biol. 20, 629–642. Barak, S., Ahmadiantehrani, S., Logrip, M.L., Ron, D., 2018. GDNF and alcohol use disorder. Addict. Biol. Barroso-Chinea, P., Cruz-Muros, I., Aymerich, M.S., Rodriguez-Diaz, M., Afonso-Oramas, D., Lanciego, J.L., Gonzalez-Hernandez, T., 2005. Striatal expression of GDNF and differential vulnerability of midbrain dopaminergic cells. Eur. J. Neurosci. 21, 1815–1827. Bird, A.P., 1986. CpG-rich islands and the function of DNA methylation. Nature 321, 209–213. Bito, H., 1998. The role of calcium in activity-dependent neuronal gene regulation. Cell Calcium 23, 143–150. Bleich, S., Lenz, B., Ziegenbein, M., Beutler, S., Frieling, H., Kornhuber, J., Bonsch, D., 2006. Epigenetic DNA hypermethylation of the HERP gene promoter induces downregulation of its mRNA expression in patients with alcohol dependence. Alcohol Clin. Exp. Res. 30, 587–591. Bossert, J.M., Ghitza, U.E., Lu, L., Epstein, D.H., Shaham, Y., 2005. Neurobiology of relapse to heroin and cocaine seeking: an update and clinical implications. Eur. J. Pharmacol. 526, 36–50. Carnicella, S., Ron, D., 2009. GDNF-a potential target to treat addiction. Pharmacol. Ther. 122, 9–18. Carnicella, S., Kharazia, V., Jeanblanc, J., Janak, P.H., Ron, D., 2008. GDNF is a fastacting potent inhibitor of alcohol consumption and relapse. Proc. Natl. Acad. Sci. U. S. A. 105, 8114–8119. Carnicella, S., Ahmadiantehrani, S., Janak, P.H., Ron, D., 2009a. GDNF is an endogenous negative regulator of ethanol-mediated reward and of ethanol consumption after a period of abstinence. Alcohol Clin. Exp. Res. 33, 1012–1024. Carnicella, S., Amamoto, R., Ron, D., 2009b. Excessive alcohol consumption is blocked by glial cell line-derived neurotrophic factor. Alcohol 43, 35–43. Carnicella, S., Ron, D., Barak, S., 2014. Intermittent ethanol access schedule in rats as a preclinical model of alcohol abuse. Alcohol 48, 243–252. Chahrour, M., Jung, S.Y., Shaw, C., Zhou, X., Wong, S.T., Qin, J., Zoghbi, H.Y., 2008. MeCP2, a key contributor to neurological disease, activates and represses transcription. Science 320, 1224–1229. Choi-Lundberg, D.L., Bohn, M.C., 1995. Ontogeny and distribution of glial cell line-derived neurotrophic factor (GDNF) mRNA in rat. Brain Res. Dev. Brain Res. 85, 80–88. Davies, D.L., Bortolato, M., Finn, D.A., Ramaker, M.J., Barak, S., Ron, D., Liang, J., Olsen, R.W., 2013. Recent advances in the discovery and preclinical testing of novel compounds for the prevention and/or treatment of alcohol use disorders. Alcohol Clin. Exp. Res. 37, 8–15. Di Chiara, G., Imperato, A., 1988. Drugs abused by humans preferentially increase synaptic dopamine concentrations in the mesolimbic system of freely moving rats. Proc. Natl. Acad. Sci. U. S. A. 85, 5274–5278. Die Drogenbeauftragte der Bundesregierung [Editor], 2018. Drogen- und Suchtbericht Oktober 2018. [cited: 27th of July 2019]. https://www.drogenbeauftragte.de/ fileadmin/dateien-dba/Drogenbeauftragte/Drogen_und_Suchtbericht/pdf/DSB-2018. pdf. Even-Chen, O., Sadot-Sogrin, Y., Shaham, O., Barak, S., 2017. Fibroblast growth factor 2 in the dorsomedial striatum is a novel positive regulator of alcohol consumption. J. Neurosci. 37, 8742–8754. Everitt, B.J., Belin, D., Economidou, D., Pelloux, Y., Dalley, J.W., Robbins, T.W., 2008. Review. Neural mechanisms underlying the vulnerability to develop compulsive drug-seeking habits and addiction. Philos. Trans. R. Soc. Lond. B Biol. Sci. 363, 3125–3135. Ghitza, U.E., Zhai, H., Wu, P., Airavaara, M., Shaham, Y., Lu, L., 2010. Role of BDNF and GDNF in drug reward and relapse: a review. Neurosci. Biobehav. Rev. 35, 157–171. Giandinoto, J.A., Stephenson, J., Edward, K.L., 2018. General hospital health professionals' attitudes and perceived dangerousness towards patients with comorbid mental and physical health conditions: systematic review and meta-analysis. Int. J. Ment. Health Nurs. 27, 942–955. Global Status Report on Alcohol and Health 2018. World Health Organization, Geneva Licence: CC BY-NC-SA 3.0 IGO. Globisch, D., Munzel, M., Muller, M., Michalakis, S., Wagner, M., Koch, S., Bruckl, T., Biel, M., Carell, T., 2010. Tissue distribution of 5-hydroxymethylcytosine and search for active demethylation intermediates. PLoS One 5, e15367. Golden, J.P., Baloh, R.H., Kotzbauer, P.T., Lampe, P.A., Osborne, P.A., Milbrandt, J., Johnson Jr., E.M., 1998. Expression of neurturin, GDNF, and their receptors in the adult mouse CNS. J. Comp. Neurol. 398, 139–150. Golden, J.P., DeMaro, J.A., Osborne, P.A., Milbrandt, J., Johnson Jr., E.M., 1999. Expression of neurturin, GDNF, and GDNF family-receptor mRNA in the developing and mature mouse. Exp. Neurol. 158, 504–528. Guo, J.U., Ma, D.K., Mo, H., Ball, M.P., Jang, M.H., Bonaguidi, M.A., Balazer, J.A., Eaves, H.L., Xie, B., Ford, E., Zhang, K., Ming, G.L., Gao, Y., Song, H., 2011. Neuronal activity modifies the DNA methylation landscape in the adult brain. Nat. Neurosci. 14, 1345–1351. Hammarlund, R., Crapanzano, K.A., Luce, L., Mulligan, L., Ward, K.M., 2018. Review of the effects of self-stigma and perceived social stigma on the treatment-seeking

8

Journal of Psychiatric Research 121 (2020) 1–9

H.B. Maier, et al.

characteristics of the 5'-untranslated region of the mouse glial cell line-derived neurotrophic factor gene. Brain Res. Mol. Brain Res. 85, 91–102. Tomac, A., Widenfalk, J., Lin, L.F., Kohno, T., Ebendal, T., Hoffer, B.J., Olson, L., 1995. Retrograde axonal transport of glial cell line-derived neurotrophic factor in the adult nigrostriatal system suggests a trophic role in the adult. Proc. Natl. Acad. Sci. U. S. A. 92, 8274–8278. Trupp, M., Belluardo, N., Funakoshi, H., Ibanez, C.F., 1997. Complementary and overlapping expression of glial cell line-derived neurotrophic factor (GDNF), c-ret protooncogene, and GDNF receptor-alpha indicates multiple mechanisms of trophic actions in the adult rat CNS. J. Neurosci. 17, 3554–3567. Uchida, S., Hara, K., Kobayashi, A., Otsuki, K., Yamagata, H., Hobara, T., Suzuki, T., Miyata, N., Watanabe, Y., 2011. Epigenetic status of Gdnf in the ventral striatum determines susceptibility and adaptation to daily stressful events. Neuron 69, 359–372. Volkow, N.D., Fowler, J.S., Wang, G.J., Swanson, J.M., 2004. Dopamine in drug abuse and addiction: results from imaging studies and treatment implications. Mol. Psychiatry 9, 557–569. Volkow, N.D., Wang, G.J., Telang, F., Fowler, J.S., Logan, J., Jayne, M., Ma, Y., Pradhan, K., Wong, C., 2007. Profound decreases in dopamine release in striatum in detoxified alcoholics: possible orbitofrontal involvement. J. Neurosci. 27, 12700–12706. Wang, J., Carnicella, S., Ahmadiantehrani, S., He, D.Y., Barak, S., Kharazia, V., Ben Hamida, S., Zapata, A., Shippenberg, T.S., Ron, D., 2010. Nucleus accumbens-derived glial cell line-derived neurotrophic factor is a retrograde enhancer of dopaminergic tone in the mesocorticolimbic system. J. Neurosci. 30, 14502–14512. Weeber, E.J., Sweatt, J.D., 2002. Molecular neurobiology of human cognition. Neuron 33, 845–848. Wolstenholme, J.T., Warner, J.A., Capparuccini, M.I., Archer, K.J., Shelton, K.L., Miles, M.F., 2011. Genomic analysis of individual differences in ethanol drinking: evidence for non-genetic factors in C57BL/6 mice. PLoS One 6, e21100. Yang, X., Diehl, A.M., Wand, G.S., 1996. Ethanol exposure alters the phosphorylation of cyclic AMP responsive element binding protein and cyclic AMP responsive element binding activity in rat cerebellum. J. Pharmacol. Exp. Ther. 278, 338–346. Yang, X., Horn, K., Wand, G.S., 1998. Chronic ethanol exposure impairs phosphorylation of CREB and CRE-binding activity in rat striatum. Alcohol Clin. Exp. Res. 22, 382–390. Zipori, D., Sadot-Sogrin, Y., Goltseker, K., Even-Chen, O., Rahamim, N., Shaham, O., Barak, S., 2017. Re-exposure to nicotine-associated context from adolescence enhances alcohol intake in adulthood. Sci. Rep. 7 2479-017-02177-2. Ziv, Y., Rahamim, N., Lezmy, N., Even-Chen, O., Shaham, O., Malishkevich, A., Giladi, E., Elkon, R., Gozes, I., Barak, S., 2018. Activity-dependent neuroprotective protein (ADNP) is an alcohol-responsive gene and negative regulator of alcohol consumption in female mice. Neuropsychopharmacology.

Pandey, S.C., Roy, A., Mittal, N., 2001a. Effects of chronic ethanol intake and its withdrawal on the expression and phosphorylation of the creb gene transcription factor in rat cortex. J. Pharmacol. Exp. Ther. 296, 857–868. Pandey, S.C., Saito, T., Yoshimura, M., Sohma, H., Gotz, M.E., 2001b. cAmp signaling cascade: a promising role in ethanol tolerance and dependence. Alcohol Clin. Exp. Res. 25, 46S–48S. Paratcha, G., Ledda, F., 2008. GDNF and GFRalpha: a versatile molecular complex for developing neurons. Trends Neurosci. 31, 384–391. Pascual, A., Hidalgo-Figueroa, M., Piruat, J.I., Pintado, C.O., Gomez-Diaz, R., LopezBarneo, J., 2008. Absolute requirement of GDNF for adult catecholaminergic neuron survival. Nat. Neurosci. 11, 755–761. Pascual, A., Hidalgo-Figueroa, M., Gomez-Diaz, R., Lopez-Barneo, J., 2011. GDNF and protection of adult central catecholaminergic neurons. J. Mol. Endocrinol. 46, R83–R92. Pochon, N.A., Menoud, A., Tseng, J.L., Zurn, A.D., Aebischer, P., 1997. Neuronal GDNF expression in the adult rat nervous system identified by in situ hybridization. Eur. J. Neurosci. 9, 463–471. Rani, C.S., Qiang, M., Ticku, M.K., 2005. Potential role of cAMP response element-binding protein in ethanol-induced N-methyl-D-aspartate receptor 2B subunit gene transcription in fetal mouse cortical cells. Mol. Pharmacol. 67, 2126–2136. Robbins, T.W., Ersche, K.D., Everitt, B.J., 2008. Drug addiction and the memory systems of the brain. Ann. N. Y. Acad. Sci. 1141, 1–21. Ron, D., Barak, S., 2016. Molecular mechanisms underlying alcohol-drinking behaviours. Nat. Rev. Neurosci. 17, 576–591. Shalev, U., Grimm, J.W., Shaham, Y., 2002. Neurobiology of relapse to heroin and cocaine seeking: a review. Pharmacol. Rev. 54, 1–42. Shaywitz, A.J., Greenberg, M.E., 1999. CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals. Annu. Rev. Biochem. 68, 821–861. Song, C.X., Szulwach, K.E., Fu, Y., Dai, Q., Yi, C., Li, X., Li, Y., Chen, C.H., Zhang, W., Jian, X., Wang, J., Zhang, L., Looney, T.J., Zhang, B., Godley, L.A., Hicks, L.M., Lahn, B.T., Jin, P., He, C., 2011. Selective chemical labeling reveals the genome-wide distribution of 5-hydroxymethylcytosine. Nat. Biotechnol. 29, 68–72. Springer, J.E., Mu, X., Bergmann, L.W., Trojanowski, J.Q., 1994. Expression of GDNF mRNA in rat and human nervous tissue. Exp. Neurol. 127, 167–170. Straten, G., Eschweiler, G.W., Maetzler, W., Laske, C., Leyhe, T., 2009. Glial cell-line derived neurotrophic factor (GDNF) concentrations in cerebrospinal fluid and serum of patients with early Alzheimer's disease and normal controls. J. Alzheimer's Dis. 18, 331–337. Syed, K.S., He, X., Tillo, D., Wang, J., Durell, S.R., Vinson, C., 2016. 5-Methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) enhance the DNA binding of CREB1 to the C/EBP half-site tetranucleotide GCAA. Biochemistry 55, 6940–6948. Tanaka, M., Ito, S., Matsushita, N., Mori, N., Kiuchi, K., 2000. Promoter analysis and

9