Alpha-linolenic acid enhances the phagocytic and secretory functions of alternatively activated macrophages in part via changes to the oxylipin profile

Journal Pre-proof Alpha-linolenic acid enhances the phagocytic and secretory functions of alternatively activated macrophages in part via changes to the oxylipin profile Samantha D. Pauls, Lisa A. Rodway, Tanja Winter, Carla G. Taylor, Peter Zahradka, Harold M. Aukema

PII:

S1357-2725(19)30239-0

DOI:

https://doi.org/10.1016/j.biocel.2019.105662

Reference:

BC 105662

To appear in:

International Journal of Biochemistry and Cell Biology

Received Date:

7 September 2019

Revised Date:

30 November 2019

Accepted Date:

3 December 2019

Please cite this article as: Pauls SD, Rodway LA, Winter T, Taylor CG, Zahradka P, Aukema HM, Alpha-linolenic acid enhances the phagocytic and secretory functions of alternatively activated macrophages in part via changes to the oxylipin profile, International Journal of Biochemistry and Cell Biology (2019), doi: https://doi.org/10.1016/j.biocel.2019.105662

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Alpha-linolenic acid enhances the phagocytic and secretory functions of alternatively activated macrophages in part via changes to the oxylipin profile Samantha D Paulsa,b, Lisa A Rodwaya,b, Tanja Wintera,b, Carla G Taylora,b,c, Peter Zahradkaa,b,c and Harold M Aukemaa,b,* Department of Food and Human Nutritional Sciences, University of Manitoba, Canada

b

Canadian Centre for Agri-Food Research in Health and Medicine, Winnipeg, Canada

*

ro

Department of Physiology and Pathophysiology, University of Manitoba, Canada

Corresponding Author:

-p

c

of

a

Harold Aukema, PhD

re

Rm 2018 St Boniface Hospital Albrechtsen Research Centre

Winnipeg, MB R2H 2A6

ur na

Ph. (204) 258-1364

lP

351 Taché Avenue

Fax. (204) 237-4018

Email. [email protected]

Jo

Running Title: ALA promotes M2 macrophage function by altering oxylipins

This work was supported by the Canadian Institutes of Health Research [MOP-133667]. Infrastructure support was from the St. Boniface Hospital Foundation

ABSTRACT Alternatively activated macrophages are innate immune cells that contribute to resolution of inflammation and maintenance of homeostasis. Modulation of available fatty acid sources is thought to affect cellular physiology through a variety of mechanisms, including through alterations to the profile of oxygenated free fatty acid metabolites, called oxylipins, produced in a

of

cell type specific manner. Here, we investigated how treatment with the plant-sourced omega-3 fatty acid α-linolenic acid (ALA) affects the oxylipin profile and functional capacity of a cell

ro

culture model of human alternatively activated (M2a-like) macrophages. In a targeted but

-p

unbiased screen, ALA enhanced the production of oxylipins from all polyunsaturated fatty acid (PUFA) precursors, with oxylipins derived from ALA being enhanced the most. Consistently,

re

ALA treatment enhanced the expression of both cytoplasmic and calcium-independent phospholipase A2. At a functional level, ALA treatment increased phagocytic activity and

lP

altered production of the chemokine MCP-1 by M2a-like cells in a manner dependent on the time of treatment. ALA treatment during polarization increased MCP-1 secretion, which was

ur na

sensitive to pharmacological inhibition of 15-LOX-1 by ML351. Thus, ALA modulates the phenotype of alternatively activated macrophages, likely through its own LOX-derived oxylipins and/or through general modulation of oxylipin biosynthesis. These effects likely contribute to the

Jo

overall anti-inflammatory benefit observed with ALA supplementation. Keywords: Macrophage, Inflammation, α-linolenic acid, Oxylipins, phospholipase A2

2

Abbreviations: AA, arachidonic acid; ALA, α-linolenic acid; COX, cyclooxygenase; CYPE, cytochrome P450 epoxygenase; CYPH, cytochrome P450 hydrolase; DGLA, dihomo-gammalinolenic acid; dh, dihydro; dhk, dihydroketo; DiHDoHE, dihydroxy-docosahexaenoic acid; DiHDPE, dihydroxy-docosapentaenoic acid; DiHETrE, dihydroxy-eicosatrienoic acid; DiHOME, dihydroxy-octadecenoic acid; EPA, eicosapentaenoic acid; EpDPE, epoxyeicosadocosapentaenoic acid; EpETE, epoxy-eicosatetraenoic acid; EpETrE, epoxy-

of

eicosatrienoic acid; EpODE, epoxy-eicosadienoic acid; EpOME, epoxy-octadecenoic acid; FA,

ro

fatty acid; GLA, gamma-linolenic acid; HDoHE, hydroxy-docosahexaenoic acid; HEPE,

hydroxy-eicosapentaenoic acid; HETE, hydroxy-eicosatetraenoic acid; HETrE, hydroxy-

-p

eicosatrienoic acid; HHTrE, hydroxy-heptadecatrienoic acid; HODE, hydroxy-octadecadienoic

re

acid; HOTrE, hydroxy-octadecatrienoic acid; IL, interkeukin; k, keto; LA, linoleic acid; LOX, lipoxygenase; LPS, lipopolysaccharide; OA, oleic acid; oxoEDE, oxo-eicosadienoic acid;

lP

oxoETE, oxo-eicosatetraenoic acid; oxoODE, oxo-octadecadienoic acid; oxoOTrE , oxooctadecatrienoic acid; PG, prostaglandin; PLA2, phospholipase A2; tet, tetranor; TriHOME,

Jo

ur na

trihydroxy-octadecenoic acid; TX, thromboxane.

3

1 INTRODUCTION Macrophages are critical innate immune cells that can adjust their phenotype in response to external cues in surrounding tissues, taking on either pro-inflammatory characteristics in response to bacterial infection or unresolved inflammation, or a pro-resolving/anti-inflammatory phenotype at late stages of acute inflammation (1). At one end of the phenotypic spectrum are

of

the classically activated macrophages, called M1, that are typically triggered by bacterial lipopolysaccharide (LPS) and interferon- (IFN-) γ. At the other end are the alternatively activated

ro

macrophages, called M2a, that are typically triggered by interleukin- (IL-) 4 and IL-13 (2).

-p

In conditions of chronic, unresolved inflammation, such as what is often observed in obesity, the balance of these functional macrophage populations is pathogenically skewed such that M1

re

outnumber M2 macrophages (3). Since M1 cells produce large amounts of pro-inflammatory

lP

cytokines, they reinforce the chronic inflammatory state. On the other hand, M2 cells clean up apoptotic cell fragments and pathogens by phagocytosis into acidic vehicles (4) without contributing undue pro-inflammatory cytokines to the milieu (5). Early interventions that help

ur na

restore the inflammatory balance could potentially slow or prevent the development of chronic disease. Dietary intervention is an ideal approach since it can be applied at early stages of disease development. Some of the most promising anti-inflammatory food constituents studied so far are

Jo

omega-3 polyunsaturated fatty acids (PUFAs). Several studies investigating fish oil as a source of docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) have demonstrated that their supplementation decreases systemic inflammatory markers in obese patients (6, 7). There is also strong evidence for a benefit in rheumatoid arthritis, with mixed results reported for inflammatory bowel disease and asthma (8). Far fewer studies have examined the anti4

inflammatory effects of α-linolenic acid (ALA), the major plant-derived omega-3 PUFA. ALA is an essential dietary fatty acid (FA) that can be converted to EPA and DHA in the body, albeit at very low rates (9). Clinical trials have revealed an anti-inflammatory effect for ALA in obesity (10, 11). Fish oil and ALA-rich oil have similar immunomodulatory capacities in tumor-bearing rats (12) and both DHA and ALA reduce pro-inflammatory cytokine production by monocyte

of

cell cultures with indistinguishable potency (13). PUFAs are thought to exert their bioactive effects through multiple mechanisms, including

ro

directly via receptor mediated signaling, through structural alteration of cell membranes and by

-p

enzymatic and non-enzymatic conversion to oxygenated metabolites called oxylipins. Oxylipins then act through G protein coupled receptors or lipid binding transcription factors (14). The best

re

studied oxylipins are those produced from the omega-6 PUFA arachidonic acid (AA) by the cyclooxygenase (COX), lipoxygenase (LOX), and cytochrome P450 (CYP) enzyme families (15,

lP

16). These are typically classified as pro-inflammatory mediators, although some have antiinflammatory, modulatory or tissue specific bioactivities (14). EPA and DHA are substrates for

ur na

these same enzyme families (17-19). Their oxylipin derivatives can antagonize the actions of AA-derived oxylipins and/or initiate unique pro-resolving signaling pathways (14). Oxylipins derived from ALA have also been identified (20) and may contribute to the overall bioactivities

Jo

of ALA directly, without a need for conversion to longer chain EPA and DHA. A more comprehensive understanding of the types of oxylipins present under various conditions and descriptions of the functional impact of discrete oxylipins will be important steps toward informing better therapeutic use of omega-3 FA and/or manipulation of their metabolites with the goal of resolving chronic inflammation.

5

Our previous study revealed that classically activated (M1-like) cell line-derived human macrophages respond to ALA treatment by reducing their production of pro-inflammatory cytokines in response to bacterial LPS stimulation (21). This effect was accompanied by a considerable enhancement in the production of oxylipins derived from ALA and from linoleic acid (LA), and a reduction in those derived from DHA. In the current study, we investigate how ALA modulates oxylipin production by alternatively activated [M(IL4+IL13) referred to here as

of

M2a-like] macrophages and how this relates to changes in cellular function. We report that

ro

treatment with ALA during polarization to the M2a-like state leads to a general increase in oxylipins from all precursor PUFAs, with ALA oxylipins and LOX products being the most

-p

markedly upregulated. Mechanistically, this can be explained by an increase in cytoplasmic and

re

calcium-independent phospholipase A2 (cPLA2 and iPLA2) expression, the enzymes responsible for freeing FA from membrane phospholipids (22). These changes were accompanied by

lP

enhancements in phagocytosis and secretion of monocyte chemoattractant protein-1 (MCP-1, also known as CCL2), which are well-described M2 cellular activities (4, 23). Pharmacological

ur na

inhibition of 15-LOX-1 abrogated the effect of ALA on MCP-1 secretion, suggesting that the effects of ALA are at least in part mediated by alterations to the oxylipin profile. Modulation of both classically activated and alternatively activated macrophage function likely contributes to

Jo

the overall beneficial effects of ALA in chronic inflammatory conditions.

6

2 MATERIALS AND METHODS 2.1 Cell culture THP-1 human monocytes (TIB-202, ATCC, VA) were maintained at a density of 2.5×105-1x106 cells/ml in RPMI-1640 medium (Gibco) supplemented with 10% FBS (Wisent) in a humidified atmosphere with 5% CO2. Differentiation to macrophages was achieved by plating at 5×105

of

cells/ml (1.56×105 cells/cm2) in tissue culture treated, flat-bottom plates (Nunc) with 5ng/ml

ro

PMA (Sigma) for 48h followed by 24h in medium alone (24). Cells were cultured an additional 72h with alternative activation stimuli, 20ng/ml each IL-4 and IL-13 (R&D Systems), to induce

re

2.2 Fatty acid treatment and LPS stimulation

-p

an M2a-like phenotype (25).

Oleic acid (OA) and ALA (Cayman Chemicals) were diluted from ethanol stock to working

lP

concentrations in complete medium. These FA (60μM) or ethanol equivalent were added to macrophages immediately prior to the addition of alternative activation cytokines. Supernatants

ur na

were either harvested then frozen at -80°C directly (unstimulated) or after stimulation with 0.1μg/ml LPS for 0.5 or 2h. For inhibitor experiments, the 5-lipoxygenase (LOX) inhibitor nordihydroguaiaretic acid (NDGA, MilliporeSigma) or the human 15-LOX-1 (murine 12/15lipoxygenase) inhibitor ML351 (MilliporeSigma) were added at 1μM (26, 27) concurrently with

Jo

cytokine and FA treatments.

2.3 Extraction and quantification of oxylipins Oxylipins were extracted from culture supernatants and quantified as previously described (2830). Briefly, methanol (final 30%) and deuterated internal standards were added to 1ml 7

supernatant/sample, which was then adjusted to pH < 3 and loaded onto pre-conditioned Strata-X solid phase extraction columns (Phenomenex). The columns were washed with pH3 water and hexane, and samples were eluted with methanol, dried down in a nitrogen stream and resuspended in mobile phase (water/acetonitrile/acetic acid, 70/30/0.02, v/v/v) for analysis by HPLC-MS/MS (QTRAP 6500; Sciex). The stable isotope dilution method (31) was used for quantification of oxylipins, with a quantification threshold of 5 times baseline level in at least

of

one treatment group. A description of the mass transitions and retention times identifying the 157

ro

oxylipins scanned for in our panel has been published previously (28, 29).

-p

2.4 Cytokine detection

Cell supernatants were harvested and stored at -80°C until assayed. The cytokines IL-1β, TNF-α

re

and MCP-1 were quantified using multi-spot U-PLEX elecrochemiluminescent plates according to manufacturer’s instructions and read by a SECTOR imager (Meso Scale Discovery).

lP

Additional experiments were performed with MCP-1 antibodies only on a Small Spot Streptavidin plate. Where indicated, cells were lysed with RIPA buffer (50mM Tris-HCl,

ur na

150mM NaCl, 0.1% sodium dodecyl sulfate, 1% nonidet-P40) containing phosphatase inhibitor (EMD Millipore) and protein was quantified by BCA assay for normalization of MCP-1 quantities in each well.

Jo

2.5 Quantitative polymerase chain reaction RNA was isolated using the miRNeasy kit with DNase treatment (Qiagen), then reverse transcribed to cDNA using the iScript advanced cDNA synthesis kit (Bio-Rad). Real-time quantitative polymerase chain reaction (qPCR) was performed using the iTaq Universal SYBR Green Supermix (Bio-Rad) and read on the StepOnePlus Real-Time PCR System (ThermoFisher Scientific). Relative gene expression was quantified by the 2^-ddCt method with β-28

microglobulin (B2M) as the reference gene. The forward (F) and reverse (R) primer sequences used are as follows: Source PrimerBank ID 224831235c1 PrimerBank ID 145312260c3 (32)

(33) NCBI Primer Blast Software

of

(33)

ro

Sequence ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG CTACAAGGGATCGGGTTTATGGA TTGGCATTGCCTAGTAGCGTA TACGGCGCTGTCATCGATTT TAGAGTCGCCACCCTGATGT GGTGTCATCCTCCTAACCAAGAGA GCTGATGTATTTCTGGACCCACTT GGATGCCATCGTTTTTGTAACTG AACTGCATTCTTCACTCTCTTGTTGT GCTCGCGCTACTCTCTCTTT CCCAGACACATAGCAATTCAGG

-p

Name IL6-F IL6-R CD206-F CD206-R IL10-F IL10-R CCL18-F CCL18-R CCL17-F CCL17-R B2M-F B2M-R

2.6 Western blotting

re

Cells were lysed with RIPA buffer, sonicated and normalized for protein concentration. Samples

lP

were run on 10% SDS-PAGE gels (Bio-Rad), transferred to polyvinylidene fluoride membranes (Roche) and then probed with anti-iPLA2/PLA2 Group VI (NBP1-81586, Novus Biologicals) or

ur na

anti-cPLA2 (sc-376618; Santa Cruz Biotechnology) primary antibodies, followed by horseradish peroxidase- (HRP)- conjugated secondary antibody (Cell Signaling Technology) before chemiluminescence detection. The same membranes were probed with anti-β-actin loading control antibody (Cell Signaling Technology).

Jo

2.7 Phagocytosis assay

THP-1 monocytes were plated in a 96-well clear bottom, black polystyrene microplate (Nunc, USA) for differentiation to macrophages and polarization to the M2a-like state. pH-Rodo Red zymosan bioparticle conjugates (Molecular Probes) were re-suspended to 0.25mg/ml in Live Cell Imaging Solution (Molecular Probes), then sonicated. Cell culture media was then replaced with

9

the bioparticles solution for 1h to allow uptake. Cells were washed once in Live Cell Imaging Solution prior to detection by plate reader and fluorescence microscopy.

2.8 Statistical analysis Prism software version 6.07 (GraphPad) was used for all statistical analyses. Outlier identification was performed prior to all comparative analyses using the ROUT method (34),

of

with ROUT coefficient Q set to 5%. Individual oxylipins were analysed by two-way ANOVA for FA, LPS or interaction effects, followed by Tukey’s post-hoc test. When comparing only

ro

unstimulated cells, a one-way ANOVA was performed for FA effects, followed by Tukey’s test.

-p

When data were not normal or could not be normalized by log transformation, the KruskalWallis test followed by Dunn’s post-test were performed for comparison of means. Differences

re

were considered significant at p<0.1 for interaction effects or p<0.05 for all other effects. Symbols *, ** and *** signify p < 0.05, <0.01 and <0.001, respectively and ns indicates not

Jo

ur na

lP

significant. All graphs plot mean  SEM.

10

3 RESULTS 3.1 Validation of a cell culture model of alternatively activated (M2a-like) macrophages We published previously that human THP-1 monocytes acquire the morphology and chemical markers characteristic of macrophages when treated with 5ng/ml phorbol 12-myristate 13-acetate (PMA) for 48h followed by a 24h rest period (21). Here, we demonstrate that a subsequent 72h

of

treatment with 20ng/ml IL-4 and 20ng/ml IL-13 (25) leads to an alternatively activated macrophage (M2a-like) phenotype, characterized by increased secretion of the chemokine MCP-

ro

1 but not pro-inflammatory cytokines TNF-α or IL-1β relative to resting (M0) macrophages

-p

(Figure 1A), and increased acidic vesicle phagocytosis (Figure 1B), as previously reported (4, 23). Additional markers measured by qPCR revealed that the M2a-like macrophages express

re

higher transcript levels of mannose receptor (CD206), IL-10, CCL17 and CCL18 and lower

lP

transcript levels of IL-6 compared to M0 macrophages (Figure 1C), as previously reported for M(IL4+IL13) cells (25, 35, 36) .

ur na

3.2 M2a-like macrophages polarized in the presence of ALA have an altered oxylipin profile characterized by increased secretion of oxylipins from all precursor fatty acids Treatment with ALA concurrently with alternative activation cytokines (IL-4 and IL-13) leads to several alterations to the oxylipin profile secreted by M2a-like macrophages, both without and

Jo

with subsequent stimulation with LPS. In a targeted but unbiased screen of 157 oxylipins, we found 72 oxylipins present at quantifiable levels in at least one treatment group. Their quantities are shown in Supplemental Table S1, as are complete statistical analyses describing changes induced by FA treatment (vehicle, oleic acid [OA] and ALA) and LPS stimulation (0h, 0.5h, 2h) by two-way ANOVA or by Kruskall-Wallis test for non-parametric data. Both vehicle (ethanol) 11

and OA (a MUFA that is not metabolized to oxylipins) were used as control treatments. Unlike what was observed in M1-like macrophages (21), very little change occurred in response to LPS (Supplemental Table S1); only AA-derived 5-HETE and EPA-derived thromboxane B3 (TXB3) were elevated after 2h LPS stimulation. On the other hand, ALA treatment triggered changes in many oxylipins. ALA treatment

of

increased 7 and decreased 3 out of 36 AA oxylipins when FA treatment and LPS stimulated cells were analyzed together by 2-way ANOVA (Supplemental Table S1). When examining FA

ro

treatment of only unstimulated cells by one-way ANOVA, only 8-HETE (increased) and 16-

-p

HETE (decreased) were different from vehicle control (Figure 2A). In contrast, multiple omega6 oxylipins derived from FAs upstream of AA in the biosynthetic pathway were increased,

re

including those from LA, dihomo-γ-linolenic acid (DGLA) and γ-linolenic acid (GLA) (Figure 2A and Supplemental Table S1). LOX products of LA were increased by the largest magnitude,

lP

including 9- and 13-hydroxy-octadecadienoic acid (HODE) and 9,10,13- and 9,12,13-trihydroxyoctadecenoic acid (TriHOME), which were increased by 7-fold, 5-fold, 7-fold and 6-fold relative

ur na

to vehicle control, respectively. For some of these, significance relative to the OA control was reached only by two-way ANOVA. Multiple omega-3 oxylipins were also increased (Figure 2B and Supplemental Table S1). The LOX products of ALA 9- and 13-hydroxy-octadecatrienoic

Jo

acid (HOTrE) went from undetectable in many control samples to the most prominent oxylipins present in ALA treated samples. The ALA-derived CYP450 product 12,13-epoxy-eicosadienoic acid (12,13-EpODE) was also increased by a large magnitude (300 fold) from vehicle control, although the p value was only 0.07 by non-parametric test (Figure 2B and Supplemental Table S1). The EPA oxylipins that increased the most in response to ALA treatment were the LOX products 5- and 9- hydroxy-eicosapentaenoic acid (HEPE, 8-fold and 5-fold relative to vehicle, 12

respectively) and the CYP450 products 14,15- and 17,18-epoxy-eicosatetraenoic acid (EpETE, 7-fold and 5-fold relative to vehicle, respectively) (Figure 2B and Supplemental Table S1). DHA oxylipins changed very little in response to ALA; an increase in two DHA-derived LOX products (8- and 13- hydroxy-docosahexaenoic acid [HDoHE]) reached significance relative to vehicle in the two-way ANOVA analysis (Supplemental Table S1), but did not reach

of

significance in a one-way ANOVA analysis of unstimulated cells (Figure 2B), and the magnitude of increase was minimal (less than 1-fold change).

ro

The heat map in Figure 2 reveals a general pattern of increased oxylipins from each precursor

-p

PUFA, however changes in discrete oxylipins were often too small and/or too variable to reach significance on their own. By grouping oxylipins into categories, the patterns become more

re

evident and indeed statistically significant (Figure 3). By this analysis, oxylipins derived from each precursor PUFA, that is, those derived from AA, LA, DGLA, ALA, EPA and DHA, are all

lP

increased after ALA treatment. OA treatment also increased AA and LA oxylipins, although to a lesser extent. ALA oxylipins were increased by 1,400-fold in ALA treated cells relative to

ur na

vehicle, the largest magnitude of any response. The next highest change was seen with the LA oxylipins, which increased by 7.6-fold. When categorized by enzymatic pathway, LOX and CYP oxylipins were increased by ALA (3.7-fold and 1.5-fold, respectively), while COX oxylipins

Jo

were unaffected.

Since a wide variety of oxylipins were increased by ALA, including omega-6 oxylipins which cannot be synthesized from ALA itself, we hypothesized that there may be an effect on enzymes upstream of oxylipin production. Indeed, we found that both iPLA2-β (PLA2G6) and cPLA2-α (PLA2G4A), the enzymes responsible for freeing FA from membrane phospholipid, were increased in ALA-treated M2a-like macrophages (Figure 4). 13

3.3 ALA promotes phagocytosis by M2a-like macrophages Since a primary function of alternatively activated macrophages is to engulf and degrade pathogens and apoptotic cell fragments, we sought to examine how phagocytic capacity was altered by ALA treatment. According to our data, M2a-like macrophages polarized in the presence of elevated ALA (60μM) internalize zymosan particles more effectively than control

of

cells polarized in the presence of vehicle or OA (Figure 5 A-C). This dose matched that used for detection of changes in oxylipin concentrations in previous experiments. Testing of lower doses

ro

revealed that 25μM ALA is sufficient to maximally increase phagocytosis (Figure 5D).

by inhibition of 15-LOX-1 but not 5-LOX

-p

3.4 ALA treatment during polarization increases MCP-1 secretion and this is abrogated

re

Several LOX products from multiple precursor FAs were increased in M2a-like macrophages treated with ALA, with no apparent preference for products of a particular LOX isoform.

lP

(Supplemental Table S1). Since the murine enzyme 12/15-lipoxygenase (orthologous to human 15-LOX-1) in particular is known to promote MCP-1 production in murine macrophages (37),

ur na

we investigated the effect of ALA treatment on MCP-1 secretion. We found that MCP-1 levels were elevated in cells treated with ALA (60μM) during polarization to the M2a-like state, while the pro-inflammatory cytokines IL-1β and TNF-α were unaffected (Figure 6A). Dose testing

Jo

revealed that cells treated with lower concentrations of ALA (25μM and 50μM) also secrete higher levels of MCP-1 compared to vehicle treated cells (Figure 6B). Addition of the 15-LOX-1 inhibitor ML-351, but not the 5-LOX inhibitor NDGA, abrogated the increase in MCP-1 in ALA-treated cells (Figure 6B). We also tested whether treatment of mature (fully polarized) M2a-like cells with ALA would also cause an increase in MCP-1 secretion after 24h incubation. Surprisingly, ALA actually led 14

to decreased MCP-1 secretion in this context (Figure 7A-B). This decrease was unaffected by 5-

Jo

ur na

lP

re

-p

ro

of

LOX or 15-LOX inhibitor treatment (Figure 7C).

15

4 DISCUSSION We report that treatment of THP1-derived macrophages with ALA during polarization to the M2a-like state broadly increases oxylipins from all precursor PUFAs, especially those derived from ALA itself and those generated by the LOX enzyme family. Consistently, protein levels of cPLA2 and iPLA2, enzymes that liberate free FAs from phospholipid, were also increased by

of

ALA. These changes were accompanied by an increased ability to phagocytose bioparticles and by increased secretion of the chemokine MCP-1. Pharmacological inhibition of 15-LOX-1 with

ro

ML351 (38) abrogated the increase in MCP-1, suggesting that the effects of ALA are at least in part mediated by alterations to the oxylipin profile. Treatment with ALA after the cells were

-p

fully polarized, as opposed to during polarization, had the opposite effect on MCP-1 production,

re

but this decrease was not sensitive to LOX inhibition. Given the importance of alternatively activated macrophages in regulating inflammation, these effects may contribute substantially to

lP

in vivo anti-inflammatory effects demonstrated in mice (39, 40) and humans (6, 7, 10, 11). In most of the experiments performed here, cells were treated with 60μM of ALA in order to

ur na

maximize detectable changes in oxylipins. Functional experiments were repeated at lower doses, revealing that 25μM ALA is sufficient to modulate both phagocytosis and MCP-1 secretion. Free ALA is found at approximately 5μM in human plasma (41); however, this is expected to increase

Jo

with ALA supplementation. Total tissue levels of ALA can increase more than 10 fold in rodents supplemented with flax oil (42). The effect of supplementation on tissue ALA in free fatty acid form has not been reported to our knowledge. A similar characterization of the oxylipin profile shift induced by ALA was performed initially in M1-like macrophages (21). In M1-like cells, 2h LPS stimulation triggered the release of numerous oxylipins, most notably COX products of AA. By contrast, LPS had little effect on 16

oxylipin release by M2a-like cells as shown here. Further, only in M2a-like macrophages did ALA treatment generally increase oxylipins from every precursor PUFA, including both omega3 and omega-6. This is significant because omega-6 PUFA cannot be generated from omega-3 PUFA such as ALA in mammals. Mechanistically, can be explained by the increase in iPLA2 and cPLA2 protein levels, which are responsible for cleaving PUFA from cellular membranes in order to provide free FA substrates for COX, LOX and Cyp450 (22). In M1-like cells, we

of

observed an increase in LOX pathway products with ALA treatment; however, the increase was

ro

restricted to products from certain precursor PUFA (ALA and LA) but not others (AA and DHA). In M2a-like cells, LOX products from all precursor PUFAs are increased by ALA

-p

treatment, although a bias towards products of ALA and LA is still observed. It is worth noting

re

that ALA can inhibit the expression of desaturation enzymes (43). Reduced conversion to longer chain PUFAs would presumably increase the amount of LA available for oxylipin production,

lP

explaining the observed bias. Another key difference is that ALA treatment decreased the production of DHA oxylipins in M1-like cells (21), but modestly increased their production in

ur na

M2a-like cells. This difference is perhaps explained by the longer treatment time for M2a-like macrophages, since ALA can be elongated and desaturated (inefficiently) to generate DHA over time (9). A 72h incubation with IL-4/IL-13 is required to maximally induce an M2 phenotype while a 24h incubation with IFN-γ/LPS is sufficient to induce an M1-like phenotype (25). For

Jo

both of our studies, ALA was introduced at the start of the polarization period in order to model the impact that increased concentrations of ALA would have on the polarization process. Together, these two studies demonstrate a dual effect of ALA where the pro-inflammatory phenotype of M1-like macrophages is dampened and the anti-inflammatory phenotype of M2alike macrophages is enhanced.

17

In ALA treated M2a-like macrophages, ALA-derived 9- and 13-HOTrE dominate the oxylipin profile. Although not extensively investigated, some immune modulatory effects have been previously ascribed to 13-HOTrE in particular. It was demonstrated to suppress matrix metalloprotease expression in chondrocytes (44) and to inhibit TNF-α, iNOS and IL-1β expression in murine macrophages (45), albeit when introduced at much higher concentrations than what is produced by M2a-like macrophages in this study (μM versus nM range). In

of

adipocytes, which are likely targets of macrophage-derived oxylipins, both 9- and 13-HOTrE

ro

reduced lipid droplet accumulation in 3T3-L1 pre-adipocytes during maturation and inhibited

-p

adiponectin, TNF-α and MCP-1 production (46).

In association with the alterations to the oxylipin profile described here, M2a-like macrophages

re

generated in the presence of ALA are more highly phagocytic than those generated under control conditions. This can be interpreted as a beneficial phenotype in the context of chronic

lP

inflammation, since phagocytosis of pathogens and apoptotic cells promotes inflammatory resolution and return to homeostasis (47). It was demonstrated as early as 1990 that saturated

ur na

FAs decrease and unsaturated FAs increase phagocytosis of zymosan particles by mouse peritoneal macrophages, although AA, LA and ALA were shown to be more effective than EPA and DHA (48). Another group later showed that DHA inhibits phagocytosis of latex beads (49).

Jo

More recent studies have demonstrated a direct pro-phagocytic effects of the DHA oxylipins resolvin D1 (RvD1) (49), protectin D-1 (PD-1) (50) and maresin 1 (51), and the EPA oxylipin resolvin E1 (RvE1) (50). These particular lipids, classified as pro-resolving lipid mediators, were not found at detectable levels in our study. The RvE1 precursor 18-HEPE was detectable and was increased in quantity by ALA treatment (two-way ANOVA only). The extent to which

18

oxylipins contribute to the pro-phagocytic effects of ALA described here was not directly investigated and is an important topic for future work. The chemokine MCP-1 has a complex set of immunomodulatory actions. Historically, it has been considered a pro-inflammatory mediator since it is upregulated in inflamed sites such as atherosclerotic lesions (52) and since whole body knockout of its receptor attenuates expression

of

of pro-inflammatory cytokines in adipose tissue (53). On the other hand, convincing evidence for a protective role of MCP-1 has recently emerged, specifically in terms of promoting an anti-

ro

inflammatory macrophage phenotype (23). It is likely that cell type specific effects contribute to

-p

the complexity of its overall role in vivo and that balanced expression is important. Here, ALA treatment concurrent with M2 maturation increases MCP-1 but ALA treatment of fully matured

re

M2a-like cells decreases MCP-1. Speculatively, the decreased MCP-1 after maturation could

phenotype.

lP

represent a negative feedback response that offsets the anti-inflammatory macrophage

ur na

The observation that the 15-LOX-1 inhibitor ML351, but not the 5-LOX inhibitor NDGA, abrogates the increase in MCP-1 secretion induced by ALA treatment during polarization suggests that 15-LOX-1 products are involved. Indeed there is evidence that 15-LOX products, or at least products of its mouse orthologue 12/15-LOX, are important to the M2 phenotype.

Jo

Expression of 12/15-LOX is induced in pro-resolving macrophages during inflammatory resolution (54) and can be upregulated by IL-4 (55). This enzyme is known to act preferentially on LA, EPA and DHA relative to AA (56-58) and is presumably also responsible for production of 13-HOTrE from ALA. Our results show that several 15-LOX products are increased by ALA treatment, including, in order of decreasing magnitude, 13-HOTrE from ALA, 15-HEPE from

19

EPA, 13-HODE from LA, 13-HOTrE-γ from DGLA and 15-oxo-eicosatetraenoic acid (oxoETE) from AA. The actions of omega-3 PUFA such as ALA on immune cells and surrounding tissues are complex and multi-faceted, but ultimately resolvable. This study presents an important advancement toward this goal by describing how the presence of ALA favourably alters the

of

function of alternatively activated macrophages at least in part via changes to the profile of secreted oxylipins. Together with our previous report (21), we have demonstrated that ALA both

ro

dampens the pro-inflammatory phenotype of M1-like macrophages while enhancing the anti-

development of chronic inflammation conditions.

-p

inflammatory phenotype of M2a-like macrophages. Both effects are expected to counter the

lP

re

Author contributions

ur na

Use this form to specify the contribution of each author of your manuscript. A distinction is made between five types of contributions: Conceived and designed the analysis; Collected the data; Contributed data or analysis tools; Performed the analysis; Wrote the paper.

Jo

For each author of your manuscript, please indicate the types of contributions the author has made. An author may have made more than one type of contribution. Optionally, for each contribution type, you may specify the contribution of an author in more detail by providing a one-sentence statement in which the contribution is summarized. In the case of an author who contributed to performing the analysis, the author’s contribution for instance could be specified in more detail as ‘Performed the computer simulations’, ‘Performed the statistical analysis’, or ‘Performed the text mining analysis’. If an author has made a contribution that is not covered by the five pre-defined contribution types, then please choose ‘Other contribution’ and provide a one-sentence statement summarizing the author’s contribution.

Manuscript title: Alpha-linolenic acid enhances the phagocytic and secretory functions of alternatively activated macrophages in part via changes to the oxylipin profile 20

Author 1: Samantha D. Pauls ☒

Conceived and designed the analysis Specify contribution in more detail (optional; no more than one sentence) Collected the data

of

☒

Specify contribution in more detail (optional; no more than one sentence) Contributed data or analysis tools

ro

☒

☒

-p

Specify contribution in more detail (optional; no more than one sentence) Performed the analysis

Wrote the paper

lP

☒

re

Specify contribution in more detail (optional; no more than one sentence)

Specify contribution in more detail (optional; no more than one sentence) Other contribution

ur na

☐

Jo

Specify contribution in more detail (required; no more than one sentence)

21

Author 2: Lisa A. Rodway ☐

Conceived and designed the analysis Specify contribution in more detail (optional; no more than one sentence)

☒

Collected the data Specify contribution in more detail (optional; no more than one sentence) Contributed data or analysis tools

of

☐

☒

ro

Specify contribution in more detail (optional; no more than one sentence) Performed the analysis

Wrote the paper

re

☐

-p

Specify contribution in more detail (optional; no more than one sentence)

☐

Other contribution

lP

Specify contribution in more detail (optional; no more than one sentence)

ur na

Specify contribution in more detail (required; no more than one sentence)

Author 3: Tanja Winter

Conceived and designed the analysis

Jo

☐

Specify contribution in more detail (optional; no more than one sentence)

☒

Collected the data Specify contribution in more detail (optional; no more than one sentence)

☒

Contributed data or analysis tools

22

Specify contribution in more detail (optional; no more than one sentence) ☐

Performed the analysis Specify contribution in more detail (optional; no more than one sentence)

☐

Wrote the paper Specify contribution in more detail (optional; no more than one sentence) Other contribution

of

☐

Jo

ur na

lP

re

-p

ro

Specify contribution in more detail (required; no more than one sentence)

23

Author 4: Carla G. Taylor ☒

Conceived and designed the analysis Specify contribution in more detail (optional; no more than one sentence)

☐

Collected the data Specify contribution in more detail (optional; no more than one sentence) Contributed data or analysis tools

of

☐

☐

ro

Specify contribution in more detail (optional; no more than one sentence) Performed the analysis

Wrote the paper

re

☐

-p

Specify contribution in more detail (optional; no more than one sentence)

☒

Other contribution

lP

Specify contribution in more detail (optional; no more than one sentence)

ur na

Project oversight and manuscript editing

Author 5: Peter Zahradka

Conceived and designed the analysis

Jo

☒

Specify contribution in more detail (optional; no more than one sentence)

☐

Collected the data Specify contribution in more detail (optional; no more than one sentence)

☐

Contributed data or analysis tools

24

Specify contribution in more detail (optional; no more than one sentence) ☐

Performed the analysis Specify contribution in more detail (optional; no more than one sentence)

☐

Wrote the paper Specify contribution in more detail (optional; no more than one sentence) Other contribution

of

☒

Jo

ur na

lP

re

-p

ro

Project oversight and manuscript editing

25

Author 6: Harold M. Aukema ☒

Conceived and designed the analysis Specify contribution in more detail (optional; no more than one sentence)

☐

Collected the data Specify contribution in more detail (optional; no more than one sentence) Contributed data or analysis tools

of

☒

☐

ro

Specify contribution in more detail (optional; no more than one sentence) Performed the analysis

Wrote the paper

re

☐

-p

Specify contribution in more detail (optional; no more than one sentence)

☒

Other contribution

lP

Specify contribution in more detail (optional; no more than one sentence)

ur na

Project oversight and manuscript editing

Author 7: Enter author name

Conceived and designed the analysis

Jo

☐

Specify contribution in more detail (optional; no more than one sentence)

☐

Collected the data Specify contribution in more detail (optional; no more than one sentence)

☐

Contributed data or analysis tools

26

Specify contribution in more detail (optional; no more than one sentence) ☐

Performed the analysis Specify contribution in more detail (optional; no more than one sentence)

☐

Wrote the paper Specify contribution in more detail (optional; no more than one sentence) Other contribution

of

☐

Jo

ur na

lP

re

-p

ro

Specify contribution in more detail (required; no more than one sentence)

27

Author 8: Enter author name ☐

Conceived and designed the analysis Specify contribution in more detail (optional; no more than one sentence)

☐

Collected the data Specify contribution in more detail (optional; no more than one sentence) Contributed data or analysis tools

of

☐

☐

ro

Specify contribution in more detail (optional; no more than one sentence) Performed the analysis

Wrote the paper

re

☐

-p

Specify contribution in more detail (optional; no more than one sentence)

☐

Other contribution

lP

Specify contribution in more detail (optional; no more than one sentence)

ur na

Specify contribution in more detail (required; no more than one sentence)

Author 9: Enter author name

Conceived and designed the analysis

Jo

☐

Specify contribution in more detail (optional; no more than one sentence)

☐

Collected the data Specify contribution in more detail (optional; no more than one sentence)

☐

Contributed data or analysis tools

28

Specify contribution in more detail (optional; no more than one sentence) ☐

Performed the analysis Specify contribution in more detail (optional; no more than one sentence)

☐

Wrote the paper Specify contribution in more detail (optional; no more than one sentence) Other contribution

of

☐

Jo

ur na

lP

re

-p

ro

Specify contribution in more detail (required; no more than one sentence)

29

Author 10: Enter author name ☐

Conceived and designed the analysis Specify contribution in more detail (optional; no more than one sentence)

☐

Collected the data Specify contribution in more detail (optional; no more than one sentence) Contributed data or analysis tools

of

☐

☐

ro

Specify contribution in more detail (optional; no more than one sentence) Performed the analysis

Wrote the paper

re

☐

-p

Specify contribution in more detail (optional; no more than one sentence)

☐

Other contribution

lP

Specify contribution in more detail (optional; no more than one sentence)

Jo

ur na

Specify contribution in more detail (required; no more than one sentence)

30

REFERENCES

Jo

ur na

lP

re

-p

ro

of

1. Liu, Y. C., X. B. Zou, Y. F. Chai, and Y. M. Yao. 2014. Macrophage polarization in inflammatory diseases. Int J Biol Sci 10: 520-529. 2. Shapouri-Moghaddam, A., S. Mohammadian, H. Vazini, M. Taghadosi, S. A. Esmaeili, F. Mardani, B. Seifi, A. Mohammadi, J. T. Afshari, and A. Sahebkar. 2018. Macrophage plasticity, polarization, and function in health and disease. J Cell Physiol 233: 6425-6440. 3. Lumeng, C. N., J. L. Bodzin, and A. R. Saltiel. 2007. Obesity induces a phenotypic switch in adipose tissue macrophage polarization. J Clin Invest 117: 175-184. 4. Canton, J., R. Khezri, M. Glogauer, and S. Grinstein. 2014. Contrasting phagosome pH regulation and maturation in human M1 and M2 macrophages. Mol Biol Cell 25: 3330-3341. 5. Mantovani, A., S. Sozzani, M. Locati, P. Allavena, and A. Sica. 2002. Macrophage polarization: tumor-associated macrophages as a paradigm for polarized M2 mononuclear phagocytes. Trends Immunol 23: 549-555. 6. Baril-Gravel, L., M. E. Labonte, P. Couture, M. C. Vohl, A. Charest, V. Guay, D. A. Jenkins, P. W. Connelly, S. West, P. M. Kris-Etherton, P. J. Jones, J. A. Fleming, and B. Lamarche. 2015. Docosahexaenoic acid-enriched canola oil increases adiponectin concentrations: a randomized crossover controlled intervention trial. Nutr Metab Cardiovasc Dis 25: 52-59. 7. Browning, L. M., J. D. Krebs, C. S. Moore, G. D. Mishra, M. A. O'Connell, and S. A. Jebb. 2007. The impact of long chain n-3 polyunsaturated fatty acid supplementation on inflammation, insulin sensitivity and CVD risk in a group of overweight women with an inflammatory phenotype. Diabetes Obes Metab 9: 70-80. 8. Yates, C. M., P. C. Calder, and G. Ed Rainger. 2014. Pharmacology and therapeutics of omega-3 polyunsaturated fatty acids in chronic inflammatory disease. Pharmacol Ther 141: 272282. 9. Goyens, P. L., M. E. Spilker, P. L. Zock, M. B. Katan, and R. P. Mensink. 2006. Conversion of alpha-linolenic acid in humans is influenced by the absolute amounts of alphalinolenic acid and linoleic acid in the diet and not by their ratio. Am J Clin Nutr 84: 44-53. 10. Faintuch, J., L. M. Horie, H. V. Barbeiro, D. F. Barbeiro, F. G. Soriano, R. K. Ishida, and I. Cecconello. 2007. Systemic inflammation in morbidly obese subjects: response to oral supplementation with alpha-linolenic acid. Obes Surg 17: 341-347. 11. Zhao, G., T. D. Etherton, K. R. Martin, S. G. West, P. J. Gillies, and P. M. Kris-Etherton. 2004. Dietary alpha-linolenic acid reduces inflammatory and lipid cardiovascular risk factors in hypercholesterolemic men and women. J Nutr 134: 2991-2997. 12. Schiessel, D. L., R. K. Yamazaki, M. Kryczyk, I. Coelho de Castro, A. A. Yamaguchi, D. C. Pequito, G. A. Brito, G. Borghetti, J. Aikawa, E. A. Nunes, K. Naliwaiko, and L. C. Fernandes. 2016. Does Oil Rich in Alpha-Linolenic Fatty Acid Cause the Same Immune Modulation as Fish Oil in Walker 256 Tumor-Bearing Rats? Nutr Cancer 68: 1369-1380. 13. Zhao, G., T. D. Etherton, K. R. Martin, J. P. Vanden Heuvel, P. J. Gillies, S. G. West, and P. M. Kris-Etherton. 2005. Anti-inflammatory effects of polyunsaturated fatty acids in THP-1 cells. Biochem Biophys Res Commun 336: 909-917. 14. Calder, P. C. 2010. Omega-3 fatty acids and inflammatory processes. Nutrients 2: 355374.

31

Jo

ur na

lP

re

-p

ro

of

15. Gabbs, M., S. Leng, J. G. Devassy, M. Monirujjaman, and H. M. Aukema. 2015. Advances in Our Understanding of Oxylipins Derived from Dietary PUFAs. Adv Nutr 6: 513540. 16. Harizi, H., J. B. Corcuff, and N. Gualde. 2008. Arachidonic-acid-derived eicosanoids: roles in biology and immunopathology. Trends Mol Med 14: 461-469. 17. Chapkin, R. S., N. E. Hubbard, and K. L. Erickson. 1990. 5-series peptido-leukotriene synthesis in mouse peritoneal macrophages: modulation by dietary n-3 fatty acids. Biochem Biophys Res Commun 171: 764-769. 18. Hong, S., K. Gronert, P. R. Devchand, R. L. Moussignac, and C. N. Serhan. 2003. Novel docosatrienes and 17S-resolvins generated from docosahexaenoic acid in murine brain, human blood, and glial cells. Autacoids in anti-inflammation. J Biol Chem 278: 14677-14687. 19. Nieves, D., and J. J. Moreno. 2006. Effect of arachidonic and eicosapentaenoic acid metabolism on RAW 264.7 macrophage proliferation. J Cell Physiol 208: 428-434. 20. Liu, M., P. Chen, E. Vericel, M. Lelli, L. Beguin, M. Lagarde, and M. Guichardant. 2013. Characterization and biological effects of di-hydroxylated compounds deriving from the lipoxygenation of ALA. J Lipid Res 54: 2083-2094. 21. Pauls, S. D., L. A. Rodway, T. Winter, C. G. Taylor, P. Zahradka, and H. M. Aukema. 2018. Anti-inflammatory effects of alpha-linolenic acid in M1-like macrophages are associated with enhanced production of oxylipins from alpha-linolenic and linoleic acid. J Nutr Biochem 57: 121-129. 22. Mouchlis, V. D., and E. A. Dennis. 2019. Phospholipase A2 catalysis and lipid mediator lipidomics. Biochim Biophys Acta Mol Cell Biol Lipids 1864: 766-771. 23. Sierra-Filardi, E., C. Nieto, A. Dominguez-Soto, R. Barroso, P. Sanchez-Mateos, A. Puig-Kroger, M. Lopez-Bravo, J. Joven, C. Ardavin, J. L. Rodriguez-Fernandez, C. SanchezTorres, M. Mellado, and A. L. Corbi. 2014. CCL2 shapes macrophage polarization by GM-CSF and M-CSF: identification of CCL2/CCR2-dependent gene expression profile. J Immunol 192: 3858-3867. 24. Park, E. K., H. S. Jung, H. I. Yang, M. C. Yoo, C. Kim, and K. S. Kim. 2007. Optimized THP-1 differentiation is required for the detection of responses to weak stimuli. Inflamm Res 56: 45-50. 25. Genin, M., F. Clement, A. Fattaccioli, M. Raes, and C. Michiels. 2015. M1 and M2 macrophages derived from THP-1 cells differentially modulate the response of cancer cells to etoposide. BMC Cancer 15: 577. 26. Hernandez-Perez, M., G. Chopra, J. Fine, A. M. Conteh, R. M. Anderson, A. K. Linnemann, C. Benjamin, J. B. Nelson, K. S. Benninger, J. L. Nadler, D. J. Maloney, S. A. Tersey, and R. G. Mirmira. 2017. Inhibition of 12/15-Lipoxygenase Protects Against beta-Cell Oxidative Stress and Glycemic Deterioration in Mouse Models of Type 1 Diabetes. Diabetes 66: 2875-2887. 27. Kim, S. Y., T. B. Kim, K. A. Moon, T. J. Kim, D. Shin, Y. S. Cho, H. B. Moon, and K. Y. Lee. 2008. Regulation of pro-inflammatory responses by lipoxygenases via intracellular reactive oxygen species in vitro and in vivo. Exp Mol Med 40: 461-476. 28. Leng, S., T. Winter, and H. M. Aukema. 2017. Dietary LA and sex effects on oxylipin profiles in rat kidney, liver, and serum differ from their effects on PUFAs. J Lipid Res 58: 17021712.

32

Jo

ur na

lP

re

-p

ro

of

29. Monirujjaman, M., J. G. Devassy, T. Yamaguchi, N. Sidhu, M. Kugita, M. Gabbs, S. Nagao, J. Zhou, A. Ravandi, and H. M. Aukema. 2017. Distinct oxylipin alterations in diverse models of cystic kidney diseases. Biochim Biophys Acta 1862: 1562-1574. 30. Aukema, H. M., T. Winter, A. Ravandi, S. Dalvi, D. W. Miller, and G. M. Hatch. 2016. Generation of Bioactive Oxylipins from Exogenously Added Arachidonic, Eicosapentaenoic and Docosahexaenoic Acid in Primary Human Brain Microvessel Endothelial Cells. Lipids 51: 591599. 31. Deems, R., M. W. Buczynski, R. Bowers-Gentry, R. Harkewicz, and E. A. Dennis. 2007. Detection and quantitation of eicosanoids via high performance liquid chromatographyelectrospray ionization-mass spectrometry. Methods Enzymol 432: 59-82. 32. Tedesco, S., F. De Majo, J. Kim, A. Trenti, L. Trevisi, G. P. Fadini, C. Bolego, P. W. Zandstra, A. Cignarella, and L. Vitiello. 2018. Convenience versus Biological Significance: Are PMA-Differentiated THP-1 Cells a Reliable Substitute for Blood-Derived Macrophages When Studying in Vitro Polarization? Front Pharmacol 9: 71. 33. Polancec, D. S., V. Munic Kos, M. Banjanac, M. Vrancic, S. Cuzic, D. Belamaric, M. J. Parnham, D. Polancec, and V. Erakovic Haber. 2012. Azithromycin drives in vitro GM-CSF/IL4-induced differentiation of human blood monocytes toward dendritic-like cells with regulatory properties. J Leukoc Biol 91: 229-243. 34. Motulsky, H. J., and R. E. Brown. 2006. Detecting outliers when fitting data with nonlinear regression - a new method based on robust nonlinear regression and the false discovery rate. BMC Bioinformatics 7: 123. 35. Mantovani, A., A. Sica, S. Sozzani, P. Allavena, A. Vecchi, and M. Locati. 2004. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol 25: 677-686. 36. Tarique, A. A., J. Logan, E. Thomas, P. G. Holt, P. D. Sly, and E. Fantino. 2015. Phenotypic, functional, and plasticity features of classical and alternatively activated human macrophages. Am J Respir Cell Mol Biol 53: 676-688. 37. Wen, Y., J. Gu, G. E. Vandenhoff, X. Liu, and J. L. Nadler. 2008. Role of 12/15lipoxygenase in the expression of MCP-1 in mouse macrophages. Am J Physiol Heart Circ Physiol 294: H1933-1938. 38. Rai, G., N. Joshi, S. Perry, A. Yasgar, L. Schultz, J. E. Jung, Y. Liu, Y. Terasaki, G. Diaz, V. Kenyon, A. Jadhav, A. Simeonov, K. van Leyen, T. R. Holman, and D. J. Maloney. 2010. Discovery of ML351, a Potent and Selective Inhibitor of Human 15-Lipoxygenase-1. In Probe Reports from the NIH Molecular Libraries Program, Bethesda (MD). 39. Baranowski, M., J. Enns, H. Blewett, U. Yakandawala, P. Zahradka, and C. G. Taylor. 2012. Dietary flaxseed oil reduces adipocyte size, adipose monocyte chemoattractant protein-1 levels and T-cell infiltration in obese, insulin-resistant rats. Cytokine 59: 382-391. 40. Todoric, J., M. Loffler, J. Huber, M. Bilban, M. Reimers, A. Kadl, M. Zeyda, W. Waldhausl, and T. M. Stulnig. 2006. Adipose tissue inflammation induced by high-fat diet in obese diabetic mice is prevented by n-3 polyunsaturated fatty acids. Diabetologia 49: 2109-2119. 41. Psychogios, N., D. D. Hau, J. Peng, A. C. Guo, R. Mandal, S. Bouatra, I. Sinelnikov, R. Krishnamurthy, R. Eisner, B. Gautam, N. Young, J. Xia, C. Knox, E. Dong, P. Huang, Z. Hollander, T. L. Pedersen, S. R. Smith, F. Bamforth, R. Greiner, B. McManus, J. W. Newman, T. Goodfriend, and D. S. Wishart. 2011. The human serum metabolome. PLoS One 6: e16957. 42. Mendonca, A. M., L. G. J. Cayer, S. D. Pauls, T. Winter, S. Leng, C. G. Taylor, P. Zahradka, and H. M. Aukema. 2018. Distinct effects of dietary ALA, EPA and DHA on rat 33

Jo

ur na

lP

re

-p

ro

of

adipose oxylipins vary by depot location and sex. Prostaglandins Leukot Essent Fatty Acids 129: 13-24. 43. Wang, S.-h., Y. Pan, J. Li, H.-q. Chen, H. Zhang, W. Chen, Z.-n. Gu, and Y. Q. Chen. 2017. Endogenous omega-3 long-chain fatty acid biosynthesis from alpha-linolenic acid is affected by substrate levels, gene expression, and product inhibition. RSC Advances 7: 4094640951. 44. Schulze-Tanzil, G., S. P. de, B. Behnke, S. Klingelhoefer, A. Scheid, and M. Shakibaei. 2002. Effects of the antirheumatic remedy hox alpha--a new stinging nettle leaf extract--on matrix metalloproteinases in human chondrocytes in vitro. Histol Histopathol 17: 477-485. 45. Kumar, N., G. Gupta, K. Anilkumar, N. Fatima, R. Karnati, G. V. Reddy, P. V. Giri, and P. Reddanna. 2016. 15-Lipoxygenase metabolites of alpha-linolenic acid, [13-(S)-HPOTrE and 13-(S)-HOTrE], mediate anti-inflammatory effects by inactivating NLRP3 inflammasome. Sci Rep 6: 31649. 46. Zahradka, P., S. Neumann, H. M. Aukema, and C. G. Taylor. 2017. Adipocyte lipid storage and adipokine production are modulated by lipoxygenase-derived oxylipins generated from 18-carbon fatty acids. Int J Biochem Cell Biol 88: 23-30. 47. Fadok, V. A., D. L. Bratton, A. Konowal, P. W. Freed, J. Y. Westcott, and P. M. Henson. 1998. Macrophages that have ingested apoptotic cells in vitro inhibit proinflammatory cytokine production through autocrine/paracrine mechanisms involving TGF-beta, PGE2, and PAF. J Clin Invest 101: 890-898. 48. Calder, P. C., J. A. Bond, D. J. Harvey, S. Gordon, and E. A. Newsholme. 1990. Uptake and incorporation of saturated and unsaturated fatty acids into macrophage lipids and their effect upon macrophage adhesion and phagocytosis. Biochem J 269: 807-814. 49. Titos, E., B. Rius, A. Gonzalez-Periz, C. Lopez-Vicario, E. Moran-Salvador, M. Martinez-Clemente, V. Arroyo, and J. Claria. 2011. Resolvin D1 and its precursor docosahexaenoic acid promote resolution of adipose tissue inflammation by eliciting macrophage polarization toward an M2-like phenotype. J Immunol 187: 5408-5418. 50. Schwab, J. M., N. Chiang, M. Arita, and C. N. Serhan. 2007. Resolvin E1 and protectin D1 activate inflammation-resolution programmes. Nature 447: 869-874. 51. Serhan, C. N., R. Yang, K. Martinod, K. Kasuga, P. S. Pillai, T. F. Porter, S. F. Oh, and M. Spite. 2009. Maresins: novel macrophage mediators with potent antiinflammatory and proresolving actions. J Exp Med 206: 15-23. 52. Takeya, M., T. Yoshimura, E. J. Leonard, and K. Takahashi. 1993. Detection of monocyte chemoattractant protein-1 in human atherosclerotic lesions by an anti-monocyte chemoattractant protein-1 monoclonal antibody. Hum Pathol 24: 534-539. 53. Weisberg, S. P., D. Hunter, R. Huber, J. Lemieux, S. Slaymaker, K. Vaddi, I. Charo, R. L. Leibel, and A. W. Ferrante, Jr. 2006. CCR2 modulates inflammatory and metabolic effects of high-fat feeding. J Clin Invest 116: 115-124. 54. Schif-Zuck, S., N. Gross, S. Assi, R. Rostoker, C. N. Serhan, and A. Ariel. 2011. Saturated-efferocytosis generates pro-resolving CD11b low macrophages: modulation by resolvins and glucocorticoids. Eur J Immunol 41: 366-379. 55. Heydeck, D., L. Thomas, K. Schnurr, F. Trebus, W. E. Thierfelder, J. N. Ihle, and H. Kuhn. 1998. Interleukin-4 and -13 induce upregulation of the murine macrophage 12/15lipoxygenase activity: evidence for the involvement of transcription factor STAT6. Blood 92: 2503-2510.

34

Jo

ur na

lP

re

-p

ro

of

56. Soler, J., P. Saura, D. Garcia-Lopez, L. Masgrau, J. M. Lluch, and A. Gonzalez-Lafont. 2016. How Can Linoleic Acid Be the Preferential Substrate of the Enzyme 15-Lipoxygenase-1? A QM/MM Approach. J Phys Chem B 120: 1950-1960. 57. Wecksler, A. T., V. Kenyon, J. D. Deschamps, and T. R. Holman. 2008. Substrate specificity changes for human reticulocyte and epithelial 15-lipoxygenases reveal allosteric product regulation. Biochemistry 47: 7364-7375. 58. Kutzner, L., K. Goloshchapova, D. Heydeck, S. Stehling, H. Kuhn, and N. H. Schebb. 2017. Mammalian ALOX15 orthologs exhibit pronounced dual positional specificity with docosahexaenoic acid. Biochim Biophys Acta 1862: 666-675. 59. Cohen, J. 1988. Statistical power analysis for the behavioral sciences. 2nd ed. L. Erlbaum Associates, Hillsdale, N.J.

35

FIGURE LEGENDS Figure 1. Validation of a cell culture model for alternatively activated macrophages. THP-1 monocytes were differentiated to macrophages by incubation with 5ng/ml PMA for 48h followed by a 24h rest period (21), then incubated for 72h with 20ng/ml each IL-4 and IL-13 to produce M2a-like macrophages, or with media alone to maintain resting (M0) macrophages. (A)

of

Supernatants were collected for quantification of the indicated mediators using a Meso Scale Discovery platform. (B) Cells were incubated with pH-Rodo Red zymosan bioparticle conjugates

ro

for 1h to allow uptake into acidic vacuoles. Fluorescence was then quantified using a plate reader (intensity) and by microscopy (% phagocytic cells). Significant differences were assessed by t-

-p

test. Data are representative of at least 3 independent experiments with at least n=3 (cytokines) or

re

n=5 (phagocytosis) replicate cell culture wells per experiment. (C) Relative quantification of the indicated transcripts was performed by qPCR with n=5 samples per group. Differences were

Jo

ur na

lP

assessed by t-test (IL-10, IL-6) or Mann-Whitney (CD206, CCL17, CCL18).

36

Figure 2. M2a-like macrophages polarized in the presence of ALA have an altered oxylipin profile. THP-1 derived macrophages were treated with 60M OA, ALA or vehicle equivalent for 72h, concurrently with exposure to alternative activation cytokines. Oxylipins were enriched from cell supernatants by solid phase extraction then quantified by LC/MS/MS using the stable isotope dilution method. Forty five omega-6 oxylipins (A) and twenty seven omega-3 oxylipins

of

(B) were present at quantifiable levels in at least one treatment group and are listed here, grouped by biosynthetic pathway [COX, LOX CYP450 hydroxylase (CYPH) and CYP450 epoxygenase

ro

(CYPE)]. Heat maps indicate their relative quantities, averaged from 6-8 samples per group from 4 independent experiments, with the lowest value in white and the highest value in black for each

-p

A and B. Differences between treatments were assessed by one-way ANOVA then Tukey’s post-

re

hoc test or by Kruskal-Wallis test then Dunn’s post-hoc test if non-parametric analysis was required. Arrows (/) indicate significant change from vehicle control and double arrows (/)

Jo

ur na

lP

indicate significant change from both vehicle and OA controls, where p<0.05.

37

of ro -p re

lP

Figure 3. M2a-like macrophages polarized in the presence of ALA have an altered oxylipin profile characterized by increased secretion of oxylipins from all precursor PUFA and from the

ur na

LOX and CYP450 enzymatic pathways. Cells were treated with vehicle, OA or ALA (60M) during polarization with alternative activation cytokines and oxylipins were extracted and quantified from cell culture supernatant as described in Figure 2. Seventy-two individual

Jo

oxylipins were quantified and are shown here grouped by precursor (left) and synthetic pathway (right). Individual oxylipin means were summed and the pooled standard deviation was calculated according to Cohen’s formula (59). Significance relative to vehicle treatment was determined by one-way ANOVA analysis and Tukey’s post-hoc test. Fold change from vehicle is indicated for significant differences (p<0.01).

38

of ro

Figure 4. ALA enhances iPLA2 and cPLA2 expression. THP-1 derived macrophages were

-p

treated with 60M ALA or vehicle equivalent for 72h, concurrently with exposure to alternative

re

activation cytokines. The resulting M2a-like cells were lysed, proteins were separated by SDSPAGE and western blotting was performed with iPLA2-β (a) and cPLA2γ-α (b) antibodies.

lP

Quantitation is shown normalized to β-actin and is representative of 2 independent experiments,

Jo

ur na

each with 3 biological replicates. Differences were assessed by t-test.

39

of ro -p re

lP

Figure 5. ALA promotes phagocytosis by M2a-like macrophages. THP-1 derived macrophages were treated with 60M OA, ALA or vehicle for 72h, concurrently with exposure to alternative

ur na

activation cytokines. The resulting M2a-like cells were incubated with pH-Rodo Red zymosan bioparticle conjugates for 1h. Fluorescence becomes unquenched when internalized into acidic vacuoles. (A) Fluorescence intensity was quantified using a plate reader. Statistical analysis was performed by one-way ANOVA followed by Tukey`s test. Data are representative of 4

Jo

independent experiments. (B) Epifluorescence and bright field images were captured and overlayed. Bioparticle positive and negative cells were counted to calculate percent phagocytic cells. Statistical analysis was performed by non-parametric Kruskal-Wallis test followed by Dunn`s test. Data are representative of 3 independent experiments. (C) Representative overlays from each treatment group showing fluorescent bioparticles inside cells (red punctae, example shown with black arrowhead), which lack detectable fluorescence outside cells (gray punctae, 40

example shown with white arrowhead). (D) ALA dose curve. Significance is shown relative to vehicle control condition (0) as analyzed by one-way ANOVA followed by Tukey`s test. Data

lP

re

-p

ro

of

are representative of 2 independent experiments.

ur na

Figure 6. The ALA-induced increase in MCP-1 secretion is abrogated by a 15-LOX-1 inhibitor. THP-1 derived macrophages were treated with 60M OA, ALA or vehicle equivalent for 72h, concurrently with M2 polarizing cytokines. (A) Supernatants were collected for detection of

Jo

inflammatory mediators by electrochemiluminescence (Meso Scale Discovery). MCP-1 measurements are representative of 4 independent experiments and IL-1 and TNF- measurements are representative of 2 independent experiments, with n=5 cell culture wells per group. (B) ALA dose curve. Significance is shown relative to vehicle control condition (0) as analyzed by one-way ANOVA followed by Tukey`s test. Data are representative of 2 independent experiments. (C) Cells were incubated with 1M of 5-LOX inhibitor NDGA, 1541

LOX-1 inhibitor ML-35, or DMSO equivalent along with vehicle or ALA treatment and M2 polarizing cytokines for 72h before supernatants were harvested for cytokine quantification. The graph shows pg MCP-1 normalized to mg total protein in n=5 cell culture wells. Results are representative of 3 independent experiments. Statistical analysis was performed by one-way ANOVA followed by Tukey`s test (A) or two-way ANOVA followed by Sikak`s test (B). †

of

indicates significance relative to matched vehicle control; * indicates significant differences

Jo

ur na

lP

re

-p

ro

within vehicle or ALA treated groups.

Figure 7. ALA decreases MCP-1 secretion by fully matured M2a-like macrophages in a LOXindependent manner. (A) M2a-like macrophages were treated with 60M OA, ALA or vehicle for 24h. Supernatants were collected for MCP-1 detection by Meso Scale Discovery analysis. (B) ALA was also tested at lower doses as described for panel A. (C) M2a-like cells were incubated with 1M of 5-LOX inhibitor NDGA, 15-LOX-1 inhibitor ML-35, or DMSO equivalent along 42

with vehicle or ALA treatment and M2 polarizing cytokines for 24h. Supernatants were then harvested for Meso Scale Discovery analysis. The graph shows pg MCP-1 normalized to mg total protein/well. Statistical analysis was performed by one-way ANOVA followed by Tukey`s test (A) or two-way ANOVA followed by Sikak`s test (B). All results are representative of 2

Jo

ur na

lP

re

-p

ro

of

independent experiments each with n=5 samples per group.

43