3-SMAD4 signaling mediates the activin A-induced suppression of PTX3 in human granulosa-lutein cells

Molecular and Cellular Endocrinology 493 (2019) 110485

Contents lists available at ScienceDirect

Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce

ALK4-SMAD2/3-SMAD4 signaling mediates the activin A-induced suppression of PTX3 in human granulosa-lutein cells

T

Chang Liua,b, Hsun-Ming Changb, Yuyin Yib, Ying Fanga, Feiyan Zhaoa, Peter C.K. Leungb,∗, Xiaokui Yanga,∗∗ a b

Department of Human Reproductive Medicine, Beijing Obstetrics and Gynecology Hospital, Capital Medical University, Beijing, China Department of Obstetrics and Gynaecology, BC Children's Hospital Research Institute, University of British Columbia, Vancouver, British Columbia, Canada

A R T I C LE I N FO

A B S T R A C T

Keywords: Activin A Pentraxin 3 ALK4 SMAD signaling Human granulosa cells

As one of the members of the transforming growth factor-β (TGF-β) superfamily, activin A plays an important role in regulating follicular development and oocyte maturation. Pentraxin 3 (PTX3) is the key component that promotes the process of cumulus expansion during mammalian ovulation. At present, the regulation of PTX3 expression in human granulosa cells remains largely unknown. This study aimed to examine the effects of activin A on the expression of PTX3 in human granulosa-lutein (hGL) cells and to investigate the underlying molecular mechanisms. Using an established immortalized hGL cell line (SVOG) and primary hGL cells as study models, we demonstrated that activin A significantly increased the phosphorylation of SMAD2 and SMAD3, which suppressed the expression of PTX3 at both the mRNA and protein levels. Additionally, these effects induced by activin A were completely reversed by pretreatment with the TGF-β type I receptor inhibitor SB431542 and knockdown of ALK4. Furthermore, knockdown of SMAD2, SMAD3, or SMAD4 completely reversed the activin Ainduced suppressive effects on PTX3 expression. Notably, the ChIP analyses demonstrated that phosphorylated SMADs could bind to human PTX3 promoter. Collectively, our results showed that the ALK4-SMAD2/3-SMAD4 signaling pathway most likely mediates the suppressive effect of activin A on PTX3 expression in hGL cells.

1. Intrduction Activins, which are identified as stimulators of FSH in the pituitary gland, belong to the transforming growth factor beta (TGF-β) superfamily. Activins are homo or heterodimers of inhibin β subunits (βA and βB) and are expressed in growing human ovarian follicles, resulting in the production of three main activins: activin A (βA and βA), activin B (βB and βB), and activin AB (βA and βB) (Evans et al., 1997; Wijayarathna and de Kretser, 2016; Young et al., 2012). The expression and potential functions of activins and their cognate receptors have been demonstrated in the reproductive system, including the uterus, placenta, and ovary (Wijayarathna and de Kretser, 2016). In the mammalian ovary, activin A plays a critical role in regulating various ovarian functions, including primordial follicle development, follicular development, steroidogenesis, extracellular matrix remodeling, oocyte maturation, ovulation, and luteal function (Bayne et al., 2015; Chang, Cheng et al., 2014, 2015, 2016a; Knight et al., 2012; Liu et al., 2016;

Stock et al., 1997). In humans and mice, activin A promotes granulosa cell (GC) proliferation, and the GC-specific knockout of activin βA led to subfertility in female mice, indicating an essential role for activin A in regulating granulosa cell-mediated reproductive function (Kipp et al., 2011; Pangas et al., 2007; Rabinovici et al., 1990). Additionally, recent studies have reported that abnormal expression patterns of activins, an imbalanced activin/follistatin (an antagonist of activins) ratio, and the dysregulation of the activin signaling pathway are associated with several ovarian pathologies, including polycystic ovary syndrome (PCOS), ovarian aging, and ovarian cancers (Eldar-Geva et al., 2001; Harada et al., 1996; Marino et al., 2014; Santoro et al., 1999; Teede et al., 2013). In human and mouse oocytes, activin A initiates its cellular activity by binding to two types of serine/threonine kinase receptors (ACVR2A [actRIIA] and ACVR2B [actRIIB]) (Sidis et al., 1998). The resulting ligand-receptor complexes further recruit and activate two type I receptors (activin receptor IA and IB), which are also known as activin

∗ Corresponding author. Department of Obstetrics and Gynecology, BC Children's Hospital Research Institute, University of British Columbia, Room 317, 950 west 28th Ave, Vancouver, British Columbia, V5Z 4H4, Canada. ∗∗ Corresponding author. Department of Human Reproductive Medicine Beijing Obstetrics and Gynecology Hospital, Capital Medical University, 251 Yaojiayuan Road, Chaoyang District, Beijing, 100026, China. E-mail addresses: [email protected] (P.C.K. Leung), [email protected] (X. Yang).

https://doi.org/10.1016/j.mce.2019.110485 Received 19 December 2018; Received in revised form 6 June 2019; Accepted 7 June 2019 Available online 08 June 2019 0303-7207/ © 2019 Elsevier B.V. All rights reserved.

Molecular and Cellular Endocrinology 493 (2019) 110485

C. Liu, et al.

2.2. Preparation and culture of primary human granulosa-lutein cells

receptor-like kinase 2 (ALK2) and ALK4, respectively (Sidis et al., 1998). The activation of the type I receptor leads to the phosphorylation of intracellular downstream mediators, the receptor-regulated SMADs (R-SMADs) SMAD2 and SMAD3 (Sidis et al., 1998). The heteromeric transcription factor complex, which consists of phosphorylated R-SMADs and a common SMAD (SMAD4), enters the nucleus and regulates the transcription of various target genes (Knight et al., 2012; Lin et al., 2006). In addition to the canonical SMAD signaling pathway, activin can also signal through SMAD-independent activin receptormediated intracellular signaling pathways, including MAPK, ERK1/2, p38, and JNK in a cell type-specific manner (Bao et al., 2005; de Guise et al., 2006). Pentraxin 3 (PTX3) is a prototype long pentraxin that plays a key role in the organization of extracellular matrix proteins and is essential for cumulus oophorus complex (COC) expansion (Russell and Salustri, 2006; Salustri et al., 2004). In human and mouse ovarian preovulatory follicles, PTX3 accumulates in the cumulus extracellular matrix before ovulation and facilitates the organization of the cumulus matrix by interacting with the hyaluronan-binding protein tumor necrosis factorstimulated gene-6 protein (TSG-6) (Baranova et al., 2014; Ievoli et al., 2011; Scarchilli et al., 2007). Female mice lacking PTX3 exhibit subfertility due to defective cumulus matrix organization and unfertilized oocytes (Varani et al., 2002). In vitro studies have shown that the addition of hormones to the COCs of PTX3−/− mice resulted in disorganization of the cumulus matrix, which could be alleviated by supplementation with recombinant PTX3 (Salustri et al., 2004). Given the importance of PTX3 in the process of COC expansion and subsequent in vivo fertilization, considerable research has been devoted to studies regarding the regulation of PTX3 in growing follicles. The highest expression levels of PTX3 (both mRNA and protein) in cumulus cells and follicle fluid were observed at 8 h after the luteinizing hormone (LH) surge, indicating that PTX3 is positively regulated by LH (Salustri et al., 2004; Varani et al., 2002). In primate ovaries, the expression levels of the inhibin β subunit (the precursor monomer of active A) in the granulosa cells of immature antral follicles are relatively high, whereas the levels of the inhibin β subunit are significantly downregulated after the LH surge (Fraser et al., 1993; Schwall et al., 1990). The spatiotemporal expression patterns of PTX3 and inhibin β subunits led us to propose that activin A serves as a cumulus expansioninhibiting factor by negatively regulating the expression of PTX3 in human granulosa cells. To test this hypothesis, we aimed to examine the effects of activin A on the expression of PTX3 in human granulosa cells and investigate the underlying molecular mechanisms.

Primary hGL cells were obtained from patients undergoing an in vitro fertilization (IVF) procedure. The study was approved by the Research Ethics Board of University of British Columbia, and all participants signed a written informed consent form. Follicular aspirates were obtained at the time of oocyte retrieval from IVF patients as described previously (Chang et al., 2014; Chang, Fang et al., 2016b). Briefly, hGL cells were seeded in 12-well plates (2 × 105 cells per well) and cultured in DMEM/F-12 (Sigma-Aldrich Corp) supplemented with 10% charcoal/dextran-treated FBS (HyClone Laboratories, Inc.), 100 U/ mL penicillin, 100 μg/mL streptomycin sulfate (Life Technologies, Inc.), and 1 × GlutaMAX (Life Technologies, Inc.). Cells were cultured in a humidified atmosphere with 95% air and 5% CO2 at 37 °C, and the culture medium was changed every other day in all experiments. Before specific treatments, the cells were cultured in medium with 0.5% charcoal/dextran-treated FBS. 2.3. Antibodies and reagents Polyclonal rabbit anti-phospho-SMAD2, anti-phospho-SMAD3 and anti-SMAD3 antibodies were obtained from Cell Signaling Technology (Beverly, MA). These antibodies do not cross-react with other SMADrelated proteins. Monoclonal mouse anti-SMAD2 antibody was obtained from Cell Signaling Technology. Monoclonal mouse anti–glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (G-9; sc-365062) antibody was obtained from Santa Cruz Biotechnology(Santa Cruz, CA). Horseradish peroxidase-conjugated goat anti-rabbit and goat antimouse IgGs were obtained from Bio-Rad and Santa Cruz Biotechnology, respectively. Recombinant human activin A was obtained from R&D Systems and was composed of a Chinese hamster ovary cell-derived recombinant human protein that was > 95% pure based on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with silver staining. It was lyophilized in a 0.2 M filtered solution of 4 mM HCl with 0.1% BSA as a carrier protein. Dorsomorphin dihydrochloride (dorsomorphin) and SB431542 were obtained from R&D Systems and Sigma-Aldrich Corp., respectively. 2.4. Reverse transcription quantitative real-time PCR (RT-qPCR) Cells were washed with cold PBS and total RNA was extracted with TRIzol Reagent (Invitrogen) according to the manufacturer's instructions. A total of 2 μg of RNA was reverse-transcribed into first-strand cDNA with a random primer and MMLV reverse transcriptase (Promega, Madison, WI). RT-PCR was performed on an Applied Biosystem 7300 Real-Time PCR system in 96-well optical reaction plates. The total reaction volume was 20 μl and included 10 μl of 2X SYBR Green PCR Master Mix (Applied Biosystems), 20 ng of cDNA, and 250 nM of each specific primer mix. The following primers were used in this study: PTX3: 5′-TCTCTGGTCTGCAGTGTTGG-3’ (sense) and 5′-TGAAGAGCTTGTCCCATTCC-3’ (antisense); SMAD2: 5′-GCCTTTAC AGCTTCTCTGAACAA-3’ (sense) and 5′- ATGTGGCAATCCTTTTCGAT3’ (antisense); SMAD3: 5′- CCCCAGCACATAATAACTTGG-3’ (sense) and 5′-AGGAGATGGAGCACCAGAAG-3’ (antisense); SMAD4: 5′-TGGCCCA GGATCAGTAGGT-3′(sense) and 5′-CATCAACACCAATTCCA GCA-3′(antisense); and GAPDH: 5′-ATGGAAATCCCATCACCAT CTT-3′(sense) and 5′-CGCCCCACTTGATTTTGG-3’ (antisense). Alternatively, TaqMan gene expression assays were used to examine ACVR1B (ALK4), TGFBR1 (ALK5) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression (Hs00244715_m1, Hs00610320_m1, and Hs02758991_g1, respectively; Applied Biosystems) in triplicate using the corresponding cDNA samples. The total reaction volume was 20 μl and included 4 μl of cDNA, 5 μl of RNase-free water, 10 μl of 2X TaqMan gene expression master mix (Applied Biosystems) and 1 μl of 20X TaqMan gene expression assay mix. RT-qPCR was performed on an Applied Biosystems 7300 Real-Time PCR System equipped with 96-well

2. Materials and methods 2.1. Culture of immortalized human granulosa-lutein cell (SVOG) In this study, we used a nontumorigenic immortalized human granulosa cell line, SVOG, which was previously produced by transfecting primary human granulosa-lutein (hGL) cells with the simian virus 40 large T antigen (Lie et al., 1996). Because the SVOG cells were generated from primary hGL cells, these cells display biological responses similar to those of various hormone or growth factor treatments (Bai et al., 2018; Chang, Qiao et al., 2016d; Wu et al., 2017). SVOG cells were cultured in Dulbecco's modified Eagle's medium/nutrient mixture F-12 Ham (DMEM/F-12; Sigma-Aldrich Corp., Oakville, ON) supplemented with 10% charcoal/dextran-treated fetal bovine serum (FBS, HyClone, Logan, UT., Logan, UT), 100 U/mL penicillin (Invitrogen, Life Technologies, Carlsbad, California), 100 μg/mL streptomycin sulfate, (Invitrogen), and 1 × GlutaMAX (Invitrogen) in a humidified atmosphere containing 5% CO2 at 37 °C. The SVOG cells were counted with a hemocytometer using 0.04% Trypan blue to assess cell viability and seeded (2–4 × 105 cells/mL) in 6-well plates. The culture medium was changed every 48 h in all experiments.Before specific treatments, the cells were cultured in serum-free medium for 24 h. 2

Molecular and Cellular Endocrinology 493 (2019) 110485

C. Liu, et al.

Fig. 1. Activin A suppresses the expression and accumulation of PTX3 in primary and immortalized human granulosa-lutein cells. (A) SVOG cells (n = 5) were treated with vehicle control or different concentrations (1, 10, or 100 ng/ml) of activin A for 3 h, and the mRNA levels of PTX3 were examined using RT-qPCR. (B) SVOG cells (n = 4) were treated with 30 ng/ml of activin A for 1, 2, 3, 6, 12, or 24 h, and the mRNA levels of PTX3 were examined using RT-qPCR. (C) SVOG cells (n = 5) were treated with vehicle control or different concentrations (1, 10, or 100 ng/ml) of activin A for 24 h, and the accumulated levels of PTX3 in the conditioned medium were measured using an enzyme immunoassay (ELISA). (D) Primary human granulosa-lutein cells (n = 6) were treated with vehicle control or different concentrations (1, 10, or 100 ng/ml) of activin A for 3 h, and the mRNA levels of PTX3 were examined using RT-qPCR. (E) Correlation between the concentration of PTX3 and activin A in human follicular fluid (n = 20). Enzyme immunoassays (ELISA) were used to examine the concentrations of PTX3 and activin A in follicular fluid from 20 IVF patients. All ELISA experiments were run in duplicate, and a mean value was used for the determination of PTX3 or activin A levels. The results are expressed as the mean ± SEM of at least 3 independent experiments, and values labeled with different letters are significantly different (P < 0.05). Ctrl, control; T, activin A treatment; C, control.

optical reaction plates. The PCR parameters used for the reaction were 50 °C for 2 min, 95 °C for 10 min and 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Assay performance was validated by evaluating amplification efficiencies using calibration curves while ensuring that the plot of log input amount vs. ΔCq (also known as ΔCt) had a slope < 0.1. Three separate experiments were performed for different cultures, and each sample was assayed in triplicate. A mean value was used to determine the mRNA levels using the comparative Cq method with the formula 2−ΔΔCq (2−ΔΔCt). GAPDH was used as the reference gene.

West Femto Chemiluminescence Substrate (Pierce, Rockford, IL), followed by exposure to CL-XPosure film (Thermo Fisher, Waltham, MA). The membranes were stripped with stripping buffer (50 mM Tris–HCl pH 7.6, 10 mmol/l β-mercaptoethanol and 1% SDS) at 50 °C for 30 min and reprobed with goat anti-actin antibodies as a loading control. Films were scanned and quantified by densitometry using Scion imaging software (Scion Corp., Frederick, MD, USA).

2.5. Western blot analysis

We performed transient knockdown assays with an ON-TARGETplus Nontargeting Control Pool or separate ON-TARGETplus SMARTpools targeting ALK4, ALK5, SAMD2, SMAD3 or SMAD4 (Thermo Fisher Scientific, Lafayette, CO). Cells were precultured to 50% confluence in antibiotic-free DMEM/F12 containing 10% charcoal/dextran-treated FBS and then transfected with 25 nM siRNA using Lipofectamine RNAiMAX (Life Technologies) for 48 h. The knockdown efficiency of each target was confirmed by RT-qPCR or Western blot analysis.

2.6. Small interfering RNA (siRNA) transfection

After treatment, the cells were washed with cold PBS and lysed in lysis buffer (Cell Signaling) containing a protease inhibitor cocktail (Sigma-Aldrich). Extracts were centrifuged at 20,000×g for 15 min at 4 °C to remove cellular debris, and protein concentrations were quantified using a DC Protein Assay (Bio-Rad). Equal amounts of protein were separated by 10% SDS–PAGE and transferred to polyvinylidene fluoride membranes. The membranes were blocked for 1 h in TBS containing 0.05% Tween 20 and 5% nonfat dried milk and incubated overnight at 4 °C with the relevant primary antibodies. After membranes were washed, they were incubated with a peroxidase-conjugated secondary antibody (Bio-Rad) for 1 h. Immunoreactive bands were detected using enhanced chemiluminescence reagents or a SuperSignal

2.7. Measurement of PTX3 and activin A After treatment with activin A for 24 h, the accumulated levels of PTX3 in the conditioned medium were measured using a quantitative sandwich enzyme immunoassay Quantikine kit (R&D Systems) 3

Molecular and Cellular Endocrinology 493 (2019) 110485

C. Liu, et al.

3. Results

according to the manufacturer's instructions. Alternatively, follicular fluid samples obtained from 20 patients with normal female endocrine system (male or tubal factors) undergoing IVF procedure were collected and asaayed for PTX3 and activin A using the quantitative sandwich enzyme immunoassay Quantikine kits (R&D systems). The inter and intra-assay coefficients of variation for these assays were less than 6% and the detection limit of PTX3 and activin A ranged from 7 to 116 pg/ ml and 7.85 pg/ml, respectively. Each sample was measured in triplicate, and secreted PTX3 levels were normalized to the total cellular protein content of each cell lysate. The normalized PTX3 levels for each treated sample are displayed as percentages of the normalized control levels.

3.1. Activin A negatively regulates the expression of PTX3 in hGL cells To investigate the effect of activin A on the expression of PTX in hGL cells, SVOG cells were treated with vehicle control or increasing concentrations (1, 10, or 100 ng/ml) of recombinant human activin A (activin A). As shown in Fig. 1A, the mRNA levels of PTX3 decreased in a concentration-dependent manner after cells were exposed to activin A for 3 h. In addition, a time-dependent study demonstrated that treatment with 30 ng/ml activin A decreased the mRNA levels of PTX3 beginning at 1 h, that suppression was maximal at 3 h and that this effect persisted until 24 h (Fig. 1B). We next used an enzyme immunoassay to examine the protein levels of PTX3 in the conditioned medium after cells were exposed to activin A for 24 h. The results showed that activin A decreased the protein levels of PTX3 in a concentration-dependent manner (Fig. 1C). To confirm the functional effects of activin A on the expression of PTX3 in hGL cells, we used primary hGL cells obtained from patients undergoing an IVF procedure. Consistent with the results obtained in SVOG cells, activin A exerted a suppressive effect on the expression of PTX3 in a concentration-dependent manner in primary hGL cells (Fig. 1D). To further investigate the physiological role of activin A in the regulation of PTX3, we further examined the concentrations of activin A and PTX3 in the follicular fluid obtained from women undergoing IVF procedure. Using the quantitative sandwich enzyme immunoassay Quantikine kits, our results showed that there was a negative correlation (r = −0.5297; P＜0.05) bewteen the concentrations of PTX3 and those of activin A in follicular fluid samples (Fig. 1E).

2.8. Chromatin immunoprecipitation (ChIP) assay We conducted the ChIP assay using a ChIP-IT Express Enzymatic Magnetic Chromatin Immunoprecipitation kit & Enzymatic Shearing kit (Catalog Nos. 53009 and 53035, Active Motif, Carlsbad, CA, USA), according to the manufactuer's protocol as previously described (Chang, Fang et al., 2016c). The purified DNA was subjected to real time qPCR amplification for the SMAD binding site located at the human PTX3 promoter using specific forward (5′-CCTCCAATTAATCT GACTGC-3′) and reverse (5′-TGGCACTGCGGTAACGGGA-3′) primers (Fig. 7A). The promoter sequences were scanned with transcription factor binding sites matrix obtained from the publicly available JASPAR database (http://jaspar.genereg.net/). We confirmed the selected primers using a silico PCR program (GENOME) and ensured that the generation of an amplicon is from the human genomic DNA. 2.9. Statistical analysis

3.2. Activin A activated SMAD2/3 signaling in SVOG cells The data are presented as the mean ± standard error of the mean of at least three independent experiments. PRISM software (GraphPad Software Inc, San Diego, CA) was used to perform one-way analysis of variance followed by Duncan's test for multiple comparisons of means. P < 0.05 was considered statistically significant.

Next, we investigated the molecular mechanisms underlying the activin A-induced suppression of PTX3 expression in SVOG cells. The phosphorylated protein levels of SMAD2 and SMAD3 were examined using western blot analysis following treatment with activin A (30 ng/

Fig. 2. Activin A activates SMAD2/3 signaling in SVOG cells. (A and B) SVOG cells (n = 5) were treated with 30 ng/ml activin A for 30, 45 or 60 min, and the phosphorylated protein levels of SMAD2 (A) or SMAD3 (B) were examined using western blot analysis. The results are expressed as the mean ± SEM of 5 independent experiments, and values labeled with different letters are significantly different (P < 0.05). T, activin A treatment; C, control. 4

Molecular and Cellular Endocrinology 493 (2019) 110485

C. Liu, et al.

Fig. 3. SMAD2/3 signaling mediates the activin A-induced suppression of PTX3 in SVOG cells. (A-D) SVOG cells (n = 5) were transfected with 25 nM control siRNA (siControl), SMAD2 siRNA (siSMAD2) or SMAD3 siRNA (siSMAD3) for 48 h. The mRNA (A and C) and protein (B and D) levels of SMAD2 and SMAD3 were examined using RT-qPCR and western blot analysis, respectively. (E) SVOG cells (n = 4) were transfected with 25 nM control siRNA (siControl), SMAD2 siRNA (siSMAD2) or SMAD3 siRNA (siSMAD3) for 48 h and then treated with 30 ng/ml activin A for an additional 3 h. The mRNA levels of SAMD2, SAMD3 and PTX3 were examined using RT-qPCR. The results are expressed as the mean ± SEM of 5 independent experiments. Values labeled with different letters are significantly different (P < 0.05). siCtrl, siControl; T, activin A treatment; C, control.

investigated whether SMAD2 and SMAD3 are involved in the activin Amediated suppression of PTX3 expression using a siRNA-based approach. SVOG cells were treated with 30 ng/ml activin A after knockdown of SMAD2 and SMAD3 was induced using specific siRNAs. The knockdown efficiency of SMAD2 and SMAD3 was confirmed using RTqPCR and western blot analysis, respectively. Both the mRNA (Fig. 3A and B) and protein (Fig. 3B and D) levels of SMAD2/3 were significantly lower after cells were transfected for 48 h. Notably, knockdown of either SMAD2 or SMAD3 completely reversed the activin Amediated suppression of PTX3 expression in SVOG cells (Fig. 3E).

ml) for 30, 45 or 60 min. As shown in Fig. 2A and B, the phosphorylated protein levels of SMAD2 (Fig. 2A) and SMAD3 (Fig. 2B) were significantly higher in the activin A-treated cells than in the control groups.

3.3. SMAD2/SMAD3 signaling is required for activin A-mediated downregulation of PTX3 in SVOG cells In our previous studies, we demonstrated that molecules downstream of the SMAD pathway, including SMAD2 and SMAD3, play important roles in the activin A-mediated regulation of human ovarian functions (Chang et al., 2014, 2015, 2016a; Liu et al., 2016). Here, we 5

Molecular and Cellular Endocrinology 493 (2019) 110485

C. Liu, et al.

Fig. 4. The TGF-β receptor inhibitor SB431542 but not dorsomorphin attenuates the activin A-induced phosphorylation of SMAD2/3 and suppression of PTX3 in SVOG cells. (A and B) SVOG cells (n = 4) were pretreated with dimethyl sulfoxide (DMSO) or TGF-β receptor inhibitors, SB431542 (10 μM) or dorsomorphin (10 μM) for 1 h and then treated with 30 ng/ml of activin A for an additional 30 min. The phosphorylated protein levels of SMAD2 (A) and SMAD3 (B) were examined using western blot analysis (C and D) SVOG cells (n = 4) were pretreated with DMSO or TGF-β receptor inhibitors, SB431542 (10 μM) or dorsomorphin (10 μM) for 1 h and then treated with 30 ng/ml of activin A for an additional 3 h (C) or 24 h (D). The mRNA (C) and accumulated protein levels of PTX3 in the conditioned medium (D) were examined using RT-qPCR (C) and an enzyme immunoassay (D), respectively. The results are expressed as the mean ± SEM of 4 independent experiments, and values labeled with different letters are significantly different (P < 0.05). Ctrl, control; T, activin A treatment.

3.5. ALK4 is the TGF-β type I receptor that mediates the activin A-induced suppression of PTX3 expression in SVOG cells

3.4. The TGF-β type I receptor inhibitor SB431542 but not dorsomorphin attenuated the phosphorylation of SMAD2/3 and reversed the suppression of PTX3 expression induced by activin A in SVOG cells

To further determine which ALK receptor mediated activin A-induced cellular activities in hGL cells, we used siRNA-based knockdown studies. As shown in Fig. 5A and B, transfection of SVOG cells with siRNA targeting ALK4 and ALK5 for 48 h significantly decreased the mRNA levels of the targeted ALKs. Notably, knockdown of ALK4 completely reversed the suppressive effect of activin A on the mRNA levels of PTX3. However, knockdown of ALK5 did not have this effect. Similarly, knockdown of ALK4 completely attenuated activin A-mediated increases in the phosphorylated SMAD2/3 protein (Fig. 5D), whereas knockdown of ALK5 did not have this effect (Fig. 5E).

Among the seven TGF-β type I receptors, ALK4 and ALK5 have been implicated in activin A-mediated cellular activities (Li et al., 2015; Olsen et al., 2015; Zheng et al., 2016). To investigate whether ALK4 or ALK5 are involved in the activin A-mediated phosphorylation of SMAD2/3 and the suppression of PTX3 expression, we pretreated SVOG cells with DMSO (as a vehicle control), 10 μM SB431542 or 10 μM dorsomorphin for 1 h and then treated the cells with 30 ng/ml activin A for different periods of time (1 h, 3 h and 24 h). Dorsomorphin is a specific inhibitor of ALK2/3/6 (Yu et al., 2008), whereas SB431542 is a selective inhibitor of ALK4/5/7 (Inman et al., 2002). Our results showed that the increases in the phosphorylation of SMAD2 (Fig. 4A) and SMAD3 (Fig. 4B) were attenuated by pretreatment with SB431542 (but not dorsomorphin). Moreover, the suppressive effects of activin A on the mRNA (Fig. 4C) and protein (Fig. 4D) levels of PTX3 were completely reversed by pretreatment with SB431542. These results indicate that either ALK4 or ALK5 is involved in activin A-mediated cellular activities in SVOG cells.

3.6. ALK4 is the TGF-β type I receptor that mediates the activin A-induced suppression of PTX3 expression in primary hGL cells To further confirm the functional effects of activin A on the expression of PTX3 in hGL cells, we used primary hGL to investigate the involvement of ALK4 in activin A-induced suppression of PTX3 3xpression. Consistent with the results obtained from SVOG cells. The 6

Molecular and Cellular Endocrinology 493 (2019) 110485

C. Liu, et al.

Fig. 5. The TGF-β type I receptor ALK4 but not ALK5 mediates the activin A-induced suppression of PTX3 in SVOG cells. (A and B) SVOG cells (n = 5) were transfected with siCtrl, siALK4 or siALK5 for 48 h. The mRNA levels of ALK4 (A) and ALK5 (B) were examined using RT-qPCR. (C) SVOG cells (n = 5) were transfected with siCtrl, siALK4 or siALK5 for 48 h, and then treated with 30 ng/ml of activin A for an additional 3 h. The mRNA levels of PTX3 were examined using RT-qPCR. (D and E) SVOG cells (n = 4) were transfected with siCtrl, siALK4 or siALK5 for 48 h and then treated with 30 ng/ml activin A for an additional 30 min. The phosphorylated protein levels of SMAD2 (D) and SMAD3 (E) were examined using western blot analysis. The results are expressed as the mean ± SEM of 5 independent experiments, and values labeled with different letters are significantly different (P < 0.05). siCtrl, siControl; C, control; T, activin A treatment.

3.7. SMAD2/3-SMAD4 signaling is required for activin A-mediated suppression of PTX3 expression in SVOG cells

addition of SB431542 but not dorsomorphin reversed the activin Ainduced suppression of PTX3 expression in hGL cells (Fig. 6A). We further examined the relative expression levels of PTX3 mRNA in both primary hGL and SVOG cells. The results showed that the mRNA levels of PTX3 were similar between primary hGL and SVOG cells (Fig. 6B). Notably, knocking down ALK4 but not ALK5 reversed the activin Ainduced suprression of PTX3 mRNA in primary hGL cells (Fig. 6C).

Before translocating to the nucleus to regulate target gene transcription, common SMAD (SMAD4) forms a heteromeric complex with SMAD2/3 (Walton et al., 2010; Wiater et al., 2009). To further confirm that the suppressive effect of activin A on the expression of PTX3 is mediated by the SMAD-dependent pathway, we performed knockdown studies using an siRNA targeting SMAD4. As shown in Fig. 7A and B, transfection of SVOG cells with an siRNA targeting SMAD4 (siSMAD4) for 48 h significantly decreased the mRNA and protein levels of SMAD4. 7

Molecular and Cellular Endocrinology 493 (2019) 110485

C. Liu, et al.

Fig. 6. The TGF-β type I receptor ALK4 but not ALK5 mediates the activin A-induced suppression of PTX3 in primary hGL cells. (A) Primary hGL cells (n = 6) were pretreated with dimethyl sulfoxide (DMSO) or TGF-β receptor inhibitors, SB431542 (10 μM) or dorsomorphin (10 μM) for 1 h and then treated with 30 ng/ml of activin A for an additional 3 h, the mRNA levels of PTX3 were examined using RT-qPCR. (B) Cell extracts obtained from primary hGL (n = 4) and SVOG (n = 4) cells were collected, the relative mRNA levels of ALK4 and ALK5 were examined using RT-qPCR. (C) Primary hGL cells (n = 4) were transfected with siCtrl, siALK4 or siALK5 for 48 h, and then treated with 30 ng/ml of activin A for an additional 3 h. The mRNA levels of PTX3, ALK4, and ALK5 were examined using RT-qPCR. The results are expressed as the mean ± SEM of 6 independent experiments, and values labeled with different letters are significantly different (P < 0.05). siCtrl, siControl; C, control; T, activin A treatment.

4. Discussion

Our results show that knockdown of SMAD4 completely reversed the activin A-induced suppression of PTX3 expression at both the mRNA (Fig. 7C) and protein (Fig. 7D) levels.

Ovulation is an inflammation-like process that is induced by the LH surge. The key event in ovulation is the release of COC, a gap junctionmediated syncytium-like structure formed by oocytes and the surrounding layer of compact cumulus cells (Berga and Naftolin, 2012; Espey, 1980; Richards et al., 2002). COC expansion is a structural change that involves the fabrication of the extracellular matrix by cumulus cell, which is required for the process of ovulation (Curry and Smith, 2006; Li et al., 2000). As a secreted protein in the pentraxin superfamily, PTX3 connects inter-α-inhibitor (IαI) and TSG-6 to hyaluronan and forms a cross-linked network that leads to the expansion of the COC (Salustri et al., 2004). Knockout mice lacking PTX3 exhibit defects in the integrity of the COC and a subfertile phenotype (Varani et al., 2002). Indeed, the expression levels of PTX3 in cumulus cells are

3.8. Phosphorylated SMAD3 binds to human PTX3 promoter in SVOG cells At present, there is no data to show that phosphorylation of SMAD molecules may bind to human PTX3 promoter in human granulosa cells. We thus investigated the interaction of phosphorylated SMAD3 protein with the human PTX3 promoter by using a ChIP analysis and the antiphospho-SMAD3 antibody. Using specific primers targeting human PTX3 promoter, the purified DNA was subjected to examine by RTqPCR (Fig. 8A). The ChIP analysis showed that activin A treatment increased the binding of endogenous phosphorylated SMAD3 to the human PTX3 promoter in SVOG cells (Fig. 8B). 8

Molecular and Cellular Endocrinology 493 (2019) 110485

C. Liu, et al.

Fig. 7. Depletion of SMAD4 reverses the activin A-induced suppression of PTX3 in SVOG cells. (A and B) Cells were transfected with 25 nM control siRNA (siCtrl) or SMAD4 siRNA (siSMAD4) for 48 h. The mRNA (A) and protein (B) levels of SMAD4 were examined using RT-qPCR (A) and western blot analysis (B), respectively. (C and D) SVOG cells were transfected with 25 nM control siRNA (siCtrl) or SMAD4 siRNA (siSMAD4) for 48 h, and then treated with 30 ng/ml of activin A for an additional 3 h (C) or 24 h (D). The mRNA (C) and accumulated protein (D) levels of PTX3 were examined using RT-qPCR (C) and an enzyme immunoassay (D), respectively. The results are expressed as the mean ± SEM of at least 3 independent experiments. Values labeled with different letters are significantly different (P < 0.05). siCtrl, siControl; T, activin A treatment; C, control.

The TGF-β superfamily is a functionally diverse group of more than 40 structurally related proteins that have been demonstrated to be key regulators in follicular development and ovulation (Knight and Glister, 2006). In addition to the regulatory role of activin A in the expression of PTX3, our recent studies showed that GC-derived BMP2 may regulate follicular function by downregulating the expression and production of the attenuated LH-induced upregulation of PTX3 via SMAD1/5/8SMAD4 signaling (Bai et al., 2017). Furthermore, we have demonstrated that additional GC–derived TGF-β superfamily members, including growth and differentiation factor 8 and TGF-β1, also suppress the expression of PTX3 via the SMAD2/3-SMAD4 signaling pathway (Fang et al., 2015; Li et al., 2018). Using SVOG cells as cell models and a siRNA-based knockdown approach, we demonstrated that activin A suppresses PTX3 expression most likely via the activation of the SMAD2/3 signaling pathway. The activin A-induced suppression of PTX3 expression can be completely reversed after knockdown of either SMAD2 or SAMD3. These results indicate that both SMAD2 and SMAD3 are required for the activin A-induced suppression of PTX3 expression.

highly correlated with the quality of the corresponding oocytes, indicating that PTX3 is the key regulator of COC expansion, which is highly correlated with ovulation. (Huang et al., 2013). Increasing evidence suggests that activin A plays an important role in granulosa cell proliferation and follicular development (da Silva et al., 2015; Pande et al., 2018). Furthermore, previous studies have reported that PTX3 levels were dramatically increased before ovulation, while the expression levels of the inhibin β subunit were decreased (Fraser et al., 1993; Salustri et al., 2004; Schwall et al., 1990; Varani et al., 2002). These findings suggest a potential functional role for activin A in regulating the expression of PTX3 before ovulation. In the present study, we demonstrate, for the first time, that activin A suppresses the expression of PTX3 in both primary and immortalized hGL cells in a concentrationand time-dependent manner. Collectively, previous studies and the results obtained from our studies suggest that GC-derived activin A might act in an autocrine/paracrine manner to achieve the final transition from a mature dominant follicle to adequately timed COC expansion and subsequent ovulation. 9

Molecular and Cellular Endocrinology 493 (2019) 110485

C. Liu, et al.

Fig. 8. SMAD3 binds to PTX3 promoter in SVOG cells. (A) The SMAD binding site in the human PTX3 promoter is highlighted by a box. The primers (forward and reverse) for ChIP assay are listed underlined. (B) SVOG cells were treated with 30 ng/ml of activin A for 6 h before being subjected to a ChIP assay. Cell extracts were precipitated with antiphospho-SMAD3 or control IgG antibodies. Subsequent RT-qPCR was performed using specific primers complementary to the SMAD binding site at PTX3 promoter region. Percent input method was used to analyze the ChIP-qPCR data. The results are expressed as the mean ± SEM from at least 3 independent experiments, and values without a common letter are significantly different (P < 0.05). Ctrl, control.

inhibitor) and dorsomorphin (ALK2/3/6 inhibitor) were used to explore which ALKs mediate activin A-induced SMAD2/3 activation and PTX3 suppression. The results showed that SB431542 but not dorsomorphin abolished the effects of activin A on hGL cells (both immortalized and primary hGL cells). Furthermore, the knockout experiments showed that ALK4 rather than ALK5 is the TGF-β type I receptor that mediates hGL cellular activities in response to activin A. Taken together, our results demonstrated that activin A suppresses the expression of PTX3, most likely through the ALK4-mediated SMAD signaling pathway in hGL cells (Fig. 9). These findings support the notion that activin A may be involved in the process of COC expansion and the subsequent ovulation in mammalian ovaries. Our findings are consistent with previous studies showing that members of the TGF-β superfamily may regulate COC expansion and ovulation through the SMAD signaling pathway. However, there are limitations in this in vitro study as our results were based on an immortalized hGL cell line and primary hGL cells obtained from women undergoing IVF treatment. We appreciate that these cells had been exposed to high pharmacological concentrations of exogenous gonadotropins (FSH, LH, and hCG) during the process of ovulation induction. Therefore, the gene expression patterns of membrane receptors, intracellular signal transducers, and the related targets can be different from those in the in vivo intraovarian microenvironment. Furthermore, it is difficult to link these results generated from this in vitro model system to the normal physiological situation. Whether our findings can be applied to explain the ovarian biology and pathology and any pharmacological or therapeutic application remains to be elucidated. PCOS is a common endocrine disease that mostly occurs in reproductive-age women characterized by hyperandrogenism and chronic anovulation (Diamanti-Kandarakis et al., 2012). Previous studies have demonstrated that an abnormal expression pattern of either activin A or PTX3 is closely related to PCOS. In particular, lower circulating concentrations of activin A were detected in PCOS patients, and this might be responsible for the lack of preovulatory follicle development

Indeed, our ChIP assay results confirmed that activin A stimulated the binding of endogenous phosphorylated SMAD3 to the human PTX3 promoter in immortalized hGL cells. Consistent with the present study, our previous studies showed that both SMAD2 and SMAD3 are involved in the expression of activin A-induced target genes, including PTGS2 and LOX (Chang et al., 2016a; Liu et al., 2016). These findings suggest that SMAD2 and SAMD3 may form a heterodimer with SMAD4 (i.e., SMAD2-SMAD3-SMAD4) rather than a homodimer with SMAD4 (i.e., SMAD2-SMAD2-SMAD4 or SMAD3-SMAD3-SMAD4) to mediate the activin A-induced suppression of PTX3 expression in hGL cells. In contrast, our previous study showed that SMAD2 but not SMAD3 is required to mediate activin A-induced downregulation of steroidogenic acute regulatory protein (StAR) expression in hGL cells (Chang et al., 2015). These findings indicate that the selection of SMADs used as downstream effectors to mediate the activin A-induced cellular activities is target gene-dependent (Chang et al., 2015). However, in agreement with our previous studies, we found that knockdown of SMAD4 completely reversed the activin A-induced suppression of PTX3 expression, indicating that SMAD4 is absolutely required for activin Ainduced cellular activities in hGL cells. Intriguingly, the conditional knockout of Smad4 in mouse ovaries led to premature luteinization of GCs, disturbed LH-induced cumulus expansion and follicle rupture, suggesting that the SMAD-dependent pathway is indispensable for mammalian cumulus expansion and ovulation (Pangas et al., 2006; Yu et al., 2013). Since the dysregulation of the activin signaling pathway has been shown to be associated with several ovarian pathologies, obtaining a better understanding of the detailed molecular mechanisms underlying activin A-mediated cellular activities will help us to develop therapeutic strategies for related ovarian disorders and infertility. Before the activation of SMAD2 and SMAD3, activin ligands must bind both type I and type II receptors, with pathway specificity primarily determined by the type I receptor (Miyazono et al., 2010; Miyazono et al., 2001). In this study, two TGF-β type I receptor inhibitors SB431542 (ALK4/5/7 10

Molecular and Cellular Endocrinology 493 (2019) 110485

C. Liu, et al.

Beijing Health Bureau (grant number 2011-3-071). References Bai, L., Chang, H.M., Cheng, J.C., Chu, G., Leung, P.C.K., Yang, G., 2017. ALK2/ALK3BMPR2/ACVR2A mediate BMP2-induced downregulation of pentraxin 3 expression in human granulosa-lutein cells. Endocrinology 158, 3501–3511. Bai, L., Chang, H.M., Cheng, J.C., Chu, G., Leung, P.C.K., Yang, G., 2018. Lithium chloride inhibits StAR and progesterone production through GSK-3β and ERK1/2 signaling pathways in human granulosa-lutein cells. Mol. Cell. Endocrinol. 461, 89–99. Bao, Y.L., Tsuchida, K., Liu, B., Kurisaki, A., Matsuzaki, T., Sugino, H., 2005. Synergistic activity of activin A and basic fibroblast growth factor on tyrosine hydroxylase expression through Smad3 and ERK1/ERK2 MAPK signaling pathways. J. Endocrinol. 184, 493–504. Baranova, N.S., Inforzato, A., Briggs, D.C., Tilakaratna, V., Enghild, J.J., Thakar, D., Milner, C.M., Day, A.J., Richter, R.P., 2014. Incorporation of pentraxin 3 into hyaluronan matrices is tightly regulated and promotes matrix cross-linking. J. Biol. Chem. 289, 30481–30498. Bayne, R.A., Kinnell, H.L., Coutts, S.M., He, J., Childs, A.J., Anderson, R.A., 2015. GDF9 is transiently expressed in oocytes before follicle formation in the human fetal ovary and is regulated by a novel NOBOX transcript. PLoS One 10 e0119819. Berga, S., Naftolin, F., 2012. Neuroendocrine control of ovulation. Gynecol. Endocrinol. : the official journal of the International Society of Gynecological Endocrinology 28 (Suppl. 1), 9–13. Chang, H.M., Cheng, J.C., Huang, H.F., Shi, F.T., Leung, P.C., 2015. Activin A, B and AB decrease progesterone production by down-regulating StAR in human granulosa cells. Mol. Cell. Endocrinol. 412, 290–301. Chang, H.M., Cheng, J.C., Klausen, C., Taylor, E.L., Leung, P.C., 2014. Effects of recombinant activins on steroidogenesis in human granulosa-lutein cells. J. Clin. Endocrinol. Metab. 99, E1922–E1932. Chang, H.M., Cheng, J.C., Liu, Y., Klausen, C., Xu, C., Leung, P.C., 2016a. Activin Ainduced increase in LOX activity in human granulosa-lutein cells is mediated by CTGF. Reproduction 152, 293–301. Chang, H.M., Fang, L., Cheng, J.C., Taylor, E.L., Sun, Y.P., Leung, P.C., 2016b. Effects of growth differentiation factor 8 on steroidogenesis in human granulosa-lutein cells. Fertil. Steril. 105, 520–528. Chang, H.M., Fang, Y., Liu, P.P., Cheng, J.C., Yang, X., Leung, P.C., 2016c. Connective tissue growth factor mediates growth differentiation factor 8-induced increase of lysyl oxidase activity in human granulosa-lutein cells. Mol. Cell. Endocrinol. 434, 186–198. Chang, H.M., Qiao, J., Leung, P.C., 2016d. Oocyte-somatic cell interactions in the human ovary-novel role of bone morphogenetic proteins and growth differentiation factors. Hum. Reprod. Update 23, 1–18. Curry Jr., T.E., Smith, M.F., 2006. Impact of extracellular matrix remodeling on ovulation and the folliculo-luteal transition. Semin. Reprod. Med. 24, 228–241. da Silva, C.M., Castro, S.V., Faustino, L.R., Rodrigues, G.Q., Brito, I.R., Rossetto, R., Saraiva, M.V., Campello, C.C., Lobo, C.H., Souza, C.E., Moura Ade, A., Donato, M.A., Peixoto, C.A., de Figueiredo, J.R., 2015. Activin-A promotes the development of goat isolated secondary follicles in vitro. Zygote 23, 41–52. de Guise, C., Lacerte, A., Rafiei, S., Reynaud, R., Roy, M., Brue, T., Lebrun, J.J., 2006. Activin inhibits the human Pit-1 gene promoter through the p38 kinase pathway in a Smad-independent manner. Endocrinology 147, 4351–4362. Diamanti-Kandarakis, E., Spritzer, P.M., Sir-Petermann, T., Motta, A.B., 2012. Insulin resistance and polycystic ovary syndrome through life. Curr. Pharmaceut. Des. 18, 5569–5576. Eldar-Geva, T., Spitz, I.M., Groome, N.P., Margalioth, E.J., Homburg, R., 2001. Follistatin and activin A serum concentrations in obese and non-obese patients with polycystic ovary syndrome. Hum. Reprod. 16, 2552–2556. Espey, L.L., 1980. Ovulation as an inflammatory reaction–a hypothesis. Biol. Reprod. 22, 73–106. Evans, L.W., Muttukrishna, S., Knight, P.G., Groome, N.P., 1997. Development, validation and application of a two-site enzyme-linked immunosorbent assay for activin-AB. J. Endocrinol. 153, 221–230. Fang, L., Chang, H.M., Cheng, J.C., Yu, Y., Leung, P.C., Sun, Y.P., 2015. Growth differentiation factor-8 decreases StAR expression through ALK5-mediated Smad3 and ERK1/2 signaling pathways in luteinized human granulosa cells. Endocrinology 156, 4684–4694. Fraser, H.M., Lunn, S.F., Cowen, G.M., Saunders, P.T., 1993. Localization of inhibin/activin subunit mRNAs during the luteal phase in the primate ovary. J. Mol. Endocrinol. 10, 245–257. Harada, K., Shintani, Y., Sakamoto, Y., Wakatsuki, M., Shitsukawa, K., Saito, S., 1996. Serum immunoreactive activin A levels in normal subjects and patients with various diseases. J. Clin. Endocrinol. Metab. 81, 2125–2130. Hashimoto, O., Funaba, M., 2011. Activin in glucose metabolism. Vitam. Horm. 85, 217–234. Huang, X., Hao, C., Shen, X., Zhang, Y., Liu, X., 2013. RUNX2, GPX3 and PTX3 gene expression profiling in cumulus cells are reflective oocyte/embryo competence and potentially reliable predictors of embryo developmental competence in PCOS patients. Reprod. Biol. Endocrinol. : RBE (Rev. Bras. Entomol.) 11, 109. Ievoli, E., Lindstedt, R., Inforzato, A., Camaioni, A., Palone, F., Day, A.J., Mantovani, A., Salvatori, G., Salustri, A., 2011. Implication of the oligomeric state of the N-terminal PTX3 domain in cumulus matrix assembly. Matrix Biol. : journal of the International Society for Matrix Biology 30, 330–337. Inman, G.J., Nicolas, F.J., Callahan, J.F., Harling, J.D., Gaster, L.M., Reith, A.D., Laping, N.J., Hill, C.S., 2002. SB-431542 is a potent and specific inhibitor of transforming

Fig. 9. Proposed model for the actions of activin A on the expression of PTX3 in human granulosa-lutein cells. Activin A binds to a heterotetrameric receptor complex comprised of type I (ALK4) and type II receptors. Ligand-induced activation of the receptor complex results in the phosphorylation and activation of ALK4, leading to the activation of receptor-regulated SMAD2/3. Phosphorylated SMAD2/3 forms a heterotrimeric complex with common SMAD4 that translocates into the nucleus where it binds PTX3 promoter and suppresses the transcription of PTX3.

observed in this disorder (Norman et al., 2001). Activins can regulate both glucose and energy metabolism by promoting the differentiation of cells that produce and respond to insulin, as these effects may improve insulin resistance through their anti-inflammatory activities (Hashimoto and Funaba, 2011). Interestingly, higher serum levels of PTX3 were observed in PCOS patients with insulin resistance (Sahin et al., 2014). Along with these clinical studies, our results suggest that the dysregulation of the activin-A/PTX3 system may contribute to the development of PCOS, especially in patients with insulin resistance. However, future studies aimed at addressing this hypothesis using animal models and in vitro experiments are required. In summary, we demonstrate that activin A suppresses the expression of PTX3 in primary and immortalized hGL cells. Furthermore, the effect induced by activin A is most likely mediated by the ALK4SMAD2/3-SMAD4 signaling pathway (Fig. 9). Our findings provide insight into the functional role of activin A in modulating human COC expansion and ovulation. Disclosure summary The authors have nothing to disclose. Conflicts of interest The authors have nothing to disclose. Funding This work was supported by funding from the Beijing Natural Science Foundation (7152055) and the Natural Science Foundation of China (81170542, 81471431) (to X.Y.) and Beijing Municipal Administration of Hospitals Clinical Medicine Development of Special Funding Support (ZYLX201510 to C.Y. and ZYLX201830 to X.Y.). This work was also supported by a Foundation Scheme Grant (FDN-143317) from the Canadian Institutes of Health Research (to P.C.K.L.). X.Y. is the recipient of “the Health Excellent Talent Foundation of Beijing” from 11

Molecular and Cellular Endocrinology 493 (2019) 110485

C. Liu, et al.

Semin. Reprod. Med. 24, 217–227. Sahin, F.K., Sahin, S.B., Balik, G., Ural, U.M., Tekin, Y.B., Cure, M.C., Senturk, S., Yuce, S., Cure, E., 2014. Does low pentraxin-3 levels associate with polycystic ovary syndrome and obesity? Int. J. Clin. Exp. Med. 7, 3512–3519. Salustri, A., Garlanda, C., Hirsch, E., De Acetis, M., Maccagno, A., Bottazzi, B., Doni, A., Bastone, A., Mantovani, G., Beck Peccoz, P., Salvatori, G., Mahoney, D.J., Day, A.J., Siracusa, G., Romani, L., Mantovani, A., 2004. PTX3 plays a key role in the organization of the cumulus oophorus extracellular matrix and in in vivo fertilization. Development 131, 1577–1586. Santoro, N., Adel, T., Skurnick, J.H., 1999. Decreased inhibin tone and increased activin A secretion characterize reproductive aging in women. Fertil. Steril. 71, 658–662. Scarchilli, L., Camaioni, A., Bottazzi, B., Negri, V., Doni, A., Deban, L., Bastone, A., Salvatori, G., Mantovani, A., Siracusa, G., Salustri, A., 2007. PTX3 interacts with inter-alpha-trypsin inhibitor: implications for hyaluronan organization and cumulus oophorus expansion. J. Biol. Chem. 282, 30161–30170. Schwall, R.H., Mason, A.J., Wilcox, J.N., Bassett, S.G., Zeleznik, A.J., 1990. Localization of inhibin/activin subunit mRNAs within the primate ovary. Mol. Endocrinol. 4, 75–79. Sidis, Y., Fujiwara, T., Leykin, L., Isaacson, K., Toth, T., Schneyer, A.L., 1998. Characterization of inhibin/activin subunit, activin receptor, and follistatin messenger ribonucleic acid in human and mouse oocytes: evidence for activin's paracrine signaling from granulosa cells to oocytes. Biol. Reprod. 59, 807–812. Stock, A.E., Woodruff, T.K., Smith, L.C., 1997. Effects of inhibin A and activin A during in vitro maturation of bovine oocytes in hormone- and serum-free medium. Biol. Reprod. 56, 1559–1564. Teede, H., Ng, S., Hedger, M., Moran, L., 2013. Follistatin and activins in polycystic ovary syndrome: relationship to metabolic and hormonal markers. Metabolism 62, 1394–1400. Varani, S., Elvin, J.A., Yan, C., DeMayo, J., DeMayo, F.J., Horton, H.F., Byrne, M.C., Matzuk, M.M., 2002. Knockout of pentraxin 3, a downstream target of growth differentiation factor-9, causes female subfertility. Mol. Endocrinol. 16, 1154–1167. Walton, K.L., Makanji, Y., Chen, J., Wilce, M.C., Chan, K.L., Robertson, D.M., Harrison, C.A., 2010. Two distinct regions of latency-associated peptide coordinate stability of the latent transforming growth factor-beta1 complex. J. Biol. Chem. 285, 17029–17037. Wiater, E., Lewis, K.A., Donaldson, C., Vaughan, J., Bilezikjian, L., Vale, W., 2009. Endogenous betaglycan is essential for high-potency inhibin antagonism in gonadotropes. Mol. Endocrinol. 23, 1033–1042. Wijayarathna, R., de Kretser, D.M., 2016. Activins in reproductive biology and beyond. Hum. Reprod. Update 22, 342–357. Wu, Y.T., Chang, H.M., Huang, H.F., Sheng, J.Z., Leung, P.C., 2017. Bone morphogenetic protein 2 regulates cell-cell communication by down-regulating connexin43 expression in luteinized human granulosa cells. Mol. Hum. Reprod. 23, 155–165. Young, J.M., Henderson, S., Souza, C., Ludlow, H., Groome, N., McNeilly, A.S., 2012. Activin B is produced early in antral follicular development and suppresses thecal androgen production. Reproduction 143, 637–650. Yu, C., Zhang, Y.L., Fan, H.Y., 2013. Selective Smad4 knockout in ovarian preovulatory follicles results in multiple defects in ovulation. Mol. Endocrinol. 27, 966–978. Yu, P.B., Hong, C.C., Sachidanandan, C., Babitt, J.L., Deng, D.Y., Hoyng, S.A., Lin, H.Y., Bloch, K.D., Peterson, R.T., 2008. Dorsomorphin inhibits BMP signals required for embryogenesis and iron metabolism. Nat. Chem. Biol. 4, 33–41. Zheng, J., Qu, J., Lu, P., Hou, Z., Cui, Y., Mao, Y., Qi, X., Ji, H., Liu, J., 2016. Activin a stimulates aromatase via the ALK4-smad pathway in endometriosis. BioMed Res. Int. 5791510 2016.

growth factor-beta superfamily type I activin receptor-like kinase (ALK) receptors ALK4, ALK5, and ALK7. Mol. Pharmacol. 62, 65–74. Kipp, J.L., Golebiowski, A., Rodriguez, G., Demczuk, M., Kilen, S.M., Mayo, K.E., 2011. Gene expression profiling reveals Cyp26b1 to be an activin regulated gene involved in ovarian granulosa cell proliferation. Endocrinology 152, 303–312. Knight, P.G., Glister, C., 2006. TGF-beta superfamily members and ovarian follicle development. Reproduction 132, 191–206. Knight, P.G., Satchell, L., Glister, C., 2012. Intra-ovarian roles of activins and inhibins. Mol. Cell. Endocrinol. 359, 53–65. Li, H., Chang, H.M., Shi, Z., Leung, P.C.K., 2018. SNAIL mediates TGF-beta1-induced downregulation of pentraxin 3 expression in human granulosa cells. Endocrinology 159, 1644–1657. Li, R., Norman, R.J., Armstrong, D.T., Gilchrist, R.B., 2000. Oocyte-secreted factor(s) determine functional differences between bovine mural granulosa cells and cumulus cells. Biol. Reprod. 63, 839–845. Li, Y., Klausen, C., Zhu, H., Leung, P.C., 2015. Activin a increases human trophoblast invasion by inducing SNAIL-mediated MMP2 up-regulation through ALK4. J. Clin. Endocrinol. Metab. 100, E1415–E1427. Lie, B.L., Leung, E., Leung, P.C., Auersperg, N., 1996. Long-term growth and steroidogenic potential of human granulosa-lutein cells immortalized with SV40 large T antigen. Mol. Cell. Endocrinol. 120, 169–176. Lin, S.J., Lerch, T.F., Cook, R.W., Jardetzky, T.S., Woodruff, T.K., 2006. The structural basis of TGF-beta, bone morphogenetic protein, and activin ligand binding. Reproduction 132, 179–190. Liu, P.P., Chang, H.M., Cheng, J.C., Leung, P.C., 2016. Activin A upregulates PTGS2 expression and increases PGE2 production in human granulosa-lutein cells. Reproduction 152, 655–664. Marino, F.E., Risbridger, G., Gold, E., 2014. The inhibin/activin signalling pathway in human gonadal and adrenal cancers. Mol. Hum. Reprod. 20, 1223–1237. Miyazono, K., Kamiya, Y., Morikawa, M., 2010. Bone morphogenetic protein receptors and signal transduction. J. Biochem. 147, 35–51. Miyazono, K., Kusanagi, K., Inoue, H., 2001. Divergence and convergence of TGF-beta/ BMP signaling. J. Cell. Physiol. 187, 265–276. Norman, R.J., Milner, C.R., Groome, N.P., Robertson, D.M., 2001. Circulating follistatin concentrations are higher and activin concentrations are lower in polycystic ovarian syndrome. Human reproduction 16, 668–672. Olsen, O.E., Wader, K.F., Hella, H., Mylin, A.K., Turesson, I., Nesthus, I., Waage, A., Sundan, A., Holien, T., 2015. Activin A inhibits BMP-signaling by binding ACVR2A and ACVR2B. Cell Commun. Signal. : CCS 13, 27. Pande, H.O., Tesfaye, D., Hoelker, M., Gebremedhn, S., Held, E., Neuhoff, C., Tholen, E., Schellander, K., Wondim, D.S., 2018. MicroRNA-424/503 cluster members regulate bovine granulosa cell proliferation and cell cycle progression by targeting SMAD7 gene through activin signalling pathway. J. Ovarian Res. 11, 34. Pangas, S.A., Jorgez, C.J., Tran, M., Agno, J., Li, X., Brown, C.W., Kumar, T.R., Matzuk, M.M., 2007. Intraovarian activins are required for female fertility. Mol. Endocrinol. 21, 2458–2471. Pangas, S.A., Li, X., Robertson, E.J., Matzuk, M.M., 2006. Premature luteinization and cumulus cell defects in ovarian-specific Smad4 knockout mice. Mol. Endocrinol. 20, 1406–1422. Rabinovici, J., Spencer, S.J., Jaffe, R.B., 1990. Recombinant human activin-A promotes proliferation of human luteinized preovulatory granulosa cells in vitro. J. Clin. Endocrinol. Metab. 71, 1396–1398. Richards, J.S., Russell, D.L., Ochsner, S., Espey, L.L., 2002. Ovulation: new dimensions and new regulators of the inflammatory-like response. Annu. Rev. Physiol. 64, 69–92. Russell, D.L., Salustri, A., 2006. Extracellular matrix of the cumulus-oocyte complex.

12