- Email: [email protected]
ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia Yinghui Chao a, Jin Shang b, *, Weidong Ji a, ** a b
Center for Translational Medicine, The First Affiliated Hospital, Sun Yat-sen University, Guangzhou, 510080, China Department of Respiratory and Critical Care Medicine, Tongji Hospital, Huazhong University of Science and Technology, Wuhan, 430030, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 6 October 2019 Accepted 21 October 2019 Available online xxx
Obstructive sleep apnea (OSA) is closely associated with cancer progression and cancer-related mortality. N6-methyladenosine (m6A) is involved in the process of intermittent hypoxia (IH) promoting tumor progression. However, it is unclear how m6A regulates the development of lung adenocarcinoma under IH. In this study, we found that ALKBH5 was elevated in lung adenocarcinoma cells and subcutaneous tumors in mice under IH, which was associated with decreased m6A levels in these cells and tissues. Next, we knocked out ALKBH5 in a human lung adenocarcinoma cell line under IH, and we found that the proliferation and invasion of these cells were significantly inhibited. Mechanistic analysis showed that under IH, knockout of ALKBH5 in lung adenocarcinoma cells upregulated the level of m6A in Forkhead box M1 (FOXM1) mRNA and decreased the translation efficiency of FOXM1 mRNA, resulting in downregulation of the FOXM1 protein. The FOXM1 protein is elevated in lung adenocarcinoma cells and subcutaneous tumor tissues of mice under IH. By knocking out FOXM1 in lung adenocarcinoma cells under IH, proliferation and invasion of these cells were inhibited, and overexpression of FOXM1 partially restored the inhibition of growth and invasion of lung adenocarcinoma cells due to ALKBH5 knockout. Collectively, our findings demonstrate that the m6A demethylase ALKBH5 affects the proliferation and invasion of lung adenocarcinoma cells under IH by downregulating m6A modification on FOXM1 mRNA and by promoting FOXM1 expression. © 2019 Elsevier Inc. All rights reserved.
Keywords: m6A ALKBH5 FOXM1 Oncogene Lung cancer Intermittent hypoxia
1. Introduction Obstructive sleep apnea (OSA) is a common disorder, present in 2% of women and 4% of men in the population [1]. Currently, epidemiological studies have shown that cancer progression and cancer-related mortality in OSA patients are accelerating [2,3]. Studies have found that the initiation of carcinogenesis in lung adenocarcinoma cells is closely related to epigenetic modification disorder [4], and some studies have also found that epigenetic genes participate in the process of IH to promote the development of lung adenocarcinoma [5]. Therefore, this is necessary to study the epigenetic mechanisms of IH that promote the development of lung adenocarcinoma and to reveal the key epigenetic regulatory targets of lung adenocarcinoma in OSA patients.
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (J. Shang), [email protected]. edu.cn (W. Ji).
The study of RNA modifications is a nascent field as yet, and the significance of these marks in controlling cell growth and differentiation is just beginning to be appreciated [4]. The m6A modification is associated with tumors, metabolism, synaptic signals, biological clock rhythm, early embryo development, stem cell selfregeneration and differentiation [6]. m6A is modified by ’readers’ (HNRNPC, HNRNPA2B1, YTHDF2, YTHDF1, and eIF3), ’writers’ (methyltransferase enzymes: METTL3, METTL14, WTAP, and KIAA1429) and ’erasers’ (demethylases: FTO/ALKBH9 and ALKBH5). In addition to METTL3 and FTO, which have been studied in recent years, ALKBH5 also plays an important role in the catalysis of mRNA [7,8]. One study indicate that ALKBH5 acts on certain mRNAs and participates in demethylation modifications, including the transcription factor Forkhead box M1 (FOXM1) [9]. FOXM1 has been demonstrated as a tumor inducer due to its function in the proliferation, invasion and chemoresistance of lung cancer [10e12]. The study found that ALKBH5 is highly expressed in lung cancer cells [13]. ALKBH5 maintains the proliferation and malignancy of glioblastoma by mediating m6A demethylation of FOXM1 mRNA [9]. Therefore, the transcriptional regulation of the demethylase
https://doi.org/10.1016/j.bbrc.2019.10.145 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: Y. Chao et al., ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.145
2
Y. Chao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
ALKBH5 in lung cancer under IH remains to be further explored. In this experiment, we found that IH promotes the expression of ALKBH5 in lung adenocarcinoma. ALKBH5 affects the proliferation and invasion of lung adenocarcinoma cells by downregulating the m6A modification on FOXM1 mRNA. 2. Materials and methods 2.1. Cell culture The human lung cancer cell lines A549 and HCIeH522 were obtained from ATCC. The cells were cultured in high glucosecontaining DMEM (Gibco). The media were supplemented with 10% fetal bovine serum (Gibco, USA). All cells were cultured at 37 C under a humidified atmosphere. Cells were exposed to either normoxia (21% O2, 5% CO2, and balanced N2) or IH (64 cycles of 5 min sustained hypoxia [1% O2, 5% CO2, and balanced N2] and 10 min normoxia) using a incubation chamber attached to an external O2eCO2eN2 computer-driven controller (O2 programmable control, 9200EX, Wakenyaku Co., Ltd, Kyoto, Japan), as described in a previous report [14]. A549 and HCIeH522 cells in normoxia are referred to as N-A549 cells and NeHCIeH522 cells, respectively. A549 and HCIeH522 cells in intermittent hypoxia were referred to as IH-A549 cells and IH-HCI-H522 cells, respectively. 2.2. RNA isolation and quantitative real-time PCR RNA was extracted with TRIzol (Life Technologies) following the manufacturer’s protocol. cDNA was generated using the transScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (Transgen). Quantitative real-time PCR using Fast SYBR Green PCR Master Mix (Applied Biosystems) was performed on a Step-One Fast Real-time PCR System (Applied Biosystems). For RNA stability assay, the cells were plated in a 6-cm dish and incubated with actinomycin D (Santa Cruz) at 5 mg/ml for indicated time points. The primers used in this study were listed below. ALKBH5 forward: 5ˊ-CGGCGAAGGCTACACTTACG-3ˊ. ALKBH5 reverse: 5ˊ-CCACCAGCTTTTGGATCACCA-3ˊ. GAPDH forward: 5ˊ-ACAACTTTGGTATCGTGGAAGG-3ˊ. GAPDH reverse: 5ˊ-GCCATCACGCCACAGTTTC-3ˊ. FOXM1 forward: 5ˊ-GGAGCAGCGACAGGT TA AGG-3ˊ. FOXM1 reverse: 5ˊ-GTTGATGGCGAATTGTATCATGG-3ˊ. 2.3. Immunoblotting (western blot) RIPA buffer was used for total protein extraction. The protein concentration was measured by the BCA Protein Quantitation Assay Kit (Takara). A total of 40 mg of protein per sample was subjected to SDS-PAGE separation and transferred onto PVDF membranes. The membranes were blocked for 1 h with 5% bovine serum albumin (BSA) (Sigma-Aldrich) in Tris-buffered saline containing 0.1% Tween 20 and then incubated overnight at 4 C with anti-ALKBH5 antibodies (Abcam, ab69325), anti-FOXM1 antibodies (Abcam, ab180710) and anti-GAPDH antibodies (Abcam, ab 181602). The membranes were washed for 30 min with Tris-buffered saline containing 0.1% Tween 20 and incubated for 1 h with the appropriate secondary antibodies. After the samples were washed with TBST for 30 min, the targeted proteins were detected with chemiluminescent substrates. 2.4. Establishment of animal models The animal model was established according to a previously described protocol [15]. Briefly, 1 107 A549 cells were subcutaneously implanted into 4-week-old NOD/SCID mice (Weitong Lihua Experimental Animal Technology Co., Ltd). Then, the mice were
exposed to IH for 6 h/day for 28 consecutive days in a specialized plexiglass chamber. The flow of nitrogen (99.99% N2, hypoxic phase) or compressed air (air, reoxygenation phase) was modulated in the chamber to maintain a nadir oxygen concentration of 5% and an IH cycle. The alternating cycle lasted for 2 min and consisted of the hypoxic and reoxygenation phases. Mice exposed to the normoxia condition were used as the control group. Tumor volume was calculated as follows: Tumor volume ¼ LengthWidth20.52. Tumor weight was quantified at the end of the experiment. 2.5. Lentivirus packaging For virus transduction, 293T cells were transfected with the appropriate lentiviral vector according to the Lipofectamine® 3000 reagent (Invitrogen) protocol. Lentiviral vectors expressing sgRNAs targeting ALKBH5 and FOXM1 were generated according to the lentiCRISPRv2 protocol (Addgene plasmid # 52961). The lentiviral vectors were cotransfected with packaging vectors (Addgene) into 293T cells. FOXM1 expression plasmids were generated by cloning the full-length ORF of human FOXM1 (NM_ 202002.3) into the LentiORF PLEX vector. The LentiORF PLEX-MCS vector was used for overexpression, with the target plasmid and the packaging plasmids pCMV-dR8.2-dvpr and PLP-VSVG at a 1:1:0.5 ratio, respectively. To establish stable cell lines, target cells were transduced using the above lentiviruses with polybrene. The sequences of sgRNAs and cloning primers are listed below. ALKBH5 sgRNA oligo1: CACCGAGGGACTTTGTTTCCAACCG. ALKBH5 sgRNA oligo2: AAACCGGTTGGAAACAAAGTCCCTC. FOXM1 sgRNA oligo1: CACCGCCATACTAACGTGCGCCCAGGGG. FOXM1 sgRNA oligo2: AAACCCCCTGGGCGCACGTTAGTATGGC. FOXM1-CDS forward: CGCGGATCCATGAAAACTAGCCCCCGTCG. FOXM1-CDS reverse: CGACGCGTCTACTGTAGCTCAGGAATAAA CTGG. 2.6. Proliferation assay A total of 5000 cells were seeded into five 96-well plates and incubated at 37 C in a humidified atmosphere. The cells were exposed to IH for different time intervals. Cellular proliferation was measured with CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) (Promega). After cultivation, 20 ml of MTS solution was added into each well at different time points and then the plates were incubated for 2 h. Finally, the absorbance at 490 nm was recorded by the SYNERGY microplate reader (BioTEK). 2.7. Transwell™ invasion assay Cell invasion assays were performed in 24-well Transwell™ (Costar) plates. The upper chamber surface of the filter was coated with Matrigel (Corning). The cells were prepared (1 105 cells/ 200 ml) with serum-free DMEM and loaded into the upper chamber. DMEM containing 20% FBS was added to the bottom chamber. After the cells were exposed to IH for 24 h, wet cotton was used to remove the noninvading cells. The cells were fixed with carbinol, stained with 0.1% crystal violet and quantified in several independent areas under the ZEISS Axio Imager. Z2 Microscope. 2.8. m6A content analysis and Me-RIP assay The content of m6A in total RNA was analyzed with the m6A RNA Methylation Assay Kit (Abcam, ab185912). Methylated m6A RNA immunoprecipitation (Me-RIP) was performed according to the reported protocol using an anti-m6A antibody (Abcam, ab151230) [16]. qPCR analysis of the methylated RNA was performed to detect methylated FOXM1 mRNA levels.
Please cite this article as: Y. Chao et al., ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.145
Y. Chao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
2.9. Sucrose gradient centrifugation and polysome fractionation Sucrose gradient centrifugation and polysome fractionation were performed as previously described [17]. Briefly, cell lines for polysome fractionation were first lysed using polysome cell extraction buffer (50 mM MOPS, 15 mM MgCl2, 150 mM NaCl, 100 mg/ml cycloheximide, 0.5% Triton X-100, 1 mg/ml heparin, 200 U RNaseOUT, 2 mM PMSF, and 1 mM benzamine). Next, cellular debris were cleared by centrifugation at 13,000g for 10 min at 4 C. Extracts were loaded on a 10e50% sucrose gradient and centrifuged at 36,000 rpm for 2.5 h at 4 C in an SW 41 Ti rotor (Beckman Coulter). Then, the RNA in the polysome fraction was extracted and subjected to real-time PCR. 2.10. Quantification and statistical analysis Data are presented as the mean ± standard error of the means (SEMs), or standard deviations (SDs). Statistical analyses were performed in GraphPad Prism 6 (GraphPad Software Inc.) using unpaired 2-tailed Student’s t-test to compare differences between 2 groups. One-way ANOVA was used to compare more than two groups. P values less than 0.05 were considered statistically significant. 2.11. Ethics statement The animal study was reviewed and approved by the Institutional Ethics Committee for Clinical Research and Animal Trials of the First Affiliated Hospital of Sun Yat-sen University [(2016)067], and written informed consent was obtained from all participants or their appropriate surrogates. 3. Results 3.1. IH promotes ALKBH5 expression in lung adenocarcinoma cells To explore the potential effect of IH on the expression of ALKBH5 in lung adenocarcinoma, we analyzed the expression of ALKBH5 in lung adenocarcinoma cells under IH and normoxia. The results showed that the mRNA and protein levels of ALKBH5 were significantly upregulated in IH-549 and IH-NCI-H566 cells compared to that in control cells (Fig. 1A and B). In addition, we constructed a tumor model of immunodeficient mice under IH and normoxia using A549 cells. We found that subcutaneous tumors were significantly greater and heavier under IH than under normoxia (Fig. 1C). ALKBH5 mRNA and protein levels were significantly higher in tumor tissues under IH than in tumor tissues under normoxia (Fig. 1D and E). We also examined the level of methylated RNA (m6A) in the abovementioned cells and subcutaneous tumor tissues, and we found that m6A in lung adenocarcinoma cells and subcutaneous tumor tissues under IH decreased (Fig. 1F and G). Therefore, these findings indicate that IH upregulates ALKBH5 expression in lung adenocarcinoma cells. 3.2. ALKBH5 knockout represses the growth and invasion of lung adenocarcinoma cells under IH To investigate the role of ALKBH5 in lung adenocarcinoma cells under IH, we constructed a stable cell line with ALKBH5 knocked out using IH-A549 and IH-NCI-H566 cells. (Fig. 2A and B). We then analyzed the changes in the function of IH-A549 and IH-NCIH566 cells after knocking out ALKBH5. The results showed that after knocking out ALKBH5 in IH-A549 and IH-NCI-H566 cells, proliferation and invasion were significantly reduced in knockout cells compared with those in control cells (Fig. 2C, D, E and F). In the
3
above experiments, we found that compared to normoxic conditions, IH conditions promoted accelerated tumor growth including tumor weight and tumor volume in mice. This is consistent with the inhibition of cell proliferation after knocking out ALKBH5 in IHA549 and IH-NCI-H566 cells. Taken together, these findings demonstrated that ALKBH5 knockout inhibited the growth and invasion of lung adenocarcinoma cells under IH.
3.3. m6A demethylase ALKBH5 regulates FOXM1 mRNA modification and translation We analyzed whether the regulation of the m6A modification on FOXM1 mRNA by ALKBH5 is involved in the development of lung adenocarcinoma under IH. The results showed that the protein levels of FOXM1 in IH-A549 and IH-NCI-H566 cells and subcutaneous tumor tissues under IH were significantly higher than that in the control group, which was similar to the change in the ALKBH5 protein (Fig. 3B and D). However, there was no statistical change in the FOXM1 mRNA levels (Fig. 3A and C). Next, we analyzed the expression of FOXM1 in the previously constructed stable cell lines. The results showed that after knocking out ALKBH5, the FOXM1 protein in IH-A549 and IH-NCI-H566 cells decreased (Fig. 3E and F), but the FOXM1 mRNA did not change statistically (Fig. 3G). We also studied the stability of FOXM1 mRNA in cells and found that knocking out ALKBH5 did not affect the stability of FOXM1 mRNA (Fig. 3H and I). We then compared the polysome-bound (translationally active) FOXM1 mRNA levels in ALKBH5 knockout cells and in control cells under IH. The results showed that the FOXM1 mRNA binding to polysomes was significantly decreased in ALKBH5-knockout IH-A549 and IH-NCIH566 cells compared to that in control cells (Fig. 3J and K). The results suggested that ALKBH5 enhances the proportion of FOXM1 mRNAs undergoing active translation in IH-A549 and IH-NCIH566 cells. We further compared the m6A levels of FOXM1 mRNA in cells, subcutaneous tumor tissues and control groups. The results showed that the m6A level of FOXM1 mRNA in IH-A549 and IH-NCIH566 cells and subcutaneous tumor tissues under IH decreased (Fig. 3L), and the m6A level of FOXM1 mRNA increased in IH-A549 and IH-NCI-H566 cells after knocking out ALKBH5 (Fig. 3M). These results indicate that ALKBH5 can demethylate FOXM1 mRNA. Overall, our data show that ALKBH5 promotes FOXM1 mRNA translation by reducing the m6A level of FOXM1 mRNA under IH, ultimately increasing the FOXM1 protein levels.
3.4. FOXM1 regulates the growth and invasion of lung adenocarcinoma cells under IH Finally, we analyzed the role of FOXM1 in lung adenocarcinoma cells under IH. We first constructed stable cell lines that knocked out FOXM1 using IH-A549 and IH-NCI-H566 cells (Fig. 4A and B). The results showed that when FOXM1 was knocked out in IH-A549 and IH-NCI-H566 cells, the proliferation and invasion of the cells were inhibited (Fig. 4C, D, E and F). The results showed that FOXM1 is involved in the regulation of the growth and invasion of lung adenocarcinoma cells under IH. To further determine whether FOXM1 is a direct effector of ALKBH5 in the development of lung adenocarcinoma under IH, we performed a rescue experiment by overexpressing FOXM1 in ALKBH5-depleted cells in which FOXM1 was downregulated (Fig. 4G). The results indicated that the forced expression of FOXM1 partially reversed the effect of ALKBH5depletion on the proliferation and invasion of IH-A549 cells (Fig. 4H and I). Taken together, these data indicate that FOXM1 is a pivotal target for ALKBH5 in lung adenocarcinoma under IH.
Please cite this article as: Y. Chao et al., ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.145
4
Y. Chao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 1. Expression of ALKBH5 in lung adenocarcinoma cells under IH. (A) IH increased ALKBH5 mRNA in A549 and NCIeH566 cells. (B) ALKBH5 protein in IH-A549 and IH-NCIH566 cells was upregulated compared to that in control cells. (C) Subcutaneous tumor model of A549 cells under IH and normoxia. Tumor images, growth curves and weights are shown. Subcutaneous tumors under IH are greater and heavier than those in normoxic conditions (n ¼ 6). (D-E) The results showed that ALKBH5 mRNA and protein levels were elevated in subcutaneous tumor tissues under IH. (F-G) The m6A content of total RNA in IH-A549 cells, IH-NCI-H566 cells and subcutaneous tumor tissues under IH decreased compared with that under normoxia. **p < 0.01, ***p < 0.001.
4. Discussion The effect of m6A modification on disease progression depends on its impact on mRNA metabolism and the cellular mRNA levels [18]. Previous studies showed that the m6A demethylase FTO promotes the growth of lung cancer cells by regulating the m6A levels of USP7 and MZF1 mRNA [19,20]. Similarly, our studies in the field of OSA reported the participation of the other demethylase ALKBH5 in the pathogenesis of lung cancer under IH. In the context of OSA, recent studies indicate that IH can also facilitate lung adenocarcinoma aggressiveness through the product of oxidative stressdHIFs [15]. Under IH conditions, cancer cells initiate a signaling pathway that triggers upregulation of the corresponding gene to adapt to the environment. ALKBH5, belonging
to the AlkB family of nonheme Fe(II)/a-ketoglutarate-dependent dioxygenases [8], is a hypoxia-inducible gene regulated by HIFs [21,22]. ALKBH5 is highly expressed in malignant tumors and plays an important role in tumor cell proliferation, invasion and migration [13,23,24]. HIF-dependent ALKBH5 expression mediates the enrichment of breast cancer stem cells in the hypoxic tumor microenvironment [22]. In our experiments under IH conditions, (1) the expression of ALKBH5 in lung adenocarcinoma cells and subcutaneous tumor tissues of mice increased, which was consistent with the decrease in the total m6A levels of RNA in adenocarcinoma cells and subcutaneous tumor tissues; (2) subcutaneous tumors grew faster, tumor volume larger, may be related to the rise of ALKBH5; (3) the proliferation and invasion of lung adenocarcinoma cells after ALKBH5 knockout are significantly inhibited,
Please cite this article as: Y. Chao et al., ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.145
Y. Chao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 2. ALKBH5 knockout inhibits the growth of lung adenocarcinoma cells under IH. (A-B) Protein levels of ALKBH5 with a specified sgRNA in lentivirus-infected IH-A549 and IH-NCI-H566 cells. (C-D) ALKBH5 knockout resulted in decreased proliferation of IH-A549 and IH-NCI-H566 cells. (E-F) Knockout of ALKBH5 inhibited the invasion of IH-A549 and IH-NCI-H566 cells. **p < 0.01, ***p < 0.001.
Please cite this article as: Y. Chao et al., ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.145
6
Y. Chao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 3. ALKBH5 regulates FOXM1 mRNA m6A modification and translation. (A) There were no significant differences in FOXM1 mRNA between lung adenocarcinoma cells under IH and normoxia. (B) The FOXM1 protein of IH-A549 and IH-NCI-H566 cells increased significantly. (C) There was no significant difference in FOXM1 mRNA in subcutaneous tumor tissues between IH and normoxia. (D) The FOXM1 protein in the subcutaneous tumor tissue under IH increased significantly. (E-F) Knockout of ALKBH5 in IH-A549 and IH-NCIH566 cells, resulted in downregulation of the FOXM1 protein in cells. (G) IH-A549 and IH-NCI-H566 cells had ALKBH5 knocked out, and there was no significant change in the FOXM1 mRNA levels in these cells. (HeI) IH-A549 and IH-NCI-H566 cells had ALKBH5 knocked out, and there was no significant change in the FOXM1 mRNA stability in these cells. (J-K) IH-A549 and IH-NCI-H566 cells had ALKBH5 knocked out, resulting in downregulation of FOXM1 mRNA abundance in polysome fractions. (L) IH reduced methylated FOXM1 mRNA in A549 cells, NCIeH566 cells and subcutaneous tumor tissues. (M). Knockout of ALKBH5 in IH-A549 and IH-NCI-H566 cells resulted in upregulation of methylated FOXM1 mRNA in cells. **p < 0.01, ***p < 0.001.
indicating that ALKBH5 is closely related to the progression of lung adenocarcinoma under IH. Additional studies are needed to define whether HIFs or other potential regulators stimulate ALKBH5 expression in lung cancer under IH exposure. Structural studies of ALKBH5 have revealed a region that binds to dsDNA, and a loss of ALKBH5 impairs mRNA export and assembly of mRNA processing factors in nuclear speckles [25e27]. ALKBH5 knockout mice are viable but show compromised spermatogenesis due to significantly altered expression of key genes required for spermatogenic maturation [8]. These studies suggest that ALKBH5 is deeply involved in RNA stability, splicing, subcellular localization,
and translation efficiency. We further revealed that ALKBH5 can demethylate FOXM1 transcripts without altering the mRNA stability and amount, but by promoting the translation of FOXM1 mRNA to lead to enhanced FOXM1 protein levels, which mediates the pro-oncogenic roles of IH in lung cancer. This is similar to our previous report that knocking out ALKBH5 from bladder epithelial cells does not affect the amount and stability of downstream genes, but it affects the translation efficiency of downstream genes [17]. FOXM1 has been reported to play an important role in cell proliferation, cell cycle, cell differentiation, angiogenesis and metastasis [28,29]. Previous studies have shown that FOXM1 is
Please cite this article as: Y. Chao et al., ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.145
Y. Chao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
7
Fig. 4. Knocking out FOXM1 in lung adenocarcinoma cells under IH reduces the proliferation and invasion of these cells. (A-B) Protein levels of FOXM1 with a specified sgRNA in lentivirus-infected IH-A549 and IH-NCI-H566 cells. (CeF) IH-A549 and IH-NCI-H566 cells had FOXM1 knocked out, resulting in significant inhibition of cell proliferation and invasion. (G) Lentivirus-mediated overexpression of FOXM1 in IH-A549 cells with ALKBH5 knocked out. (HeI) FOXM1 partially restored the cell proliferation and invasion capacities in IH-A549 cells, which were reduced by ALKBH5 knockout. **p < 0.01, ***p < 0.001.
upregulated in human malignancies, suggesting a poor prognosis [12,30]. It was reported that FOXM1 expression and its related pathway in non-small cell lung cancer are critical for carcinoma progression [10,11]. Additionally, in patients with advanced nonsmall-cell lung cancer, high FOXM1 expression was associated with cisplatin-based chemotherapy resistance and poor prognosis, suggesting the vital role of FOXM1 in the development and progression of non-small-cell lung cancer [12]. ALKBH5 enhanced FOXM1 expression by demethylating FOXM1 transcripts and maintained the tumorigenicity of glioblastoma stem-like cells [9]. In our study under IH, the expression levels of FOXM1 were upregulated in lung adenocarcinoma and were associated with proliferation and invasion as determined by ALKBH5 demethylation regulation. Importantly, FOXM1 was also reported to be transcriptionally upregulated due to HIF-1a signaling activation. We speculate that the increased expression of HIFs in response to IH exposure may be the reason for the upregulated demethylase ALKBH5-FOXM1 pathway in lung adenocarcinoma. In conclusion, m6A modifications are critically implicated in the development and progression of lung cancer under IH. The increased tumor malignancy properties associated with IH appear to be mediated, at least in part, by the upregulated demethylase ALKBH5-FOXM1 pathway in lung adenocarcinoma cells. Our
findings provide effective benefits in the treatment of lung tumors whose organ properties make them more susceptible to regional hypoxic cycles, as well as in the context of cancer patients suffering from OSA. Declaration of competing interest The authors declare that they have no conflict of interest. References [1] Y.Q. Zhen, Y.M. Wu, Y.H. Sang, et al., 2,3-Oxidosqualene cyclase protects liver cells from the injury of intermittent hypoxia by regulating lipid metabolism, Sleep Breath. 19 (2015) 1475e1481. [2] F. Campos-Rodriguez, M.A. Martinez-Garcia, M. Martinez, et al., Association between obstructive sleep apnea and cancer incidence in a large multicenter Spanish cohort, Am. J. Respir. Crit. Care Med. 187 (2013) 99e105. [3] M.A. Martínez-García, F. Campos-Rodriguez, J. Dur an-Cantolla, et al., Obstructive sleep apnea is associated with cancer mortality in younger patients, Sleep Med. 15 (2014) 742e748. [4] I. Lokody, Gene regulation: RNA methylation regulates the circadian clock, Nat. Rev. Genet. 15 (2014) 3. [5] R. Cortese, I. Almendros, Y. Wang, D. Gozal, Tumor circulating DNA profiling in xenografted mice exposed to intermittent hypoxia, Oncotarget 6 (2015) 556e569. [6] T. Pan, N6-methyl-adenosine modification in messenger and long non-coding RNA, Trends Biochem. Sci. 38 (2013) 204e209.
Please cite this article as: Y. Chao et al., ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.145
8
Y. Chao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
[7] C. Xu, K. Liu, W. Tempel, et al., Structures of human ALKBH5 demethylase reveal a unique binding mode for specific single-stranded N6methyladenosine RNA demethylation, J. Biol. Chem. 289 (2014) 17299e17311. [8] G. Zheng, J.A. Dahl, Y. Niu, et al., ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility, Mol. Cell 49 (2013) 18e29. [9] S. Zhang, B.S. Zhao, A. Zhou, et al., m(6)A demethylase ALKBH5 maintains tumorigenicity of glioblastoma stem-like cells by sustaining FOXM1 expression and cell proliferation program, Cancer Cell 31 (2017) 591e606 e6. [10] Z. Cheng, C. Yu, S. Cui, et al., circTP63 functions as a ceRNA to promote lung squamous cell carcinoma progression by upregulating FOXM1, Nat. Commun. 10 (2019) 3200. [11] L. Zhao, L. Liu, Z. Dong, J. Xiong, miR-149 suppresses human non-small cell lung cancer growth and metastasis by inhibiting the FOXM1/cyclin D1/MMP2 axis, Oncol. Rep. 38 (2017) 3522e3530. [12] Y. Wang, L. Wen, S.H. Zhao, Z.H. Ai, J.Z. Guo, W.C. Liu, FOXM1 expression is significantly associated with cisplatin-based chemotherapy resistance and poor prognosis in advanced non-small cell lung cancer patients, Lung Cancer 79 (2013) 173e179. [13] J. Guo, Y. Wu, J. Du, et al., Deregulation of UBE2C-mediated autophagy repression aggravates NSCLC progression, Oncogenesis 7 (2018) 49. [14] H. Ota, S. Tamaki, A. Itaya-Hironaka, et al., Attenuation of glucose-induced insulin secretion by intermittent hypoxia via down-regulation of CD38, Life Sci. 90 (2012) 206e211. [15] L. Li, F. Ren, C. Qi, et al., Intermittent hypoxia promotes melanoma lung metastasis via oxidative stress and inflammation responses in a mouse model of obstructive sleep apnea, Respir. Res. 19 (2018) 28. [16] G. Lichinchi, S. Gao, Y. Saletore, et al., Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells, Nat Microbiol 1 (2016) 16011. [17] H. Jin, X. Ying, B. Que, et al., N(6)-methyladenosine modification of ITGA6 mRNA promotes the development and progression of bladder cancer, EBioMedicine 47 (2019) 195e207. [18] G. Cao, H.B. Li, Z. Yin, R.A. Flavell, Recent advances in dynamic m6A RNA modification, Open Biol 6 (2016) 160003.
[19] J. Li, Y. Han, H. Zhang, et al., The m6A demethylase FTO promotes the growth of lung cancer cells by regulating the m6A level of USP7 mRNA, Biochem. Biophys. Res. Commun. 512 (2019) 479e485. [20] J. Liu, D. Ren, Z. Du, H. Wang, H. Zhang, Y. Jin, m(6)A demethylase FTO facilitates tumor progression in lung squamous cell carcinoma by regulating MZF1 expression, Biochem. Biophys. Res. Commun. 502 (2018) 456e464. [21] A. Thalhammer, Z. Bencokova, R. Poole, et al., Human AlkB homologue 5 is a nuclear 2-oxoglutarate dependent oxygenase and a direct target of hypoxiainducible factor 1alpha (HIF-1alpha), PLoS One 6 (2011), e16210. [22] C. Zhang, D. Samanta, H. Lu, et al., Hypoxia induces the breast cancer stem cell phenotype by HIF-dependent and ALKBH5-mediated m(6)A-demethylation of NANOG mRNA, Proc. Natl. Acad. Sci. U. S. A. 113 (2016) E2047eE2056. [23] K. Koike, Y. Ueda, H. Hase, et al., anti-tumor effect of AlkB homolog 3 knockdown in hormone- independent prostate cancer cells, Curr. Cancer Drug Targets 12 (2012) 847e856. [24] J. Zhang, S. Guo, H.Y. Piao, et al., ALKBH5 promotes invasion and metastasis of gastric cancer by decreasing methylation of the lncRNA NEAT1, J. Physiol. Biochem. 75 (2019) 379e389. [25] W. Aik, J.S. Scotti, H. Choi, et al., Structure of human RNA N(6)-methyladenine demethylase ALKBH5 provides insights into its mechanisms of nucleic acid recognition and demethylation, Nucleic Acids Res. 42 (2014) 4741e4754. [26] C. Feng, Y. Liu, G. Wang, et al., Crystal structures of the human RNA demethylase Alkbh5 reveal basis for substrate recognition, J. Biol. Chem. 289 (2014) 11571e11583. [27] B. Molinie, J. Wang, K.S. Lim, et al., m(6)A-LAIC-seq reveals the census and complexity of the m(6)A epitranscriptome, Nat. Methods 13 (2016) 692e698. [28] G.B. Liao, X.Z. Li, S. Zeng, et al., Regulation of the master regulator FOXM1 in cancer, Cell Commun. Signal. 16 (2018) 57. [29] D. Nandi, P.S. Cheema, N. Jaiswal, A. Nag, FOXM1: repurposing an oncogene as a biomarker, Semin. Cancer Biol. 52 (2018) 74e84. [30] M.Y. Kim, A.R. Jung, G.E. Kim, et al., High FOXM1 expression is a prognostic marker for poor clinical outcomes in prostate cancer, J. Cancer 10 (2019) 749e756.
Please cite this article as: Y. Chao et al., ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.145
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia Yinghui Chao a, Jin Shang b, *, Weidong Ji a, ** a b
Center for Translational Medicine, The First Affiliated Hospital, Sun Yat-sen University, Guangzhou, 510080, China Department of Respiratory and Critical Care Medicine, Tongji Hospital, Huazhong University of Science and Technology, Wuhan, 430030, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 6 October 2019 Accepted 21 October 2019 Available online xxx
Obstructive sleep apnea (OSA) is closely associated with cancer progression and cancer-related mortality. N6-methyladenosine (m6A) is involved in the process of intermittent hypoxia (IH) promoting tumor progression. However, it is unclear how m6A regulates the development of lung adenocarcinoma under IH. In this study, we found that ALKBH5 was elevated in lung adenocarcinoma cells and subcutaneous tumors in mice under IH, which was associated with decreased m6A levels in these cells and tissues. Next, we knocked out ALKBH5 in a human lung adenocarcinoma cell line under IH, and we found that the proliferation and invasion of these cells were significantly inhibited. Mechanistic analysis showed that under IH, knockout of ALKBH5 in lung adenocarcinoma cells upregulated the level of m6A in Forkhead box M1 (FOXM1) mRNA and decreased the translation efficiency of FOXM1 mRNA, resulting in downregulation of the FOXM1 protein. The FOXM1 protein is elevated in lung adenocarcinoma cells and subcutaneous tumor tissues of mice under IH. By knocking out FOXM1 in lung adenocarcinoma cells under IH, proliferation and invasion of these cells were inhibited, and overexpression of FOXM1 partially restored the inhibition of growth and invasion of lung adenocarcinoma cells due to ALKBH5 knockout. Collectively, our findings demonstrate that the m6A demethylase ALKBH5 affects the proliferation and invasion of lung adenocarcinoma cells under IH by downregulating m6A modification on FOXM1 mRNA and by promoting FOXM1 expression. © 2019 Elsevier Inc. All rights reserved.
Keywords: m6A ALKBH5 FOXM1 Oncogene Lung cancer Intermittent hypoxia
1. Introduction Obstructive sleep apnea (OSA) is a common disorder, present in 2% of women and 4% of men in the population [1]. Currently, epidemiological studies have shown that cancer progression and cancer-related mortality in OSA patients are accelerating [2,3]. Studies have found that the initiation of carcinogenesis in lung adenocarcinoma cells is closely related to epigenetic modification disorder [4], and some studies have also found that epigenetic genes participate in the process of IH to promote the development of lung adenocarcinoma [5]. Therefore, this is necessary to study the epigenetic mechanisms of IH that promote the development of lung adenocarcinoma and to reveal the key epigenetic regulatory targets of lung adenocarcinoma in OSA patients.
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (J. Shang), [email protected]. edu.cn (W. Ji).
The study of RNA modifications is a nascent field as yet, and the significance of these marks in controlling cell growth and differentiation is just beginning to be appreciated [4]. The m6A modification is associated with tumors, metabolism, synaptic signals, biological clock rhythm, early embryo development, stem cell selfregeneration and differentiation [6]. m6A is modified by ’readers’ (HNRNPC, HNRNPA2B1, YTHDF2, YTHDF1, and eIF3), ’writers’ (methyltransferase enzymes: METTL3, METTL14, WTAP, and KIAA1429) and ’erasers’ (demethylases: FTO/ALKBH9 and ALKBH5). In addition to METTL3 and FTO, which have been studied in recent years, ALKBH5 also plays an important role in the catalysis of mRNA [7,8]. One study indicate that ALKBH5 acts on certain mRNAs and participates in demethylation modifications, including the transcription factor Forkhead box M1 (FOXM1) [9]. FOXM1 has been demonstrated as a tumor inducer due to its function in the proliferation, invasion and chemoresistance of lung cancer [10e12]. The study found that ALKBH5 is highly expressed in lung cancer cells [13]. ALKBH5 maintains the proliferation and malignancy of glioblastoma by mediating m6A demethylation of FOXM1 mRNA [9]. Therefore, the transcriptional regulation of the demethylase
https://doi.org/10.1016/j.bbrc.2019.10.145 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: Y. Chao et al., ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.145
2
Y. Chao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
ALKBH5 in lung cancer under IH remains to be further explored. In this experiment, we found that IH promotes the expression of ALKBH5 in lung adenocarcinoma. ALKBH5 affects the proliferation and invasion of lung adenocarcinoma cells by downregulating the m6A modification on FOXM1 mRNA. 2. Materials and methods 2.1. Cell culture The human lung cancer cell lines A549 and HCIeH522 were obtained from ATCC. The cells were cultured in high glucosecontaining DMEM (Gibco). The media were supplemented with 10% fetal bovine serum (Gibco, USA). All cells were cultured at 37 C under a humidified atmosphere. Cells were exposed to either normoxia (21% O2, 5% CO2, and balanced N2) or IH (64 cycles of 5 min sustained hypoxia [1% O2, 5% CO2, and balanced N2] and 10 min normoxia) using a incubation chamber attached to an external O2eCO2eN2 computer-driven controller (O2 programmable control, 9200EX, Wakenyaku Co., Ltd, Kyoto, Japan), as described in a previous report [14]. A549 and HCIeH522 cells in normoxia are referred to as N-A549 cells and NeHCIeH522 cells, respectively. A549 and HCIeH522 cells in intermittent hypoxia were referred to as IH-A549 cells and IH-HCI-H522 cells, respectively. 2.2. RNA isolation and quantitative real-time PCR RNA was extracted with TRIzol (Life Technologies) following the manufacturer’s protocol. cDNA was generated using the transScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (Transgen). Quantitative real-time PCR using Fast SYBR Green PCR Master Mix (Applied Biosystems) was performed on a Step-One Fast Real-time PCR System (Applied Biosystems). For RNA stability assay, the cells were plated in a 6-cm dish and incubated with actinomycin D (Santa Cruz) at 5 mg/ml for indicated time points. The primers used in this study were listed below. ALKBH5 forward: 5ˊ-CGGCGAAGGCTACACTTACG-3ˊ. ALKBH5 reverse: 5ˊ-CCACCAGCTTTTGGATCACCA-3ˊ. GAPDH forward: 5ˊ-ACAACTTTGGTATCGTGGAAGG-3ˊ. GAPDH reverse: 5ˊ-GCCATCACGCCACAGTTTC-3ˊ. FOXM1 forward: 5ˊ-GGAGCAGCGACAGGT TA AGG-3ˊ. FOXM1 reverse: 5ˊ-GTTGATGGCGAATTGTATCATGG-3ˊ. 2.3. Immunoblotting (western blot) RIPA buffer was used for total protein extraction. The protein concentration was measured by the BCA Protein Quantitation Assay Kit (Takara). A total of 40 mg of protein per sample was subjected to SDS-PAGE separation and transferred onto PVDF membranes. The membranes were blocked for 1 h with 5% bovine serum albumin (BSA) (Sigma-Aldrich) in Tris-buffered saline containing 0.1% Tween 20 and then incubated overnight at 4 C with anti-ALKBH5 antibodies (Abcam, ab69325), anti-FOXM1 antibodies (Abcam, ab180710) and anti-GAPDH antibodies (Abcam, ab 181602). The membranes were washed for 30 min with Tris-buffered saline containing 0.1% Tween 20 and incubated for 1 h with the appropriate secondary antibodies. After the samples were washed with TBST for 30 min, the targeted proteins were detected with chemiluminescent substrates. 2.4. Establishment of animal models The animal model was established according to a previously described protocol [15]. Briefly, 1 107 A549 cells were subcutaneously implanted into 4-week-old NOD/SCID mice (Weitong Lihua Experimental Animal Technology Co., Ltd). Then, the mice were
exposed to IH for 6 h/day for 28 consecutive days in a specialized plexiglass chamber. The flow of nitrogen (99.99% N2, hypoxic phase) or compressed air (air, reoxygenation phase) was modulated in the chamber to maintain a nadir oxygen concentration of 5% and an IH cycle. The alternating cycle lasted for 2 min and consisted of the hypoxic and reoxygenation phases. Mice exposed to the normoxia condition were used as the control group. Tumor volume was calculated as follows: Tumor volume ¼ LengthWidth20.52. Tumor weight was quantified at the end of the experiment. 2.5. Lentivirus packaging For virus transduction, 293T cells were transfected with the appropriate lentiviral vector according to the Lipofectamine® 3000 reagent (Invitrogen) protocol. Lentiviral vectors expressing sgRNAs targeting ALKBH5 and FOXM1 were generated according to the lentiCRISPRv2 protocol (Addgene plasmid # 52961). The lentiviral vectors were cotransfected with packaging vectors (Addgene) into 293T cells. FOXM1 expression plasmids were generated by cloning the full-length ORF of human FOXM1 (NM_ 202002.3) into the LentiORF PLEX vector. The LentiORF PLEX-MCS vector was used for overexpression, with the target plasmid and the packaging plasmids pCMV-dR8.2-dvpr and PLP-VSVG at a 1:1:0.5 ratio, respectively. To establish stable cell lines, target cells were transduced using the above lentiviruses with polybrene. The sequences of sgRNAs and cloning primers are listed below. ALKBH5 sgRNA oligo1: CACCGAGGGACTTTGTTTCCAACCG. ALKBH5 sgRNA oligo2: AAACCGGTTGGAAACAAAGTCCCTC. FOXM1 sgRNA oligo1: CACCGCCATACTAACGTGCGCCCAGGGG. FOXM1 sgRNA oligo2: AAACCCCCTGGGCGCACGTTAGTATGGC. FOXM1-CDS forward: CGCGGATCCATGAAAACTAGCCCCCGTCG. FOXM1-CDS reverse: CGACGCGTCTACTGTAGCTCAGGAATAAA CTGG. 2.6. Proliferation assay A total of 5000 cells were seeded into five 96-well plates and incubated at 37 C in a humidified atmosphere. The cells were exposed to IH for different time intervals. Cellular proliferation was measured with CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) (Promega). After cultivation, 20 ml of MTS solution was added into each well at different time points and then the plates were incubated for 2 h. Finally, the absorbance at 490 nm was recorded by the SYNERGY microplate reader (BioTEK). 2.7. Transwell™ invasion assay Cell invasion assays were performed in 24-well Transwell™ (Costar) plates. The upper chamber surface of the filter was coated with Matrigel (Corning). The cells were prepared (1 105 cells/ 200 ml) with serum-free DMEM and loaded into the upper chamber. DMEM containing 20% FBS was added to the bottom chamber. After the cells were exposed to IH for 24 h, wet cotton was used to remove the noninvading cells. The cells were fixed with carbinol, stained with 0.1% crystal violet and quantified in several independent areas under the ZEISS Axio Imager. Z2 Microscope. 2.8. m6A content analysis and Me-RIP assay The content of m6A in total RNA was analyzed with the m6A RNA Methylation Assay Kit (Abcam, ab185912). Methylated m6A RNA immunoprecipitation (Me-RIP) was performed according to the reported protocol using an anti-m6A antibody (Abcam, ab151230) [16]. qPCR analysis of the methylated RNA was performed to detect methylated FOXM1 mRNA levels.
Please cite this article as: Y. Chao et al., ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.145
Y. Chao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
2.9. Sucrose gradient centrifugation and polysome fractionation Sucrose gradient centrifugation and polysome fractionation were performed as previously described [17]. Briefly, cell lines for polysome fractionation were first lysed using polysome cell extraction buffer (50 mM MOPS, 15 mM MgCl2, 150 mM NaCl, 100 mg/ml cycloheximide, 0.5% Triton X-100, 1 mg/ml heparin, 200 U RNaseOUT, 2 mM PMSF, and 1 mM benzamine). Next, cellular debris were cleared by centrifugation at 13,000g for 10 min at 4 C. Extracts were loaded on a 10e50% sucrose gradient and centrifuged at 36,000 rpm for 2.5 h at 4 C in an SW 41 Ti rotor (Beckman Coulter). Then, the RNA in the polysome fraction was extracted and subjected to real-time PCR. 2.10. Quantification and statistical analysis Data are presented as the mean ± standard error of the means (SEMs), or standard deviations (SDs). Statistical analyses were performed in GraphPad Prism 6 (GraphPad Software Inc.) using unpaired 2-tailed Student’s t-test to compare differences between 2 groups. One-way ANOVA was used to compare more than two groups. P values less than 0.05 were considered statistically significant. 2.11. Ethics statement The animal study was reviewed and approved by the Institutional Ethics Committee for Clinical Research and Animal Trials of the First Affiliated Hospital of Sun Yat-sen University [(2016)067], and written informed consent was obtained from all participants or their appropriate surrogates. 3. Results 3.1. IH promotes ALKBH5 expression in lung adenocarcinoma cells To explore the potential effect of IH on the expression of ALKBH5 in lung adenocarcinoma, we analyzed the expression of ALKBH5 in lung adenocarcinoma cells under IH and normoxia. The results showed that the mRNA and protein levels of ALKBH5 were significantly upregulated in IH-549 and IH-NCI-H566 cells compared to that in control cells (Fig. 1A and B). In addition, we constructed a tumor model of immunodeficient mice under IH and normoxia using A549 cells. We found that subcutaneous tumors were significantly greater and heavier under IH than under normoxia (Fig. 1C). ALKBH5 mRNA and protein levels were significantly higher in tumor tissues under IH than in tumor tissues under normoxia (Fig. 1D and E). We also examined the level of methylated RNA (m6A) in the abovementioned cells and subcutaneous tumor tissues, and we found that m6A in lung adenocarcinoma cells and subcutaneous tumor tissues under IH decreased (Fig. 1F and G). Therefore, these findings indicate that IH upregulates ALKBH5 expression in lung adenocarcinoma cells. 3.2. ALKBH5 knockout represses the growth and invasion of lung adenocarcinoma cells under IH To investigate the role of ALKBH5 in lung adenocarcinoma cells under IH, we constructed a stable cell line with ALKBH5 knocked out using IH-A549 and IH-NCI-H566 cells. (Fig. 2A and B). We then analyzed the changes in the function of IH-A549 and IH-NCIH566 cells after knocking out ALKBH5. The results showed that after knocking out ALKBH5 in IH-A549 and IH-NCI-H566 cells, proliferation and invasion were significantly reduced in knockout cells compared with those in control cells (Fig. 2C, D, E and F). In the
3
above experiments, we found that compared to normoxic conditions, IH conditions promoted accelerated tumor growth including tumor weight and tumor volume in mice. This is consistent with the inhibition of cell proliferation after knocking out ALKBH5 in IHA549 and IH-NCI-H566 cells. Taken together, these findings demonstrated that ALKBH5 knockout inhibited the growth and invasion of lung adenocarcinoma cells under IH.
3.3. m6A demethylase ALKBH5 regulates FOXM1 mRNA modification and translation We analyzed whether the regulation of the m6A modification on FOXM1 mRNA by ALKBH5 is involved in the development of lung adenocarcinoma under IH. The results showed that the protein levels of FOXM1 in IH-A549 and IH-NCI-H566 cells and subcutaneous tumor tissues under IH were significantly higher than that in the control group, which was similar to the change in the ALKBH5 protein (Fig. 3B and D). However, there was no statistical change in the FOXM1 mRNA levels (Fig. 3A and C). Next, we analyzed the expression of FOXM1 in the previously constructed stable cell lines. The results showed that after knocking out ALKBH5, the FOXM1 protein in IH-A549 and IH-NCI-H566 cells decreased (Fig. 3E and F), but the FOXM1 mRNA did not change statistically (Fig. 3G). We also studied the stability of FOXM1 mRNA in cells and found that knocking out ALKBH5 did not affect the stability of FOXM1 mRNA (Fig. 3H and I). We then compared the polysome-bound (translationally active) FOXM1 mRNA levels in ALKBH5 knockout cells and in control cells under IH. The results showed that the FOXM1 mRNA binding to polysomes was significantly decreased in ALKBH5-knockout IH-A549 and IH-NCIH566 cells compared to that in control cells (Fig. 3J and K). The results suggested that ALKBH5 enhances the proportion of FOXM1 mRNAs undergoing active translation in IH-A549 and IH-NCIH566 cells. We further compared the m6A levels of FOXM1 mRNA in cells, subcutaneous tumor tissues and control groups. The results showed that the m6A level of FOXM1 mRNA in IH-A549 and IH-NCIH566 cells and subcutaneous tumor tissues under IH decreased (Fig. 3L), and the m6A level of FOXM1 mRNA increased in IH-A549 and IH-NCI-H566 cells after knocking out ALKBH5 (Fig. 3M). These results indicate that ALKBH5 can demethylate FOXM1 mRNA. Overall, our data show that ALKBH5 promotes FOXM1 mRNA translation by reducing the m6A level of FOXM1 mRNA under IH, ultimately increasing the FOXM1 protein levels.
3.4. FOXM1 regulates the growth and invasion of lung adenocarcinoma cells under IH Finally, we analyzed the role of FOXM1 in lung adenocarcinoma cells under IH. We first constructed stable cell lines that knocked out FOXM1 using IH-A549 and IH-NCI-H566 cells (Fig. 4A and B). The results showed that when FOXM1 was knocked out in IH-A549 and IH-NCI-H566 cells, the proliferation and invasion of the cells were inhibited (Fig. 4C, D, E and F). The results showed that FOXM1 is involved in the regulation of the growth and invasion of lung adenocarcinoma cells under IH. To further determine whether FOXM1 is a direct effector of ALKBH5 in the development of lung adenocarcinoma under IH, we performed a rescue experiment by overexpressing FOXM1 in ALKBH5-depleted cells in which FOXM1 was downregulated (Fig. 4G). The results indicated that the forced expression of FOXM1 partially reversed the effect of ALKBH5depletion on the proliferation and invasion of IH-A549 cells (Fig. 4H and I). Taken together, these data indicate that FOXM1 is a pivotal target for ALKBH5 in lung adenocarcinoma under IH.
Please cite this article as: Y. Chao et al., ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.145
4
Y. Chao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 1. Expression of ALKBH5 in lung adenocarcinoma cells under IH. (A) IH increased ALKBH5 mRNA in A549 and NCIeH566 cells. (B) ALKBH5 protein in IH-A549 and IH-NCIH566 cells was upregulated compared to that in control cells. (C) Subcutaneous tumor model of A549 cells under IH and normoxia. Tumor images, growth curves and weights are shown. Subcutaneous tumors under IH are greater and heavier than those in normoxic conditions (n ¼ 6). (D-E) The results showed that ALKBH5 mRNA and protein levels were elevated in subcutaneous tumor tissues under IH. (F-G) The m6A content of total RNA in IH-A549 cells, IH-NCI-H566 cells and subcutaneous tumor tissues under IH decreased compared with that under normoxia. **p < 0.01, ***p < 0.001.
4. Discussion The effect of m6A modification on disease progression depends on its impact on mRNA metabolism and the cellular mRNA levels [18]. Previous studies showed that the m6A demethylase FTO promotes the growth of lung cancer cells by regulating the m6A levels of USP7 and MZF1 mRNA [19,20]. Similarly, our studies in the field of OSA reported the participation of the other demethylase ALKBH5 in the pathogenesis of lung cancer under IH. In the context of OSA, recent studies indicate that IH can also facilitate lung adenocarcinoma aggressiveness through the product of oxidative stressdHIFs [15]. Under IH conditions, cancer cells initiate a signaling pathway that triggers upregulation of the corresponding gene to adapt to the environment. ALKBH5, belonging
to the AlkB family of nonheme Fe(II)/a-ketoglutarate-dependent dioxygenases [8], is a hypoxia-inducible gene regulated by HIFs [21,22]. ALKBH5 is highly expressed in malignant tumors and plays an important role in tumor cell proliferation, invasion and migration [13,23,24]. HIF-dependent ALKBH5 expression mediates the enrichment of breast cancer stem cells in the hypoxic tumor microenvironment [22]. In our experiments under IH conditions, (1) the expression of ALKBH5 in lung adenocarcinoma cells and subcutaneous tumor tissues of mice increased, which was consistent with the decrease in the total m6A levels of RNA in adenocarcinoma cells and subcutaneous tumor tissues; (2) subcutaneous tumors grew faster, tumor volume larger, may be related to the rise of ALKBH5; (3) the proliferation and invasion of lung adenocarcinoma cells after ALKBH5 knockout are significantly inhibited,
Please cite this article as: Y. Chao et al., ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.145
Y. Chao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 2. ALKBH5 knockout inhibits the growth of lung adenocarcinoma cells under IH. (A-B) Protein levels of ALKBH5 with a specified sgRNA in lentivirus-infected IH-A549 and IH-NCI-H566 cells. (C-D) ALKBH5 knockout resulted in decreased proliferation of IH-A549 and IH-NCI-H566 cells. (E-F) Knockout of ALKBH5 inhibited the invasion of IH-A549 and IH-NCI-H566 cells. **p < 0.01, ***p < 0.001.
Please cite this article as: Y. Chao et al., ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.145
6
Y. Chao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 3. ALKBH5 regulates FOXM1 mRNA m6A modification and translation. (A) There were no significant differences in FOXM1 mRNA between lung adenocarcinoma cells under IH and normoxia. (B) The FOXM1 protein of IH-A549 and IH-NCI-H566 cells increased significantly. (C) There was no significant difference in FOXM1 mRNA in subcutaneous tumor tissues between IH and normoxia. (D) The FOXM1 protein in the subcutaneous tumor tissue under IH increased significantly. (E-F) Knockout of ALKBH5 in IH-A549 and IH-NCIH566 cells, resulted in downregulation of the FOXM1 protein in cells. (G) IH-A549 and IH-NCI-H566 cells had ALKBH5 knocked out, and there was no significant change in the FOXM1 mRNA levels in these cells. (HeI) IH-A549 and IH-NCI-H566 cells had ALKBH5 knocked out, and there was no significant change in the FOXM1 mRNA stability in these cells. (J-K) IH-A549 and IH-NCI-H566 cells had ALKBH5 knocked out, resulting in downregulation of FOXM1 mRNA abundance in polysome fractions. (L) IH reduced methylated FOXM1 mRNA in A549 cells, NCIeH566 cells and subcutaneous tumor tissues. (M). Knockout of ALKBH5 in IH-A549 and IH-NCI-H566 cells resulted in upregulation of methylated FOXM1 mRNA in cells. **p < 0.01, ***p < 0.001.
indicating that ALKBH5 is closely related to the progression of lung adenocarcinoma under IH. Additional studies are needed to define whether HIFs or other potential regulators stimulate ALKBH5 expression in lung cancer under IH exposure. Structural studies of ALKBH5 have revealed a region that binds to dsDNA, and a loss of ALKBH5 impairs mRNA export and assembly of mRNA processing factors in nuclear speckles [25e27]. ALKBH5 knockout mice are viable but show compromised spermatogenesis due to significantly altered expression of key genes required for spermatogenic maturation [8]. These studies suggest that ALKBH5 is deeply involved in RNA stability, splicing, subcellular localization,
and translation efficiency. We further revealed that ALKBH5 can demethylate FOXM1 transcripts without altering the mRNA stability and amount, but by promoting the translation of FOXM1 mRNA to lead to enhanced FOXM1 protein levels, which mediates the pro-oncogenic roles of IH in lung cancer. This is similar to our previous report that knocking out ALKBH5 from bladder epithelial cells does not affect the amount and stability of downstream genes, but it affects the translation efficiency of downstream genes [17]. FOXM1 has been reported to play an important role in cell proliferation, cell cycle, cell differentiation, angiogenesis and metastasis [28,29]. Previous studies have shown that FOXM1 is
Please cite this article as: Y. Chao et al., ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.145
Y. Chao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
7
Fig. 4. Knocking out FOXM1 in lung adenocarcinoma cells under IH reduces the proliferation and invasion of these cells. (A-B) Protein levels of FOXM1 with a specified sgRNA in lentivirus-infected IH-A549 and IH-NCI-H566 cells. (CeF) IH-A549 and IH-NCI-H566 cells had FOXM1 knocked out, resulting in significant inhibition of cell proliferation and invasion. (G) Lentivirus-mediated overexpression of FOXM1 in IH-A549 cells with ALKBH5 knocked out. (HeI) FOXM1 partially restored the cell proliferation and invasion capacities in IH-A549 cells, which were reduced by ALKBH5 knockout. **p < 0.01, ***p < 0.001.
upregulated in human malignancies, suggesting a poor prognosis [12,30]. It was reported that FOXM1 expression and its related pathway in non-small cell lung cancer are critical for carcinoma progression [10,11]. Additionally, in patients with advanced nonsmall-cell lung cancer, high FOXM1 expression was associated with cisplatin-based chemotherapy resistance and poor prognosis, suggesting the vital role of FOXM1 in the development and progression of non-small-cell lung cancer [12]. ALKBH5 enhanced FOXM1 expression by demethylating FOXM1 transcripts and maintained the tumorigenicity of glioblastoma stem-like cells [9]. In our study under IH, the expression levels of FOXM1 were upregulated in lung adenocarcinoma and were associated with proliferation and invasion as determined by ALKBH5 demethylation regulation. Importantly, FOXM1 was also reported to be transcriptionally upregulated due to HIF-1a signaling activation. We speculate that the increased expression of HIFs in response to IH exposure may be the reason for the upregulated demethylase ALKBH5-FOXM1 pathway in lung adenocarcinoma. In conclusion, m6A modifications are critically implicated in the development and progression of lung cancer under IH. The increased tumor malignancy properties associated with IH appear to be mediated, at least in part, by the upregulated demethylase ALKBH5-FOXM1 pathway in lung adenocarcinoma cells. Our
findings provide effective benefits in the treatment of lung tumors whose organ properties make them more susceptible to regional hypoxic cycles, as well as in the context of cancer patients suffering from OSA. Declaration of competing interest The authors declare that they have no conflict of interest. References [1] Y.Q. Zhen, Y.M. Wu, Y.H. Sang, et al., 2,3-Oxidosqualene cyclase protects liver cells from the injury of intermittent hypoxia by regulating lipid metabolism, Sleep Breath. 19 (2015) 1475e1481. [2] F. Campos-Rodriguez, M.A. Martinez-Garcia, M. Martinez, et al., Association between obstructive sleep apnea and cancer incidence in a large multicenter Spanish cohort, Am. J. Respir. Crit. Care Med. 187 (2013) 99e105. [3] M.A. Martínez-García, F. Campos-Rodriguez, J. Dur an-Cantolla, et al., Obstructive sleep apnea is associated with cancer mortality in younger patients, Sleep Med. 15 (2014) 742e748. [4] I. Lokody, Gene regulation: RNA methylation regulates the circadian clock, Nat. Rev. Genet. 15 (2014) 3. [5] R. Cortese, I. Almendros, Y. Wang, D. Gozal, Tumor circulating DNA profiling in xenografted mice exposed to intermittent hypoxia, Oncotarget 6 (2015) 556e569. [6] T. Pan, N6-methyl-adenosine modification in messenger and long non-coding RNA, Trends Biochem. Sci. 38 (2013) 204e209.
Please cite this article as: Y. Chao et al., ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.145
8
Y. Chao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
[7] C. Xu, K. Liu, W. Tempel, et al., Structures of human ALKBH5 demethylase reveal a unique binding mode for specific single-stranded N6methyladenosine RNA demethylation, J. Biol. Chem. 289 (2014) 17299e17311. [8] G. Zheng, J.A. Dahl, Y. Niu, et al., ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility, Mol. Cell 49 (2013) 18e29. [9] S. Zhang, B.S. Zhao, A. Zhou, et al., m(6)A demethylase ALKBH5 maintains tumorigenicity of glioblastoma stem-like cells by sustaining FOXM1 expression and cell proliferation program, Cancer Cell 31 (2017) 591e606 e6. [10] Z. Cheng, C. Yu, S. Cui, et al., circTP63 functions as a ceRNA to promote lung squamous cell carcinoma progression by upregulating FOXM1, Nat. Commun. 10 (2019) 3200. [11] L. Zhao, L. Liu, Z. Dong, J. Xiong, miR-149 suppresses human non-small cell lung cancer growth and metastasis by inhibiting the FOXM1/cyclin D1/MMP2 axis, Oncol. Rep. 38 (2017) 3522e3530. [12] Y. Wang, L. Wen, S.H. Zhao, Z.H. Ai, J.Z. Guo, W.C. Liu, FOXM1 expression is significantly associated with cisplatin-based chemotherapy resistance and poor prognosis in advanced non-small cell lung cancer patients, Lung Cancer 79 (2013) 173e179. [13] J. Guo, Y. Wu, J. Du, et al., Deregulation of UBE2C-mediated autophagy repression aggravates NSCLC progression, Oncogenesis 7 (2018) 49. [14] H. Ota, S. Tamaki, A. Itaya-Hironaka, et al., Attenuation of glucose-induced insulin secretion by intermittent hypoxia via down-regulation of CD38, Life Sci. 90 (2012) 206e211. [15] L. Li, F. Ren, C. Qi, et al., Intermittent hypoxia promotes melanoma lung metastasis via oxidative stress and inflammation responses in a mouse model of obstructive sleep apnea, Respir. Res. 19 (2018) 28. [16] G. Lichinchi, S. Gao, Y. Saletore, et al., Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells, Nat Microbiol 1 (2016) 16011. [17] H. Jin, X. Ying, B. Que, et al., N(6)-methyladenosine modification of ITGA6 mRNA promotes the development and progression of bladder cancer, EBioMedicine 47 (2019) 195e207. [18] G. Cao, H.B. Li, Z. Yin, R.A. Flavell, Recent advances in dynamic m6A RNA modification, Open Biol 6 (2016) 160003.
[19] J. Li, Y. Han, H. Zhang, et al., The m6A demethylase FTO promotes the growth of lung cancer cells by regulating the m6A level of USP7 mRNA, Biochem. Biophys. Res. Commun. 512 (2019) 479e485. [20] J. Liu, D. Ren, Z. Du, H. Wang, H. Zhang, Y. Jin, m(6)A demethylase FTO facilitates tumor progression in lung squamous cell carcinoma by regulating MZF1 expression, Biochem. Biophys. Res. Commun. 502 (2018) 456e464. [21] A. Thalhammer, Z. Bencokova, R. Poole, et al., Human AlkB homologue 5 is a nuclear 2-oxoglutarate dependent oxygenase and a direct target of hypoxiainducible factor 1alpha (HIF-1alpha), PLoS One 6 (2011), e16210. [22] C. Zhang, D. Samanta, H. Lu, et al., Hypoxia induces the breast cancer stem cell phenotype by HIF-dependent and ALKBH5-mediated m(6)A-demethylation of NANOG mRNA, Proc. Natl. Acad. Sci. U. S. A. 113 (2016) E2047eE2056. [23] K. Koike, Y. Ueda, H. Hase, et al., anti-tumor effect of AlkB homolog 3 knockdown in hormone- independent prostate cancer cells, Curr. Cancer Drug Targets 12 (2012) 847e856. [24] J. Zhang, S. Guo, H.Y. Piao, et al., ALKBH5 promotes invasion and metastasis of gastric cancer by decreasing methylation of the lncRNA NEAT1, J. Physiol. Biochem. 75 (2019) 379e389. [25] W. Aik, J.S. Scotti, H. Choi, et al., Structure of human RNA N(6)-methyladenine demethylase ALKBH5 provides insights into its mechanisms of nucleic acid recognition and demethylation, Nucleic Acids Res. 42 (2014) 4741e4754. [26] C. Feng, Y. Liu, G. Wang, et al., Crystal structures of the human RNA demethylase Alkbh5 reveal basis for substrate recognition, J. Biol. Chem. 289 (2014) 11571e11583. [27] B. Molinie, J. Wang, K.S. Lim, et al., m(6)A-LAIC-seq reveals the census and complexity of the m(6)A epitranscriptome, Nat. Methods 13 (2016) 692e698. [28] G.B. Liao, X.Z. Li, S. Zeng, et al., Regulation of the master regulator FOXM1 in cancer, Cell Commun. Signal. 16 (2018) 57. [29] D. Nandi, P.S. Cheema, N. Jaiswal, A. Nag, FOXM1: repurposing an oncogene as a biomarker, Semin. Cancer Biol. 52 (2018) 74e84. [30] M.Y. Kim, A.R. Jung, G.E. Kim, et al., High FOXM1 expression is a prognostic marker for poor clinical outcomes in prostate cancer, J. Cancer 10 (2019) 749e756.
Please cite this article as: Y. Chao et al., ALKBH5-m6A-FOXM1 signaling axis promotes proliferation and invasion of lung adenocarcinoma cells under intermittent hypoxia, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.145