Alien species and their zoonotic parasites in native and introduced ranges: The raccoon dog example

Accepted Manuscript Title: Alien species and their zoonotic parasites in native and introduced ranges: the raccoon dog example “Your article is registered as a regular item and is being processed for inclusion in a regular issue of the journal. If this is NOT correct and your article belongs to a Special Issue/Collection please contact [email protected] immediately prior to returning your corrections.”–> Author: Leidi Laurimaa Karmen S¨uld John Davison Epp Moks Harri Valdmann Urmas Saarma PII: DOI: Reference:

S0304-4017(16)30020-6 http://dx.doi.org/doi:10.1016/j.vetpar.2016.01.020 VETPAR 7893

To appear in:

Veterinary Parasitology

Received date: Revised date: Accepted date:

7-7-2015 12-1-2016 25-1-2016

Please cite this article as: {http://dx.doi.org/ This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Alien species and their zoonotic parasites in native and introduced ranges: the raccoon dog example

Leidi Laurimaa, Karmen Süld, John Davison, Epp Moks, Harri Valdmann, Urmas Saarma*

Department of Zoology, Institute of Ecology and Earth Sciences, University of Tartu, Estonia

*

Corresponding author at: Department of Zoology, Institute of Ecology and Earth Sciences,

University of Tartu, Vanemuise 46, 51014 Tartu, Estonia; E-mail address: [email protected] (U. Saarma)

1

Graphical Abstract

Highlights 

The raccoon dog is native in East Asia and alien in Europe



We compared the parasite faunas of raccoon dogs in their native and introduced ranges



Animals in native and introduced ranges exhibit different set of helminth species



Raccoon dog should be considered an important source of zoonotic agents in Europe

ABSTRACT The raccoon dog (Nyctereutes procyonoides) is a canid that is indigenous in East Asia and alien in Europe, where it was introduced more than half a century ago. The aim of this study was to compare the parasite faunas associated with raccoon dogs in their native and introduced ranges, and to identify zoonotic parasite species. We examined 255 carcasses of hunted raccoon dogs from Estonia and recorded a total of 17 helminth species: 4 trematodes, 4 cestodes and 9 nematodes. The most prevalent parasite species were Uncinaria stenocephala (97.6%) and Alaria alata (68.3%). Average parasite species richness was 2.86 (the highest was 9) and only two animals were not parasitized at all. Although the infection intensity was determined by weight and not by sex, all animals infected with more than five helminth species were males. We also found that animals infected with higher numbers of helminth species fed significantly more on natural plants. Intentional consumption of grass may represent a self-medicating behaviour among raccoon dogs. We included the Estonian data into a wider comparison of raccoon dog parasite faunas and found a total of 54 helmith taxa, including 28 of zoonotic potential. In Europe, raccoon dogs are infected with a minimum of 32 helminth species of which 19 are zoonotic; in the native range they are 2

infected with 26 species of which 17 are zoonotic. Most species were nematodes or trematodes, with fewer cestodes described. The recent increase in the number and range of raccoon dogs in Europe and the relatively high number of zoonotic parasite taxa that it harbours suggests that this species should be considered an important source of environmental contamination with zoonotic agents in Europe.

Keywords: Echinococcus multilocularis; invasive species; Nyctereutes procyonoides; parasite fauna; self-medicating behaviour; zoonoses

1. Introduction The raccoon dog (Nyctereutes procyonoides) is an alien canid, introduced to Europe in 1929–1958 from the Far-East of Russia (Heptner and Naumov, 1998). Its native distribution area includes south-eastern Russia, eastern provinces of China, northern Vietnam, and Japan (Nowak, 1984; Pitra et al., 2010). There are six raccoon dog subspecies recognized in East Asia (Kauhala and Kowalczyk, 2011) and the precise origin and subspecies identity of the introduced animals is largely unknown. However, only one subspecies (N. p. ussuriensis) is believed to have been present in the eastern part of the former Soviet Union (Heptner and Naumov, 1998) at the beginning of the twentieth century. Hence, translocation of raccoon dogs to the western part of the former Soviet Union during that period involved this subspecies. In Europe the raccoon dog is known to be an important vector of multiple zoonotic agents, of which some, e.g. the rabies virus, the fox tapeworm Echinococcus multilocularis and Trichinella spp., are highly hazardous to human health (Kauhala and Kowalczyk, 2011). Characteristics including omnivorous diet, high reproductive potential and the ability to hibernate at high latitudes have allowed the raccoon dog to successfully colonise new areas (Kauhala and Kowalczyk, 2011). As a result, the raccoon dog is now well-established in northern, eastern and central parts of Europe and continues to expand its range towards the west and south. An outstanding question in invasion ecology is to understand what happens to parasite faunas when host species become established in a new territory: 1) which parasites are prevalent in native ranges but absent in new territories, and vice versa; 2) and do some parasites pose a particular threat to local fauna and to human health in invasive ranges. Epidemiological studies describing the endoparasite fauna of the raccoon dog in Europe have been conducted in several countries, e.g. 3

Belarus (Shimalov and Shimalov, 2002), Lithuania (Bružinskaite-Schmidhalter et al., 2012), Denmark (Al-Sabi et al., 2013) and Germany (Thiess et al., 2001). A number of smaller studies targeting the parasites that infect humans have also been conducted in Europe, e.g. on Echinococcus multilocularis and nematodes from the genus Trichinella (Machnicka-Rowinska et al., 2002; Oivanen et al., 2002; Pannwitz et al., 2010; Schwarz et al., 2011). The only parasitological study of the subspecies N. p. ussuriensis in its native range that we could find originates from the 1970s (Judin, 1977). In that study, a total of 26 endoparasite species were reported, many of which, including E. multilocularis, are of considerable zoonotic potential (Knapp et al., 2015; Vuitton et al., 2015). By comparison, the first case of E. multilocularis infection in raccoon dogs in Europe was only reported in 2001 (Thiess et al., 2001). To date, no studies have compared the parasite fauna of the alien N. p. ussuriensis – the subspecies introduced to Europe – in its native and introduced distribution areas. Sutor et al. (2014) described the raccoon dog parasites in Far-East and Europe, however, that comparison was made with N. p. koreensis. Raccoon dogs were first introduced to Estonia from the Russian Far East in 1950 (Aul, 1957). In recent decades the population has been regulated by hunting, but also by diseases, such as rabies and sarcoptic mange (Süld et al., 2014). However, following a successful vaccination campaign initiated in 2005, the rabies virus has been eradicated from Estonia (Pärtel, 2013), and judging by hunting bags recorded during the period 2005-2012 (growth from approximately 4,000 to more than 12,000 individuals), the number of raccoon dogs has increased considerably (Veeroja and Männil, 2014). The parasite fauna of Estonian raccoon dogs was investigated about a decade ago, when a pilot study based on examination of 21 animals revealed six endoparasite species (Moks, 2004). Since the known endoparasite fauna of raccoon dogs in Europe is significantly larger, e.g. consisting of 25 species in Belarus (Shimalov and Shimalov, 2002), it seems likely that raccoon dogs in Estonia harbour more parasite species than indicated by the pilot study. The aim of this study was to examine the raccoon dog parasite fauna in Estonia to determine the potential for environmental contamination with zoonotic agents, and to compare the parasite fauna of the subspecies in its native and introduced ranges.

4

2. Material and methods 2.1. Sample collection 255 raccoon dog carcasses were collected from animals legally harvested by hunters for purposes other than this project, and examined for internal parasites. Samples were collected between autumn 2010 and spring 2012 from different parts of Estonia, covering 9 of 15 counties. All animals collected with fur (n=227) were examined for sores and patches of thick crusty skin as signs of sarcoptic mange. After weighing the carcasses, intestinal organs were removed and kept at –80˚C for at least 5 days before parasitological examination as a safety precaution (Eckert et al., 2001), since this kills the eggs of the highly dangerous tapeworms E. multilocularis and E. granulosus which have been recorded in Estonia (Moks et al., 2005, 2006, 2008; Laurimaa et al., 2015a, 2015b). Lungs, gall bladder and urinary bladder were studied using established washing and sieving techniques for helminth detection (Parre, 1985). The small and large intestines were separated and examined by the sedimentation and counting technique (Hofer et al., 2000). Up to 200 specimens were counted per helminth species. Parasites were stored in 95% ethanol.

2.2. Morphological identification Trematodes, cestodes and nematodes were identified according to their morphology after Kozlov (1977). Cestodes from the genera Echinococcus, Taenia and Mesocestoides were further identified after Abuladze (1964), Loos-Frank (2000) and Hrčkova et al. (2011), respectively.

2.3. Genetic analysis As the scoleces of tapeworms from the genus Taenia were deformed and lacking some of the features required for morphological identification (e.g. hooks), these samples were submitted to genetic identification. Genomic DNA was extracted using the High Pure PCR Template Preparation Kit (Roche) according to the manufacturer’s instructions. A 506 bp fragment of cox1 gene of tapeworm

mitochondrial

DNA

TGATCCGTTAGGTGGTGGTGA)

was

amplified and

with

primers

CesCox2R

CesCox1F (5’

(5’

-

GACCCTAACGACATAACATAATGAAAATG). 20-80 ng of purified genomic DNA and 5 pmol of primers were used in the PCRs performed in a total volume of 20 µL also containing 1x Advantage-2 PCR buffer, 1U Advantage-2 Polymerase mix (BD Biosciences, USA), 0.2 mM dNTP 5

(Fermentas, Lithuania). Thermocycling was performed using a touchdown protocol: a 1 mindenaturing step at 95 ºC, followed by 10 cycles of 20 sec at 95 ºC, 30 sec at 55 ºC and 45 sec at 68 ºC, but with the annealing temperature reduced by 0.5 ºC in each step (touchdown), followed by 25 cycles of 20 sec at 95 ºC, 30 sec at 45 ºC and 45 sec at 68 ºC. Samples were purified and sequenced as in Saarma et al. (2009), with sequencing performed using the same primers as used in the primary PCR.

2.4. Statistics For statistical analysis, collected animals were divided into two seasons reflecting the availability of natural food resources: 1) autumn (August-October); and 2) winter and early spring (NovemberApril). As few animals originated from the summer period, these were omitted from the statistical analysis. We used the Mann-Whitney U test to reveal significant associations between the season and number of identified helminth species. We also tested whether infestation with some helminth species, the number of helminths or animal weight depended on host sex (Mann-Whitney U test); if the number of parasite specimens (<200 or >200) depended on animal weight (Logistic regression); and whether animals infected with different numbers of helminth species consumed some food items significantly more than others (ANOVA). Statistical tests were performed using software STATISTICA 7. For comparative analysis of parasites and consumed food items, we used the raccoon dog dietary data from Süld et al. (2014), which originate from the same animals used in this study. To assess the co-occurrence of parasite species and food categories, we calculated the C-score (Stone and Roberts, 1990) for all pairs of parasite species, and for parasite species and food types. To generate a distribution of C-scores that could be expected if parasites were distributed randomly with respect to one another, we generated 999 random matrices and recalculated all pairwise C-scores for each matrix. Analyses were carried out using software R (package vegan) on parasite species that were represented in at least 10 animals.

6

3. Results 3.1. Parasite fauna in Estonia Due to decomposition or severe carcass damage some samples were excluded from the analyses. In total, 249 small intestine, 240 lung and 223 urinary bladder samples were examined. Gall bladders were also investigated, but only for 41 animals, and parasites detected in this organ were not included in statistical analyses due to the low sample size. We identified a total of 17 helminth species (Table 1), 12 from small intestine, 3 from lungs, 1 from urinary bladder and gall bladder (Table S1). Raccoon dogs were most often infected with Uncinaria stenocephala (97.6%) and Alaria alata (68.3%). Infestation with other helminth species was considerably lower (Table 1). Genetic identification of tapeworms confirmed the presence of Taenia polyacantha. Altogether four (1.6%) animals were found to be infected with E. multilocularis, and this finding has been discussed in detail in Laurimaa et al. (2015c). In two raccoon dogs, ascarid nematodes were found in the stomach in addition to the small intestine. We also often found intestinal helminth A. alata metacercaria in the lungs (13.3%). Two Mesocestoides species (M. litteratus and M. lineatus) were present in raccoon dogs, but we were unable to determine the species in most cases due to the absence of mature proglottids. Taking individuals where all organs were examined (intestines, lungs and urinary bladder; n=205), most (84.9%) were infected with one to four species (Table 2). Average parasite species richness was 2.86 species (95% CI 2.64 to 3.08). Only two animals were not parasitized at all. The highest number of different parasite species in the internal organs of a single raccoon dog was nine.

3.2. Variation between sexes Sarcoptic mange was detected in 15.0% (34/227) of animals with no significant difference between the sexes in the frequency of infection (15.0% of males vs 15.7% of females; Chi-square=0.02, p=0.89). Furthermore, Mann-Whitney U tests (p>0.05) did not reveal any significant difference between sexes in infestation with any identified helminth species. Although all animals harbouring more than five helminth species were males (Table 2), we did not find any significant relationship between the number of helminth species and animal sex (Mann-Whitney U test: z=-0.75; p=0.46). While there was no significant difference between animal sex and weight (mean weight for males 4.81 vs 4.84 for females), heavier animals were infected with more parasite specimens than smaller 7

animals: there was a significant relationship between animal weight and the infection intensity (logistic regression: Chi-square =9.08, p<0.01).

3.3. Parasite fauna vs. season, and food categories The number of helminth species detected in raccoon dogs varied between seasons (Mann-Whitney U test: z=-5.19; p<0.01): animals sampled from the autumn period were infested with more helminth species than animals collected from winter and early spring. Moreover, there was a significant relationship between the number of helminth species and consumed food categories (ANOVA: F(7,193)=4.99; p<0.01). Animals infected with higher numbers of helminth species consumed both natural plants and invertebrates more frequently (Table 3). We also detected a significant positive relationship between infection with one of the most prevalent parasite species A. alata and consumption of natural plants (Mann-Whitney U test z=-4.32; p<0.01).

3.4. Co-occurrence analyses No significant relationships were detected in the co-occurrence of different parasite species (Table S2). However, analysis of co-occurrence between parasite species and different food categories detected four significant relationships (Table S3): a) A. alata & Invertebrates (co-occurrence), b) Trematoda & Natural plants (co-occurrence), c) Trematoda & Invertebrates (co-occurrence), and d) Trematoda & Carrion (separation).

4. Discussion 4.1. Parasite fauna of the raccoon dog in Estonia In this study we identified 17 endoparasite species in raccoon dogs in Estonia (Table 1). In comparison with the same organs examined for parasites in a previous pilot study based on only 21 animals (Moks, 2004), 13 new endoparasite species were identified: 2 new trematode species (M. bilis and P. elegans), 3 new cestode species (M. litteratus, T. polyacantha and E. multilocularis), and 8 new nematode species (E. aerophilus, C. vulpis, M. patens, P. plica, T. canis, T. leonina, A. putorii and A. vasorum). Aside from Trichinella sp (we did not examine muscle tissue for infection with this parasite), all the helminth species found in the earlier pilot study (I. melis, A. alata, M. lineatus, Taenia spp., U. stenocephala, Trichinella sp; Moks, 2004) were recorded in the current 8

work. In addition to endoparasites, we also detected ectoparasite Sarcoptes scabiei, an agent for sarcoptic mange, in 15.0% of the animals. We did not find any statistically significant differences between animal sex and infection intensity, nor between sex and weight; both can be explained by the fact that the raccoon dog is not a dimorphic species. On the other hand, we showed that heavier animals were infected with higher numbers of parasite specimens. Thus, helminth infection intensity in raccoon dogs seems to be determined by weight but not sex. However, it is interesting to note that all the raccoon dogs infected with more than five helminth species were males (Table 2), though we found no significant relationship between the number of helminth species and sex. In other studies, Al-Sabi et al. (2013) found that the raccoon dog sex is insignificant risk factor of infection with a certain parasite species, whereas Bružinskaite-Schmidhalter et al. (2012) suggested that factor “male” could be a risk factor for infection with the following parasites: A. alata, Mesocestoides spp, T. canis, C. putorii, C. vulpis, and Echinostomatidae. We also found that animals sampled in autumn (August-October) were infested with more helminth species than those from winter and early spring (November-April). This finding is consistent with changes in the seasonal food habits of raccoon dogs. In autumn, raccoon dogs forage intensively and widely in order to accumulate subcutaneous fat to survive the cold winter (Drygala et al., 2008), and therefore encounter a wide variety of parasites. However, in winter, especially when the snow cover exceeds 35 cm as it did in winters 2010/2011 and 2011/2012 in Estonia (Estonian Weather Service, 2012-2013), it becomes difficult for raccoon dogs to forage (Kauhala et al., 2007), which leads to fewer feeding opportunities and less contact with parasites. If the temperature drops far below zero, as in the winters of this study (Estonian Weather Service, 2012-2013), raccoon dogs tend to stay in their dens for several days or even weeks without feeding.

4.2. Co-occurrence of different parasites, and parasites vs. food categories Co-occurrence analysis of different parasite species did not detect any significant relationships (Table S2). Thus, there was no evidence for significant competition or synergy between the parasites infecting raccoon dogs. Although the stomach content analysis only reflects an animal’s food consumption during a short time period, we found four significant relationships between parasite occurrence and diet component consumption (Table S3). We detected significant co-occurrence between A. alata and “Invertebrates” (Table S3). As this parasite is most commonly associated with amphibians, it is 9

difficult to explain why such a relationship exists. It could be a feeding habit of infected animals to compensate for a deficiency of certain nutrients that are present in invertebrates. Since A. alata constitutes the majority in the group Trematoda, the same co-occurrence was apparent between Trematoda and “Invertebrates” (Table S3).

4.3. Self-medicating behaviour in raccoon dogs? We found that raccoon dogs infected with trematodes fed significantly more on “Natural plants”, whereas the opposite was found for “Carrion” (Table S3). The mesocercariae of one of the most frequent trematode parasites detected in this study – A. alata, has been increasingly detected in wild boar tissues during the official Trichinella inspections (Riehn et al., 2010; Portier et al., 2011). Moreover, wild boar remains constituted the largest share (frequency of occurrence, FO=18%) of the “Carrion” consumed by raccoon dogs originating from the same animals as in this study (Süld et al., 2014). On one hand this fact appears to be in discord with the negative relation observed for “Carrion” in the co-occurrence analysis; however, raccoon dogs that were already infected with a high burden of Alaria flukes (often seen >200 specimens) might have preferred to feed more on natural plants and less on carrion. Indeed, we found a significant relationship between the number of Alaria flukes and consumption of natural plants. Different grasses (Poaceae) and decayed plant material, though in small quantities, constituted the majority (53%) of “Natural plants” (K. Süld, personal comm.). Since only 6 animals fed on wild berries, the consumption of natural plant material probably did not have an important nutritious effect. Intentional consumption of grass has been documented among many carnivore species, e.g. dogs, wolves (Canis lupus) and civet (Viverricula indica), and it has been hypothesised that plant consumption occurs more often in animals exhibiting signs of illness (Stahler et al., 2006; Sueda et al., 2008; Su et al., 2013). Furthermore, we found that animals that harboured more helminth species fed significantly more on “Natural plants” (Table 3). Given this, we suggest that these data indicate self-medicating behaviour among Estonian raccoon dogs.

4.3. Raccoon dog as a vector for zoonotic parasites in Estonia Nine of the 17 endoparasite species recorded from Estonian raccoon dogs in this study are of zoonotic importance, potentially causing serious health problems to humans or their companion animals (Table 1; Table S1). A parasite was considered zoonotic, if it has previously been described as an agent of human infection. In 15.0% of examined animals we identified sarcoptic mange, a 10

disease caused by the ectoparasitic itch mite Sarcoptes scabiei that can infect domestic animals, notably dogs. The mite can also occasionally infect humans, causing severe itching as it burrows into the upper layer of the skin (Heukelbach and Feldmeier, 2006). Among the pathogens we identified, the one causing the most severe disease in humans is the fox tapeworm (E. multilocularis), which was recorded from four raccoon dogs (1.6%) in two counties: two from the mainland (Järvamaa) and two from the island Saaremaa (see also Laurimaa et al., 2015c). Estonia is now the 6th country in Europe after Germany, Poland, Latvia, Slovakia and Lithuania (Thiess et al., 2001; Machnicka-Rowinska et al., 2002; Bagrade et al., 2008; Hurnikova et al., 2009; Bružinskaite-Schmidhalter et al., 2012; Marcinkute et al., 2015), where E. multilocularisinfected raccoon dogs have been reported. E. multilocularis causes the zoonotic disease alveolar echinococcosis, which is characterised by a long incubation period of 5 to 15 years and a high fatality rate. After ingestion of E. multilocularis eggs, parasitic lesions develop in the host’s liver and potentially spread to other organs, including the brain (Pawlowski et al., 2001). Uncinaria stenocephala (97.6%) and A. alata (68.3%) were the most prevalent parasite species and might therefore be considered to have the highest zoonotic potential. Larvae of both parasite species can occasionally infect humans and cause discomfort. Uncinaria stenocephala larvae can pass through a person’s skin and migrate subcutaneously, causing a painful itchy rash called cutaneous larva migrans (Tamminga et al., 2009). Alaria alata infection can be acquired by humans after eating inadequately cooked wild boar or frog meat (Möhl et al., 2009). Upon infection with A. alata larvae, the parasite can migrate to various organs (e.g. the eye) or muscle tissue and cause severe illness (Wasiluk, 2009). Although the patent period of both U. stenocephala and A. alata is up to 6 months (Järvis, 2011) we did not observe any seasonality of the infection. Hence, it seems that U. stenocephala and A. alata are common in Estonian wildlife throughout the year. Infectivity to humans and dogs, and the observed high prevalence rates in Estonia, as well as in Denmark and Lithuania (Bružinskaite-Schmidhalter et al., 2012; Al-Sabi et al., 2013), make U. stenocephala and A. alata pathogens that could represent a considerable public health risk if the number of raccoon dogs (and foxes) remains high. Considering the relatively large number of parasites with zoonotic potential (9 of 17 in Estonia, and 19 of 32 in Europe; Table 4 and Table S1), the raccoon dog should be regarded in Europe as an important source of environmental contamination with zoonotic agents that are of considerable public health risk.

11

4.5. Comparison of introduced and native distribution areas As the raccoon dog subspecies (N. p. ussuriensis) present in Europe is the same as in the species’ native range in the Russian Far East, it is of great interest to compare the parasite fauna between native and alien distribution areas. The animals used for translocation were probably free of parasites, as they were regularly treated with anthelminthics (Skorodumov, 1939); anthelmintics were administered to adult animals once a year and when parasite eggs were detected in faeces. Thus, the parasite species in European raccoon dogs have most likely been acquired in situ after the introduction. This notion is supported, for example, by studies of raccoon dog parasites in Volga Delta region, where the majority of detected trematode species were unique to this area (see below). Based on the data from this study and from the literature, we identified a total of 54 helminth taxa in the raccoon dog native and alien distribution areas. Of these, 28 are of zoonotic importance. Raccoon dogs in Europe are infected with a minimum of 32 helminth species, while raccoon dogs in their native range in the Russian Far East are infected with a minimum of 26 species (Table 4). The number of zoonotic parasites is similar in the two distribution ranges, being 19 in Europe and 17 in the Far East (Tables 4, 5). A total of 9 cestode taxa, including 5 zoonotic (‘z’ in Table 5) species, have been recorded from raccoon dogs in Europe and the Far East of Russia. Raccoon dogs from the Far East and Europe are infected with 5 and 9 cestode taxa, respectively. As all the cestode taxa present in Far-East Russia have also been found in Europe, the number of shared parasite species is 5, of which 4 are of zoonotic potential. The two areas differ by 4 cestode taxa that are all present in the introduced (‘I’), but not the native (‘N’), range (Table 5). The proportions of taxa common to both areas among the other broad parasite groups are somewhat different. Among nematodes, less than half of the species are common to both areas (8/18) and among trematodes, there is very little overlap between the species composition of the native and introduced areas (3/15 species are common to both areas) (Figure 4; Tables 4, 5). Specifically comparing the initial raccoon dog introduction areas in Europe (Novgorod, Leningrad and Tver regions in north-western part of European Russia, Belarus and the Baltic States) with the species native area also reveals differences in parasite species composition. The biggest differences can be seen in the class Trematoda: animals in Far East are infected with numerous trematode species that are absent in Europe (Table S4). The difference between these parasite faunas might result from the fact that trematodes usually have complex life cycles, with numerous intermediate host species (e.g. freshwater snails of the genus Parafossarulus for Clonorchis sinensis; freshwater snails of the family Semisulcospiridae for Matagonimus yokogawai, Paragonimus westermani and

12

Nanophyetus salmincola; sea snail Littorina littorea for Cryptocotyle lingua). Particular trematode species may therefore be absent from the introduced range if a specific intermediate host is missing. However, in Europe raccoon dogs are infected with 6 nematode and 3 taeniid species (T. polyacantha, T. crassiceps, and T. pisiformis) not present in the subspecies’ native range (Table 4). It is possible that the higher number of different helminth species seen in European raccoon dogs is acquired through contact with other highly parasitized canid species, such as the red fox (Vulpes vulpes) and wolf (Canis lupus). In addition to the Baltics and Belarus, raccoon dogs were also introduced to the Volga Delta region (Astrakhan Oblast) of Russia, where their parasite fauna has thoroughly been examined at various times. Zablotskii (1970) studied the parasites of 80 animals collected during 1961-1967 and found 22 helminth species in total (Table S4). This study showed that raccoon dogs in the Volga Delta are parasitized with 7 trematode species unique to the area (out of 12; Zablotskii, 1970). Moreover, in a different study, conducted on 54 animals about 30 years later, three new trematode species (Echinostoma revolutum, Apophallus muehlingi, Rossicotrema donicum), not present among European or Far Eastern raccoon dogs, were identified in Volga Delta (Table S4; Ivanov et al., 2009). By contrast, only 9 trematode species have been reported from both European countries and the Far-East (Table 4). The richness of trematodes in the Volga Delta and the absence of those species from European raccoon dogs again may reflect variations in the presence and abundance of intermediate host species.

4.6. Comparison between countries 4.6.1. Trematoda The trematode species most frequently reported from raccoon dogs are A. alata, I. melis and M. bilis (Figure 1). The reason for the higher infection rate (prevalence mostly >68%) in A. alata compared with other trematode species might be that Alaria infection is associated with multiple paratenic hosts (e.g. wild boar (Sus scrofa), brown bear (Ursus arctos), mustelids, mole (Talpa europaea), common European adder (Vipera berus)) and to a lesser degree with aquatic animals (Möhl et al., 2009). Considering previous studies of raccoon dog epidemiology that have published the prevalence of Trematoda (Judin, 1977 and Al-Sabi et al., 2013) infection appears to be similarly high in all countries - Estonia, Denmark and Far-East Russia (range from 69.1% - 88.9%) (Judin, 1977; Al13

Sabi et al., 2013; Table S5). This may indicate that habitats with access to freshwater (the preferred habitat for raccoon dogs; Heptner and Naumov, 1998) and specific host species for trematodes are similarly available in all these countries.

4.6.2. Cestoda The prevalence of the cestode E. multilocularis and of two other prevalent tapeworm taxa (Taenia polyacantha and Mesocestoides sp) is shown in Figure 2. Infection of raccoon dogs with E. multilocularis in Estonia is somewhat lower than in other neighbouring countries (1.6% vs. 13.9% in Latvia and 8.2% in Lithuania; Figure 2; Table S5), but similar to its native range in the Far East (1.4%) (see also Laurimaa et al., 2015c). This parasite is also endemic in Japan, where rather than N. p. ussuriensis, it infects the genetically and morphologically somewhat different subspecies N. p. albus (23.1%; Yimam et al., 2002). The infection rates of other taeniid tapeworms is similarly low, probably because raccoon dogs are not very efficient predators and, at least in Estonia, feed more on plant material (FO=82.5%) and carrion (FO=48.5%) than on the small mammals (FO=28.6%) (Süld et al., 2014) that act as the intermediate host for many taeniid species (Table S1). When comparing parasite prevalence in the whole group Cestoda, differences can be detected among different study areas (Estonia, Denmark, and Far-East Russia; Table S5). Raccoon dogs in Far-East Russia are highly parasitized with tapeworms (77.0%; Judin, 1977), probably because their diet mainly consists of the most frequent intermediate group of hosts – the small mammals (about 70%; Judin, 1977). By contrast, Estonian and probably also Danish raccoon dogs only consume rodents occasionally (FO=19%; Süld et al., 2014) and are therefore less infected with cestodes (26.3% in Denmark and 30.5% in Estonia) (Al-Sabi et al., 2013).

4.6.3. Nematoda Raccoon dogs can become infected with capillarid nematodes (P. plica, E. aerophilus, A. putorii) if they consume infected earthworms. The probability of acquiring these parasites varies in different countries (Figure 3; Table S5). The reasons for this remain unclear, though there are possible explanations for particular parasite prevalences. During the warm season, Lithuanian raccoon dogs feed intensively on earthworms, with earthworm biomass accounting for 12.2% of dietary volume (FO=21%; Baltrunaite, 2002); by contrast, Estonian raccoon dogs seem to feed mostly on

14

anthropogenic plant material (cereals and fruits), with no detected consumption of earthworms, at least in the cold season (K. Süld, personal comm.). Estonian raccoon dogs were most frequently infected with U. stenocephala (97.6%), mirroring to some extent the results of other European studies where the infection rate is always around or above 50% (Figure 3; Table S5). Similar infection rates of C. vulpis, which is acquired from snails and amphibians (see also Table S1), can be observed among all raccoon dog studies in Europe and FarEast Russia (Judin, 1977; Thiess et al., 2001; Shimalov and Shimalov, 2002; BružinskaiteSchmidhalter et al., 2012; Table S5). In previous studies where the prevalence of Nematoda is provided, Danish raccoon dogs were substantially less infected than animals in Estonia or Far-East Russia (52.2% vs. 98.8% in Estonia and 82.0% in Russia) (Judin, 1977; Al-Sabi et al., 2013; Table S5). The lower infection rate in Denmark could be due to lower exposure to infected soil and invertebrates that act as sources of contamination for most nematodes.

Conclusions In this study we identified 13 new helminth species in Estonian raccoon dogs, not recorded in an earlier study from about a decade ago. We found evidence of likely self-medicating behaviour among examined raccoon dogs: animals infected with more parasite species consumed more natural plant material. This phenomenon is further supported by the significant co-occurrence trematode infection (A. alata) and consumption of natural plants in the diet. Intentional consumption of grass has previously been documented in animals exhibiting signs of infection. When comparing the parasite fauna of the subspecies N. p. ussuriensis in its native and introduced distribution ranges, we identified a total of 54 helmith taxa, of which 28 have zoonotic potential. Raccoon dogs in Europe are infected with a minimum of 32 helminth species, of which 19 are zoonotic; while raccoon dogs in the Far East are infected with a minimum of 26 species, of which17 are zoonotic. The proportion of species common to both areas was highest for cestodes and somewhat lower for nematodes and trematodes. We also found differences in the infection rates of particular parasite species between different countries. Such variation seems likely to reflect differences in the importance of host species in raccoon dog diet and in the parasites’ life cycles.

Acknowledgements We would like to thank Dr. Alexander Saveljev for his generous help. This work was supported by institutional research funding (IUT20-32) from the Estonian Ministry of Education and Research; 15

the European Union through the European Regional Development Fund (Centre of Excellence FIBIR); and the Estonian Doctoral School of Ecology and Environmental Sciences.

References Abuladze, K.I., 1964. Osnovy tsestodologii, Tom IV: Teniaty – lentochnye gelminty zhivotnyh i cheloveka i vyzyvaemye imi zabolevanija [Common Cestodology, Part 4: Taeniidae— tapeworms of animals and humans and causal agents of their illnesses]. Moscow: Nauka, 530 p. (in Russian) Al-Sabi, M.N.S., Chriel, M., Jensen, T.H., Enemark, H.L., 2013. Endoparasites of the raccoon dog (Nyctereutes procyonoides) and the red fox (Vulpes vulpes) in Denmark 2009-2012 – A comparative

study.

Int.

J.

Parasitol.

Parasites.

Wildl.

2,

144-151.

doi:10.1016/j.ijppaw.2013.04.001 Anisimova, E.I., 2008. Struktura gelmintofauny enotovidnoj sobaki (Nyctereutes procyonoides, Gray) naturalizovavshejsya v Belarusi [The structure of helminths fauna of raccoon dog (Nectereutes procyonoides, Gray) nationalized in Belarus]. Vesci Akademii navuk BSSR. Serya bialagicnyh navuk. 2, 80-82. (in Belarusian). Aul, J., Ling, H., Paaver, K., 1957. Eesti NSV imetajad [Mammals of Estonian SSR]. Eesti Riiklik Kirjastus, Tallinn, pp. 256-257. (in Estonian) Bagrade, G., Esite, Z., Deksne, G., 2014. Data on Echinococcus multilocularis in fox and raccoon dog population in Latvia during 2010-2013 season of rabies state eradication and control programme. 9th Baltic Theriological Conference. Daugavpils, Latvia. Bagrade, G., Šnabel, V., Romig, T., Ozolinš, J., Hüttner, M., Miterpakova, M., Ševcova, D., Dubinsky, P., 2008. Echinococcus multilocularis is a frequent parasite of red foxes (Vulpes vulpes) in Latvia. Helminthologia. 45, 157-161. Baltrunaite, L., 2002. Diet composition of the red fox (Vulpes vulpes) pine marten (Martes martes) and raccoon dog (Nyctereutes procyonoides) in clay plain landscape, Lithuania. Acta Zoologica Lituanica. 12, 362-368. Bružinskaite-Schmidhalter, R., Šarkunas, M., Malakauskas, A., Mathis, A., Torgerson, P.R., Deplazes, P., 2012. Helminths of red foxes (Vulpes vulpes) and racoon dogs (Nyctereutes procyonoides) in Lithuania. Parasitology. 139, 120-127. 16

Drygala, F., Stier, N., Zoller, H., Boegelsack, K., Mix, H.M., Roth, M., 2008. Habitat use of the raccoon dog (Nyctereutes procyonoides) in north-eastern Germany. Mamm. Biol. 73, 371-378. doi:10.1016/j.mambio.2007.09.005 Esite, Z., Deksne, G., Bagrade, G., 2012. Overview of Alaria alata distribution in different host animals in Latvia. Proceedings of Conference on "Current events in veterinary research and practice” 22nd – 23rd November 2012, Jelgava, Latvia. pp. 36-39. Estonian

Weather

Service,

2012-2013.

Eesti

meteoroloogia

aastaraamat

2011-2012

[Meteorological yearbooks of Estonia 2011-2012]. (in Estonian) Gawor, J., Malczewski, A., 2005. Tasiemiec wielojamowy wystepujacy u lisow jako przyczyna niebezpiecznej choroby odzwierzecej [The tapeworm in foxes as a cause of a dangerous zoonosis alveococcosis in Poland]. Kosmos. 54, 89-94. (in Polish with English summary) Gusev, A.V., 1951. K parazitofaune ussuriiskogo enota (Nyctereutes procyonoides Gray, 1834) [On the parasite fauna of raccoon dog (Nyctereutes procyonoides Gray, 1934)]. Parazitologicheskii sbornik Zoologicheskogo Instituta Akademii Nauk SSSR. Leningrad. 13, 96-104. (in Russian) Heptner, V.G., Naumov, N.P., 1998. Mammals of the Soviet Union Vol. II Part 1a. Sirenia and Carnivora (Sea cows; Wolves and Bears). Amerind Publishing Co, New Delhi, pp. 82-123. Heukelbach, J.,

Feldmeier, H., 2006. Scabies. Lancet. 367, 1767-1774. doi: 10.1016/S0140-

6736(06)68772-2 Hofer, S., Gloor, S., Müller, U., Mathis, A., Hegglin, D., Deplazes, P., 2000. High prevalence of Echinococcus multilocularis in urban red foxes (Vulpes vulpes) and voles (Arvicola terrestris) in the city of Zurich, Switzerland. Parasitology. 120, 135-142. Hrčkova, G., Miterpakova, M., O’Connor, A., Šnabel, V., Olson, P.D., 2011. Molecular and morphological circumscription of Mesocestoides tapeworms from red foxes (Vulpes vulpes) in central Europe. Parasitology. 138, 638-647. Hurnikova, Z., Miterpakova, M., Chovancova, B., 2009. The important zoonoses in the protected areas of the Tatra National Park (TANAP). Wiad. Parazytol. 55, 395-398. Ivanov, V.M. , Semenova, N.N., Parshin, O.U., 2009. Trematodofauna enotovidnoi sobaki v delte Volgi [Trematodofauna of the raccoon dog in delta Volga river]. Samarskaja Luka. 18, 177-179. (in Russian) 17

Järvis, T., 2011. Veterinaarparasitoloogia 4 & 5 [Veterinary parasitology 4 & 5]. Tartu Ülikooli Kirjastus. (in Estonian) Judin, V.G., 1977. Enotovidnaja sobaka Primorja i Priamurja [Raccoon dog in Primorje and Amur]. Izd. Moscow: Nauka, pp. 124-134. (in Russian) Kauhala, K., Holmala, K., Schregel, J., 2007. Seasonal activity patterns and movements of the raccoon dog, a vector of diseases and parasites in southern Finland. Mamm. Biol. 72, 342-353. Kauhala, K., Kowalczyk, R., 2011. Invasion of the raccoon dog Nyctereutes procyonoides in Europe: History of colonization, features behind its success, and threats to native fauna. Curr. Zool. 57, 584-598. Kazlauskas, J., Prusaite, J., 1976. Gelminty zhivotnyh otrjada hishnyh (Carnivora) v Litve [Helminths of the order Carnivora in Lithuania]. Acta Parasitologica Lituanica. 14, 33-41. (in Russian with English summary) Knapp J, Gottstein B, Saarma U, Millon L. (2015). Taxonomy, phylogeny and molecular epidemiology of Echinococcus multilocularis: from fundamental knowledge to health ecology. Vet. Parasitol. 213, 85-91. doi: 10.1016/j.vetpar.2015.07.030 Kozlov, D.P., 1963. Izuchenie gelmintofauny zhivotnyh semeistva Canidae dalnego vostoka [Helminth fauna of the family Canidae in the Far East]. In: Judin, V.G., 1977. Enotovidnaja sobaka Primorja i Priamurja. Izd. Moscow: Nauka, pp. 124-134. (in Russian) Kozlov, D.P., 1977. Opredelitel gelmintov hishnyh mlekopitajushih SSSR [Key of helminths of carnivores]. Moscow: Nauka, 275 p. (in Russian) Laurimaa, L., Davison, J., Plumer, L., Süld, K., Oja, R., Moks, E., Keis, M., Hindrikson, M., Kinkar, L., Laurimäe, T., Abner, J., Remm, J., Anijalg, P., Saarma, U., 2015a. Non-invasive molecular diagnostics identifies Echinococcus multilocularis spillover to an urban area in Estonia. Emerg. Infect. Dis. 21, 163-164. doi: 10.3201/eid2101.140136 Laurimaa, L., Davison, J., Süld, K., Plumer, L., Oja, R., Moks, E., Keis, M., Hindrikson, M., Kinkar, L., Laurimäe, T., Abner, J., Remm, J., Anijalg, P., Saarma, U., 2015b. First report of highly pathogenic Echinococcus granulosus genotype G1 in dogs in European urban environment. Parasite Vector. 8, 182. doi: 10.1186/s13071-015-0796-3 Laurimaa, L., Süld, K., Moks, E., Valdmann, H., Umhang, G., Knapp, J., Saarma, U., 2015c. First report of the zoonotic tapeworm Echinococcus multilocularis in raccoon dogs in Estonia, and 18

comparisons with other countries in Europe. Vet. Parasitol. 212, 200-205. doi: 10.1016/j.vetpar.2015.06.004 Loos-Frank, B., 2000. An up-date of Verster's (1969) 'Taxonomic revision of the genus Taenia Linnaeus' (Cestoda) in table format. Syst. Parasitol. 45, 155-183. Machnicka-Rowinska, B., Rocki, B., Dziemian, E., Kolodziej-Sobocinska, M., 2002. Raccoon dog (Nyctereutes procyonoides) – the new host of Echinococcus multilocularis in Poland. Wiad. Parazytol. 48, 65-68. Marcinkute A, Šarkunas M, Moks E, Saarma U, Jokelainen P, Bagrade G, Laivacuma S, Strupas K, Sokolovas V, Deplazes P. (2015). Echinococcus infections in the Baltic region. Vet. Parasitol. 213, 121-131. doi: 10.1016/j.vetpar.2015.07.032 Möhl, K., Große, K., Hamedy, A., Wüste, T., Kabelitz, P., Lücker, E., 2009. Biology of Alaria alata and human exposition risk to Alaria mesocercariae–a review. Parasitol. Res. 105, 1-15. Moks, E., 2004. Punarebase (Vulpes vulpes), kährikkoera ((Nyctereutes procyonoides), hundi (Canis lupus) ja euroopa ilvese (Lynx lynx) helmintofaunast Eestis [Heminth fauna of the red fox (Vulpes vulpes), raccoon dog (Nyctereutes procyonoides), grey wolf (Canis lupus) and lynx (Lynx lynx) in Estonia]. University of Tartu, Master thesis. 49 pp. (in Estonian) Moks, E., Jõgisalu, I., Saarma, U., Talvik, H., Järvis, T., Valdmann, H., 2006. Helminthologic survey of the wolf (Canis lupus) in Estonia,with an emphasis on Echinococcus granulosus. J. Wildl. Dis. 42, 359-365. doi: 10.7589/0090-3558-42.2.359 Moks, E., Jõgisalu, I., Valdmann, H., Saarma, U., 2008. First report of Echinococcus granulosus G8 in Eurasia and a reappraisal of the phylogenetic relationships of “genotypes” G5–G10. Parasitology. 135, 647-654. doi: 10.1017/S0031182008004198 Moks, E., Saarma, U., Valdmann, H., 2005. Echinococcus multilocularis in Estonia. Emerg. Infect. Dis. 11, 1973-1974. doi: 10.3201/eid1112.050339 Nowak, E., 1984. Verbreitungs- und Bestandsentwicklung des Marderhundes, Nyctereutes procyonoides (Gray, 1834) in Europa. Z. Jagdwiss. 30, 137-154. Oivanen, L., Kapel, C.M.O., Pozio, E., La Rosa, G., Mikkonen, T., Sukura, A., 2002. Associations between Trichinella species and host species in Finland. J. Parasitol. 88, 84-88.

19

Parre, J., 1985. Veterinaarparasitoloogia [Veterinary Parasitology]. Valgus, Tallinn, 439 pp. (in Estonian) Pärtel, A., 2013. Self-declaration by Estonia on the recovery of its rabies-free status. OIE Bulletin 3, 58-61. Pannwitz, G., Mayer-Scholl, A., Balicka-Ramisz, A., Nöckler, K., 2010. Increased prevalence of Trichinella spp., northeastern Germany, 2008. Emerg. Infect. Dis. 16, 936-942. doi: 10.3201/eid1606.091629 Pawlowski, Z.S., Eckert, J., Vuitton, D.A., Ammann, R.W., Kern, P., Craig, P.S., Dar, K.F., DeRosa, F., Filice, C., Gottstein, B., Grimm, F., MacPherson, C.N.L., Sato, N., Todorov, T., Uchino, J., von Sinner, W., Wen, H., 2001. Echinococcosis in humans: clinical aspects, diagnosis and treatment. In: Eckert, J., Gemmell, M.A., Meslin, F.X., Pawlowski, Z.S. (Eds) WHO/OIE manual on echinococcosis in humans and animals: a public health problem of global concern. WHO/OIE, Paris, pp 20-71. Pitra, C., Schwarz, S., Fickel, J., 2010. Going west – invasion genetics of the alien raccoon dog Nyctereutes procyonoides in Europe. Eur. J. Wildl. Res. 56, 117-129. doi: 10.1007/s10344-0090283-2 Portier, J., Jouet, D., Ferte, H., Gibout, O., Heckmann, A., Boireau, P., Vallee, I., 2011. New data in France on the trematode Alaria alata (Goeze, 1792) obtained during Trichinella inspections. Parasite. 18, 271-275. Pozio, E., Bandi, C., La Rosa, G., Järvis, T., Miller, I., Kapel, C.M., 1995. Concurrent infection with sibling Trichinella species in a natural host. Int. J. Parasitol. 25, 1247-1250. doi: 10.1016/0020-7519(95)00042-z Riehn, K., Hamedy, A., Große, K., Zeitler, L., Lücker, E., 2010. A novel detection method for Alaria alata mesocercariae in meat. Parasitol. Res. 107, 213-220. Saarma, U., Jõgisalu, I., Moks, E., Varcasia, A., Lavikainen, A., Oksanen, A., Simsek, S., Andresiuk, V., Denegri, G., Gonzalez, L.M., Ferrer, E., Garate, T., Rinaldi, L., Maravilla, P., 2009. A novel phylogeny for the genus Echinococcus, based on nuclear data, challenges relationships based on mitochondrial evidence. Parasitology. 136, 317-328.

20

Schwarz, S., Sutor, A., Staubach, C., Mattis, R., Tackmann, K., Conraths, F.J., 2011. Estimated prevalence of Echinococcus multilocularis in raccoon dogs (Nyctereutes procyonoides) in northern Brandenburg, Germany. Curr. Zool. 57, 655-661. Shimalov, V.V., Shimalov, V.T., 2002. Helminth fauna of the racoon dog (Nyctereutes procyonoides Gray,

1834)

in

Belorussian

Polesie.

Parasitol.

Res.

88,

944-945.

doi:10.1007/s00436-001-0582-3 Skorodumov, A.N., 1939. Razvedenie ussuriiskih enotov [Propagation of ussurian raccoon dogs]. VKOI, Moscow. 67 pp. (in Russian) Stahler, D.R., Smith, D.W., Guernsey, D.S., 2006. Foraging and feeding ecology of the gray wolf (Canis lupus): lessons from Yellowstone National Park, Wyoming, USA. J. Nutr. 136, 1923S1926S. Stone, L., Roberts, A., 1990. The checkerboard score and species distributions. Oecologia. 85, 7479. doi: 10.1007/bf00317345 Su, H., Su, Y., Huffman, M.A., 2013. Leaf swallowing and parasitic infection of the Chinese lesser civet Viverricula indica in northeastern Taiwan. Zool. Stud. doi:10.1186/1810-522X-52-22 Sueda. K.L.C., Hart, B.L., Cliff, K.D., 2008. Characterisation of plant eating in dogs. Appl. Anim. Behav. Sci. 111, 120-132. Süld, K., Valdmann, H., Laurimaa, L., Soe, E., Davison, J., Saarma, U., 2014. An invasive vector of zoonotic disease sustained by anthropogenic resources: the raccoon dog in northern Europe. PLoS ONE 9(5): e96358. doi:10.1371/journal.pone.0096358 Sutor, A., Schwarz, S., Conraths, F.J., 2014. The biological potential of the raccoon dog (Nyctereutes procyonoides, Gray 1834) as an invasive species in Europe—new risks for disease spread? Acta Theriol. 59, 49-59. doi: 10.1007/s13364-013-0138-9 Tamminga, N., Bierman, W.F.W., de Vries, P.J., 2009. Cutaneous larva migrans acquired in Brittany, France. Emerg. Inf. Dis. 15, 1856-1858. doi: 10.3201/eid1511.090261 Theiss, T., Schuster, R., Nöckler, K., Mix, H., 2001. Helminth findings in indigenous raccoon dogs Nyctereutes procyonoides (Gray, 1834). Berl. Munch. Tierarztl. Wochenschr. 114, 273-276. (in German)

21

Torchin, M.E., Lafferty, K.D., Dobson, A.P., McKenzie, V.J., Kuris, A.M., 2003. Introduced species and their missing parasites. Nature. 421, 628-630. doi:10.1038/nature01346 Veeroja, R., Männil, P., 2014. Ulukiasurkondade seisund ja küttimissoovitus 2014 [Status of game populations in Estonia and proposal for hunting in 2014]. Estonian Environment Agency, pp. 64-66. (in Estonian) Vuitton, D.A., Demonmerot, F., Knapp, J., Richou, C., Grenouillet, F., Chauchet, A., Vuitton, L., Bresson-Hadni, S., Millon, L., 2015. Clinical epidemiology of human AE in Europe. Vet. Parasitol. 213, 110-120. doi: 10.1016/j.vetpar.2015.07.036 Wasiluk, A., 2009. Alariosis - newly diagnosed trematodiasis. Wiad. Parazytol. 55, 349-352. Yimam, A.E., Nonaka, N., Oku, Y., Kamiya, M., 2002. Prevalence and intensity of Echinococcus multilocularis in red foxes (Vulpes vulpes schrencki) and raccoon dogs (Nyctereutes procyonoides albus) in Otaru city, Hokkaido, Japan. Jpn. J. Vet. Res. 49, 287-296. Zablotskii, V.I., 1970. Gelmintofauna enotovidnoi sobaki i ondatry akklimatizirovannyh v delte Volgi [The helminth fauna of raccoon dogs and muskrats acclimated in the Volga Delta]. In: Judin, V.G., 1977. Enotovidnaja sobaka Primorja i Priamurja. Izd. Moscow: Nauka, pp. 124134. (in Russian)

Legends to Figures Figure 1. Trematode infection rate (%) in raccoon dogs (this study; Judin, 1977; Anisimova, 2008; Thiess et al., 2001; Shimalov and Shimalov, 2002; Bružinskaite-Schmidhalter et al., 2012; Esite et al.,

2012;

Al-Sabi

et

al.,

2013).

* Echinostomatidae was reported.

Figure 2. Cestode infection rate (%) in raccoon dogs ( this study; Judin, 1977; Thiess et al., 2001; Machnicka-Rowinska et al., 2002; Shimalov and Shimalov, 2002; Yimam et al., 2002; Gawor and Malczewski, 2005; Bagrade et al., 2008; Hurnikova et al., 2009; Bružinskaite-Schmidhalter et al., 2012; Schwarz et al., 2011; Al-Sabi et al., 2013; Bagrade et al., 2014). *The prevalence of 50%

22

reported

from

Slovakia

was

based

on

examination

of

two

animals.

** Taenia sp was reported.

Figure 3. Nematode infection rate (%) in raccoon dogs (this study; Judin, 1977; Thiess et al., 2001; Shimalov and Shimalov, 2002; Anisimova, 2008; Bružinskaite-Schmidhalter et al., 2012; Al-Sabi et al., 2013).

Figure 4. Parasite species infecting the raccoon dog in its native and introduced ranges, and the number of species shared between the two areas. The numbers in circles: total number of parasite species/zoonotic species. Note that the figure is schematic and that the comparison between Europe and Far-East is made with a population from a very narrow area in Primorye and Amur regions (PA; Judin, 1977) from where the subspecies was introduced to Europe and elsewhere.

23

Fig. 1

24

Fig. 2

25

Fig. 3

26

Fig. 4

27

Table 1. Prevalence of all identified helminth species from Estonian raccoon dogs. Asterisks (*) mark the species of zoonotic potential. No. Helminth species

of

Prevalence

No. pos. helminths

(95% CI)

/exam.

Mean

(min-max) intensitya

Trematodes

69.1

Alaria alata*

68.3 (62.5-74.1) 170/249

1 - 200

121

A. alata metacercaria

13.3 (9.0-17.6)

32/240

1 - 200

37

Metorchis bilis*

19.5 (7.4-31.6)

8/41

1 - 14

6

Isthmiophora melis

6.0 (3.0-9.0)

15/249

1 - 86

10

Plagiorchis elegans

0.8 (0-1.9)

2/249

1-3

2

Cestodes

30.5

1 - 200

32

Mesocestoides

spp

(M. lineatus* and M. litteratus) 21.3 (16.2-26.4) 53/249 Taenia spp (T. polyacanthab)

8.4 (5.0-11.9)

21/249

1 - 47

7

Echinococcus multilocularis*

1.6 (0-3.2)

4/249

3 - 200

125

Nematodes

98.8

Uncinaria stenocephala*

97.6 (95.7-99.5) 243/249

1 - 200

49

Eucoleus aerophilus*

30.0 (24.2-35.8) 72/240

1 - 49

6

Crenosoma vulpis

15.0 (10.5-19.5) 36/240

1 - 200

17

Molineus patens

13.7 (9.4-18.0)

34/249

1 - 24

3

Pearsonema plica

10.8 (6.7-14.9)

24/223

1 - 71

7

8.0 (4.7-11.4)

20/249

1 - 15

2

Aonchotheca putorii*

3.6 (1.3-5.9)

9/249

1-2

1

Angiostrongylus vasorum

1.3 (0-2.7)

3/240

1

1

Ascarids (T. canis* and T. leonina*)

a

Note that the upper limit in counting was 200 and therefore the numbers are indicative;

b

Three specimens identified genetically as Taenia polyacantha

28

Table 2. Number of identified endoparasite species in raccoon dog in Estonia (n=205). Ascarid species were considered as a single species, as were Taenia spp. and Mesocestoides spp. Gall bladder parasites were omitted. No. of parasite species

No. of raccoon dogs (%)

% of males

not infected

2 (1.0)

one

45 (22.0)

48.9

two

51 (24.9)

54.9

three

37 (18.0)

55.6

four

41 (20.0)

45.0

five

18 (8.8)

44.4

six

6 (2.9)

100

seven

2 (1.0)

100

eight

2 (1.0)

100

nine

1 (0.5)

100

0.0

Table 3. Effect on helminth infection in raccoon dogs (number of different species) of consuming different food items. Positive and negative estimates indicate increased and decreased consumption, respectively. Significant effects (P < 0.05) are shown in bold typeface. Estimate

Std. Error

t value

Pr(>|t|)

(Intercept)

2.55405

0.24011

10.637

< 2e-16

Anthropogenic Plants

0.01196

0.26763

0.045

0.96439

Natural Plants

0.94561

0.30482

3.102

0.00221

Birds

-0.51322

0.32355

-1.586

0.11433

Small Mammals

-0.17088

0.24804

-0.689

0.49171

Carrion

-0.04941

0.22315

-0.221

0.82499

Amphibians & Reptiles

-0.15563

0.51021

-0.305

0.76067

Invertebrates

0.92550

0.30517

3.033

0.00276

29

Table 4. Parasites of raccoon dog (N. p. ussuriensis) in its native (Far-East) and introduced (Volga Delta and Europe) distribution areas (this study; Gusev, 1951; Kozlov, 1963; Kazlauskas and Prusaite, 1976; Zablotskii, 1970; Judin, 1977; Thiess et al., 2001; Oivanen et al., 2002; Shimalov and Shimalov, 2002; Ivanov et al., 2009; Bružinskaite-Schmidhalter et al., 2012; Al-Sabi et al., 2013). Parasites in bold typeface are of zoonotic potential. See also Table S4 for more detailed reports. Far-East Parasite taxa

Russia

Volga Delta

Europe

TREMATODA

N=9

N=15

N=9

Alaria alata

+

+

+

Apophallus muehlingi

-

+

-

Clonorchis sinensis

+

-

-

Cryptocotyle lingua

+

-

+

Echinochasmus perfoliatus

-

+

-

Echinochasmus ryjikowi

+

-

-

Echinoparyphium clerci

+

-

-

Echinostoma revolutum

-

+

-

Isthmiophora melis

+

+

+

Mesorchis denticulatus

-

-

+

Metagonimus yokogawai

+

-

-

Metorchis bilis

-

+

+

Nanophyetus salmincola

+

-

-

Neodiplostomum spathoides

-

+

-

Opistorchis felineus

-

+

+

Paracoenogonimus ovatus

-

+

-

Paragonimus westermani

+

-

-

Petasiger exaeratus

-

+

-

Pharyngostomum cordatum

-

+

-

Plagiorchis elegans

-

-

+

Plagiorchis massino

-

+

-

Pseudamphistomum truncatum

-

+

+

Pygidiopsis summa

-

-

+

Rossicotrema donicum

-

+

-

30

Strigea falconis

-

+

-

CESTODA

N=5

N=3

N=9

Dilepis undula

-

-

+

Dipylidium caninum

+

+

+

Echinococcus multilocularis

+

-

+

Ligula colymbi

-

+

-

Mesocestoides spp

+

-

+

Spirometra erinacei

+

+

+

Taenia crassiceps

-

-

+

Taenia hydatigena

+

-

+

Taenia pisiformis

-

-

+

Taenia polyacantha

-

-

+

NEMATODA

N=12

N=7

N=14

Ancylostoma caninum

+

+

+

Angiostrongylus vasorum

-

-

+

Aonchotheca putorii

-

-

+

Contracaecum spiculigerum

-

+

-

Crenosoma vulpis

+

-

+

Dioctophyme renale

+

-

-

Eucoleus aerophilus

-

+

+

Molineus patens

+

-

+

Pearsonema plica

+

-

+

Physaloptera sibirica

+

-

-

Soboliphyme baturini

+

-

-

Strongyloides erschowi

-

-

+

Strongyloides vulpis

-

+

+

Thelazia callipaeda

+

-

-

Toxascaris leonina

+

-

+

Toxocara canis

+

+

+

Trichinella spp

+

+

+

Trichuris vulpis

-

-

+

Uncinaria stenocephala

+

+

+

31

Table 5. Comparison of trematode, cestode and nematode species found in raccoon dogs in its native (Far-East Russia) and introduced (Europe, excl. Volga Delta) ranges; *the number of species identical or different between the native and introduced ranges; I – introduced range; N- native range; z – zoonotic species Trematoda

Cestoda

Nematoda

Total

Total

15 taxa (10z)

9 taxa (5z)

18 taxa (10z)

42 taxa (25z)

Europe

9 (6z)

9 (5z)

14 (8z)

32 (19z)

Far-East Russia

9 (6z)

5 (4z)

12 (7z)

26 (17z)

Shared*

3 (2z)

5 (4z)

8 (5z)

16 (11z)

6I+6N

(4+4z) 4I+0N

(1+0z) 6I+4N

(3+2z) 16I+10N

Different*

= 12 (8z)

= 4 (1z)

= 10 (5z)

32

= 26 (14z)

(8+6z)