Alcohol dehydrogenase polymorphism and Parkinson's disease

Neuroscience Letters 305 (2001) 70±72

www.elsevier.com/locate/neulet

Alcohol dehydrogenase polymorphism and Parkinson's disease E.K. Tan, S. Nagamitsu, T. Matsuura, M. Khajavi, J. Jankovic, W. Ondo, T. Ashizawa* Department of Neurology, VA Medical Center, Baylor College of Medicine, Houston, TX, USA Received 9 January 2001; received in revised form 20 February 2001; accepted 20 February 2001

Abstract A particular alcohol dehydrogenase (ADH) polymorphism (allele A1) in the promoter region of the gene has been recently demonstrated to be associated with increased risk of Parkinson's disease (PD). In a case control study, we examine frequencies of ADH A1 allele in 100 PD patients (i.e. 200 alleles), 100 diseased controls (i.e. 200 alleles), and 194 healthy controls (i.e. 388 alleles). In addition, we study possible association of a combined non-amyloid component of plaque (NACP-Rep 1) allele and ADH A1 allele with risk of PD. There was no statistical signi®cance of the frequencies of ADH A1 allele between PD patients 12/200 (6%), diseased controls 13/200 (6.5%), and healthy controls 20/388 (5.2%). No strong evidence of an association was found between ADH A1 allele and PD susceptibility in our study patients. There was also no suggestion of linkage disequilibrium between NACP-Rep 1 and ADH A1 alleles. q 2001 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Alcohol dehydrogenase; Non-amyloid component of plaque; Gene; Polymorphism; Parkinson's disease; Huntington's disease

Polymorphisms of various genes responsible for dopamine metabolism, detoxi®cation reactions or both within dopaminergic neurones have been associated with an increased risk of Parkinson's disease (PD) [18]. The functional importance of these polymorphic alleles, however, is controversial since no single association has been consistently reproduced in different populations [2,10±13,15,16]. The potential of the ADH to reduce toxic metabolites in the dopaminergic neurones, renders ADH a potential candidate gene to PD susceptibility [1]. The ADH gene resides close to the alpha-synuclein gene, where two mutations cause an uncommon form of autosomal dominant parkinsonism [8,14]. We and others have previously shown that a polymorphism of non-amyloid component of plaque (NACPRep 1) in the promoter region of alpha-synuclein gene is signi®cantly higher in PD patients than normal controls [9,17]. Recently, a particular ADH polymorphism (allele A1) in the promoter region of the gene has been demonstrated to be associated with increased risk of PD, particularly those patients with a family history of the disease [1]. In this study, we determine the frequencies of ADH A1 * Corresponding author. Department of Neurology, Baylor College of Medicine, 6550 Fannin, Smith 1801, Houston, TX 77030, USA. Tel.: 11-713-7983953; fax: 11-713-7983128. E-mail address: [email protected] (T. Ashizawa).

allele in PD patients, and compare them to healthy and diseased controls, and study the signi®cance, if any, of a combined NACP-Rep 1 and ADH A1 alleles. One hundred PD patients (mean age 61 ^ 12 years, range 32±82, and mean age at onset of disease 53.4 ^ 11.5 years, range 28±80), 100 diseased controls (54 with Hungtinton's disease, HD, 46 with essential tremor ET), and 100 healthy controls, similar in age, gender and race (Caucasian), were studied. The mean age of ET, HD and healthy controls was 63.2 ^ 14.0 years (range 19±86), 51.1 ^ 16.6 years (range 13±84) and 57.1 ^ 12.2 years (range 22±74), respectively. These patients and controls were previously used for association study of NACP-Rep 1 [17]. We also included 94 healthy individuals of Hispanic origin. The diagnosis of idiopathic PD was made using standardized clinical criteria [6]. Among the 100 PD patients, 53 gave a positive family history of PD, with at least one affected ®rst or second degree relative, but none of the pedigrees exhibited clear autosomal dominant mode of inheritance. The mean age of onset of symptom onset was similar between familial and sporadic PD (52.0 vs 52.9 years). Forty one PD patients reported disease onset at age # 50 years. The diagnosis in HD patients was con®rmed by DNA testing showing an expanded ($40) CAG repeat. ET was diagnosed using recommended clinical criteria [3,7]. All study patients

0304-3940/01/$ - see front matter q 2001 Elsevier Science Ireland Ltd. All rights reserved. PII: S0 30 4- 39 40 ( 01) 0 17 70- 0

E.K. Tan et al. / Neuroscience Letters 305 (2001) 70±72

71

history and those without, compared to controls. Our results contradict those of Buervenich et al. [1] who found a significant association of ADH A1 allele and risk of PD, particularly those with a positive family history, in a Swedish population. Association studies of susceptibility loci in PD utilizing a case control design face an inherent risk of mismatched study patients and controls because of the relatively small sample sizes compared to the population at large. The dif®culties with interpretation of results from genetic studies of multifactorial diseases have been previously highlighted [5,11,18,19] and could in part explain the inconsistencies of the results seen in various studies of PD susceptibility loci. Alternatively, it could also indicate that the polymorphisms do not have any functional relevance to the etiology of the disease. However, reproducibility of results within the same or different ethnic population, meta-analysis of ®ndings from various studies, and comparisons of study patients with additional related or unrelated diseased controls, may greatly enhance the power of analysis, and hence a more accurate interpretation of the pathophysiologic signi®cance of the observed polymorphism. In this study, we have employed three control groups, healthy matched Caucasian controls, healthy controls of a different ethnic group (Hispanics), and diseased controls without PD. The diseased controls were further subdivided into two groups, DNA con®rmed HD patients (no relation to PD), and ET patients (possible association with PD) [4,7]. The frequencies of ADH A1 allele of our Caucasian, and Hispanic healthy controls were found to be similar to the Swedish controls (24) (4.5% vs 5.9% vs 4.6%). This indicates a relative stability of this allele amongst different ethnic population. The similar frequencies of the allele in the two diseased groups (both 6.5%) further support this assumption. In the Swedish study, the allele frequency in the `familial' cases was relatively high (19.5%), but the small sample size (n ˆ 21 patients) in this group limits any meaningful conclusion. The frequency in our 53 `familial' cases was 5.7%, similar to those without family history (the de®nition of `family history' is similar in the two

signed an informed consent approved by the local Institutional Review Board. Genotyping: using primers ADH-F (5 0 AATCAGCCATGCCTAGGCAAA 3 0 ) and ADH-R (5 0 GGAGGGGACAGAAATGTTCCA 3 0 ), the ADH A1 allele frequencies were determined by a polymerase chain reaction (PCR) with the following conditions: 958C of denaturing followed by 30 cycles of 968C for 30 s, 558C for 30 s, and 728C for 45 s. The PCR products were digested with ten units of restriction enzyme AluI as previously described [1]. The digested samples were electrophoresed on 3.5% agarose gels and the digested bands visualized under UV-illumination with ethidium bromide staining. For the wild type allele, the products were of 160 and 22 bp, and products of polymorphic A1 allele were of sizes 86, 74 and 22 bp. Statistical analysis: the frequencies of ADH A1 allele in both the diseased controls and healthy controls were compared with PD patients. In addition, we also analyzed frequencies of combination of ADH A1 with various NACP-Rep 1 polymorphic alleles in PD, diseased and healthy controls. x 2 test was used to compare the categorical variables. Statistical signi®cance was de®ned at P , 0:05. The frequencies of ADH A1 allele were as follows: PD patients 12/200 (6%), healthy matched controls 9/200 (4.5%), diseased controls 13/200 (6.5%), and healthy Hispanic controls 11/188 (5.9%) (Table 1). None of the differences between the groups reached statistical signi®cance. There was also no statistically signi®cant difference in ADH A1 frequencies found in PD subsets, 6/106 (5.7%) in those with positive family history and 6/94 (6.4%) in those without. ADH A1 frequencies also showed no difference in diseased controls subsets, HD 7/108 (6.5%) and ET 6/92 (6.5%). Only one PD patient and one ET patient had both ADH A1 allele and NACP-Rep 1 263 bp allele, and a combination of these two alleles was not seen in any of the other study patients or healthy subjects. In this study, we did not ®nd a signi®cant association of ADH A1 allele with an increased risk of PD, compared to healthy and diseased controls. Subset analysis also failed to reveal any signi®cant differences between those with family Table 1 ADH A1 frequencies in PD, healthy and diseased controls a

PD patients (total) Family history Without family history Healthy controls (Caucasians) Healthy controls (Hispanics) Diseased controls ET HD a

Ns:not signi®cant (P . 0.05).

Total number of alleles

Number of ADH A1 allele

Allele frequency (%)

P value (PD vs controls)

200 106 94 200

12 6 6 9

6.0 5.7 6.4 4.5

Ns

186

11

5.9

Ns

200 92 108

13 6 7

6.5 6.5 6.5

Ns Ns Ns

72

E.K. Tan et al. / Neuroscience Letters 305 (2001) 70±72

studies). While much larger sample sizes may have greater power to detect smaller differences between the comparison groups, the low frequency of the ADH A1 allele and the rarity of homozygosity (two in Swedish study, none in present study) argue against a strong etiologic importance of this allele. However, as the pathogenesis of PD is likely to be multifactorial, it is conceivable that selected, genetically predisposed, individuals may express the PD phenotype when exposed to speci®c enviromental toxins. One can therefore postulate that ADH A1 polymorphism may only be signi®cant when these various preconditions are ful®lled. There could also be a common `founder' effect in a particular race. We and others have previously found an association of a NACP-Rep 1 allele (263 bp) with PD [9,17]. Although the ADH and the alpha-synuclein genes are about 9 cM apart, another susceptibility loci in linkage disequilibrium with ADH A1 and NACP-Rep 1 263 bp alleles is a theoretical possibility, if this region belongs to a recombination cold spot. However, we did not ®nd such an association between these two alleles in our study population. In conclusion, our study did not ®nd a signi®cant association of ADH A1 allele, or ADH A1 and NACP-Rep1 alleles with risk of PD. Independent replication of the ®ndings within the Swedish and other ethnic population is needed. Further studies with a different approach, for example, a comparison of affected and unaffected sibpairs, may be of interest. [1] Buervenich, S., Sydow, O., Carmine, A., Zhang, Z.P., Anvret, M. and Olson, L., Alcohol dehydrogenase alleles in Parkinson's disease, Mov. Disord., 5 (2000) 813±818. [2] Christensen, P.M., Gotzsche, P.C. and Brosen, K., The sparteine/debrisoquine (CYP2D6) oxidation polymorphism and the risk of Parkinson's disease: a meta-analysis, Pharmacogenetics, 8 (1998) 473±479. [3] Deuschl, G., Bain, P. and Brin, M., Consensus statement of the Movement Disorder Society on Tremor. Ad Hoc Scienti®c Committee, Mov. Disord., 13 (Suppl. 3) (1998) 2±23. [4] Farrer, M., Gwinn, K., Muenter, M., De Vrieze, F.W., Crook, R., Perez-Tur, J., Lincoln, S., Maraganore, D., Adler, C., Newman, S., MacElwee, K., McCarthy, P., Miller, C., Waters, C. and Hardy, J., A chromosome 4p haplotype segregating with Parkinson's disease and postural tremor, Human Mol. Genetics, 8 (1999) 81±85. [5] Freely associating, Nat. Genet., 22 (1999) 1±2. [6] Gelb, D.J., Oliver, E. and Gilman, S., Diagnostic criteria for Parkinson's disease, Arch. Neurol., 56 (1999) 33±39. [7] Jankovic, J., Essential tremor and other movement disorders, In L.J. Findley and W. Koller (Eds.), Handbook of

[8]

[9]

[10]

[11] [12]

[13]

[14]

[15] [16]

[17]

[18]

[19]

Tremor Disorders, Marcel Dekker Inc, New York, NY, 1995, pp. 245±262. Kruger, R., Kuhn, W., Muller, T., Woitalla, D., Graeber, M., Kosel, S., Przuntek, H., Epplen, J.T., Schols, L. and Riess, O., Ala30Pro mutation in the gene encoding alpha-synuclein in Parkinson's disease, Nat. Genet., 18 (1998) 106±108. KruÈger, R., Vieira-Saecker, A.M., Kuhn, W., Berg, D., Muller, T., Kuhnl, N., Fuchs, G.A., Storch, A., Hungs, M., Woitalla, D., Przuntek, H., Epplen, J.T., Schols, L. and Riess, O., Increased susceptibility to sporadic Parkinson's disease by a certain combined a-synuclein/apolipoprotein E genotype, Ann. Neurol., 45 (1999) 611±617. Landi, M.T., Ceroni, M., Martignoni, E., Bertazzi, P.A., Caporaso, N.E. and Nappi, G., Gene-enviroment interaction in Parkinson's disease: the case of CYP2D6 gene polymorphism, Adv. Neurol., 69 (1996) 61±72. Markopoulou, K. and Langston, J.W., Candidate genes and Parkinson's disease: where to next? Neurology, 53 (1999) 1382±1383. McCann, S.J., Pond, S.M., James, K.M. and Le Couteur, D.G., The association between polymorphisms in the cytochrome P-450 2D6 gene and Parkinson's disease: a casecontrol study and meta-analysis, J. Neurol. Sci., 153 (1997) 50±53. Nicholl, D.J., Bennett, P., Hiller, L., Bonifati, V., Vanacore, N., Fabbrini, G., Marconi, R., Colosimo, C., Lamberti, P., Stocchi, F., Bonuccelli, U., Vieregge, P., Ramsden, D.B., Meco, G. and Williams, A.C., A study of ®ve candidate genes in Parkinson's disease and related neurodegenerative disorders, Neurology, 53 (1999) 1415±1421. Polymeropoulos, M.H., Lavedan, C., Leroy, E., Ide, S.E., Dehejia, A., Dutra, A., Pike, B., Root, H., Rubenstein, J., Boyer, R., Stenroos, E.S., Chandrasekharappa, S., Athanassiadou, A., Papapetropoulos, T., Johnson, W.G., Lazzarini, A.M., Duvoisin, R.C., Di Iorio, G., Golbe, L.I. and Nussbaum, R.L., Mutation in the alpha-synuclein gene identi®ed in families with Parkinson's disease, Science, 276 (1997) 2045±2047. Riedl, A.G., Watts, P.M., Jenner, P. and Marsden, C.D., P450 enzymes and Parkinson's disease: the story so far, Mov. Disord., 13 (1998) 212±220. Rostami-Hodjegan, A., Lannard, M.S., Woods, H.E. and Tucker, G.T., Meta-analysis of studies of the CYP2D6 polymorphism in relation to lung cancer and Parkinson's disease, Pharmacogenetics, 8 (1998) 227±238. Tan, E.K., Matsuura, T., Nagamitsu, S., Khajavi, M., Jankovic, J. and Ashizawa, T., Polymorphism of NACP-Rep 1 in Parkinson's disease: an etiologic link with essential tremor, Neurology, 54 (2000) 1195±1198. Tan, E.K., Khajavi, M., Thornby, J.I., Nagamitsu, S., Jankovic, J. and Ashizawa, T., Variability and validity of polymorphism association studies in Parkinson's disease, Neurology, 55 (2000) 533±538. Todd, J.A., Interpretation of results from genetic studies of multifactorial diseases, Lancet, 35 (1999) S15±S16.