Allozyme and DNA sequence data support speciation of Northern and Southern populations of silver catfish, Schilbe intermedius (Rüppel, 1832)

Comparative Biochemistry and Physiology Part A 120 (1998) 531 – 543

Allozyme and DNA sequence data support speciation of Northern and Southern populations of silver catfish, Schilbe intermedius (Ru¨ppel, 1832) F.H. van der Bank a,*, G.D. Engelbrecht a, H. Sauer-Gu¨rth b, M. Wink b, P.F.S. Mulder c b

a Department of Zoology, Rand Afrikaans Uni6ersity, P.O. Box 524, Auckland Park 2006, South Africa Uni6ersita¨t Heidelberg, Institut fu¨r Pharmazeutische Biologie, Im Neuenheimer Feld 364, D-69120 Heidelberg, Germany c Department of Physiology, Uni6ersity of the North, Pri6ate Bag X1106, So6enga, 0727, South Africa

Received 5 January 1998; accepted 2 April 1998

Abstract Patterns of genetic variation in Schilbe intermedius were investigated due to morphological differences and taxonomic uncertainties regarding the Southern African schilbeids. A total of three populations, two Southern populations representing the former Eutropius depressirostris and a Northern population representing S. mystus, were electrophoretically analysed to determine the extent of genetic differentiation among these populations. The Northern and Southern populations were fixed for different alleles at the G3PDH-2 protein coding locus and allozyme differentiation between populations, using the 0.95 criterion, were also encountered at the PGDH-2 locus. Genetic distance values indicate greater genetic differentiation between the Northern and Southern populations compared to the two Southern populations. DNA sequence analysis of 900 – 1000 nucleotides of the cytochrome b gene revealed distances of 3.2–3.5% between the Schilbe/Eutropius complex. This finding, together with ingroup and outgroup analysis of evolutionary relationships, is congruent with the results from the electrophoretic analysis of the taxa. Sufficient differentiation exist between the Northern and Southern populations to regard them as distinct species. © 1998 Elsevier Science Inc. All rights reserved. Keywords: Schilbe; Eutropius; Schilbeidae; DNA sequence; Electrophoresis; Genetic distance; Taxonomy

1. Introduction The Schilbeidae is a speciose family of relative small catfishes found in tropical and sub-tropical African and Asian freshwaters. The genus Schilbe is commonly known as butter- or silverbarbels. Some species have been studied extensively with the aid of conventional taxonomic methods [14 – 16]. Although a new classification for schilbeids has been proposed [14], there remain many problems regarding species borders and taxonomic relationships between species of this family. Schilbe intermedius [51] has a widespread distribution

* Corresponding author. Tel.: +27 11 4892450; fax: + 27 11 4892286; e-mail: [email protected]. 1095-6433/98/$19.00 © 1998 Elsevier Science Inc. All rights reserved. PII S1095-6433(98)10063-6

in East and West Africa, the Nile, the Zaire-basin and the upper reaches of the Zambezi River System up to Lake Kariba. Southern African populations of S. intermedius were, until as recently as 1984, subdivided in two different genera (Schilbe and Eutropius). The genera were distinguished by the presence of an adipose fin in Eutropius and the absence thereof in Schilbe. The form previously known as E. depressirostris [47], occurs in the East flowing rivers of Africa from Kenya in the North up to as far South as the Pongola River System in KwaZulu-Natal, South Africa [6,14]. Its distribution in Southern Africa includes the Zambezi River System below the Victoria Falls, and the lowveld river systems of Zimbabwe, Mozambique, the Transvaal and KwaZulu-Natal Provinces (South Africa). The two

532

F.H. 6an der Bank et al. / Comparati6e Biochemistry and Physiology, Part A 120 (1998) 531–543

Table 1 Informative characters in the data set studied (positions 1 to 910)

nominal species are therefore geographically isolated, except in Lake Kariba where both species occur [5]. De Vos [14] found three museum samples of S. intermedius from West Africa with an adipose fin and

regards the presence or absence of the adipose fin as an insufficient character to distinguish between these species on the generic and subgeneric level. This author consequently abandoned the use of this character for

F.H. 6an der Bank et al. / Comparati6e Biochemistry and Physiology, Part A 120 (1998) 531–543

533

Table 1 (Continued)

“, character identical to that in the first line.

taxonomic purposes. As a result of the inconsistency regarding the presence or absence of the adipose fin (since other species are still differentiated into the above mentioned groups based on this character), E. depressirostris is considered to be synonymous with S. intermedius [14]. However, this author erroneously described E. depressirostris as a species without an adipose fin and S. intermedius as a species without an adipose fin or with a rudimentary adipose fin. In addition, a morphometric study of the types of S. mystus and S. (E.) niloticus suggested that they are actually conspecific [16]. Schilbe mystus and S. (E.) niloticus are also synonyms of the species formerly known as E. niloticus, and S. intermedius is the senior synonym of the species misidentified as S. mystus (i.e. the Southern African species). To complicate matters further, an electrophoretic study of S. mystus and E. niloticus from the Volta Basin in Ghana, indicated that S. mystus comprises several cryptic species [1]. Eutropius niloticus had a close relationship with one population of Schilbe and the authors suspected that this population could represent an isolated population of E. depressirostris, a species which has never before been recorded in West Africa.

The confusion regarding the taxonomic and phylogenetic relationships of the schilbeids necessitated the confirmation of the taxonomic status of S. intermedius and the former E. depressirostris. Successful management of a species, especially of commercially important fish such as schilbeids, require a full understanding of the quantity and spatial distribution of genetic variation. Gel-electrophoresis is a technique that has been successfully applied in the past to assay genetic variation and differentiation in many organisms [49]. The usefulness of electrophoresis for delineating taxonomic borders and for inferring evolutionary relationships have been reported by various authors [12,23,24,43,55]. Engelbrecht et al. [17,18] studied the protein variation of S. intermedius from the Upper Zambezi and the Limpopo River Systems. The data obtained in these studies was used in the present study to provide comparative genetic information on the degree of relatedness of populations representing S. intermedius and the former E. depressirostris. We have also used DNA sequence analysis to study the above-mentioned species complex. This method is a very powerful tool for taxonomic and evolutionary studies. Problems of character adaptation and convergence, which sometimes can obscure the morphological analysis, are much re-

534

F.H. 6an der Bank et al. / Comparati6e Biochemistry and Physiology, Part A 120 (1998) 531–543

Fig. 1. Map showing sampling localities: 1, Hans Strijdom; 2, Magalakwena; 3, the Zambezi River.

F.H. 6an der Bank et al. / Comparati6e Biochemistry and Physiology, Part A 120 (1998) 531–543

535

Fig. 2. Reconstruction of the molecular phylogeny of the Schilbe/Eutropius-complex by (A) NJ analysis based on cytochrome b sequences using Micropterus as an outgroup and the electric fishes Pollimyrus and Marcusenius as ingroups; numbers at each furcation in the phylogram are bootstrap values (1000 replicates using the TAMURA-NEI distance algorithm); (B) MP, phylogram of the most parsimonious bootstrap tree (length 468 steps, CI = 0.919, HI =0.08, RI =0.916); branch and bound search; options: addition sequence furthest, compute via stepwise, keep minimal trees only, ACCTRAN, MULPARS; numbers at each furcation in the phylogram represent inferred changes, which are almost equivalent to the number of nucleotide substitutions; bootstrap values at all furcations are 100%; and (C) ML, Ln likelihood = −3707.29; all branch lengths between taxa are significantly positive (P B0.01) [20].

duced when using sequences of marker genes. Marker genes employed at present are not those controlling the development or the morphology of a species, but rather those encoding enzymes or rRNA [4,27]. For animals, sequences of mitochondrial genes are often chosen as markers, since they have a higher variability than nuclear DNA. Among these mitochondrial genes, the cytochrome b gene, in which deletions, inversions and insertions are of minor importance, as compared to ribosomal genes which are also often used to infer molecular phylogenies, has often been employed to reconstruct the evolutionary past of vertebrates [2,4,28,32–35,38,50,53,56,65,67].

depressirostris (= S. intermedius) individuals (SA1-5) were sampled from the Zambezi River (17°32%S; 24°31%E) and Glen Alpine Dam (23°14%S; 28°42%E), Magalakwena River [18], respectively. The specimens were labeled individually and deposited in the JLB Smith Institute for Icthyology, Grahamstown, South Africa. Voucher numbers are RUSI 056106 and RUSI 056105 for NAM1-2 and SA1-5, respectively. Marcusenius macrolepidotus from the Crocodile River, South Africa (25°30%S; 31°11%E) and the Zambezi River (17°32%S; 24°31%E), together with Pollimyrus castelnaui from the Cuando River (18°09%S; 23°23%E) were used as ingroup species. DNA was isolated from muscle tissue, which was preserved in ethanol, using the ‘proteinase K method’ as described by Kocher et al. [29].

2. Materials and methods

2.2. PCR and DNA-sequencing 2.1. DNA-isolation A total of two S. intermedius (NAM1-2) and five E.

Primer pairs used for PCR (modified from [29,44]) were L-14841 (5%-CCATCCAACATCTCAGCATGAT-

536

F.H. 6an der Bank et al. / Comparati6e Biochemistry and Physiology, Part A 120 (1998) 531–543

Fig. 2. (Continued)

GAAA-3%) [positions refer to the cytochrome b gene of Gallus [13]]: and mt-F (H-15917; 5%-TAGTTGGCCAATGATGATGAATGGGTGTTCTACTGGTT-3%): or L14724 (5%-CGAAGCTTGATATGAAAAACCATCGTTG-3%) and Mt-E (H-15713; 5%-AATAGGAAGTATCATTCGGGTTTGT-3%). For amplification 0.5 mg of total DNA was used as a template, plus 20 pmol each of the two corresponding PCR primers, 1.5 mM MgCl2, 0.1 mM of each dNTPs, 5 ml 10 × amplification buffer (100 mM Tris–HCl, pH 8.5, 500 mM KCl, 5% Triton x-100)and 0.5 U Taq-Polymerase (Pharmacia, Freiburg) in a total volume of 50 ml. After an initial denaturation (4 min at 94°C), 30 cycles of 45 s at 94°C, 60 s at 52°C and 120 s at 72° C were performed on a Biometra thermocycler. After 30 cycles the reaction temperature was maintained at 72°C for 10 min and then lowered to 4°C for further storage. A total of 0.2–2 ml of 50 ml double-stranded PCR product was used to carry out cycle sequencing reactions to produce single strand PCR products, terminated by the four didesoxy nucleotides according to the protocol of Amersham Life Science (Braunschweig) ‘Thermo sequenase fluorescent labeled primer cycle sequencing kit with 7-deaza-dGTP’. The following sequencing primers

which were labeled with ‘DyeAmidite 667’ in a ‘Gene assembler plus’ (Pharmacia, Freiburg), were employed to obtain overlapping sequences: Mt-CCy 5-%*CTA/CCCATGAGGA/CCAAATA/CTC-3%, Mt-LECy 5%*TCAAACCCGAATGATAC/TTTCCTATT-3%; MtECy 5%-*AATAGGAAA/GTATCATTCTGGTTTGA3%, and S-Mt-BCy 5%-*TCAAAATGATATTTGTCCTC3%. PCR conditions: initially 94°C 3 min, then 30 cycles with 30 s at 94°C, and 40 s at 60°C; the vials were maintained at 4°C after synthesis. Products of the sequencing reactions were analysed with the automated DNA sequencer ‘ALF-Express’ (Pharmacia, Freiburg). Gels: 11% Hydrolink/urea (a total volume of 320 ml contained 116 g urea, 35.2 ml longrange hydrolink (Seachem), and 48 ml 10x TBE) solutions were filtered (0.45 mm) and 40 ml (to which 200 ml APS and 20 ml Temed were added) were used to produce 0.3 mm electrophoresis gels. Electrophoresis conditions: Temperature 55°C; 25 W, 60 mA, 800 V; 700 min. The sequences were aligned to the cytochrome b sequence of Micropterus salmoides [63] which was also used as an outgroup. Sequence data, whose informative characters are shown in Table 1, will be deposited in the Sequence Library of EMBL. The full

F.H. 6an der Bank et al. / Comparati6e Biochemistry and Physiology, Part A 120 (1998) 531–543

537

Fig. 2. (Continued)

length DNA sequences can be obtained from [email protected] and it will also be submitted to GenBank. Phylogenetic trees were reconstructed by Maximum Parsimony (MP) analysis (phylogeny program PAUP 3.1.1) [58], the distance matrix method Neighbour Joining (NJ, as implemented in the program package MEGA 1.0; 1000 replicates) [30] and Maximum Likelihood analysis (ML; DNAML in PHYLIP; version 3.572c) [20]. In Neighbour Joining analyses, genetic distances were calculated based on the Tamura-Nei algorithm which takes differences in transition/transversion rates into account. Bootstrap analyses were performed to obtain confidence estimates for each furcation. Maximum Parsimony is a character state method. A Branch and Bound exact search (addition sequence furthest; swapping algorithm: TBR; MULPARS OPTION) was carried out. Results can be illustrated as clado- or phylograms (in phylograms, branch lengths are proportional to the number of inferred changes or evolutionary distances).

2.3. Electrophoresis A total of 160 individuals comprising three populations were sampled. The populations were sampled

from the Zambezi River (17°32%S; 24°31%E) near Lake Lisikili (60 individuals), the Magalakwena River (23°12%S; 28°40%E) (50 individuals) and the Hans Strijdom Dam (24°00’S; 27°45’E) in the Mogol River (50 individuals). The latter two (Southern) populations are both from the Limpopo River System and represent E. depressirostris. The Northern population represents S. intermedius (Fig. 1). Sampling and electrophoretic procedures are described in Engelbrecht et al. [17,18]. Relative gene diversities were calculated to determine the extent of genetic differentiation within and between all three populations using the method of Chakraborty et al. [11]. The F-statistics were also calculated [66] to determine the fixation indices relative to the total population (FIT) and its subpopulations (FIS), respectively and also as a measure of genetic divergence among subpopulations (FST) relative to the amount under complete fixation. Nei’s [40] genetic distance (D) coefficient was used and standard errors of D were calculated according to Nei and Roychoudhury [41]. The results of the distance data were then used to construct dendrograms using UPGMA (Unweighted Pair Group Method using Arithmetic Averages) [54] and Distance Wagner trees

538

F.H. 6an der Bank et al. / Comparati6e Biochemistry and Physiology, Part A 120 (1998) 531–543

Table 2 Pairwise genetic distances between taxa based on 900 nucleotides of the cytochrome b gene Nucleotides

1

2

3

4

5

6

7

8

9

11

20

1. Outgroup 2. S. intermedius NAM1 3. S. intermedius NAM2 4. E. depressirostris SA1 5. E. depressirostris SA2 6. E. depressirostris SA3 7. E. depressirostris SA4 8. E. depressirostris SA5 9. M. macrolepidotus 1 11. M. macrolepidotus 12 20. P. castelnaui CR9

234 235 201 199 203 202 200 213 206 163

0.223 1 29 30 30 28 30 220 206 162

0.224 0.001 30 31 31 29 31 221 207 163

0.221 0.032 0.033 4 3 3 7 196 183 166

0.222 0.034 0.035 0.005 3 5 7 194 182 167

0.223 0.033 0.034 0.003 0.003 4 4 197 185 166

0.221 0.031 0.032 0.003 0.006 0.004 5 196 183 166

0.223 0.033 0.035 0.008 0.008 0.005 0.006 195 184 166

0.216 0.225 0.226 0.221 0.223 0.222 0.211 0.223 29 103

0.208 0.209 0.210 0.201 0.204 0.203 0.200 0.206 0.030 98

0.204 0.203 0.204 0.208 0.209 0.208 0.208 0.208 0.123 0.123 -

Below diagonal: total character differences; above diagonal: proportion of nucleotides differing (1.0 = 100%)

[19]. Nei’s D was used for UPGMA analysis because of its superiority in estimating branch lengths [42]. The analyses of allozyme data were performed using the BIOSYS-1 computer program [59]. A Wagner parsimony tree was also constructed using PAUP (Phylogenetic Analysis Using Parsimony, version 2.4) [57] algorithm. Lundberg rooting was used to construct a tree from binary coded transformation (if allele present=1, if absent =0) as described by Mickevich and Mitter [36,37].

intermedius and its presence in E. depressirostris merits its use as a valid taxonomic character. The presence or absence of the adipose fin is an important taxonomic character in several other genera (e.g. Icthyococcus, [7]; Hemigrammocharax, [46]; Gonostoma, [48]). Abban (personal communication) has obtained similar results for West African schilbeid and also disagrees with the revision by De Vos and Skelton [16]. They (Abban and Teugels) plan to revise the Schilbe/Eutropius complex using genetic and morphological studies.

3.2. DNA sequence data 3. Results and discussion

3.1. Morphology It is possible to distinguish morphologically between the Northern and Southern populations of Southern African schilbeids studied. It was suggested that the presence or absence of the adipose fin as a taxonomic character in the schilbeids should be discarded [14]. We disagree as we believe the adipose fin is a constant character. The presence of an adipose fin has never been observed in Cunene- and Upper Zambezi River System populations of S. intermedius (FHVDB, personal observation; Skelton, personal communiction). However, Bell-Cross (personal communication) found S. intermedius individuals from the Upper Kafue River with a rudimentary adipose fin. Given the degree of morphological similarities that exists between schilbeid species, it is conceivable that these individuals may represent a cryptic species of Eutropius, an isolated population of E. depressirostris or hybrids. It may be worthwhile to examine individuals from this locality genetically to obtain a better understanding of their phylogenetic relationship with other Southern African schilbeids. Furthermore, the absence of an adipose fin in E. depressirostris individuals has never been observed by the authors of this study. Therefore, we believe that the consistency of the absence of the adipose fin in S.

DNA sequencing of Schilbe intermedius and Eutropius depressirostris (termed ‘Schilbe/Eutropius complex’) and South African electric fishes (Marcusenius, Pollimyrus) as ingroups yielded between 900 and 1000 nucleotides with 356 variable and 224 parsimony informative characters (Table 1). The transition/transversion ratio between Schilbe and Eutropius accounts for 4.03. The evaluation of 1000 random trees (using PAUP 3.1.1) show a substantial skewness of tree-length distribution and provides a g1 value of − 1.148 indicating that the data set contains a significant (PB 0.05) phylogenetic signal [26]. The underlying phylogeny was reconstructed employing MP, NJ, and ML. The topology of the resulting trees was identical (Fig. 2) and furcations between taxa are supported by bootstrap values of 100% indicating that the phylogenetic relationships obtained are apparently robust and reliable. A total of two monophyletic clades are evident: (a) Schilbe and Eutropius; (b) Marcusenius and Pollimyrus, which, respectively, share common ancestry. Intraspecific variation of 0.48% was obtained in cytochrome b from cod from different regions of Norway and the Arctic area [3]; and in cottoid fish of Lake Baikal divergence between related species was between 0.7 and 3.8% [54]. The distances between S. intermedius and E. depressirostris lie between 3.2 and 3.5%, and fall

F.H. 6an der Bank et al. / Comparati6e Biochemistry and Physiology, Part A 120 (1998) 531–543

within the above-mentioned range. The intraspecific distances are between 0.09 and 0.8% (Table 2). Distances between well established and unrelated genera, e.g. between Marcusenius and Pollimyrus, Schilbe or Eutropius are much higher (i.e. 12.2 – 22.6%), indicating that speciation of Schilbe and Eutropius must be more recent. In mammals a crude molecular clock equates 2% nucleotide differences with 1 million years divergence time [9,64]. It has been suggested that the molecular clock shows an even slower rate in fishes than in Table 3 Polymorphic loci, relative mobility RM of alleles, allelic frequencies and gene diversity within and between three populations of S. intermedius Locus

ADH-3

EST-1 EST-2

GAPDH-2

GAPDH-3

GDA−2 G3PDH-2 GPI-3

IDH-3 LDH-2 ME-2 MPI-2 MPI-3 PGDH-2 PGM-3 PROT-3 PROT-4 PROT-5 SOD-1

RM

−100 −200 −350 100 93 100 93 88 122 100 78 −100 −200 −350 100 90 100 93 128 100 71 −100 −200 128 100 100 90 100 93 100 90 113 100 100 89 106 100 107 100 110 100 100 96

Locality Zambezi

Magalakwena Hans Strijdom

0.984 0.008 0.008 0.975 0.025 0.825 0.167 0.008 0.067 0.916 0.017 0.984 0.008 0.008 0.925 0.075 1.000

1.000

0.083 0.834 0.083 0.967 0.033 1.000 0.992 0.008 0.950 0.050 0.992 0.008 0.008 0.992 0.992 0.008 0.025 0.975 0.110 0.890 0.155 0.845 0.983 0.017

539

mammals [10,54]. Even if this calibration is very crude, it suggests that Schilbe and Eutropius must have seperated more than 1.6 or even 3.2 million years ago, which would be long enough to develop into separate species. Given the small sample size analysed, our data suggest that we are dealing with two species, but that this result needs to be confirmed by a wider data set and the analysis of a nuclear marker gene. Whether they should be classified in different genera appears more questionable. In this context, it is interesting to note that two distinct haplotypes (distance 2.9%; Table 2) were discovered in M. macrolepidotus, which are separated geographically. Marcusenius macrolepidotus from South Africa (SA12; Fig. 2) is a distinct species (based on electric organ differences, morphology and genetics; Kramer et al., in press) from the species in Namibia (NAM1).

3.3. Electrophoretic study

1.000

1.000

1.000

1.000

1.000

1.000

1.000

1.000

1.000

1.000

1.000

1.000 1.000

1.000 0.080 0.920

1.000

1.000

1.000 1.000

0.060 0.940 1.000

0.680 0.320 1.000

1.000

1.000

1.000

1.000

1.000

1.000

1.000

1.000

1.000

1.000 1.000

1.000 1.000

1.000

The enzyme systems screened, enzyme commission (EC) numbers, buffer systems used and tissue sources are as referred to by Engelbrecht et al. [17,18]. The gene products of 63 loci were detected of which 60 yielded interpretable results. Proteins that revealed differences either in mobility or allele frequency are comparatively presented in Table 3. The two Southern populations and the Northern population have fixed allelic differences (95% criterion) at two loci, G3PDH-2 and PGDH-2 (Fig. 3). Alleles at these loci can therefore be used in routine electrophoretic analysis to distinguish between the Northern and Southern populations of S. intermedius. Thorpe and Sole`-Cava [60] described a statistical test to determine the probability that two samples are from the same gene pool. The method to estimate probabilities for fixed allelic differences in samples N1 and N2 is: P: (n/2N1)2N2 where n is the number of fixed allele differences between taxa. The two Southern populations were pooled to form one population (N2 = 100). A value of P= 0 was obtained which means that the probability that the Northern and Southern populations are from the same gene pool is zero. Analysis of the gene diversity between populations also gives a good indication of the amount of genetic divergence present between populations and species. The largest amount of genetic variation between species is derived from the between population level of organisation [39]. The relative gene diversity analysis in the present study revealed that 53.5% (9 18.1%) of the total diversity originated from diversity between populations and 46.5% (9 18.1%) from within populations. The values are comparable to the average between-population relative gene diversity value of 53% and the within-population value of 47% obtained for populations of Clarias gariepinus [61]. These authors subse-

540

F.H. 6an der Bank et al. / Comparati6e Biochemistry and Physiology, Part A 120 (1998) 531–543

Fig. 3. Allele mobility differences between individuals form the Schilbe/Eutropius-complex at the PGDH-2 protein coding locus (1, Zambezi; 2, Magalakwena; 3, Hans Strijdom).

quently confirmed the view that C. lazera is a synonym for C. gariepinus. However, the values reflect the gene diversity for all three populations studied, and it is thus not surprising that the relatively little gene diversity for the pooled samples of the present study suggests that E. depressirostris is closely related to S. intermedius [14]. For example, the gene diversity values are 0.037 for all populations, and more (0.042) for the Zambezi and Hans Strijdom populations, respectively. The FST values are related to gene diversity analysis [59]. A summary of F-statistics for all populations is listed in Table 4; the mean FIS value across all polymorphic loci is 0.437, the mean FIT value is 0.742 and the mean FST value is 0.542 for all populations. The mean FST value suggests substantial genetic differentiation of the Northern and the Southern populations. This result is supported by the D values (Table 4). Values of D between the Northern and Southern populations ranged from 0.0355 to 0.0370 whereas a value of only 0.0018 was obtained between the Southern populations. The values of D and FST (Table 4) between the two Southern populations, suggest marginal gene flow or, at least, a recent separation of the gene pools between the Table 4 Nei’s (1978) (D) genetic distances below diagonal and F-statistic values (FIS, FIT and FST) above diagonal between three populations of S. intermedius Populations

Magalakwena

Magalakwena

Hans Strijdom

Hans Strijdom

Zambezi

0.827 (FIS) 0.851 (FIT) 0.139 (FST)

0.406 0.701 0.496 0.335

0.0018 (D) (9 0.016)

(FIS) (FIT) (FST) (FIS)

0.672 (FIT) 0.507 (FST) Zambezi

0.0370 (D) (9 0.024)

0.0355 (D) ( 9 0.024)

S.E. of D are presented in parentheses

two populations. This is to be expected from two populations originating from the same river system. However, the higher D value (mean= 0.036) between the Northern and Southern populations indicates restricted or no gene flow. The latter is supported by the value of P= 0 (the probability that the populations share a same gene pool) as discussed previously. To infer phylogenetic relationships between populations, species, genera and families from D values, there must be good agreement between D and taxonomic category [24]. Genetic distance estimates between various taxonomic groups range from 0.002 to 0.065 (9 0.05) between conspecific populations, 0.025–0.65 (9 0.3) between congeneric species, and 0.58–1.21 (9 0.9) between genera [52]. However, these values should not be viewed as absolute criteria to assign samples to a taxonomic category since molecular divergence is a continuous process and the boundaries between the different taxonomic categories are not sharp [21,24]. The average D value (0.036) between the two Southern populations and the Northern population obtained in the present study (Table 4), reflects the similarities based on a very large number of loci studied (N=60; 17,18), and this is most likely the reason why the D value is not consistent with estimates of genetic distance associated with those obtained by others for congeneric species (based on data from 22–30 loci). It is wellknown that sample size, number of loci and the choice of loci may have differences in genetic variation [31], which influences D values. For example, the original estimate for average heterozygosity in humans [25] turned out to be 50% too small. Phylogenetic trees constructed using different methods, consistently separated the Northern population from the Southern populations. The UPGMA phenogram constructed using D values had a percentage standard deviation of 2.027 and a cophenetic correlation of 99.9% and the Distance Wagner tree constructed using PAUP had a consistency index of 97.3%. All the

F.H. 6an der Bank et al. / Comparati6e Biochemistry and Physiology, Part A 120 (1998) 531–543

trees produced similar topologies. The trees consisted of two clusters, one cluster representing the Northern population and the other cluster grouped the two Southern populations. In conclusion, the question arises whether the differences observed are sufficient to justify a taxonomic distinction of the populations. It is believed that it is sufficient based on the following five observations. (1) The presence of the adipose fin in the Southern populations and the absence of it in the Northern population were consistently observed in field studies. (2) This is supported by geological data. The Victoria- and Kafue Falls and the Rift Valley present very efficient barriers to fish distribution and, most often, to effectively isolate species. Furthermore, there is no geographic evidence of river captures or linkings between the Limpopo River System and the Zambezi River System [45,62]. However, several authors speculated on a linkage between the Lower Limpopo and the Lower Zambezi rivers [8,22]. These authors argue that the evidence for their theory lies in the presence of certain fish species in the systems mentioned, which do not occur in other parts of the river (i.e. the Upper Zambezi) or Okavango River System. Eutropius depressirostris is but one of these fish species that support their theory. The link between the Limpopo and Lower Zambezi River Systems probably extended into Natal, and it is assumed that Natal received the remainder of its species via this route [22]. Thus, it is most likely that geographic isolation of the Northern and Southern populations in the present study set the scene for independent evolvement and genetic divergence. It should be stressed that genetic distance values do not give an indication of phylogenetic changes, but it represents the genetic differences and similarities that occurred between the populations. For the populations in the present study it is most probable that allopatric speciation occurred, with the Victoria- and Kafue Falls and the Rift Valleys establishing geographic barriers between the Northern and Southern populations. (3) Substantial DNA sequence differences were obtained. (4) There are fixed allelic mobility differences at two loci between the Northern and Southern populations. The existence of allele mobility differences between populations is a significant evolutionary event in the phylogenetic history of a species since this indicates large genetic differentiation between populations. The fixed electromorphic differences between the Northern and Southern populations confirm the notion that gene flow has been very low or absent for a very long time to allow speciation to commence. Finally, phylogenetic analyses (which consistently separated the Northern and Southern populations of S. intermedius) merits the recognition of the Northern and Southern populations analysed in the present study as distinct species. Because of substantial morphological differences (the

541

adipose fin), we also suggest that the taxa should be treated as members of different genera, S. intermedius and E. depressirostris.

Acknowledgements We thank Professor Paul Skelton from the J.L.B. Smith Institute for Ichthyology for critically reviewing the Introduction.

References [1] Abban EK, Skibinski DOF. Protein variation in Schilbe mystus (L.) and Eutropius niloticus (Ru¨ppel) (Pisces: Siluriformes) in the Volta Basin of Ghana, West Africa. Aquacult Fish Manage 1988;19:25 – 37. [2] Alves-Gomes J, Hopkins CD. Molecular insights into the phylogeny of Mormyriform fishes and the evolution of their electric organs. Brain Behav Evol 1997;49:324 – 51. [3] Arnason E, Palsson S. Mitochondrial cytochrome b DNA sequence variation of Atlantic cod Gadus morhua, from Norway. Mol Ecol 1996;5:715 – 24. [4] Avise JC. Molecular Markers, Natural History and Evolution. London: Chapman and Hall, 1994. [5] Bell-Cross G. The fish fauna of the Zambezi River System. Arnoldia 1972;5(29):1 – 19. [6] Bell-Cross G, Minshull JL. The Fishes of Zimbabwe. Trustees of the National Museums and Monuments of Zimbabwe, Harare,1988. [7] Bonaparte CL. Inconografia della fauna italica per le quattro classidegli animali vertebrati, tomo 3, Pesci, Roma, 1841;30:155– 160. [8] Bowmaker AP, Jackson PBN, Jubb RA. Freshwater fishes. In: Werger MJA, editor, Biogeography and ecology of Southern Africa Junk, The Hague, 1978:1181 – 1230. [9] Brown WM, George M., Wilson, A.C. Rapid evolution of animal mitochondrial DNA. Proc Natl Acad Sci 1979;76:1967– 1971. [10] Cantatore P, Roberti M, Pesole G, Ludovico A, Milella F, Gadaleta MN, Saccone C. Evolutionary analysis of cytochrome b sequences in some Perciformes: Evidence for a slower rate of evolution than in mammals. J Mol Evol 1994;39:589 – 97. [11] Chakraborty R, Haag M, Ryman N, Stahl G. Hierarchial gene diversity analysis and its application to brown trout population data. Hereditas 1982;97:17 – 22. [12] Creech S. An electrophoretic investigation of populations of Atherina boyeri Risso, 1810 and A. presbyter Cuvier, 1829 (Teleostei: Atherinidae): genetic evidence in support of the two species. J Fish Biol 1991;39:807 – 16. [13] Desjardins P, Morais R. Sequence and gene organisation of chicken mitochondrial genome: a novel gene order in higher vertebrates. J Mol Biol 1990;212:599 – 634. [14] De Vos L. Preliminary data of a systematic revision of the African species of the family Schilbeidae (Pisces, Siluriformes). Rev Zool Afr 1984;98(2):424– 33. [15] De Vos L, Leveque C. Etude syste´matique et morphologique du genre Eutropius en Afrique de L’ouest (Pisces, Schilbeidae). Rev Zool Afr 1983;97(3):469– 532. [16] De Vos L, Skelton P. Name changes for two common African catfishes. Rehabilitation of Schilbe intermedius Ru¨ppel, 1832 (Siluriformes, Schilbeidae). Cybium 1990;14(4):323– 6.

542

F.H. 6an der Bank et al. / Comparati6e Biochemistry and Physiology, Part A 120 (1998) 531–543

[17] Engelbrecht GD, Van der Bank FH, Mulder PFS. Allozyme variation in Schilbe intermedius Ru¨ppel, 1832 (Pisces; Siluriformes) from the upper Zambezi River System. Comp Biochem Physiol 1994;109B(2/3):511–517. [18] Engelbrecht GD, Van der Bank FH, Mulder PFS. Allozyme variation in Schilbe intermedius Ru¨ppel, 1832 (Pisces; Siluriformes) from two locailities in the Limpopo River System, South Africa. Comp Biochem Physiol 1997;117B(2):179– 181. [19] Farris JS. Estimating phylogenetic trees from distance matrices. Am Natur 1972;106:645–68. [20] Felsenstein, J. PHYLIP (Phylogenetic Interference Package Version 3.5.c). Distributed by the author. Department of Genetics University, Washington, Seattle, 1993. [21] Ferreira JT, Grant WS, Avtalion RR. Workshop on Fish Genetics. CSIR Special Publication, Pretoria;1984. [22] Gaigher IG, Pott McC. Distribution of fishes in Southern Africa. S Afr J Sci 1973;69:25–27. [23] Gajardo GM, Beardmore JA. Electrophoretic evidence suggests that the Artemia found in the Salar de Atacama, Chile, is A. franciscana Kellogg. Hydrobiology 1993;257:65–71. [24] Grant WS, Dempster YL, Da Silva FM. Use of protein electrophoresis in evolutionary systematics. Trans R Soc S Afr 1988;46(4):295– 311. [25] Harris H, Hopkinson DA. Handbook of Enzyme Electrophoresis in Human Genetics. North-Holland, Amsterdam;1976. [26] Hillis D, Huelsenbeck JP. Signal, noise, and reliability in molecular phylogenetic analysis. J Heredity 1992;83:189– 95. [27] Hillis D, Moritz C, Mable BK. Molecular Systematics, 2 ed., Sinauer, 1996. [28] Kocher TD, Conroy JA, McKaye KR, Stauffer JR. Similar morphologies of cichlid fish in Lakes Tanganyika and Malawi are due to convergence. Mol Phyl Evol 1993;2:18–165. [29] Kocher TD, Thomas WK, Meyer A, Edwards SV, Pa¨a¨bo S, Villablan FX, Wilson AC. Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proc Natl Acad Sci USA 1989;86:6196– 200. [30] Kumar S, Tamura K, Nei M. MEGA-Molecular Evolutionary Genetics Analysis. Version 1.0. Pennsylvania State University, 1993. [31] Lewontin RC. The Genetic Basis of Evolutionary Change. New York: Columbia University Press, 1994. [32] Lydeard C, Wooten MC, Meyer A. Cytochrome b sequence variation and a molecular phylogeny of the live-bearing fish genus Gambusia (Cyprinodontiformes: Poeciliidae). Ca. J Zool 1995;73:213 – 27. [33] Meyer A. Phylogenetic relationships and evolutionary processes in East African Cichlid fishes. Trends Ecol Evol 1993;8:279 – 84. [34] Meyer A. Shortcomings of the cytochrome b gene as a molecular marker. Trends Ecol Evol 1994;9:278–80. [35] Meyer A, Kocher DT, Basasibwaki P, Wilson AC. Monophyletic origin of Lake Victoria cichlid fishes suggested by mitochondrial DNA sequences. Nature 1990;347:550 – 3. [36] Mickevich MF, Mitter C, Treating polymorphic characters in systematics: a phylogenetic treatment of electrophoretic data. In: Funk VA, Brooks, DR, editors, Advances in Cladistics, New York Botanical Gardden, Bronx, NY, 1981:45–58. [37] Mickevich MF, Mitter C. Evolutionary patterns in allozyme data: a systematic approach. In: Platnick, N.I., Funk, V.A., editors, Advances in Cladistics, Vol. 2, Proc. 2nd Meet. Willi Hennig Soc. Columbia University Press, New York, 1983:169 – 176. [38] Moran P, Kornfield I, Reinthal PN. Molecular systematics and radiation of the haplochromine cichlids (Teleostei: Perciformes) of Lake Malawi. Copeia 1994:274–278.

[39] Nei M. Analysis of gene diversity in subdivided populations. Proc Natl Acad Sci USA 1973;70(12):3321– 3. [40] Nei M. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 1978;89:583 – 91. [41] Nei M, Roychoudhury AK. Sampling variances of heterozygosity and genetic distance. Genetics 1974;76:379–90. [42] Nei M, Tajima F, Tateno Y. Accuracy of estimated phylogenetic trees from molecular data. II. Gene frequency data. J Mol Evol 1983;19:153 – 70. [43] Oosthuizen JS, Van der Bank FH, Ferreira JT. Genetic distances between and evolutionary relationships for Tilapia guinasana, T. rendalli and T. sparrmanii. Biochem Syst Ecol 1993;21(3):351– 62. [44] Pa¨a¨bo S. Amplifying ancient DNA. In: Innes MA, Gelfand DH, Sninsky JJ-, White J, editors, PCR Protocols: A guide to methods and applications, Academic Press, San Diego, CA, 1990:159 – 166, [45] Partridge TC, Maud RR. Geomorphic evolution of Southern Africa since the mesozoic. S Afr J Geol 1987;90(2):179–208. [46] Pellegrin J. Les poissons des eaux douces de l’Afrique occidentale (du Se´ne´gal au Niger). Publs. Comm. Etud. hist. scient. Afr. occid. fr., In: Larose E. editor, Paris, 1923. [47] Peters WCH. Diagnosen von neuen Fluss-Fischen aus Mossambique. Mber dt Akad Wiss Berl 1852;275 – 276:681–5. [48] Rafinesque CS. Caratteri di alcani nuovi generi e nuovi specie di animali (principalmente di pesci) e piante della Sicilia, con varie osservazioni sopra i medisimi. Palermo, (Reprint, 1967, Asher-Amsterdam), 1810:105. [49] Richardson BJ, Baverstock PR. Adams M. Allozyme Electrophoresis. New York: Academic Press, 1986:410. [50] Roe KJ, Conkel D, Lydeard C. Molecular systematics of middle American cichlid fishes and the evolution of trophic types in ‘Cichlasoma (Amphilobius)A and C. (Thorichthys). Mol Phylog Evol 1197;7:366 – 376. [51] Ru¨ppel E. Fortsetzung der Beschreibung und Abbildung mehrerer neuer Fische, im Nil entdeckt. Frankfurt a. M. 1832:14. [52] Shaklee JB, Tamaru CS, Waples RS. Speciation and evolution of marine fishes studies by electrophoretic analysis of proteins. Pac Sci 1982;36:141 – 57. [53] Slobodyanyuk SL, Kirilchik SV, Pavlova ME, Belikov SI, Novitsky AL. The evolutionary relationships of two families of cottoid fishes of Lake Baikal (East Siberia) as suggested by analysis of mitochondrial DNA. J Mol Evol 1995;40:392–9. [54] Sneath PH, Sokal RR. Numerical Taxonomy. Freeman, San Francisco, 1973. [55] Stoneking M, Wagner DJ, Hildebrand AC. Genetic evidence suggesting subspecific differences between Northern and Southern populations of brook trout (Sal6elinus fontinalis). Copeia 1981;4:810 – 9. [56] Sturmbauer C, Meyer A. Genetic divergence, speciation, and morphological stasis in a lineage of African cichlid fishes. Nature 1992;359:578 – 81. [57] Swofford DL. PAUP: Phylogenetic Analysis Using Parsimony Version 2.4. Illisnois Natural History Survey, 607 East Peabody Drive, Champaign, Illisnois 1985:61820. [58] Swofford DL. PAUP, Phylogenetic analysis using parsimony. Version 3.1.1 Illinois;1993. [59] Swofford DL, Selander RB. BIOSYS-1: a FORTRAN program for the comprehensive analysis of electrophoretic data in population genetics and systematics. J Hered 1981;72:281– 3. [60] Thorpe JP, Sole`-Cava AM. The use of allozyme electrophoresis in invertebrate systematics. Zool Scripta 1994;23:3 –18.

F.H. 6an der Bank et al. / Comparati6e Biochemistry and Physiology, Part A 120 (1998) 531–543 [61] Van der Walt LD, Van der Bank FH, Steyn GJ. Allozyme variation in domesticated African catfish (Clarias gariepinus) from the Netherlands. Comp Biochem Physiol 1993;104B(1):15– 8. [62] Wellington JH. Southern Africa: a geographical study, Vol. I, Physical geography. The University Press, Cambridge, 1955. [63] Whitmore DH, Thai TH, Craft CM. The largemouth bass cytochrome b gene. J Fish Biol 1994;44:637–45. [64] Wilson AC, Ochmann H, Prager EM. Molecular time scale for evolution. Trends Genet 1987;3:241–7.

.

543

[65] Wittmann U, Heidrich P, Wink M, Gwinner E. Speciation in the stonechat (Saxicola torquatara) inferred from nucleotide sequences of the cytochrome b gene. J Zool Syst Evol Res 1995;33:116 – 22. [66] Wright S. The interpretation of populations structure by Fstatistics with special regard to systems of mating. Evolution 1965;19:395 – 420. [67] Zhu D, Jamieson BGM, Hugall A, Moritz C. Sequence evolution and phylogenetic signal in control-region and cytochrome b sequences of Rainbow fishes (Mlelanotaenidae). Mol Biol Evol 1994;11:672 – 83.

.