Allele-specific protein-DNA interactions between the single-stranded DNA-binding protein, ssA-TIBF, and DNA replication determinants in Tetrahymena1

Article No. jmbi.1999.3365 available online at http://www.idealibrary.com on

J. Mol. Biol. (2000) 295, 423±439

Allele-specific Protein-DNA Interactions between the Single-stranded DNA-binding Protein, ssA-TIBF, and DNA Replication Determinants in Tetrahymena Swati Saha and Geoffrey M. Kapler* Department of Medical Biochemistry and Genetics Texas A&M Health Science Center, College Station TX, 77843-1114, USA

Type I elements are multifunctional, cis-acting determinants that regulate the initiation of DNA replication, replication fork movement and transcription of the Tetrahymena thermophila rDNA minichromosome. Previous studies identi®ed a protein, ssA-TIBF, that binds speci®cally to the A-rich strand of type I elements. Here, we examine interactions of ssA-TIBF with the wild-type C3 allele, and a natural variant, B rDNA, which manifests a defect in replication initiation and fork pausing. Puri®ed ssA-TIBF is a homotetramer that binds one substrate molecule and contacts DNA via a single 24 kDa subunit. Both the A-rich and T-rich strands of type I elements are bound by ssA-TIBF, suggesting that this protein might stabilize replication origins in their unwound state. Nucleotides downstream of type I elements contribute to DNA binding, with the extent of DNA-protein contact being greater for wild-type C3 rDNA compared to B rDNA. Allele-speci®c protein-DNA contacts also occur within the conserved type I element itself. Despite these differences, the binding af®nities of ssA-TIBF for C3 and B rDNA substrates are indistinguishable. Consequently, the mode of DNA binding must account for any role ssATIBF might play in the regulation of rDNA replication. # 2000 Academic Press

*Corresponding author

Keywords: DNA-protein interactions; DNA replication; DNA footprinting; single-stranded DNA

Introduction The initiation of DNA replication is controlled by sequence-speci®c DNA-protein interactions. Key regulatory steps include the binding of initiator proteins to replication origins, melting of the DNA duplex and recruitment of replication enzymes. In the virus SV40, all of these events are mediated by a single protein, large T antigen (reviewed by Hassell & Brinton, 1996). As an initiator protein, T antigen forms a complex with duplex DNA at the origin and remains bound following conversion of the origin to a singlestranded form. T antigen then recruits the host replication machinery, and ultimately functions as a replicative helicase that unwinds parental duplex DNA at the elongating replication fork. Chromosomal origins in the yeast Saccharomyces cerevisiae resemble viral origins, in that they are typically small (120 bp) and composite in nature. They contain an essential 11 bp determinant, the E-mail address of the corresponding author:[email protected] 0022-2836/00/030423±17 $35.00/0

ARS element, ¯anked by A ‡ T-rich sequences on one side and auxiliary genetic determinants on the other (B1-B3 for ARS1; Marahrens & Stillman, 1992). Both double-stranded and single-stranded DNA binding proteins recognize ARS elements in vitro. Double-stranded DNA binding is mediated by a large multiprotein complex, ORC, that is required for the initiation of DNA replication (Bell & Stillman, 1992). In contrast to SV40 T antigen, ORC remains bound to the origin throughout the cell-cycle and does not associate with the elongating replication fork (Dif¯ey et al., 1994; Aparicio et al., 1997). A physiological role for the two singlestranded ARS binding proteins has yet to be established (Kuno et al., 1990, 1991; Schmidt et al., 1991). As the origin region is prone to unwinding (Umek & Kowalski, 1988), these proteins could play a role in stabilizing the unwound duplex. Replication initiation sites and their cis-acting regulatory determinants are more poorly de®ned in other eukaryotes. The limited information available indicates that replication origins in most organisms are more complex than in S. cerevisiae. For example, regulatory elements can reside # 2000 Academic Press

424 thousands of base-pairs away from the initiation site in Drosophila and human chromosomes (Delidakis & Kafatos, 1989; Heck & Spradling, 1990; Kitsberg et al., 1993; Aladjem et al., 1995). The ciliated protozoan Tetrahymena thermophila is a useful experimental model system for studying eukaryotic DNA replication (reviewed by Kapler et al., 1996). The rDNA minichromosome (encoding the 17 S, 5.8 S and 26 S ribosomal RNA genes) is initially generated during macronuclear development by excision of the 10.3 kb germline (micronuclear) rDNA copy and rearrangement into a giant 21 kb palindrome (Yasuda & Yao, 1991). Once formed, the rDNA is ampli®ed 5000-fold within the ensuing developmental S phase (Yao et al., 1974). Following macronuclear development, the rDNA is replicated only once (on average) per cell division in vegetatively growing cells. Two-dimensional gel electrophoresis studies demonstrated that both gene ampli®cation and cell cycle-controlled rDNA replication utilize the same origins of replication (Zhang et al., 1997). All initiation events occur within de®ned segments of the 1.9 kb, 50 non-transcribed spacer (50 NTS), localizing to tandem, imperfectly duplicated 430 bp segments that encompass the nucleosome-free domains 1 and 2 (D1 and D2; Figure 1(a)) (Palen & Cech, 1984). Two classes of cis-acting mutations that cause defects in the formation or propagation of rDNA minichromosomes have been identi®ed. rDNA ``maturation'' mutants fail to form and/or amplify rDNA minichromosomes during development (Kapler et al., 1994) and cis-acting determinants responsible for rDNA excision and palindrome formation have been identi®ed (Yao et al., 1990; Yasuda & Yao, 1991; Kapler & Blackburn, 1994). rDNA ``maintenance'' mutants proceed through development normally, but show defects in propagation of the rDNA in vegetatively growing cells (Larson et al., 1986; Yaeger et al., 1989; Kapler et al., 1994; Blomberg et al., 1997; Gallagher & Blackburn, 1998). Maintenance mutations cause only a partial loss of function and produce a phenotype only when placed in competition with other rDNA alleles. For example, the B rDNA allele is gradually lost from the macronucleus of heterozygous C3/B strains, but is stably propagated in B rDNA homozygotes. All known rDNA maintenance mutations occur within or immediately downstream of phylogenetically conserved type I elements (Figure 1(a)). Some of these mutations co-localize with the mapped replication origins (type IB element mutations, B, rmm1, rmm4, rmm7; Larson et al., 1986; Yaeger et al., 1989; Zhang et al., 1997), and others map to the promoter region, 600 and 1000 bp downstream of the D2 and D1 origins, respectively (type IC and ID element mutations, rmm3, rmm8; Gallagher & Blackburn, 1998; D.L. Dobbs & E.H. Blackburn, personal communication). Type I elements are required for rDNA replication (Reischmann et al., 1999), and biochemical studies suggest that the

ssDNA-binding Proteins and DNA Replication

promoter-proximal elements regulate replication through long-distance DNA-protein/proteinprotein interactions (Gallagher & Blackburn, 1998). The type IC and ID elements are part of the basal rRNA gene promoter (Miyahara et al., 1993; Pan et al., 1995; R.E. Pearlman, personal communication), and consequently regulate rRNA transcription as well. In that mutations in the promoter region affect replication or transcription, but not both, these two processes may be controlled by different sequence-speci®c DNA binding proteins. Type I elements regulate replication fork movement as well, causing forks to arrest transiently at speci®c, conserved nearby sequences (MacAlpine et al., 1997). Similar to fork arrest sites in S. cerevisiae, type I elements block replication fork movement in an orientation-dependent manner (Brewer & Fangman, 1988; Deshpande & Newlon, 1996). Previous studies identi®ed a 24 kDa protein that interacts with the type I element in vitro (Umthun et al., 1994). This protein, ssA-TIBF (single-stranded A type I binding factor), was shown to bind to the A-rich strand of type I element in a sequencespeci®c manner (Hou et al., 1995). More recently, two additional type I element binding proteins with subunit molecular masses of 32 kDa and 110 kDa were identi®ed. The 32 kDa protein exists as a homodimer and the 110 kDa protein is part of a multisubunit complex with a mass of 250 kDa (unpublished results). To better understand possible roles for ssA-TIBF in rDNA replication or transcription, we examined the interaction of puri®ed ssA-TIBF with its target recognition sequence in vitro. Our data indicate that ssA-TIBF binds independently to both strands of the type I element in a sequence-speci®c manner, suggesting that it could reside in unwound DNA at the origin. The data further reveal that ssA-TIBF binds to C3 and B rDNA alleles in fundamentally differently ways. These allele-speci®c differences correlate with defects in vegetative B rDNA replication (Larson et al., 1986) and the ability to induce replication fork pausing (MacAlpine et al., 1997).

Results ssA-TIBF is a homotetramer of subunit molecular mass 24 kDa To better examine potential roles for ssA-TIBF in rDNA replication and/or transcription, ssA-TIBF was ®rst puri®ed to apparent homogeneity using a combination of conventional and af®nity chromatography resins (see Materials and Methods). Following hydroxyapatite chromatography, two peaks of activity were detected by gel shift analysis with the C3 type I element oligonucleotide, C3 ssA37 (Figure 1(b)). UV cross-linking studies revealed that both peaks contain a 24 kDa DNA binding activity (unpublished results), suggesting that they contain differently charged species of the same binding protein. Considerable nuclease

ssDNA-binding Proteins and DNA Replication

425

Figure 1. Puri®cation of the type I element binding protein ssA-TIBF. (a) Schematic of the 21 kb rDNA minichromosome encoding the 26 S, 5.8 S and 17 S rRNA genes (terminal hashes, telomeres), and blowup of the 1.9 kb 50 non-transcribed spacer. Origins of replication localize to the imperfect, tandem 430 bp duplication. Phylogenetically conserved type I and type III elements reside in these segments (D1 and D2) and at promoter-proximal sites that are similarly devoid of nucleosomes (black ovals) (Challoner et al., 1985). The position of mutations that affect vegetative rDNA replication are indicated (B, rmm). (b) Electrophoretic mobility shift assay pro®le of Biogel-HTP fractions; 0.1 pmol of radiolabeled C3 ssA37 was used per binding reaction. F, free oligonucleotide substrate; C, protein-DNA complex. The two peaks of DNA binding activity (peaks 1 and 2) are demarcated. (c) SDS-PAGE analysis of puri®ed ssA-TIBF. About 50 ng of puri®ed protein from the peak DNA-binding fraction obtained from oligonucleotide af®nity chromatography was resolved on a 0.1 % SDS, 12 % polyacrylamide gel, and silver-stained. The arrow indicates the position of the puri®ed protein, ssA-TIBF (24 kDa). (C3 ssA37 50 GGCAAAAAAAAAAACAAAAATAGTAAACCTTCCGAAC).

activity was detected in the peak 1 fractions, and therefore only peak 2 was subjected to further puri®cation. Following chromatography on DNAcellulose, ssA-TIBF was puri®ed to apparent homogeneity on an ssA37 af®nity column. Two proteins (ssA-TIBF and a 32 kDa protein) eluted from this column as distinct, but overlapping peaks (data not shown). Importantly, fractions containing just ssA-TIBF (subunit mass 24 kDa) were obtained (Figure 1(c)). All subsequent experiments were performed with af®nity-puri®ed fractions that contained ssA-TIBF and no other detectable protein.

To determine the oligomeric status of native ssA-TIBF, puri®ed protein was subjected to glutaraldehyde crosslinking followed by SDS-PAGE. This experiment revealed that ssA-TIBF exists as a single homotetrameric species with an apparent mass of 96 kDa (Figure 2(a), ÿ/‡ glutaraldehyde). Monomers, dimers and trimers, if present, were in too small amounts to be detected by silver staining. Analytical gel ®ltration on a Superose 6 FPLC column (Pharmacia/Amersham) supported this result. A single peak of DNA binding activity corresponding to a globular protein of 90-110 kDa

426

ssDNA-binding Proteins and DNA Replication

Figure 2. Native ssA-TIBF is a homotetramer. (a) Glutaraldehyde cross-linking of puri®ed ssA-TIBF protein. Puri®ed ssA-TIBF was incubated with 0.1 % glutaraldehyde for 10-20 minutes at room temperature and subjected to electrophoresis on a 0.1 % SDS, 12 % polyacrylamide gel, followed by silver staining. M, monomer; T, tetramer. (b) Size exclusion pro®le of puri®ed, native ssA-TIBF chromatographed on an analytical Superose 6 column. The linear regression line corresponds to the elution pro®les of various proteins used as molecular mass marker calibration standards (®lled circles, kDa). The elution pro®le of ssA-TIBF DNA binding activity is depicted along the X-axis. The retention volume of ssA-TIBF was 15.4 ml.

was detected, suggesting that the protein exists as a homotetramer (Figure 2(b)). Mode of interaction of ssA-TIBF with its DNA substrate To examine how native ssA-TIBF binds its substrate, puri®ed ssA-TIBF was incubated with radiolabeled C3 ssA37, covalently crosslinked by UV irradiation, and the products analyzed by SDSPAGE. Speci®city was assessed by comparing the signals for DNA-protein complexes formed in the absence and presence of unlabeled speci®c and non-speci®c competitors. A time-course of UV irradiation ranging from 30 seconds to 30 minutes revealed a single prominent crosslinked species with an estimated mass of 36 kDa (Figure 3(a)). This corresponds to crosslinking of a single ssATIBF subunit (24 kDa) to each DNA substrate molecule (ssA37, 12 kDa). Two faint, crosslinked species (48 and 55 kDa) were detected only after extensive crosslinking. The higher molecular mass crosslinked species might represent binding of a second protein subunit to DNA in a small fraction of molecules. The results of this experiment raised the possibility that as many as four substrate molecules might be bound to the ssA-TIBF tetramer, each subunit interacting with a different DNA substrate.

We set out to determine the number of DNA binding sites on native ssA-TIBF. An excess of two different DNA substrates, C3 ssA37 and C3 ssA54, were co-incubated with the protein. C3 ssA37 is a derivative of the C3 type IB element that lacks the T tract at the 50 end of the type IB element and contains additional 30 nucleotides (see Figure 5(a)). C3 ssA54 is a derivative of C3 ssA37 in which 17 ¯anking non-rDNA nucleotides are included. Gel shift analysis with each substrate revealed a single DNA-protein complex, migrating at different positions (Figure 3(b), ssA54, ssA37). No additional complex of intermediate mobility was detected when the two substrates were co-incubated with ssA-TIBF (Figure 3(b), ssA37 ‡ ssA54), suggesting that only one DNA molecule is bound to each tetramer. Collectively, the results from the UV-crosslinking and two-substrate experiments indicate that only one subunit of tetrameric ssA-TIBF participates in protein-DNA interactions. Purified ssA-TIBF binds both the A and T strands of the C3 and B rDNA type IB elements with similar affinity ssA-TIBF was originally identi®ed in crude S100 extracts as an activity that bound the Arich strand of the type IB element in a sequencespeci®c manner (Umthun et al., 1994). Having puri®ed the protein to homogeneity, we further

ssDNA-binding Proteins and DNA Replication

427

Figure 3. Native ssA-TIBF binds DNA via one protein subunit and contains one DNA binding site. (a) Time-course of UV-crosslinking of ssA-TIBF and radiolabeled C3 ssA37; 0.1 pmol oligonucleotide and 30 nM protein were used per reaction. Competition experiments were carried out with tenfold excess cold oligonucleotide. Speci®c competitor, ssA37; non-speci®c competitor, 222O rc, derived from the rRNA coding region (see Materials and Methods). The apparent mass of crosslinked complex is the sum of the protein (24 kDa/ssA-TIBF monomer) plus the oligonucleotide (12 kDa). (b) Determination of the number of DNA binding sites in native ssA-TIBF homotetramers. ssA-TIBF (30 nM) was incubated with 0.1 pmol of radiolabeled ssA37, ssA54 or both oligonucleotides, and DNA-protein complexes resolved by non-denaturing gel electrophoresis. C1, DNA-protein complex formed with ssA37 alone; C2, DNA-protein complex formed with ssA54 alone.

examined its DNA binding properties. ssA-TIBF exhibited no signi®cant double-stranded DNA binding activity when incubated with a 37 bp DNA duplex consisting of C3 ssA37 and the complementary C3 ssT37 oligonucleotide (data not shown). To our surprise, the protein bound to the single-stranded, T strand substrate, C3 ssT50 (Figure 4, type I-T, ®rst lane; see Figure 5(a) for oligonucleotide sequences). Experiments with cold competitor DNAs revealed that puri®ed ssA-TIBF recognized the type I element T strand with approximately tenfold greater af®nity than the T strand of the phylogenetically conserved type II element (type II-T) (Figure 4).

Since mutations in type I elements alter the ability to support DNA replication (Reischmann et al., 1999) and modulate replication fork movement (MacAlpine et al., 1997), allele-speci®c proteinDNA interactions might play a critical role in one or both processes. The 42 bp deletion in B rDNA leaves the type IB element intact, juxtaposing it to the downstream type III element, a sequencespeci®c binding site for topoisomerase I (Bonven et al., 1985). Therefore, experiments were performed to (i) determine the binding af®nity of ssATIBF for the newly discovered type I element T strand binding in C3 and B rDNA, and (ii) determine whether ssA-TIBF contacts the DNA differ-

428

ssDNA-binding Proteins and DNA Replication

Figure 4. Puri®ed ssA-TIBF binds to the T strand of the type IB element: 30 nM ssA-TIBF was incubated with 0.1 pmol of radiolabeled C3 ssT50 oligonucleotide. Competition experiments were carried out with various concentrations of cold speci®c (C3 ssT50) and non-speci®c (type I strand) competitors (see Materials and Methods). The graph represents the relative binding af®nity of ssA-TIBF for these two oligonucleotides.

ently for these two alleles (A-rich and T-rich strands). In our initial competitive binding experiments, we were unable to detect an allele-speci®c difference in the binding of puri®ed ssA-TIBF to the Arich strand of the type IB element (data not shown). Similar results were obtained with crude S100 extracts (unpublished results), indicating that additional essential proteins were not being lost during puri®cation. To assess the af®nity of puri®ed ssA-TIBF for the A-rich and T-rich strands of the type IB element, apparent equilibrium dissociation constants were determined for both strands of the two rDNA alleles (Figure 5(a); C3 ssA53, B ssA53, C3 ssT50, B ssT53). In each experiment, increasing concentrations of protein were incubated with a ®xed concentration of oligonucleotide and reaction products were analyzed by electrophoresis on non-denaturing polyacrylamide gels (Figure 5(b), representative data from one experiment with B ssA53). When the percentage of oligonucleotide bound to protein was plotted as a function of protein concentration, Kd values ranging from 4.25  10ÿ8 M to 5.25  10ÿ8 M were obtained from the resulting hyperbolic curves (Figure 5(b), graphs). Interestingly, the binding af®nities for the A and T strands of the type IB element were virtually identical. No signi®cant difference in af®nity for C3 and B rDNA alleles was observed.

Sequences downstream of the type IB element preferentially enhance binding of ssA-TIBF to the C3 rDNA allele Mutations downstream of type I elements, such as the B rDNA deletion, are responsible for rDNA maintenance and fork arrest defects (Yaeger et al., 1989; MacAlpine et al., 1997). In that downstream sequence changes produce cellular phenotypes, the contribution of these sequences to allele-speci®c DNA-protein interactions was investigated. Competitive binding studies were performed ®rst, by incubating subsaturating amounts of ssA-TIBF with a ®xed amount of radiolabeled C3 or B ssA53 oligonucleotide and increasing concentrations of cold competitors (ssA37 or ssA53) from the respective rDNA alleles. ssA37 and ssA53 lack the T tract at the 50 end of the type IB element that is dispensable for ssA-TIBF binding (Hou et al., 1995). They contain 11 and 27 nucleotides 30 to the type IB element, respectively (Figure 5(a)). Gel shift analyses indicated that ssA-TIBF has a 30-fold greater af®nity for the C3 ssA53 compared to the shorter C3 ssA37 oligonucleotide (Figure 5(c), upper panels). Whereas a 2.5-fold molar excess of C3 ssA53 competitor caused a 35 % reduction in binding of protein to labeled C3 ssA53, a 75-fold molar excess of the C3 ssA37 competitor was required to achieve the same degree of competition. This difference could not be attributed

ssDNA-binding Proteins and DNA Replication

simply to the length of the substrate as the oligonucleotide ssA54, containing the ssA37 sequence and 17 additional non-rDNA nucleotides, behaved identically with the ssA37 competitor (data not shown). In contrast to C3 rDNA binding, ssA-TIBF exhibited only a three- to fourfold higher af®nity for B ssA53 compared to the corresponding B ssA37 oligonucleotide (Figure 5(c), lower panels). These results imply that sequences >11 nucleotides downstream of the type IB element contribute to the interaction between ssA-TIBF and the C3 rDNA substrate, but not the B rDNA substrate. The ssA-TIBF binding site is truncated by the B rDNA 42 bp deletion To test whether binding site interactions are altered in the B rDNA mutant, we utilized DNA footprinting to look for differences in DNA-protein complexes formed between puri®ed ssA-TIBF and C3 rDNA or B rDNA. The extent of DNA-protein contacts was ®rst investigated by examining the ability of ssA-TIBF to protect the phosphodiester backbone from DNase I-catalyzed hydrolysis (Galas & Schmitz, 1978). The oligonucleotides C3 ssA53, C3 ssT50, B ssA53 and B ssT53 were labeled at their 50 ends, incubated with protein, digested with DNaseI, and the products were analyzed on a denaturing polyacrylamide gel. The A strand binding studies revealed that ssATIBF protection extends further downstream of the C3 type IB element (Figure 6(a)) compared to the corresponding B rDNA element (Figure 6(b)). In the case of the B rDNA substrate, the footprint extended from approximately nucleotide 11 or further in, to nucleotide 40 at the most (Figure 6(b), compare lane 3 (ÿssA-TIBF) to lane 7 and 8 (‡ssATIBF), see inset). Positions 44 and 45 were hypersensitive to DNase I treatment in the presence of ssA-TIBF, as was position 50. These protected and hypersensitive residues provided a broad demarcation of the protein binding site for the type IB A strand, as there was no DNase I cleavage site in large stretches of the B rDNA ssA53 substrate (e.g. nucleotides 11-18 and 32-40). The footprint on the C3 oligonucleotide, ssA53, spanned the entire substrate (Figure 6(a), compare lane 3 (ÿssA-TIBF) to lanes 7 and 8 (‡ssA-TIBF)). Consequently, we were unable to demarcate either end of the binding site. Similar results were obtained for the T-rich strand of B and C3 rDNA. The pro®le for B ssT53 clearly showed that the protein binding site begins around nucleotide 12-13 (Figure 6(d), compare lane 3 (ÿssA-TIBF) to lanes 5-8 (‡ssA-TIBF)). However, the other end of the binding site could not be mapped, due to the lack of DNase I-sensitive residues beyond nucleotide 41. Extensive protection was observed for the C3 oligonucleotide, C3 ssT50. In this case, modest hypersensitivity was detected around nucleotide 48 (Figure 6(c), compare lane 3 (ÿssA-TIBF) to lanes 7 and 8 (‡ ssA-TIBF)). It is possible that the protein binding site extends

429 beyond the limits of the C3 rDNA T strand and A strand substrates (see below). ssA-TIBF forms allele-specific DNA contacts that distinguish between C3 and B rDNA type IB elements In addition to the extended DNase I footprint on C3 rDNA, ssA-TIBF might contact shared portions of the C3 and B rDNA substrates in an inherently different way. This possibility was addressed by probing for speci®c contacts in DNA-protein complexes using dimethyl sulfate (DMS) or potassium permanganate (KMnO4). DMS modi®es the N7 position of guanine. Proteins that contact guanine residues via this position can inhibit this modi®cation. Potassium permanganate modi®es T and, to a lesser extent, C residues, in single-stranded DNA and single-stranded regions of duplex DNA. Similar to DMS, residues contacted by protein can be identi®ed based on the protein-induced protection patterns. Bound proteins can also render adjacent sites hypersensitive to modi®cation and cleavage by altering the local DNA structure. DMS studies were performed with the four substrates used for DNase I footprinting (C3 ssA53, B ssA53, C3 ssT50, and B ssT53). In the case of the A strands, one of the seven G residues in C3 ssA53 (G42) was protected from methylation by ssA-TIBF (Figure 7(a), compare lanes 2 and 3), indicating a point of contact between the protein and its DNA substrate. The G42 residue occurs downstream of the conserved segment in the C3 type IB element (Figure 5(a)), within the sequence that is deleted in the B rDNA allele. Although three G residues are present in the unique sequence 30 to the B rDNA type IB element (Figure 5(a); G32, G43 and G50), none of these residues was protected by ssA-TIBF in B ssA53 (Figure 7(b), compare lanes 2 and 3). Differences were detected by DMS footprinting of T strand substrates. C3 ssT50 and B ssT53 contain eight and three G residues, respectively, two of which are shared between these substrates (G26 and G39). Residues G8, G17, G21, G25 and G26 in oligonucleotide C3 ssT50 were hypermethylated in the presence of ssA-TIBF, the degree of hypermethylation increasing with protein concentration (Figure 7(c), compare lane 2 with lanes 3-7). In contrast, residue G39 was protected in a protein concentration-dependent manner. Residue G26 was similarly hypersensitive in the B ssT53 substrate. However, position G39 was prominently hypermethylated rather than protected in B rDNA (Figure 7(d), compare lanes 2 and 3). This difference in reactivity (protection versus hypermethylation of G39) occurs within the conserved type I element segment, suggesting that ssA-TIBF contacts DNA in a fundamentally different way in these two alleles. In the DNase I analyses described above, the 30 end of the ssA-TIBF binding site was not determined for the T strand of B rDNA, due to lack of DNase I-sensitive sites on the DNA (Figure 6(d)). However, position G51 was pro-

430

ssDNA-binding Proteins and DNA Replication

Figure 5 (legend opposite)

tected from DMS in the presence of ssA-TIBF (Figure 7(d)), indicating that T strand binding extends close to or beyond the start of the type IB element in B rDNA. In that nucleotide 51 was missing in the C3 ssT50 substrate, we could not determine whether this contact occurs in the C3 allele as well. DNA footprinting with KMnO4 con®rmed the presence of allele-speci®c DNA-protein contacts

and illuminated several interesting features of ssATIBF binding to type I elements. The C3 ssA53 oligonucleotide showed protection of residues T21, T24, T30, T31, T38 and T41 in presence of ssA-TIBF (Figure 8(a), compare lanes 2 and 3). Residues T39 and T40 were not affected, suggesting that the protein contacted all but these two T residues. T21 and T24 reside within the type IB element and the remaining T residues are positioned downstream.

431

ssDNA-binding Proteins and DNA Replication

Figure 5. ssA-TIBF binds to the A-rich and T-rich strands of the C3 and B rDNA type IB element with similar af®nity. (a) Sequence of the C3 rDNA type IB element (boxed region) and ¯anking 30 nucleotides, and C3 and B rDNAspeci®c oligonucleotides used in gel shift and footprinting studies (nucleotides 30 to the type IB element are highlighted with bold italics). (b) Determination of the Kd values for ssA-TIBF with different DNA substrates. The photograph depicts a representative experiment using the B ssA53 substrate. Radiolabeled oligonucleotide (1.6 nM, 0.025 pmol) was incubated with different concentrations of protein (1.25  10ÿ10 M to 2.5  10ÿ7 M). B, oligonucleotide bound to protein; F, free oligonucleotide. Data from the plotted graphs yield the Kd values for each substrate. DNA substrates are depicted at the top of each graph. Each graph shown is one of three separate experiments for the given substrate (error bars depict the range of values obtained from individual experiments). Kd values reported are the average of three experiments. (c) Comparison of the relative binding af®nity of ssA-TIBF to C3 ssA53 versus C3 ssA37, and to B ssA53 versus B ssA37. Subsaturating amounts of ssA-TIBF were incubated with 0.1 pmol of labeled oligonucleotide (C3 ssA53 and B ssA53, respectively) in the absence and presence of cold competitor oligonucleotides. Each graph quantitatively represents the relative binding af®nities of the protein for the two substrates.

The B ssA53 substrate showed a modi®cation pattern that differed considerably from C3 ssA53. Positions T21, T38, T39, T40, T41, T42 were unaffected by the addition of ssA-TIBF; however, protection was observed at positions 24, 29 and 30 (Figure 8(b), compare lanes 1 and 2). Protection of residue T29, immediately 30 of the type IB element, was especially pronounced. In the case of C3 ssT50 and B ssT53, no T residue was protected in the presence of ssA-TIBF. Instead, hypersensitivity of residues T32, T35, T36, T37 and T38 was observed for the C3 allele (Figure 8(c), compare lanes 2 and 3). Positions T34, T35, T36, and T37 were similarly hypersensitive in B rDNA (Figure 8(d), lanes 1 and 2). T38 was unaffected in B rDNA by the addition of ssA-TIBF, whereas T34 was unaffected in the C3 allele. Thus the permanganate footprint for the T strand also revealed allele-speci®c differences in the binding of ssA-

TIBF to its DNA substrate. Although both alleles displayed hypersensitivity in the common portions of these two substrates, the ssA-TIBF induced KMnO4 modi®cation patterns were slightly different, suggesting that ssA-TIBF binds differently to these two DNA substrates.

Discussion With the exception of T. thermophila (reviewed by Kapler et al., 1996), S. cerevisiae (reviewed by Newlon, 1996), and Schizosaccharomyces pombe (Dubey et al., 1996), cis-acting genetic determinants for the initiation of eukaryotic DNA replication have been de®ned only by gross deletions or DNA rearrangements. Genetic studies on T. thermophila rDNA have identi®ed a multifunctional cis-acting determinant, the type I element, that regulates the

432

ssDNA-binding Proteins and DNA Replication

Figure 6 (legend opposite)

initiation of DNA replication (Larson et al., 1994; Yaeger et al., 1989; Gallagher & Blackburn, 1998; Reischmann et al., 1999), replication fork movement (MacAlpine et al., 1997), and transcription (Miyahara et al., 1993; Pan et al., 1995; R.E. Pearlman, personal communication). Three different sequence-speci®c type I element binding activities have been identi®ed thus far, all of which bind to single-stranded DNA. Several sequence-speci®c, single-stranded DNA binding proteins have been identi®ed as activators and repressors of transcription in other eukaryotes (Davis-Smyth et al., 1996; Ohmori et al., 1996; Menon et al., 1997). Although single-stranded DNA binding proteins that recognize the human c-myc origin (Bergemann et al., 1992) and yeast ARS elements (Kuno et al., 1990, 1991; Schmidt et al., 1991) have been identi®ed, a role in replication control has not been established. How DNA targets become accessible to singlestranded DNA binding proteins in vivo is not understood. Similarly, the basis for recognition of unstructured or structured, non-B form singlestranded DNA is unknown. The T strand of the

rDNA type I element resembles the protein binding site in the chick alpha2(I) collagen gene promoter, in that it contains a pyrimidine tract that is predicted to exist in a non-B DNA form (Bayarsaihan & Lukens, 1996). By comparison, recognition in RNA-based processes (transcription, translation), is typically mediated by interactions within short single-stranded loops or bulges in partially duplexed RNA (reviewed by Draper, 1995). The precise roles of the three type I element binding proteins in Tetrahymena rDNA metabolism awaits the cloning of these genes. However, in vitro biochemical experiments suggest a role for ssA-TIBF in replication initiation and/or subsequent replication fork movement. ssA-TIBF appears to be more abundant than the other type I element binding activities, binds to DNA with equal or greater af®nity (unpublished results), and binds differently to C3 rDNA and B rDNA alleles, the latter being partially defective for replication initiation and the regulation of replication fork movement.

ssDNA-binding Proteins and DNA Replication

433

Figure 6. ssA-TIBF produces an extended footprint over C3 rDNA type IB elements relative to B rDNA. DNase I footprinting was performed by incubating 0.025 pmol of the oligonucleotide substrates ((a) C3 ssA53; (b) B ssA53; (c) C3 ssT50; (d)) B ssT53) with increasing concentrations of ssA-TIBF and subjecting DNA-protein complexes to digestion with DNase I. Products were resolved by denaturing gel electrophoresis. M, sequence marker consisting of the G nucleotide ladder for the corresponding DNA substrates. Thick arrows depict nucleotides that are nuclease-hypersensitive in the presence of ssA-TIBF. Thin arrows depict one border of the footprint (bracketed region in cases where both ends were de®ned). The inset in (b) is a longer exposure of a portion of the gel showing the 50 border of the footprint.

Puri®ed ssA-TIBF is a homotetramer of subunit molecular mass 24 kDa, and thus could contain up to four DNA binding sites, one per monomer. The absence of repeated DNA sequence motifs suggested that each type I element is bound by just one ssA-TIBF subunit, a prediction veri®ed by UV crosslinking. Despite this, puri®ed ssA-TIBF binds only one DNA substrate in vitro, suggesting that the native tetramer alone cannot mediate longrange interactions between dispersed type I elements. Long-distance interactions are thought to play an important role in rDNA replication control (reviewed by Kapler et al., 1996). Recent experiments suggest that these interactions may involve protein-protein contacts between a type I element binding activity and a second protein that recognizes a different sequence at the origin (Gallagher & Blackburn, 1998). The T. thermophila genome is very A ‡ T-rich compared to most eukaryotes (T. thermophila

>70 %, humans 30 %, S. cerevisiae <40 %). The rDNA 50 NTS is 81 % A ‡ T, with the type I elements themselves being 84 % A ‡ T. ARS elements in yeast are ¯anked by A ‡ T-rich sequences that may serve as DNA unwinding elements. The extremely high A ‡ T content at Tetrahymena rDNA origins may favor DNA unwinding, even in the absence of helix-destabilizing DNA-protein interactions. Type I elements reside in segments that are devoid of nucleosomes (Palen & Cech, 1984), also a feature that may favor breathing. We postulate that single-stranded type I element binding proteins, such as ssA-TIBF, might function as initiator proteins that bind to type I elements that naturally oscillate between double and single-stranded states. Alternatively, the binding of these proteins may be secondary to a yet to be identi®ed double-stranded (ORC-like) DNAbinding activity that ®rst unwinds the duplex.

434

ssDNA-binding Proteins and DNA Replication

Figure 7. Methylation protection footprinting identi®es allele-speci®c interactions between ssA-TIBF and type I elements: 0.025 pmol of the oligonucleotide substrates ((a) C3 ssA53; (b) B ssA53; (c) C3 ssT50; (d) B ssT53)) were incubated with ssA-TIBF and subjected to treatment with DMS to identify protein-DNA contacts. Following treatment with piperidine, products were resolved by denaturing gel electrophoresis. Protected residues are indicated with ®lled arrows. Hypersensitive residues are indicated with ®lled triangles.

An unanticipated feature of ssA-TIBF is its ability to associate speci®cally with both the A-rich and T-rich strand of type I elements. Binding to both strands of the type I element, either independently or by a single homotetramer, is predicted to have a more stabilizing effect on origin unwinding, relative to binding of a single DNA strand, possibly committing the DNA to an ``open con®guration''. Interestingly, the SV40 initiator protein, large T antigen, binds both double and singlestranded forms of its recognition sequence (reviewed by Hassell & Brinton, 1996). In this case, binding to the duplex converts the origin to a single-stranded form. Single-stranded DNA binding has been proposed to stabilize the viral origin and promote the recruitment of replication enzymes. rDNA replication fork movement is also regulated by type I elements. Forks arrest transiently at speci®c positions upstream of the type I element and mutations in type I elements diminish fork pausing (MacAlpine et al., 1997). Single-stranded type I element binding proteins might inhibit the

progression of replication forks by selectively binding to their single-strand substrate following unwinding of the duplex by a replicative DNA helicase. Alternatively, the DNA binding site could be occupied prior to unwinding at the replication fork, similar to the human transcription termination factor TTF1 (Gerber et al., 1997). Whereas our current studies do not rule out an important regulatory role for the 32 and 110 kDa type I element binding proteins, the allele-speci®city demonstrated for ssA-TIBF suggests that it may be an important factor for DNA replication control. In contrast to a previous report (Hou et al., 1995), we show that allele-speci®city is the result of how the protein contacts DNA rather than due to a difference in binding af®nity for wild-type (C3) versus mutant (B) rDNA. A large difference in binding af®nity is not predicted by the phenotype of the B rDNA allele. B rDNA homozygotes are viable and grow at wild-type rates, indicating that rDNA metabolism (replication, expression) is not severely compromised. The B rDNA mutation produces a phenotype only when placed in competition with

ssDNA-binding Proteins and DNA Replication

435

Figure 8. Potassium permanganate footprinting identi®es allele-speci®c interactions between ssA-TIBF and type I elements: 0.025 pmol of oligonucleotide substrates ((a) C3 ssA53, (b) B ssA53, (c) C3 ssT50, (d) B ssT53)) were incubated with 250 nM ssA-TIBF and subjected to treatment with KMnO4 to identify protein-DNA contacts. Following treatment with piperidine, products were resolved by denaturing gel electrophoresis. M, sequence marker consisting of the G nucleotide ladder for the corresponding DNA substrate. Hypersensitive residues are indicated by ®lled triangles and protected residues are denoted by ®lled arrows.

the wild-type C3 rDNA allele. As little as a 10 % difference in replication ef®ciency can account for the advantage C3 rDNA has over B rDNA in heterozygotes (Larson et al., 1986). Signi®cant differences in DNA-protein contacts were detected by DNA footprinting. First, ssATIBF forms an extended footprint over the C3 rDNA type IB element (A-rich and T-rich strands) compared to the corresponding B rDNA substrates. The C3 rDNA footprints encompass the divergent sequences downstream of the type I element, and include the 50 portion of the type I element itself, which is identical in C3 and B rDNA. For C3 rDNA, the footprint is equal to or greater than the length of the substrates tested (53 and 50 nt for the C3 A-rich and T-rich strands, respectively). In contrast, ssA-TIBF protects only 30 nt in the A strand for the B rDNA allele. The length of the protected region on the T strand was greater (>40 nt; Figure 6(d), DNase I; Figure 7(d), DMS), but did not include the entire B rDNA substrate. These ®ndings suggest that ssA-TIBF interfaces with the two strands (A versus T) differently. DNA foot-

printing with KMnO4 con®rmed this prediction, and further suggests that the binding of ssA-TIBF to the T-rich strand dramatically alters the DNA structure. Whereas ssA-TIBF protects speci®c T residues in the A-rich strand of type IB element (C3 and B rDNA), T residues in the complementary T-rich strands are rendered hypersensitive to KMnO4 by ssA-TIBF, consistent with the idea that the DNA substrate is reordered upon protein binding. Whether these differences can explain allelespeci®c in vivo properties remains to be determined. For example, the pausing of replication forks upstream of type I elements is orientationdependent. Strand-speci®c differences in how ssATIBF contacts the DNA might account for this bias. The most salient feature about ssA-TIBF uncovered in these studies relates to allele-speci®c DNA binding. The primary sequence 30 of the type IB element is responsible for the different replication properties of C3 and B rDNA. Our in vitro experiments identi®ed unique footprints that distinguish binding to C3 and B rDNA (Figure 9). They include differences in reactivity at positions within the con-

436 served type I element sequence itself (A strand position 21, T strand positions 32, 34, 38 and 39), as well as at downstream nucleotides that fortuitously are common to both alleles (A strand positions 38 and 41). These observations provide evidence that ssA-TIBF contacts the DNA in a fundamentally different way in the two rDNA alleles. These differences in protein-DNA interactions in vitro are likely to re¯ect different protein conformations upon DNA binding in vivo. This in turn might affect protein-protein interactions, possibly diminishing the ability of ssA-TIBF to form productive replication complexes on B rDNA. Cloning the gene for ssA-TIBF and the other type I element binding proteins will be necessary to answer these and other questions. To this end, ssA-TIBF and the 32 kDa protein have been puri®ed to homogeneity and a partial peptide sequence has been obtained for ssA-TIBF.

Materials and Methods Strains and culture methods Extracts were prepared from Tetrahymena thermophila strain CU428. Cultures were grown at 30  C with gentle shaking in 2 % PPYS (2 % (w/v) proteose peptone, 0.2 % (v/v) yeast extract, 0.003 % (w/v) sequestrine) to which 250 mg/ml penicillin, 100 mg/ml streptomycin and 250 ng/ml amphotericin B had been added (Orias & Bruns, 1975). Oligonucleotides Synthetic oligonucleotides (Gibco-BRL) for DNA binding studies were puri®ed by denaturing gel electrophoresis followed by chromatography on Sep-pak C18

ssDNA-binding Proteins and DNA Replication cartridges (Millipore). Oligonucleotides were radiolabeled using [g-32P]ATP (ICN, 6000 Ci/mmol) and polynucleotide kinase (Gibco-BRL or New England Biolabs), and subsequently puri®ed by spin-column chromatography on Sephadex G50. C3 ssA37 is a 37mer containing the A-rich strand of the type IB element and ¯anking 30 sequences of the C3 rDNA allele. It lacks the seven nucleotide T tract at the 50 end of the type I elements, which was previously shown to be dispensable for binding (Hou et al., 1995). Similarly, B ssA37 corresponds to the analogous segment from the B rDNA allele, which carries a 42 bp deletion immediately 30 to the type IB element (Larson et al., 1986). ssA54 is a derivative of C3 ssA37 that contains additional random nucleotides at both the 50 and 30 ends. The remaining ssA- and ssToligonucleotides contain analogous portions of type I elements and downstream sequences from the respective C3 and B rDNA alleles. The sequences of these oligonucleotides are shown in Figure 5(a). Additional competitor oligonucleotides include type II T, consisting of the T-rich strand of the tandemly arrayed type IIA-C elements (50 GTTTTTTACTCGCCTGAGCGAGTTTATAA ATTCACCTGAGCGTATTTTT) and 2220rc, a reverse complement primer from the rRNA coding region (50 AACAGTACTAGCGTGTTGCG) (Engberg & Nielsen, 1990). Preparation of extracts and purification of ssA-TIBF S100 extracts from mid-log phase cells (2.5 x 105 cells/ ml) were prepared as described (Hou et al., 1995). Protease inhibitors were purchased from Boehringer Mannheim. Typically, 55-60 ml of extract (protein concentration 8-10 mg/ml) were obtained from 4 l of culture. ssA-TIBF was puri®ed from S100 extracts using a modi®cation of the Hou et al. (1995) method (D. Dobbs, personal communication). To purify ssA-TIBF, nucleic acids were ®rst precipitated by treating the extracts with 0.9 % (w/v) strepto-

Figure 9. Allele-speci®c interactions between ssA-TIBF and each strand of the C3 and B rDNA type IB element. Summary of positions in the A-rich and T-rich strands of the C3 and B rDNA type IB element that were protected (®lled circle) or hypersensitive (open triangle) to DMS or KMnO4 in the presence of ssA-TIBF. Boxed segments correspond to type IB element sequences that are conserved between C3 and B rDNA. Unboxed sequences are 30 to the type IB element. The marked positions indicate nucleotide positions relative to the 50 end of the substrate DNA for the A-rich and complementary T-rich strands (drawn here in the same orientation).

437

ssDNA-binding Proteins and DNA Replication mycin sulfate at 4  C with stirring, followed by centrifugation at 20,000 g for 40 minutes. The supernatant was adjusted to 90 % saturation with solid ammonium sulfate, with slow stirring at 4  C for one hour to precipitate proteins. Insoluble proteins were pelleted by centrifugation at 11,000 g for ten minutes. The protein pellet was resuspended in and dialyzed against phosphate buffer (10 mM potassium phosphate (pH 7.0), 10 % (v/v) glycerol, 1 mM DTT) and loaded onto a Biogel HTP column (BioRad, 75 ml bed volume). After washing the column with two bed volumes of the phosphate buffer, the protein was eluted using a 350 ml linear phosphate gradient, 20 mM-600 mM phosphate (pH 7.0). Fractions were analyzed for ssA-TIBF activity by gel mobility shift assays with the radiolabeled C3 ssA37 oligonucleotide (see below). Two peaks of activity were observed, the ®rst eluting between 150 and 225 mM potassium phosphate (pH 7.0) and the second, more abundant peak eluting between 275 and 400 mM phosphate. Peak 2 fractions were pooled and dialyzed against TEG-NaCl buffer (10 mM Tris (pH 8.0), 1 mM EDTA, 20 % glycerol, 100 mM NaCl, 1 mM DTT) and subjected to chromatography on double-stranded DNA cellulose (Sigma, 15 ml bed volume). After washing the column with TEG-NaCl buffer, the column was eluted with a 75 ml linear sodium chloride gradient (100 mM-1500 mM NaCl). ssATIBF-containing fractions eluted between 550 and 1200 mM sodium chloride. Pooled peak fractions were dialyzed against TEMG-NaCl buffer (10 mM Tris (pH 8.0), 1 mM EDTA, 2 mM MgCl2, 20 % glycerol, 100 mM NaCl, 1 mM DTT) prior to chromatography on a 1 ml oligo af®nity column consisting of the biotinylated C3 ssA37 oligonucleotide coupled to streptavidinagarose beads (Gibco-BRL). Proteins were eluted using a step gradient of NaCl (200 mM-1400 mM) in TEMG buffer. About 4-6 mg of pure ssA-TIBF was obtained per 4l of culture, eluting from the ®nal column between 400 and 800 mM sodium chloride. Protein concentrations were quantitated by the Bradford method for crude extracts (BioRad; Bradford, 1976) and Micro BCA method for puri®ed protein (Pierce Chemicals; Wiechelman et al., 1988). For the purpose of quantifying puri®ed protein, DTT was not included in the af®nity column buffers.

Gel retardation assays DNA-protein binding reactions were carried out in 16 ml reaction volumes in a Hepes-based buffer (12 mM Hepes (pH 7.9), 0.1 mM EDTA, 12.5 % glycerol, 5 mM MgCl2 , 30 mM KCl, 1 mM DTT) in the presence of 5 mg of bovine serum albumin on ice for 10-15 minutes: 0.1 pmol of oligonucleotide was used per reaction in standard activity assays. Reactions were analyzed by electrophoresis on non-denaturing 5 % polyacrylamide gels at room temperature in TBE (200 V, two hours). In experiments designed to determine the number of DNA binding sites on native ssA-TIBF, DNA-protein complexes were resolved by electrophoresis on 1100  1700 , non-denaturing 4 % gels in TBE (100V for 16-20 hours at room temperature). For Kd value determinations, 0.025 pmol of oligonucleotide was used per reaction. Gels were either exposed to X-ray ®lm or subjected to PhosphorImager analysis (Packard Cyclone apparatus) to quantify the radioactivity in individual bands.

UV and glutaraldehyde crosslinking studies For UV crosslinking studies, puri®ed ssA-TIBF was incubated with 0.1 pmol of radiolabeled C3 ssA37 for 10-15 minutes on ice prior to UV irradiation (on ice) for varying times in a Stratalinker UV crosslinker at a distance of 5 cm from the UV source. Reactions were stopped by the addition of SDS-PAGE loading dye and analyzed by electrophoresis on 0.1 % SDS/12 % polyacrylamide gels. Dried gels were exposed for autoradiography at ÿ70  C for 12-20 hours. Glutaraldehyde crosslinking studies were performed by incubating puri®ed ssA-TIBF protein with 0.1 % glutaraldehyde (Sigma) for 15-20 minutes at room temperature, followed by SDS-PAGE and silver staining (BioRad). Determination of binding parameters Apparent equilibrium dissociation constants (Kd) were determined as described (Carey, 1991). A constant amount of radiolabeled oligonucleotide was incubated with increasing amounts of puri®ed ssA-TIBF and Kd estimated from the resulting hyperbolic curve (Kd ˆ [ssA-TIBF] at 50 % maximal binding). Corrections were made for inactive DNA molecules prior to plotting of graphs. Bound and unbound oligonucleotides were quanti®ed by PhosphorImager analysis as described above. The reported Kd values are the average of three experiments. Relative binding af®nities of oligonucleotides were determined as described (Hou et al., 1995). Each experiment was done three times and the values obtained for each concentration point varied between 7 and 10 %. Data from single experiments are shown here. Relative binding af®nities obtained from all experiments of a set were identical. DNase I, dimethyl sulfate and potassium permanganate footprinting DNase I treatment of DNA-protein complexes was carried out following incubation of ssA-TIBF with 0.025 pmol of labeled oligonucleotide for 10-15 minutes on ice as described for gel retardation assays. DNase I (3.2 units; FPLC pure, Pharmacia/Amersham) was added to each reaction and quickly mixed prior to incubation at 30  C for 3.5 minutes. Reactions were stopped by the addition of 8 ml of formamide stop dye. Approximately one-third of each reaction was analyzed by electrophoresis on 8 M urea/12 % polyacrylamide gels, at 1700 V for 2-2.5 hours. Gels were exposed for autoradiography at ÿ70  C for 24-72 hours. For DMS and KMnO4 analyses, binding reactions were carried out as described above, except that DTT was omitted from the binding buffer. After binding, the reactions were treated with either 0.25 % (v/v) DMS (Sigma) or 0.25 mM KMnO4 (Sigma) at 30  C for ten minutes before stopping the reaction by the addition of 2 ml of 2-mercaptoethanol. DNA was precipitated by the addition of 5 ml of saturated ammonium acetate, 1 mg of yeast total RNA and 50 ml of ethanol. The DNA pellet was resuspended in 10 ml of TE and reprecipitated. The dried DNA pellet was resuspended in 100 ml of freshly prepared 1 M piperidine (Sigma) and incubated at 90  C for 30 minutes. Samples were then vacuum-dried and the dried pellet resuspended in 100 ml of water, vortex mixed thoroughly and re-dried. This was repeated twice with 100 ml and 50 ml of water, respectively. The ®nal pellets were resuspended in 10 ml of formamide dye and reactions analyzed by electrophoresis on 8 M urea/12 %

438 polyacrylamide gels at 1700 V for 2-2.5 hours. Gels were typically exposed for autoradiography for 24-36 hours at ÿ70  C.

Acknowledgments We are grateful to Drena Dobbs for communicating unpublished results, including the use of hydroxyapatite and double-strand DNA cellulose chromatography for the puri®cation of ssA-TIBF. We thank Dorothy Shippen for critical reading of the manuscript. We are especially grateful to Vinay Nandicoori for help in the preparation of Figures. This work was supported by NIH grant GM56572.

References Aladjem, M. I., Groudine, M., Brody, L. L., Dieken, E. S., Fournier, R. E., Wahl, G. M. & Epner, E. M. (1995). Participation of the human beta-globin locus control region in initiation of DNA replication. Science, 270, 815-819. Aparicio, O., Weinstein, D. & Bell, S. (1997). Components and dynamics of DNA replication complexes in S. cerevisiae: redistribution of MCM proteins and Cdc45p during S phase. Cell, 91, 59-69. Bayarsaihan, D. & Lukens, L. N. (1996). Single-strandDNA-binding factors speci®cally recognize the pyrimidine element in the chick alpha2(I) collagen gene promoter. Biochem. J. 314, 293-296. Bell, S. P. & Stillman, B. (1992). ATP-dependent recognition of eukaryotic origins of DNA replication by a multiprotein complex. Nature, 357, 128-134. Bergemann, A. D., Ma, Z. W. & Johnson, E. M. (1992). Sequence of cDNA comprising the human pur gene and sequence-speci®c single-stranded-DNA-binding properties of the encoded protein. Mol. Cell. Biol. 12, 5673-5782. Blomberg, P., Randolph, C., Yao, C.-H. & Yao, M.-C. (1997). Regulatory sequences for ampli®cation and replication of the ribosomal DNA minichromosome in Tetrahymena thermophila. Mol. Cell. Biol. 17, 72377247. Bonven, B. J., Gocke, E. & Westergaard, O. (1985). A high af®nity topoisomerase I binding sequence is clustered at DNase I I hypersensitive sites in Tetrahymena rDNA-chromatin. Cell, 41, 541-551. Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254. Brewer, B. J. & Fangman, W. L. (1988). A replication fork barrier at the 30 end of yeast ribosomal RNA genes. Cell, 55, 637-643. Carey, J. (1991). Gel retardation. Methods Enzymol. 208, 103-117. Challoner, P. B., Amin, A. A., Pearlman, R. E. & Blackburn, E. H. (1985). Conserved arrangement of repeated DNA sequences in non-transcribed spacers of ciliated ribosomal RNA genes: evidence for molecular coevolution. Nucl. Acids Res. 13, 2661-2680. Davis-Smyth, T., Duncan, R. C., Zheng, T., Michelotti, G. & Levens, D. (1996). The far upstream elementbind proteins comprise an ancient family of singlestrand DNA-binding transactivators. J. Biol. Chem. 271, 31679-31687.

ssDNA-binding Proteins and DNA Replication Delidakis, C. & Kafatos, F. C. (1989). Ampli®cation enhancers and replication origins in the autosomal chorion gene cluster of Drosophila. EMBO J. 8, 891901. Deshpande, A. M. & Newlon, C. S. (1996). DNA replication fork pause sites dependent on transcription. Science, 272, 1030-1033. Dif¯ey, J. F. X., Cocker, J. H., Dowell, S. J. & Rowley, A. (1994). Two steps in the assembly of complexes at yeast replication origins in vivo. Cell, 78, 303-316. Draper, D. E. (1995). Protein-RNA recognition. Annu. Rev. Biochem. 64, 593-620. Dubey, D. D., S.-M, K., Todorov, I. T. & Huberman, J. A. (1996). Large, complex modular structure of a ®ssion yeast DNA replication origin. Curr. Biol. 6, 467473. Engberg, J. & Nielsen, H. (1990). Complete sequence of the extrachromosomal rDNA molecule of the ciliate Tetrahymena thermophila strain B1868VII. Nucl. Acids Res. 18, 6915-6919. Galas, D. J. & Schmitz, A. (1978). DNase I footprinting: a simple method for the detection of protein-DNA binding speci®city. Nucl. Acids Res. 5, 3157-3170. Gallagher, R. C. & Blackburn, E. H. (1998). A promoter mutation affecting replication of the Tetrahymena ribosomal DNA minichromosome. Mol. Cell. Biol. 18, 3021-3033. Gerber, J.-K., Gogel, E., Berger, C., Wallisch, M., Muller, F., Grummt, I. & Grummt, F. (1997). Termination of mammalian rDNA replication: polar arrest of replication fork movement by transcription terminator factor TTF-1. Cell, 90, 559-567. Hassell, J. A. & Brinton, B. T. (1996). SV40 and polyoma virus replication. In DNA Replication in Eukaryotic Cells (DePamphilis, M. L., ed.), pp. 639-678, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Heck, M. M. S. & Spradling, A. C. (1990). Multiple replication origins are used during Drosophila chorion gene ampli®cation. J. Cell Biol. 110, 903-914. Hou, Z., Umthum, A. R. & Dobbs, D. L. (1995). A single-stranded DNA binding protein that speci®cally recognizes cis-acting sequences in the replication origin and transcriptional promoter region of Tetrahymena rDNA. Biochemistry, 34, 4583-4592. Kapler, G. M. & Blackburn, E. H. (1994). A weak germline excision mutation blocks developmentally controlled ampli®cation of the rDNA minichromosome of Tetrahymena thermophila. Genes Dev. 8, 84-95. Kapler, G. M., Orias, E. & Blackburn, E. H. (1994). Tetrahymena thermophila mutants defective in the developmentally programmed maturation and maintenance of the rDNA minichromosome. Genetics, 137, 455-466. Kapler, G. M., Larson, D. D. & Blackburn, E. H. (1996). DNA replication in Tetrahymena. In DNA Replication in Eukaryotic Cells (DePamphilis, M. L., ed.), pp. 915-932, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Kitsberg, D., Selig, S. & Cedar, H. (1993). Replication structure of the human beta-globin domain. Nature, 366, 588-590. Kuno, K., Murakami, S. & Kuno, S. (1990). Singlestrand-binding factor(s) which interact with ARS1 of Saccharomyces cerevisiae. Gene, 95, 73-77. Kuno, K., Kuno, S., Matsushima, K. & Murakami, S. (1991). Evidence for binding of at least two factors, including T-rich strand-binding factor(s) to the

ssDNA-binding Proteins and DNA Replication single-stranded ARS1 sequence in Saccharomyces cerevisiae. Mol. Gen. Genet. 230, 45-48. Larson, D. D., Blackburn, E. H., Yaeger, P. C. & Orias, E. (1986). Control of rDNA replication in Tetrahymena involves a cis-acting upstream repeat of a promoter element. Cell, 47, 229-240. Larson, D. D., Shau, W.-L. & Benbow, R. M. (1994). Modular sequence elements associated with origin regions in eukaryotic chromosomal DNA. Nucl. Acids Res. 22, 2479-2489. MacAlpine, D. M., Zhang, Z. & Kapler, G. M. (1997). Type I elements mediate replication fork pausing at conserved upstream sites in the Tetrahymena thermophila rDNA minichromosome. Mol. Cell. Biol. 17, 4517-4525. Marahrens, Y. & Stillman, B. (1992). A yeast chromosomal origin of DNA replication de®ned by multiple functional elements. Science, 255, 817-823. Menon, R. K., Cheng, H. & Singh, M. (1997). Identi®cation and characterization of a single strand DNAbindng protein that represses growth hormone receptor gene expression. Mol. Endocrinol. 11, 12911304. Miyahara, K., Hashimoto, T., Higashinakagawa, T. & Pearlman, R. E. (1993). Common sequence elements are important for transcription and replication of the extrachromosomal rRNA-encoding genes of Tetrahymena. Gene, 127, 209-213. Newlon, C. S. (1996). DNA replication in yeast. In DNA Replication in Eukaryotic Cells (DePamphilis, M. L., ed.), pp. 873-914, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Ohmori, M., Ohta, M., Shimura, H., Shimurat, Y., Suzuki, K. & Kohn, L. D. (1996). Cloning of the single strand DNA-binding protein important for maximal expression and thyrotropin (TSH)-induced negative regulation of the TSH receptor. Mol. Endocrinol. 10, 1407-1424. Orias, E. & Bruns, P. J. (1975). Induction and isolation of mutants in Tetrahymena. Methods Cell Biol. 13, 247282. Palen, T. E. & Cech, T. R. (1984). Chromatin structure at the replication origins and transcription-initiation regions of the ribosomal RNA genes of Tetrahymena. Cell, 36, 933-942. Pan, W.-J., Gallagher, R. C. & Blackburn, E. H. (1995). Replication of an rDNA gene origin plasmid in the

439 Tetrahymena thermophila macronucleus is prevented by transcription through the origin from an RNA polymerase I promoter. Mol. Cell. Biol. 15, 33723381. Reischmann, K. P., Zhang, Z. & Kapler, G. M. (1999). Long range cooperative interactions regulate the initiation of replication in the Tetrahymena thermophila rDNA minichromosome. Nucl. Acids Res. 26, 4635-4644. Schmidt, A. M., Herterich, S. U. & Krauss, G. (1991). A single-stranded DNA binding protein from S. cerevisiae speci®cally recognizes the T-rich strand of the core sequence of ARS elements and discriminates against mutant sequences. EMBO J. 10, 981-985. Umek, R. M. & Kowalski, D. (1988). The ease of DNA unwinding as a determinant of initiation at yeast replication origins. Cell, 52, 559-567. Umthun, A. R., Hou, Z., Sibenaller, Z. A., Shiau, W.-L. & Dobbs, D. L. (1994). Identi®cation of DNA-binding proteins that recognize a conserved type I repeat sequence in the replication origin region of Tetrahymena rDNA. Nucl. Acids Res. 22, 4432-4440. Wiechelman, K. J., Braun, R. D. & Fitzpatrick, J. D. (1988). Investigation of the bicinchoninic acid protein assay: identi®cation of the groups responsible for color formation. Anal. Biochem. 175, 231-237. Yaeger, P. C., Orias, E., Shaiu, W.-L., Larson, D. D. & Blackburn, E. H. (1989). The replication advantage of a free linear rDNA gene is restored by somatic recombination in Tetrahymena thermophila. Mol. Cell. Biol. 9, 452-460. Yao, M.-C., Kimmel, A. R. & Gorovsky, M. A. (1974). A small number of cistrons for ribosomal RNA in the germline nucleus of a eukaryote, Tetrahymena pyriformis. Proc. Natl Acad. Sci. USA, 71, 3082-3086. Yao, M.-C., Yao, C.-H. & Monks, B. (1990). The controlling sequence for site-speci®c chromosome breakage in Tetrahymena. Cell, 63, 763-772. Yasuda, L. F. & Yao, M.-C. (1991). Short inverted repeats at a free end signal large palindromic DNA formation in Tetrahymena. Cell, 67, 505-516. Zhang, Z., MacAlpine, D. M. & Kapler, G. M. (1997). Developmental regulation of DNA replication: replication fork barriers and programmed gene ampli®cation in Tetrahymena. Mol. Cell. Biol. 17, 6147-6156.

Edited by T. Richmond (Received 9 August 1999; received in revised form 3 November 1999; accepted 3 November 1999)