- Email: [email protected]
Allele frequencies data and statistic parameters for 13 STR loci in a population of the Brazilian Amazon Region
Forensic Science International 168 (2007) 244–247 www.elsevier.com/locate/forsciint
Announcement of Population Data
Allele frequencies data and statistic parameters for 13 STR loci in a population of the Brazilian Amazon Region Elzemar Martins Ribeiro Rodrigues a, Teresinha de Jesus Brabo Ferreira Palha a,b, Sidney Emanuel Batista dos Santos a,* a
Laborato´rio de Gene´tica Humana e Me´dica, Departamento de Patologia, Universidade Federal do Para´, Brazil b Centro de Perı´cias Cientı´ficas Renato Chaves, Bele´m, Para´, Brazil Received 27 December 2005; received in revised form 3 February 2006; accepted 4 March 2006 Available online 5 June 2006
Abstract Allele frequencies for 13 short tandem repeat (D3S1358, vWA, D21S11, D18S51, D5S818, D13S317, D7S820, TH01, TPOX, D16S539, CSF1PO, D8S1179 and FGA) loci were determined in a sample of 325 unrelated individuals from the population of the Amazon of Bele´m, Brazil. These loci are the most commonly used in forensic and paternity testing. The forensic parameters investigated presented high values. The power of discrimination and the probability of exclusion for these 13 STRs are 99.999999999992% and 99.9998%, respectively. In conclusion, these 13 markers are suitable for forensic analysis and paternity tests of the Amazonian population. # 2006 Elsevier Ireland Ltd. All rights reserved. Keywords: Short tandem repeats; Brazilian population; PCR multiplex
Population: Peripheral blood samples were collected, after the signature of term of consent, from 325 unrelated healthy volunteers of Bele´m, a city located in the Brazilian Amazon Region (Fig. 1), whose population was formed by the miscegenation of Europeans, Africans, and Amerindians [1]. Extraction: DNA was extracted using the phenol-chloroform protocol [2]. PCR: 20–30 ng of target DNA was amplified according to the protocol established at the Laboratory of Human and Medical Genetics of Federal University of Para´ State. Primers D5S818, D13S317, TPOX, D16S539, CSF1PO, TH01, and D7S820 are described elsewhere [3], and primers vWA, D21S11, D18S51, D3S1358, D8S1179 and FGA were designed using PRIMER3 software (http://www-genome.wi.mit.edu/ cgi-bin/primer/primer3_www.cgi), Table 1. One of each primer pair was 50 labeled with a fluorescent dye (6FAM, HEX or NED) from Applied Biosystems, Foster City, USA.
* Corresponding author at: Universidade Federal do Para´, Centro de Cieˆncias Biolo´gicas, Laborato´rio de Gene´tica Humana e Me´dica, Rua Augusto Correˆa, 01 Guama´, Caixa Postal 8615, CEP 66075-970 Bele´m, Para´, Brazil. Tel.: +55 91 3249 0373; fax: +55 91 3249 0373. E-mail address: [email protected] (S.E.B. dos Santos). 0379-0738/$ – see front matter # 2006 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.forsciint.2006.03.003
Typing: Electrophoresis and typing were performed in ABI 377 Automated Sequencer (Applied Biosystems, USA) using 5% denaturing polyacrylamide gel. Data acquisition was performed by Genescan Analysis 3.1.2. Software (Applied Biosystem, USA). ABIGS ROX 500 reference ladder was used as size standard. Consistent allele designation and typing quality were assured by simultaneous electrophoretic analysis of an allele sample with known size. Alleles were designated according to published nomenclatures and in concordance with The National Institute of Standards and Technology (NIST) for forensic STR analysis (www.cstl.nist.gov/div831/strbase/) [4]. Data analysis: Data were analyzed using Arlequin Version 2.000 (http://lgb.unige.ch/arlequin) [5], GENEPOP [6] and Powerstatsv12.xls (http://www.promega.com/geneticidtools/ powerstats/) software. Data access: Available upon request: [email protected]. Results: Allele frequencies and statistic parameters for the 13 STR loci of the population of Bele´m are shown in Table 2. Other remarks: All the loci analyzed reached the Hardy– Weinberg equilibrium in the population studied (P > 0.05), except D13S317 locus (P = 0.021). When the Bonferroni correction [7] was employed using the number of loci analyzed, the differences observed were not statistically significant (P = 0.25). The results observed in the population
E.M.R. Rodrigues et al. / Forensic Science International 168 (2007) 244–247
245
Fig. 1. The map shows the geographic localization of Bele´m, a city located in the Brazilian Amazon Region (www.albras.net/imagens/mapa_local.gif).
of Bele´m were compared with those of other populations [8– 17] from different geopolitical regions of Brazil. Population differentiation tests (locus by locus), carried out with the Arlequin Software Version 2.000 [5] revealed there is significant differences between the D7S820 system from Bele´m and other Brazilian populations: West-Center Region (P = 0.02), Pernambuco (P = 0.01) and Rio de Janeiro (P = 0.02). Significant differences between Bele´m and Pernambuco population also were shown on the systems D13S317 (P = 0.001) and D21S11 (P < 0.001). The populations of Bele´m and Piauı´ (northeast Brazil) show significant differences regarding the D7S820 (P < 0.001) and D13S317 (P < 0.001) systems. The forensic parameters investigated
show high average values: polymorphism information content (PIC = 78%); power of discrimination (PD = 93%); power of exclusion (PE = 62%); observed heterozygozity (Ho = 79%), similar to those of other South American [18] and Central American populations [19]. The FGA marker exhibits the highest heterozygosity (89%) and D3S1358 and TPOX markers exhibit the lowest one (72%). The power of discrimination and the probability of exclusion for these 13 STRs are 99.999999999992% and 99.9998%, respectively. In conclusion, these 13 markers are suitable for forensic analyses and paternity tests of the Amazonian population. This paper follows the journal’s guidelines for publication of population data [20].
Table 1 Description of sequences of the new or modified primers used in the present study Loci VWA D21S11 D18S51 D3S1358 D8S1179 FGA a
Modified primer sequences.
Forward and Reverse primers (50 –30 ) 0
5 50 50 50 50 50 50 50 50 50 50 50
Reference 0
TGATAAGAATAATCAGTATGTGACTTG 3 TGATAAGAATAATCAGTATGTGACTTG 30 GAGTCAATTCCCCAAGTGAATTG 30 GATGTTGTATTAGTCAATGTTCTC 30 TCTCTGGTGTGTGGAGATGTCTT 30 ACAAAAATTAGTTGGGCATGGTG 30 AATCTGGGTGACAGAGCAAGAC 30 CTTTGGGGGCATCTCTTATACTC 30 CACACGGCCAAGTAGAAGAAAG 30 CGTATCCCATTGCGTGAATATG 30 GCCCCATAGGTTTTGAACTCAC 30 AGCCACATACTTACCTCCAGTCG 30
[3]a [3]a [4]a [4]a New New [4]a New New New New New
246
E.M.R. Rodrigues et al. / Forensic Science International 168 (2007) 244–247
Table 2 Allele frequencies distribution of 13 STRs loci in the present study Alleles
D3S1358
VWA
D21S11
D18S51
D5S818
D13S317
D7S820
D16S539
TH01
TPOX
CSF1PO
D8S1179
5 6 7 8 9 9.3 10 11 12 13 14 15 16 17 18 18.2 19 20 21 22 22.2 23 24 24.2 25 26 27 28 29 29.2 30 30.2 31 31.2 32 32.2 33 33.2 34 34.2 35 35.2
– – – – – – – – 0.002 0.003 0.059 0.322 0.289 0.157 0.134 – 0.023 0.012 – –
– – – – – – – 0.008 – 0.015 0.068 0.134 0.263 0.288 0.148 – 0.057 0.020 – –
– – – – – – – – – – – – – – – – – – – –
– – – – 0.002 – 0.009 0.008 0.120 0.115 0.159 0.139 0.169 0.122 0.088 – 0.037 0.025 0.005 0.003
– – 0.008 0.025 0.059 – 0.065 0.285 0.400 0.148 0.011 0.002 – – – – – – – –
– – 0.003 0.100 0.115 – 0.042 0.222 0.314 0.152 0.049 0.003 – – – – – – – –
– – 0.0190.132 0.117 – 0.297 0.212 0.117 0.095 0.009 0.002 – – – – – – – –
0.002 – – 0.026 0.177 – 0.099 0.286 0.239 0.151 0.019 0.003 – – – – – – – –
0.012 0.226 0.262 0.120 0.165 0.211 0.005 – – – – – – – – – – – – –
0.002 0.014 0.003 0.410 0.120 – 0.066 0.294 0.092 0.003 – – – – – – – – – –
– – 0.011 0.017 0.022 – 0.274 0.295 0.303 0.068 0.009 0.002 – – – – – – – –
– – – 0.007 0.012 – 0.056 0.068 0.143 0.320 0.244 0.109 0.039 0.002 0.001 – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – 0.006 0.003 0.003 0.031 0.115 0.191 0.001 0.271 0.054 0.078 0.080 0.012 0.100 0.003 0.029 0.006 0.008 0.003 0.006
– 0.002 – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
N Ho He PIC PD PE P
325 0.72 0.76 0.73 0.91 0.54 0.137
325 0.78 0.82 0.84 0.96 0.71 0.231
325 0.87 0.87 0.86 0.97 0.75 0.705
325 0.81 0.80 0.77 0.93 0.60 0.754
325 0.77 0.76 0.73 0.91 0.54 0.815
325 0.77 0.80 0.82 0.96 0.68 0.208
325 0.77 0.81 0.79 0.94 0.63 0.817
325 0.79 0.80 0.77 0.93 0.60 0.614
325 0.80 0.79 0.79 0.94 0.63 0.925
325 0.72 0.73 0.69 0.89 0.48 0.874
325 0.75 0.74 0.70 0.89 0.50 0.854
207 0.79 0.80 0.78 0.94 0.61 0.656
FGA – – – – – – – – – – – – – – 0.010 0.005 0.099 0.118 0.140 0.135 0.002 0.118 0.172 0.111 0.070 0.010 0.005 0.002 0.002 – – – – – – – – – – – – – 207 0.89 0.88 0.87 0.97 0.76 0.152
N: number of individuals; Ho: observed heterozygozity; He: expected heterozygozity; PIC: polymorphism information content; PD: power of discrimination; PE: power of exclusion; P: Hardy–Weinberg equilibrium exact test.
Acknowledgments We especially thank the donors of samples, who enabled ˆ ndrea this study to be carried out. We also thank Dr. A Ribeiro dos Santos for extremely valuable contribution and support.
References [1] S.E.B. Santos, J.F. Guerreiro, The indigenous contribution to the formation of the population of the Brazilian Amazon Region, Rev. Bras. Genet. 18 (1995) 311–315. [2] J. Sambrook, E.F. Frotsch, T. Maniatis, Isolations of DNA from mammalian cells, in: N. Ford, C. Nolan, M. Ferguson (Eds.), Molecular
E.M.R. Rodrigues et al. / Forensic Science International 168 (2007) 244–247
[3] [4]
[5]
[6]
[7] [8]
[9]
[10]
Cloning, Cold Spring Harbor Laboratory Press, New York, 1989 , pp. 916–919. A. Masibay, T.J. Mozer, C. Sprecher, Promega Corporation reveals primer sequence in its testing kits, J. Forensic Sci. 45 (2000) 1360–1362. C.M. Ruitberg, D.J. Reeder, J.M. Butler, STRBASE: a short tandem repeat DNA database for human identity testing community, Nucl. Acids Res. 29 (2001) 320–322. S. Schneider, D. Roessli, L. Exxcoffier, Arlequin: A Software for Population Genetics Data Analysis, Ver. 2.000, Genetics and Biometry Lab, Department of Antropology, University of Geneva, 2000. M. Raymond, F. Rousset, GENEPOP: Population genetics Software Package, 1999. Available on the Internet at: http://wbiomed.curtin.edu.au:80/genepop/index.html. B.S. Weir, Multiple tests, Genetic Data Analysis, vol. 109, Sinauer Associates, Inc., Sunderland, MA, 1990, pp. 109–110. D. Grattapaglia, A.B. Schmidt, C. Costa e Silva, C. Stringher, A.P. Fernandes, M.E. Ferreira, Brazilian population database for the 13 STR loci of the AmpFISTR1 Profiler PlusTM and Cofiler TM multiplex kits, Forensic Sci. Int. 118 (2001) 91–94. A.C.S. Goes, D.A. Silva, E.H.F. Gil, M.T.D. Silva, R.W. Perreira, E.F. Carvalho, Allele frequencies data and statistic parameters for 16 STR loci – D19S433, D2S1338, CSF1PO, D16S539, D7S820, D21S11, D18S51, D13S317, D5S818, FGA, Penta E, TH01, vWA, D8S1179, TPOX, D3S1358 – in the Rio de Janeiro population, Brazil, Forensic Sci. Int. 140 (2004) 131–132. S.M. Callegari-Jacques, D. Grattapaglia, F. Salzano, S.P. Salamoni, S.G. Rossetti, M.E. Ferreira, M.H. Hutz, Historical genetics: spatiotemporal analysis of the formation of the Brazilian population, Am. J. Hum. Biol. 15 (2003) 824–834.
247
[11] L.A. Ferreira da Silva, B.J. Pimentel, D.A. Azevedo, E.N.P. Silva, S.S. Santos, Allele frequencies of 9 STR loci – D16S539, D7S820, D13S317, CSF1PO, TPOX, TH01, F13A01, FESPS and vWA, – in the population from Alagoas, north-eastern Brazil, Forensic Sci. Int. 130 (2002) 187–188. [12] D.A. Silva, C.A. Crouse, R. Chakraborty, A.C.S. Go´es, Statistical analyses of 14 short tandem repeat loci in Brazilian populations from Rio de Janeiro and Mato Grosso do Sul, Forensic Sci. Int. 139 (2004) 173–176. [13] M.R. Whittle, N.L. Romano, V.A.C. Negreiros, Updated Brazilian genetic data, together with mutation rates, on 19 STR loci, including D10S1237, Forensic Sci. Int. 139 (2004) 207–210. [14] F.P.N. Leite, F.J. Menegassi, S.P. Schwengber, P.E. Raimann, T.K. Albuquerque, STR data 09 autosomal STR markers from Rio Grande do Sul (southern Brazil), Forensic Sci. Int. 132 (2003) 223–224. [15] E. Dellalibera, M.L.B. Havro, M. Souza, K. Kajihara, L. Mauricio-daSilva, R.S. Silva, Genetic analysis of 13STR loci in the population from the State of Pernambuco, northeast Brazil, Forensic Sci. Int. 146 (2004) 57–59. [16] M.V. Santos, M.J. Anjos, L. Andrade, M.C. Vide, F. Corte-Real, D.N. Vieira, Int. Congr. Ser. 1261 (2004) 219–222. [17] E.B. Silva, E. Dellalibera, M. Souza, R.S. Silva, L. Mauricio-da-Silva, Forensic Sci. Int. 126 (2002) 90–92. [18] B. Martı´nez, L. Caraballo, L.G.A. Amorim, A. Carracedo, Autosomic STR population data in two Caribbean samples from Colombia, Forensic Sci. Int. 152 (2005) 79–81. [19] I. Sano´u, G. Nu´nez, A. Rodrı´guez, A.S. Silva, O. Garcı´a, J. Uriarte, M. Espinoza, STR data for 11 autosomal STR markers from Costa Rica, Central Ame´rica, Forensic Sci. Int. (2005). [20] P. Lincoln, A. Carracedo, Publication of population data of human polymorphisms, Forensic Sci. Int. 110 (2000) 03–05.
Announcement of Population Data
Allele frequencies data and statistic parameters for 13 STR loci in a population of the Brazilian Amazon Region Elzemar Martins Ribeiro Rodrigues a, Teresinha de Jesus Brabo Ferreira Palha a,b, Sidney Emanuel Batista dos Santos a,* a
Laborato´rio de Gene´tica Humana e Me´dica, Departamento de Patologia, Universidade Federal do Para´, Brazil b Centro de Perı´cias Cientı´ficas Renato Chaves, Bele´m, Para´, Brazil Received 27 December 2005; received in revised form 3 February 2006; accepted 4 March 2006 Available online 5 June 2006
Abstract Allele frequencies for 13 short tandem repeat (D3S1358, vWA, D21S11, D18S51, D5S818, D13S317, D7S820, TH01, TPOX, D16S539, CSF1PO, D8S1179 and FGA) loci were determined in a sample of 325 unrelated individuals from the population of the Amazon of Bele´m, Brazil. These loci are the most commonly used in forensic and paternity testing. The forensic parameters investigated presented high values. The power of discrimination and the probability of exclusion for these 13 STRs are 99.999999999992% and 99.9998%, respectively. In conclusion, these 13 markers are suitable for forensic analysis and paternity tests of the Amazonian population. # 2006 Elsevier Ireland Ltd. All rights reserved. Keywords: Short tandem repeats; Brazilian population; PCR multiplex
Population: Peripheral blood samples were collected, after the signature of term of consent, from 325 unrelated healthy volunteers of Bele´m, a city located in the Brazilian Amazon Region (Fig. 1), whose population was formed by the miscegenation of Europeans, Africans, and Amerindians [1]. Extraction: DNA was extracted using the phenol-chloroform protocol [2]. PCR: 20–30 ng of target DNA was amplified according to the protocol established at the Laboratory of Human and Medical Genetics of Federal University of Para´ State. Primers D5S818, D13S317, TPOX, D16S539, CSF1PO, TH01, and D7S820 are described elsewhere [3], and primers vWA, D21S11, D18S51, D3S1358, D8S1179 and FGA were designed using PRIMER3 software (http://www-genome.wi.mit.edu/ cgi-bin/primer/primer3_www.cgi), Table 1. One of each primer pair was 50 labeled with a fluorescent dye (6FAM, HEX or NED) from Applied Biosystems, Foster City, USA.
* Corresponding author at: Universidade Federal do Para´, Centro de Cieˆncias Biolo´gicas, Laborato´rio de Gene´tica Humana e Me´dica, Rua Augusto Correˆa, 01 Guama´, Caixa Postal 8615, CEP 66075-970 Bele´m, Para´, Brazil. Tel.: +55 91 3249 0373; fax: +55 91 3249 0373. E-mail address: [email protected] (S.E.B. dos Santos). 0379-0738/$ – see front matter # 2006 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.forsciint.2006.03.003
Typing: Electrophoresis and typing were performed in ABI 377 Automated Sequencer (Applied Biosystems, USA) using 5% denaturing polyacrylamide gel. Data acquisition was performed by Genescan Analysis 3.1.2. Software (Applied Biosystem, USA). ABIGS ROX 500 reference ladder was used as size standard. Consistent allele designation and typing quality were assured by simultaneous electrophoretic analysis of an allele sample with known size. Alleles were designated according to published nomenclatures and in concordance with The National Institute of Standards and Technology (NIST) for forensic STR analysis (www.cstl.nist.gov/div831/strbase/) [4]. Data analysis: Data were analyzed using Arlequin Version 2.000 (http://lgb.unige.ch/arlequin) [5], GENEPOP [6] and Powerstatsv12.xls (http://www.promega.com/geneticidtools/ powerstats/) software. Data access: Available upon request: [email protected]. Results: Allele frequencies and statistic parameters for the 13 STR loci of the population of Bele´m are shown in Table 2. Other remarks: All the loci analyzed reached the Hardy– Weinberg equilibrium in the population studied (P > 0.05), except D13S317 locus (P = 0.021). When the Bonferroni correction [7] was employed using the number of loci analyzed, the differences observed were not statistically significant (P = 0.25). The results observed in the population
E.M.R. Rodrigues et al. / Forensic Science International 168 (2007) 244–247
245
Fig. 1. The map shows the geographic localization of Bele´m, a city located in the Brazilian Amazon Region (www.albras.net/imagens/mapa_local.gif).
of Bele´m were compared with those of other populations [8– 17] from different geopolitical regions of Brazil. Population differentiation tests (locus by locus), carried out with the Arlequin Software Version 2.000 [5] revealed there is significant differences between the D7S820 system from Bele´m and other Brazilian populations: West-Center Region (P = 0.02), Pernambuco (P = 0.01) and Rio de Janeiro (P = 0.02). Significant differences between Bele´m and Pernambuco population also were shown on the systems D13S317 (P = 0.001) and D21S11 (P < 0.001). The populations of Bele´m and Piauı´ (northeast Brazil) show significant differences regarding the D7S820 (P < 0.001) and D13S317 (P < 0.001) systems. The forensic parameters investigated
show high average values: polymorphism information content (PIC = 78%); power of discrimination (PD = 93%); power of exclusion (PE = 62%); observed heterozygozity (Ho = 79%), similar to those of other South American [18] and Central American populations [19]. The FGA marker exhibits the highest heterozygosity (89%) and D3S1358 and TPOX markers exhibit the lowest one (72%). The power of discrimination and the probability of exclusion for these 13 STRs are 99.999999999992% and 99.9998%, respectively. In conclusion, these 13 markers are suitable for forensic analyses and paternity tests of the Amazonian population. This paper follows the journal’s guidelines for publication of population data [20].
Table 1 Description of sequences of the new or modified primers used in the present study Loci VWA D21S11 D18S51 D3S1358 D8S1179 FGA a
Modified primer sequences.
Forward and Reverse primers (50 –30 ) 0
5 50 50 50 50 50 50 50 50 50 50 50
Reference 0
TGATAAGAATAATCAGTATGTGACTTG 3 TGATAAGAATAATCAGTATGTGACTTG 30 GAGTCAATTCCCCAAGTGAATTG 30 GATGTTGTATTAGTCAATGTTCTC 30 TCTCTGGTGTGTGGAGATGTCTT 30 ACAAAAATTAGTTGGGCATGGTG 30 AATCTGGGTGACAGAGCAAGAC 30 CTTTGGGGGCATCTCTTATACTC 30 CACACGGCCAAGTAGAAGAAAG 30 CGTATCCCATTGCGTGAATATG 30 GCCCCATAGGTTTTGAACTCAC 30 AGCCACATACTTACCTCCAGTCG 30
[3]a [3]a [4]a [4]a New New [4]a New New New New New
246
E.M.R. Rodrigues et al. / Forensic Science International 168 (2007) 244–247
Table 2 Allele frequencies distribution of 13 STRs loci in the present study Alleles
D3S1358
VWA
D21S11
D18S51
D5S818
D13S317
D7S820
D16S539
TH01
TPOX
CSF1PO
D8S1179
5 6 7 8 9 9.3 10 11 12 13 14 15 16 17 18 18.2 19 20 21 22 22.2 23 24 24.2 25 26 27 28 29 29.2 30 30.2 31 31.2 32 32.2 33 33.2 34 34.2 35 35.2
– – – – – – – – 0.002 0.003 0.059 0.322 0.289 0.157 0.134 – 0.023 0.012 – –
– – – – – – – 0.008 – 0.015 0.068 0.134 0.263 0.288 0.148 – 0.057 0.020 – –
– – – – – – – – – – – – – – – – – – – –
– – – – 0.002 – 0.009 0.008 0.120 0.115 0.159 0.139 0.169 0.122 0.088 – 0.037 0.025 0.005 0.003
– – 0.008 0.025 0.059 – 0.065 0.285 0.400 0.148 0.011 0.002 – – – – – – – –
– – 0.003 0.100 0.115 – 0.042 0.222 0.314 0.152 0.049 0.003 – – – – – – – –
– – 0.0190.132 0.117 – 0.297 0.212 0.117 0.095 0.009 0.002 – – – – – – – –
0.002 – – 0.026 0.177 – 0.099 0.286 0.239 0.151 0.019 0.003 – – – – – – – –
0.012 0.226 0.262 0.120 0.165 0.211 0.005 – – – – – – – – – – – – –
0.002 0.014 0.003 0.410 0.120 – 0.066 0.294 0.092 0.003 – – – – – – – – – –
– – 0.011 0.017 0.022 – 0.274 0.295 0.303 0.068 0.009 0.002 – – – – – – – –
– – – 0.007 0.012 – 0.056 0.068 0.143 0.320 0.244 0.109 0.039 0.002 0.001 – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – 0.006 0.003 0.003 0.031 0.115 0.191 0.001 0.271 0.054 0.078 0.080 0.012 0.100 0.003 0.029 0.006 0.008 0.003 0.006
– 0.002 – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
– – – – – – – – – – – – – – – – – – – – –
N Ho He PIC PD PE P
325 0.72 0.76 0.73 0.91 0.54 0.137
325 0.78 0.82 0.84 0.96 0.71 0.231
325 0.87 0.87 0.86 0.97 0.75 0.705
325 0.81 0.80 0.77 0.93 0.60 0.754
325 0.77 0.76 0.73 0.91 0.54 0.815
325 0.77 0.80 0.82 0.96 0.68 0.208
325 0.77 0.81 0.79 0.94 0.63 0.817
325 0.79 0.80 0.77 0.93 0.60 0.614
325 0.80 0.79 0.79 0.94 0.63 0.925
325 0.72 0.73 0.69 0.89 0.48 0.874
325 0.75 0.74 0.70 0.89 0.50 0.854
207 0.79 0.80 0.78 0.94 0.61 0.656
FGA – – – – – – – – – – – – – – 0.010 0.005 0.099 0.118 0.140 0.135 0.002 0.118 0.172 0.111 0.070 0.010 0.005 0.002 0.002 – – – – – – – – – – – – – 207 0.89 0.88 0.87 0.97 0.76 0.152
N: number of individuals; Ho: observed heterozygozity; He: expected heterozygozity; PIC: polymorphism information content; PD: power of discrimination; PE: power of exclusion; P: Hardy–Weinberg equilibrium exact test.
Acknowledgments We especially thank the donors of samples, who enabled ˆ ndrea this study to be carried out. We also thank Dr. A Ribeiro dos Santos for extremely valuable contribution and support.
References [1] S.E.B. Santos, J.F. Guerreiro, The indigenous contribution to the formation of the population of the Brazilian Amazon Region, Rev. Bras. Genet. 18 (1995) 311–315. [2] J. Sambrook, E.F. Frotsch, T. Maniatis, Isolations of DNA from mammalian cells, in: N. Ford, C. Nolan, M. Ferguson (Eds.), Molecular
E.M.R. Rodrigues et al. / Forensic Science International 168 (2007) 244–247
[3] [4]
[5]
[6]
[7] [8]
[9]
[10]
Cloning, Cold Spring Harbor Laboratory Press, New York, 1989 , pp. 916–919. A. Masibay, T.J. Mozer, C. Sprecher, Promega Corporation reveals primer sequence in its testing kits, J. Forensic Sci. 45 (2000) 1360–1362. C.M. Ruitberg, D.J. Reeder, J.M. Butler, STRBASE: a short tandem repeat DNA database for human identity testing community, Nucl. Acids Res. 29 (2001) 320–322. S. Schneider, D. Roessli, L. Exxcoffier, Arlequin: A Software for Population Genetics Data Analysis, Ver. 2.000, Genetics and Biometry Lab, Department of Antropology, University of Geneva, 2000. M. Raymond, F. Rousset, GENEPOP: Population genetics Software Package, 1999. Available on the Internet at: http://wbiomed.curtin.edu.au:80/genepop/index.html. B.S. Weir, Multiple tests, Genetic Data Analysis, vol. 109, Sinauer Associates, Inc., Sunderland, MA, 1990, pp. 109–110. D. Grattapaglia, A.B. Schmidt, C. Costa e Silva, C. Stringher, A.P. Fernandes, M.E. Ferreira, Brazilian population database for the 13 STR loci of the AmpFISTR1 Profiler PlusTM and Cofiler TM multiplex kits, Forensic Sci. Int. 118 (2001) 91–94. A.C.S. Goes, D.A. Silva, E.H.F. Gil, M.T.D. Silva, R.W. Perreira, E.F. Carvalho, Allele frequencies data and statistic parameters for 16 STR loci – D19S433, D2S1338, CSF1PO, D16S539, D7S820, D21S11, D18S51, D13S317, D5S818, FGA, Penta E, TH01, vWA, D8S1179, TPOX, D3S1358 – in the Rio de Janeiro population, Brazil, Forensic Sci. Int. 140 (2004) 131–132. S.M. Callegari-Jacques, D. Grattapaglia, F. Salzano, S.P. Salamoni, S.G. Rossetti, M.E. Ferreira, M.H. Hutz, Historical genetics: spatiotemporal analysis of the formation of the Brazilian population, Am. J. Hum. Biol. 15 (2003) 824–834.
247
[11] L.A. Ferreira da Silva, B.J. Pimentel, D.A. Azevedo, E.N.P. Silva, S.S. Santos, Allele frequencies of 9 STR loci – D16S539, D7S820, D13S317, CSF1PO, TPOX, TH01, F13A01, FESPS and vWA, – in the population from Alagoas, north-eastern Brazil, Forensic Sci. Int. 130 (2002) 187–188. [12] D.A. Silva, C.A. Crouse, R. Chakraborty, A.C.S. Go´es, Statistical analyses of 14 short tandem repeat loci in Brazilian populations from Rio de Janeiro and Mato Grosso do Sul, Forensic Sci. Int. 139 (2004) 173–176. [13] M.R. Whittle, N.L. Romano, V.A.C. Negreiros, Updated Brazilian genetic data, together with mutation rates, on 19 STR loci, including D10S1237, Forensic Sci. Int. 139 (2004) 207–210. [14] F.P.N. Leite, F.J. Menegassi, S.P. Schwengber, P.E. Raimann, T.K. Albuquerque, STR data 09 autosomal STR markers from Rio Grande do Sul (southern Brazil), Forensic Sci. Int. 132 (2003) 223–224. [15] E. Dellalibera, M.L.B. Havro, M. Souza, K. Kajihara, L. Mauricio-daSilva, R.S. Silva, Genetic analysis of 13STR loci in the population from the State of Pernambuco, northeast Brazil, Forensic Sci. Int. 146 (2004) 57–59. [16] M.V. Santos, M.J. Anjos, L. Andrade, M.C. Vide, F. Corte-Real, D.N. Vieira, Int. Congr. Ser. 1261 (2004) 219–222. [17] E.B. Silva, E. Dellalibera, M. Souza, R.S. Silva, L. Mauricio-da-Silva, Forensic Sci. Int. 126 (2002) 90–92. [18] B. Martı´nez, L. Caraballo, L.G.A. Amorim, A. Carracedo, Autosomic STR population data in two Caribbean samples from Colombia, Forensic Sci. Int. 152 (2005) 79–81. [19] I. Sano´u, G. Nu´nez, A. Rodrı´guez, A.S. Silva, O. Garcı´a, J. Uriarte, M. Espinoza, STR data for 11 autosomal STR markers from Costa Rica, Central Ame´rica, Forensic Sci. Int. (2005). [20] P. Lincoln, A. Carracedo, Publication of population data of human polymorphisms, Forensic Sci. Int. 110 (2000) 03–05.