Alpha1-acid glycoprotein is contained in bovine neutrophil granules and released after activation

Available online at www.sciencedirect.com

Veterinary Immunology and Immunopathology 125 (2008) 71–81 www.elsevier.com/locate/vetimm

Alpha1-acid glycoprotein is contained in bovine neutrophil granules and released after activation Mizanur Md Rahman a,c,1, Alba Miranda-Ribera a,1, Cristina Lecchi a, Valerio Bronzo a, Paola Sartorelli a, Federica Franciosi b, Fabrizio Ceciliani a,* a

Department of Animal Pathology, Hygiene and Veterinary Public Health, University of Milano, Via Celoria 10, 20133 Milano, Italy b Department of Animal Sciences, University of Milano, Via Celoria 10, 20133 Milano, Italy c Department of Medicine & Surgery, Chittagong Veterinary and Animal Sciences University, Zakir Hossain Road, Chittangong 4202, Bangladesh Received 10 December 2007; received in revised form 28 March 2008; accepted 5 May 2008

Abstract The present study was designed to investigate the capability of bovine neutrophil granulocytes to produce the minor acute phase protein a1-acid glycoprotein (AGP, Orososmucoid). Bovine neutrophils contain a high MW (50–60 kDa) AGP isoform (PMNAGP), as determined by Western blotting and confirmed by fluorescence microscopy. The presence of AGP in bovine neutrophils has been confirmed by fluorescence immunocytometry. In addition, bovine neutrophils contain also a 42–45 kDa isoform, which has the same MW as plasma-, liver-delivered, AGP. cDNA sequence of plasma- and PMN-AGP revealed that (i) the two proteins are products of the same gene; (ii) the differences in molecular weight are due do different post-translational modifications. This result was confirmed by deglycosylation of the two glycoforms. Exocytosis studies showed that isolated neutrophils exposed to several challengers, including Zymosan activated serum (ZAS) and phorbol 12-myristate 13-acetate (PMA), which mimic the inflammatory activation, released PMN-AGP as early as 15 min. AGP’s mRNA is physiologically expressed by mature resting neutrophils. Realtime PCR on LPS, ZAS and PMA challenged cells revealed that the level of expression apparently does not increase after inflammatory activation. Collectively, the findings reported in this paper proved that PMN-AGP: (i) is a hyperglycosylated glycoform of plasma AGP, (ii) is stored in granules, and (iii) is released by neutrophils in response to activation. Due to its anti-inflammatory activity, PMN-AGP may work as a fine tuning of the neutrophils functions in the inflammatory focus, i.e. it can reduce the damages caused by an excess of inflammatory response. # 2008 Elsevier B.V. All rights reserved. Keywords: Granulocytes; Granule proteins; Alpha1-acid glycorptoein; Acute-phase proteins; Exocytosis

1. Introduction

* Corresponding author. Tel.: +39 02 50318100; fax: +39 02 50318100. E-mail address: [email protected] (F. Ceciliani). 1 These authors contributed equally to this work. 0165-2427/$ – see front matter # 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.vetimm.2008.05.010

Neutrophils (PMN) represent the first line of defence against bacterial invasion of host tissues. Their microbicidal action consists in phagocytosis of bacteria, followed by killing due to the generation of reactive oxygen intermediates (ROI) as well as release of proteases and anti-microbial proteins stored in granules (Borregaard and Cowland, 1997). While essential to

72

M.M. Rahman et al. / Veterinary Immunology and Immunopathology 125 (2008) 71–81

oppose infections, the activation of neutrophils can also release cytotoxic mediators, which may result in tissue damage. Therefore, neutrophils intervention during inflammation is paradoxical; in fact, they are crucial for host defence, but they may also be involved in the development of many inflammatory diseases in case of failure in the control of their several aggressive activities (Smith, 1994). For this reason, the activation of neutrophils must be tightly regulated by both systemic and local mediators. The re-establishment of systemic homeostasis is thought to be one of the functions of many of the acute phase proteins, a family of structurally unrelated proteins which increase their concentration in plasma during the systemic reaction of inflammation (Gabay and Kushner, 1999). Acute phase proteins (APP) are synthesized mainly by the liver, but there is growing evidence that at least some of them can be expressed at extra-hepatic levels (Hochepied et al., 2003). Alpha1-acid glycoprotein (AGP, orosomucoid) is one of them. AGP increases from three to five folds during systemic inflammation, and therefore acts as a minor acute phase protein in most of the animals investigated so far (Petersen et al., 2004). From a structural point of view, AGP is an immunocalin, a small hydrophobic molecule-binding protein with immunomodulatory functions (Logdberg and Wester, 2000), which include the expression of anti-inflammatory cytokines by macrophages (Tilg et al., 1993), the downgrading of the chemotactic response of neutrophils (Laine´ et al., 1990), and the inhibition of the proliferative response of lymphocytes (Bennett and Schmid, 1980). Due to the very high concentration of AGP in plasma during the acute phase reaction (from 0.6 to 1 mg/ml), it is conceivable that the main AGP’s isoform which is active in inflamed tissues derives from this source due to exudation. Other AGP isoforms can be produced locally during inflammation, for example by endothelial cells (So¨rensson et al., 1999) and activated macrophages (Fournier et al., 1999) or carried into the inflamed tissues by defensive cells such as neutrophils (Theilgaard-Mo¨nch et al., 2005; Poland et al., 2005), raising the amount of AGP that can be biologically active in the inflammatory microenvironment. Human neutrophils AGP (PMN-AGP) is synthesized during granulocyte differentiation and stored in primary granules (Theilgaard-Mo¨nch et al., 2005). The function of PMN-AGP is unknown, but it has been suggested that it may fulfil a feedback response mechanism that allows the neutrophils to modulate locally their responses. The primary structure, as well as the glycan pattern in physiological conditions, of bovine plasma AGP isoform are known

(Ceciliani et al., 2005; Nakano et al., 2004). A high molecular weight AGP isoform has been recently reported also in bovine neutrophils (Ceciliani et al., 2007b), but both localization of AGP in the cells and the stimuli that can induce its exocytosis are unknown. Therefore, in order to get insight to the local modulation of the bovine immune response by AGP, the first aim of this study was to verify whether AGP can be exocytosed by bovine neutrophils after their stimulation with different challengers that are commonly utilized to mimic inflammatory activation. In order to investigate whether the two isoforms derived from the same gene, cDNA sequence of PMN-AGP was determined, and comparative deglycosylation studies were carried out. Finally, since it has been reported that human neutrophils can express several genes after stimulation with pro-inflammatory molecules (Tsukahara et al., 2003), the capability of activated neutrophils to produce AGP’s mRNA in activated cells was also investigated. 2. Materials and methods 2.1. Reagents All reagents were from Sigma-Chemicals Co., unless otherwise specified. Two kinds of Hanks balanced saline, sterile and celltested solution (HBSS) were used: (HBSS+) with 0.5 mM CaCl2, 1 mM MgCl2, and Ca2+ and Mg2+ free (HBSS). NaCl solutions were diluted starting from sterile cell tested 5 M NaCl. Preparation of Zymosan activated serum (ZAS) was carried out by incubating Zymosan A from Saccharomyces cerevisiae with healthy bovine serum, at a concentration of 15 mg/ml, at 37 8C for 60 min. The incubation mixture was centrifuged at 500  g for 10 min, and the supernatants containing C3a and C5a were collected and heated at 56 8C for 60 min, in order to inactivate endogenous alkaline phosphatase (ALK-P) and remaining components that might activate serum. After further centrifugation at 500  g for 10 min, samples were finally filtered using 0.22 mm filters (Millipore, Vimodrone, Italy). 2.2. Bovine neutrophils isolation Clinically healthy lactating Holstein cows between 2 and 7 years of age were used throughout these studies as blood donors for all experiments. Blood was obtained from the coccygeal vein and collected into blood bag containing acid–citrate–dextrose (Terumo, Belgium). PMN were isolated using a Percoll1-gradient as

M.M. Rahman et al. / Veterinary Immunology and Immunopathology 125 (2008) 71–81

73

Table 1 Primers and amplification protocols used for cDNA sequencing of bovine PMN-AGP Primer

Sequence

Size (bp)

Thermal profile

First pair of primers AGP_F_1 AGP_R_1

TTGCTTGGCTGCAGGTGT TAGGACGCTTCTGTCTCC

18 18

First denaturation Second denaturation Annealing Extension (5 cycles) Third denaturation Annealing Extension (40 cycles) Final extension

2 min at 94 8C 45 s at 94 8C 50 s at 62 8C 90 s at 72 8C 45 s at 94 8C 50 s at 58 8C 90 s at 72 8C 10 min at 72 8C

18 25

First denaturation Second denaturation Annealing Extension (35 cycles) Final extension

2 min at 94 8C 30 s at 94 8C 30 s at 62 8C 60 s at 72 8C 10 min at 72 8C

Second pair of primers AGP_F_2 CTTCATGCTTGCTGCCTC AGP_R_2 GCACCGAAACAAACTTTATTGATGC

previously described (Rinaldi et al., 2007), with slight modification. Briefly, 40 ml of blood were transferred to 50 ml polypropylene conical tubes and centrifuged (1000  g) for 20 min at 4 8C. The plasma and buffy coat were aseptically aspirated and discarded. The remaining cells were brought to 35 ml volume with icecold PBS and the suspension slowly pipetted down the side of a clean 50 ml polypropylene conical tube containing 10 ml of 1.084 g/ml ice cold Percoll1. The tubes were centrifuged (400  g) for 40 min at 20 8C. The supernatant, mononuclear cell layer, and Percoll1 were aseptically aspirated and a pellet composed of PMN’s and erythrocytes was retained. Erythrocytes were lysed by mixing one volume of cells with two volumes of an ice cold 0.2% NaCl solution and inverting the tube for 1 min. Tonicity was restored by the addition of one-half volume of a 3.7% NaCl solution. The tubes were centrifuged at 500  g for 2 min at 4 8C. Lysis were usually repeated, sometimes twice, using pre-warmed (37 8C) red blood cells lysis buffer. The cell pellet was washed twice by resuspension in PBS and recentrifugation for 2–3 min at 4 8C (30 ml final volume). Cells were enumerated using an automated cell counter. Cell viability and differential cell counts were determined by trypan blue exclusion and Wright staining, respectively. PMN purity was >95% and viability >90%. PMN concentrations were adjusted with HBSS and maintained on ice until used in the various assays described below. 2.3. cDNA sequencing of PMN-AGP Total RNA was extracted from the bovine purified PMN using the RNeasy Mini Kit (Qiagen, Milano,

Italy) according to the manufacturer’s protocol. The reverse transcription (RT) reaction was carried out on 1 mg RNA using iSCRIPT cDNA SYNTESIS Kit (BIORAD, Hercules, CA, USA). The cDNA was used as the template for the PCR (Eppendorf Mastercycler1). PCR reactions were performed in 10 ml final volumes under the following condition: 1 buffer Eppendorf, 1.5 mM MgCl2, 0.2 mM of each dNTP, 1 mM of each primer and 0.5 unit of Taq Polymerase (Eppendorf, Milano, Italy). The primers used to amplify the coding sequence of PMN boAGP are listed in Table 1 and were obtained following the alignment of the known AGP cDNA sequence available in GenBank, i.e. bovine (AJ844606), bovine (NM001040502), capra hircus (EU127316). The thermal profile was described in Table 1. PCR products were applied on a 1.7% agarose gel electrophoresis and the segments of predicted molecular weight obtained were gel-purified using the QIAquick gel extraction kit (Qiagen, Milano, Italy) and then were quantified by NanoDrop1 ND-1000. The fragments were sequenced directly with ABI technology using an automated DNA sequencer (ABI PRISM 310 Genetic Analyzer). The predicted amino acid sequence was obtained using the ExPASy proteomic server. 2.4. Semi-quantification of PMN-AGP In order to determine the total content of AGP in neutrophils, an aliquot of 108 cells was pelletted and resuspended in 200 ml lysis buffer (10 mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA and protease inhibitor cocktail), containing 0.5% hexadecyltrimethylammonium bromide (CTAB) for 30 min. In order to rule out

74

M.M. Rahman et al. / Veterinary Immunology and Immunopathology 125 (2008) 71–81

any possible interfering of the CTAB with further analysis, the cells were also disrupted in a mechanical way in the lysis buffer, but without 0.5% CTAB. The incubation solution was centrifuged at 13 000  g at RT. The quantification of AGP was carried out in two ways: (a) by a radial immunodiffusion assay commercial kit (Bovine a1 AG Plate, Tridelta) and (b) by densitometric semi-quantification: in brief, SDS-PAGE and Western blotting of different amounts of CTAB supernatants were carried out. AGP positive bands were visualized by immunostaining using a polyclonal anti-bovine AGP antibody following an established protocol (Ceciliani et al., 2007a). Densitometric analysis was performed using the Imagemaster 1D software (Amersham Biosciences, Nerviano, Italy) and the amount of protein contained in each single band was semi-quantified after comparison with known amount of plasma purified AGP loaded as positive standards. 2.5. PMN-AGP exocytosis studies The exocytosis of AGP from neutrophils was determined on isolated cells (200 ml cell suspension of a solution containing a concentration of 1  107 cells in 1 ml in HBSS+ in 4 ml polypropylene tubes) incubated with molecules that can specifically promote the degranulation of neutrophil granules, including phorbol 12-myristate 13-acetate (PMA), at a concentration of 2.5 mg/ml and ZAS, at a final concentration of 250 mg/ml. Ionomycin (2 mM) was used as positive control for degranulation. CTAB (0.5%) lysed cells were used to determine the total enzymatic content of the cells. Cells were stimulated with the activators and, following incubation for 0, 15, 30, 60, 120 min, the supernatant of each well was transferred in an Eppendorf tube and centrifuged at 400  g for 7 min at RT. The presence of exocytosed AGP was determined by means of direct SDS-PAGE and Western blotting electrophoresis of 15 ml of the supernatant and by immunoprecipitation, as by previously established protocol (Ceciliani et al., 2007b). The effective degranulation of neutrophils was determined by analysis of the exocytosis of primary (azurophil) and secondary (specific) granules as follows: (a) The analysis of primary granules exocytosis was determined by the assay of the enzymatic activity of myelopeoxidase (MPO) (Quade and Roth, 1997). An aliquot of 100 ml of supernatant was added to 150 ml of tetramethylbenzidine (TMB) readymade

solution. The reaction was carried out for 30 min at RT in the dark, and finally blocked by adding 50 ml H2SO4 1 M. The plate was read at an absorbance of 450 nm. The data were expressed as the percentage of MPO on the supernatant of challenged cells compared to total MPO activity in neutrophils lysed with CTAB. (b) The analysis of secondary granules exocytosis was carried by the assay of the enzymatic activity of alkaline-phosphatase (ALK-P) (Rausch and Moore, 1975; Gennaro et al., 1978) following modification of a previously established protocol (Coomber et al., 1997). An aliquot of 33 ml of culture supernatant was added to 100 ml of pnitrophenyl phosphate (pNPP) readymade solution, and the mixture was incubated for 10 min at RT. The reaction was finally blocked by the addition of 50 ml NaOH 3 M, and the plates were read at an absorbance of 410 nm. The data were expressed as the percentage of ALK-P activity present in the supernatant of challenged cells compared to total ALK-P activity in the same amount of neutrophils lysed after incubation with 0.5% CTAB. All the enzymatic assays experiments were carried out in a 96-well flat bottom cell tested ELISA plates using HBSS+ at 37 8C. The supernatant of each well was transferred in an Eppendorf tube and centrifuged at 400  g for 7 min at RT. Supernatants were transferred into 96-well flat bottom ELISA plates, non-sterile, and enzymatic assay was carried out. Absorbances were measured on an automatic microtiter plate reader Multiscan MS (Labsystem, Helsinki, Finland) using the previously described parameters. Background values were calculated from wells containing pNPP and TMB, in their respective assay, added with 33 ml and 100 ml of HBSS+ respectively, and the results were automatically subtracted from all values. 2.6. Statistical analysis For all statistical procedures, mean and standard error of the mean values were computed by using statistical software (SPSS 15.0, SPSS Inc., Chicago, USA). Results are expressed as mean values plus or minus standard error of the mean values. Statistical analysis was performed comparing different experimental groups with non-parametric Wilcoxon test for paired samples. Statistical significance was accepted at P < 0.05.

M.M. Rahman et al. / Veterinary Immunology and Immunopathology 125 (2008) 71–81

2.7. Immunocytochemistry: AGP detection In order to verify if the activation of neutrophils is capable to modify the distribution of the protein from the granules to the surface of the cell, cytospins of purified bovine neutrophils were activated with PMA and ZAS as previously described for 30 min, and fixed in suspension in 1% paraformaldehyde in DPBS (Ca2+ and Mg2+ free) for 10 min at +4 8C. Cells were allowed to settle on a glass slide and processed to assess AGP localization by immunofluorescence. After an incubation of 30 min at +26 8C in DPBS containing 1% BSA and 1% NDS (normal donkey serum), the slides were incubated overnight at +4 8C with an anti-bovine-AGP polyclonal antibody raised in rabbit (17 mg/ml in DPBS) (Ceciliani et al., 2007a). After incubation, samples were washed twice in DPBS and stained with a fluorescein isothiocyanate (FITC) conjugated antirabbit IgG antibody (1:200) raised in donkey (Jackson Immunoresearch Lab, Inc., West Grove, PA) for 30 min at 26 8C. Chromatin DNA was stained with DAPI (0.05 mg/ml in PBS) (Molecular Probes Europe BV, Leiden, The Netherlands). As control, the primary antibody against boAGP was omitted in one slide for each experiment. All samples were mounted with an anti-fade medium (Vectashield, Vector lab. Burilngame, CA) and observed with a conventional epifluorescence microscope (Nikon, Eclipse E 600). Non-activated cells in HBSS+ medium were used as negative control. 2.8. PNGase-F digestions Aliquots of approximately 1 mg of plasma- and PMNAGP were deglycosylated by peptide N-glycosidase F (PNGase-F) from E. meningosepticum. Reaction was carried out in 100 ml of 25 mM phosphate buffer, pH 7.5, 0.5% SDS, 200 mM b-mercaptoethanol. Samples were heated at 100 8C for 5 min, 2% (v/v) final concentration of Triton X-100 were added. Deglycosylation was started by adding 2 ml of PNGase-F solution (10 enzyme units), incubated for 3 h at 37 8C or, in some cases, prolonged to 12 h, and finally stopped by the adding of SDS-PAGE loading buffer and boiled for 50 . Samples were analyzed with SDS-PAGE and electroblotted on nitrocellulose for immunodetection, which was carried out as previously described. 2.9. PMN-AGP’s mRNA expression studies Aliquots of 6  106 cells in 1 ml HBSS were cultured in polypropylene tubes, in order to avoid the

75

adhesion of the cells to the walls of the vials, and activated with PMA and ZAS as previously described, for 30 min. Cells were also stimulated with E. coli lipopolysaccharides (LPS) (Serotype 055:B5) for 120 min, following a previously published protocol (Tsukahara et al., 2003). After the incubation, total RNA was extracted using the RNeasy Mini Kit (Qiagen, Milano, Italy) according to the protocol of the manufacturer. The reverse transcription (RT) reaction was carried out on 1 mg RNA using iSCRIPT cDNA SYNTESIS Kit (Bio-Rad). The thermal profile was as protocol suggesting. Quantitative reactions were performed in 25 ml of SYBR Green mix and 450 nM of beta-actin primers (sense-CCAAAGCCAACCGTGAGA and antisense-CCAGAGTCCATGACAATGC) and AGP degenerated primers (sense-CCAACCTGATGACAGYGGC and antisense-GCCGACTYATTGTACTCGGG). Each sample was tested in duplicate. In order to evaluate that PCR efficiency, series of dilution were prepared by performing fourfold serial dilution starting from the reference samples. The thermal profile used (95 8C for 90 s, 50 cycles of 95 8C for 15 s, 56 8C for 30 s and 60 8C for 30 s; for melting curve construction, 55 8C for 60 s and 80 cycles starting to 55 8C and increasing 0.5 8C each 10 s) was the same for each target gene. The results obtained were compared using the delta–delta Ct method (Giulietti et al., 2001). 3. Results 3.1. The quantification of AGP in bovine neutrophils The radial immunodiffusion (RID) analysis on 1  108 cells dissolved in 200 ml of lysis buffer and 0.5% CTAB gave no appreciable result. In order to rule out that the detergent added to the lysis buffer interferes with the binding of PMN-AGP to the antibody dissolved in the agar-gel plate of the radial immunodiffusion assay, a different homogenization procedure, in which the cells were mechanically disrupted without the use of 0.5% CTAB, was applied. Even in absence of the detergent RID analysis gave negative results. On the contrary, Fig. 1 illustrates the results of the semiquantitative assay of PMN-AGP carried out by comparison of the total content of AGP in neutrophils and known amounts of purified plasma AGP used as internal standard. The amount of PMN-AGP ranges around 0.1 mg per 106 cells. Fig. 1 also shows that there are at least two proteins which react with the polyclonal anti-bovine AGP antibody, a high-MW isoform (50– 60 kDa) and a low MW isoform (45 kDa).

76

M.M. Rahman et al. / Veterinary Immunology and Immunopathology 125 (2008) 71–81

Fig. 1. The semi-quantitative analysis of AGP in bovine neutrophils. Different known amounts of purified plasma AGP were analyzed by SDS-PAGE, as indicated in the figure, together with different amount of supernatants deriving from CTAB-treated isolated neutrophils. Densitometric imaging analysis was carried out as described in Section 2.

3.2. PMN-AGP is the product of the same gene of plasma-AGP, and different molecular weight is due to different post-translational processing In order to determine if plasma- and PMN-AGP isoforms were the products of the same gene, cDNA sequencing of PMN-AGP was carried out, revealing and open reading frame of 658 bp, and showed that the resulting amino acid sequence was identical to that of plasma-AGP. The cDNA sequence of bovine AGP from neutrophils has been deposited in EMBL database under the accession number of EU250279. The differences in the MW of the two AGP’s isoforms were further investigated by experimental Ndeglycosylation with PNGase-F. Western blotting experiments shown in Fig. 2 indicate that deglycosylation of PMN-AGP was almost complete. Both plasmaand PMN-AGP can be completely deglycosylated by PNGse-F treatment, even with a different ratio. The deglycosylation of the two glycoforms revealed a different SDS-PAGE profile, the plasma-AGP being only partially deglycosylated.

Fig. 2. Deglycosylation of plasma- and PMN-AGP. Plasma purified AGP and PMN-AGP were treated with PNGase F, as described in Section 2. Aliquots of 10 ng were analyzed by WB and immunodetection with anti-bovine AGP polyclonal antibody after treatment for 3 h.

On the contrary, plasma-AGP was not completely deglycosylated after 3 h of PNGase-F treatment. The prolonging of the incubation time for other 12 h and/or the increasing of the ratio glycosidase:plasma-AGP did not apparently increase the cleavage rate (Fig. 2, Supplemental material). Fig. 2 shows that the PNGase-F digestion of fractions containing PMN-AGP reduced the protein from a MW of a unique 50–60 kDa to a band of approximately 20 kDa, that corresponds to the MW of 20 410 Da of the amino acids backbone of the bovine AGP, as deduced by cDNA sequencing of the plasma AGP gene (Ceciliani et al., 2005). On the contrary, PNGase-F treatment on plasma-AGP produced three partially glycosylated bands, of 20, 26 and 32 kDa; among them the only 20 kDa, is the completely deglycosylated AGP. 3.3. AGP is exocytosed from PMN after stimulation In the present study the exocytosis of PMN-AGP was induced by treating isolated neutrophils with molecules which stimulate the release of granules. The presence of the target protein in the supernatant of activated cells was monitored by SDS-PAGE by directly analyzing the supernatant. Western blot analyses of the supernatants derived from neutrophils activated with different challengers are presented in Fig. 3A. The presence of a very high background after ZAS interfered with the detection of AGP (Fig. 2, Supplemental material). Therefore, the amount of exocytosed PMN-AGP after ZAS challenging was not detected. Fig. 3A demonstrates how the stimulation of neutrophils by PMA and Ionomycin resulted in a marked release of AGP from neutrophils. The mobilization of PMN-AGP-containing granules begins very early in the process of activation of the cells, i.e.15 min after PMN-AGP challenging can be detected in the supernatant of incubated cells. On the contrary, non-stimulated PMN did not spontaneously release AGP, since it was not detectable in the extracellular supernatant. Fig. 3B presents the exocytosis of primary and secondary granules, as determined by the enzymatic assays of specific markers enzymes (MPO and ALK-P, respectively). The activation of the cells with PMA induces the release in the supernatant of ALK-P, a marker commonly used to detect the mobilization of secondary granules. On the contrary, the treatment of bovine neutrophils with PMA does apparently induce a very low exocytosis of primary granules, as can be shown by the very low MPO activity, which is not statistically significant when compared to HBSS-treated controls (P < 0.05).

M.M. Rahman et al. / Veterinary Immunology and Immunopathology 125 (2008) 71–81

77

Fig. 3. PMN-AGP exocytosis by activated neutrophils. (A) Isolated bovine PMN were activated with PMA. PMN treated with calcium ionophore ionomycin were used as positive control. As negative control, unstimulated cells (i.e. treated with HBSS) were used (HBSS). Purified plasma AGP was used as molecular weight marker control. Supernatant was analyzed with SDS-PAGE and WB. (B) The degranulation of primary and secondary granules from PMA stimulated PMN. Alkaline phosphatase (ALK-P) and myeloperoxidase (MPO) enzyme release (means of four animals  S.E.M.) were used as markers of secondary and primary granules, respectively. Values are expressed as percentages of total enzyme activity from CTAB treated cells. Statistical significance was accepted at *P < 0.05. Black bars = HBSS treated negative controls.

3.4. Immunocytochemistry studies In order to confirm that PMN-AGP’s containing granules are mobilized to the cell membrane in response to activating molecules, cytospins of resting and stimulated neutrophils were prepared and labelled for AGP immunoreactivity using the polyclonal antiboAGP antibody. Results are given in Fig. 4. Resting neutrophils revealed a homogeneous staining, apparently located on the membrane of the cells (Fig. 4A1). After a 30 min stimulation with ZAS, anti-boAGP immunoreactivity increased, and some large aggregates of PMN-AGP formed on the neutrophils membrane, suggesting that PMN-AGP containing granules had translocated onto the cell membrane and were preparing to discharge their content outside the cell (Fig. 4B1).

On the whole the first part of the data which resulted from the structural characterization and exocytosis of neutrophils AGP demonstrated that this protein is present in bovine PMN, and is discharged outside the cells after stimulation with pro-inflammatory molecules or ionomycin. 3.5. AGP’s mRNA expression in bovine neutrophils RT-PCR was carried out in order to investigate whether bovine neutrophils, both resting and activated, may synthesize a second wave of AGP. The presence of coding mRNA in resting, non-activated neutrophils was clearly established by qualitative PCR, as shown in Fig. 5a. In a second experiment, the relative abundance of AGP’s mRNA isolated from LPS, PMA and ZAS activated neutrophils was determined (Fig. 5b), using

78

M.M. Rahman et al. / Veterinary Immunology and Immunopathology 125 (2008) 71–81

Fig. 4. Granules translocation of PMN-AGP after ZAS activation. Cytospins of freshly isolated neutrophils treated for 30 min with ZAS. Panel (A1): non-stimulated neutrophils (negative controls) immunostained with anti-bovine polyclonal antibody (Ceciliani et al., 2007a) and anti-rabbit, FITC labelled, secondary antibody (green). Panel (A2): combined images of anti-bovine AGP and DAPI nuclear staining (blue). Panel (B1): ZAS stimulated (30 min) neutrophils, immunostained with anti-bovine polyclonal antibody as described above. Panel (B2): combined images of antibovine AGP and DAPI nuclear staining (blue). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of the article.)

non-activated AGP as the endogenous reference gene. The rate of expression of AGP’s mRNA after PMA-, ZAS- and LPS-activation (1.109-, 0.553- and 0.84-fold, n = 2 animals) was found to be non-significant when compared with the normal rate of AGP’s mRNA expressed after treatment of cells with HBSS. 4. Discussion Fig. 5. The mRNA expression of PMN-AGP. (a) Amplification of PMN-AGP cDNA. Liver AGP was used as MW standard and positive control. (b) Relative PMN-AGP gene expression of bovine neutrophils after incubation with ZAS, LPS and PMA. The results were normalized against AGP cDNA purified from non-activated, HBSS treated cells. Data are means of two independent experiments.

Acute Phase Proteins are synthesized by the liver and sent to bloodstream, where they are supposed to fulfil the majority of their functions, including those involved in the control of collateral damages due to an excessive inflammatory response (Gabay and Kushner, 1999). The

M.M. Rahman et al. / Veterinary Immunology and Immunopathology 125 (2008) 71–81

acute phase proteins can reach the inflammatory site through the inflammatory exudate, but it has also been demonstrated an extrahepatic production of APP, in particular in the mammary gland (McDonald et al., 2001; Ceciliani et al., 2007b; Thielen et al., 2007). The concentration of some APP in the inflammatory focus may be further increased by aliquots that can be carried in the site of inflammation by leukocytes. Two acute phase proteins have been detected in bovine granulocytes so far, haptoglobin and AGP (Cooray et al., 2007; Ceciliani et al., 2007b). The very low amount of AGP is consistent with that found in human neutrophils (Poland et al., 2005). Neutrophils activated with PMA corelease AGP and alkaline phosphatase, a marker specific for secondary granules and secretory vesicles, but very little myeloperoxidase, a marker specific for primary granules. This observation, together with the observation that PMA promotes the specific release of proteins contained in secondary granules, but only minor amount from primary granules (Udby et al., 2002; Sorensen et al., 1997), suggests that bovine AGP is likely to be stored mainly in secondary granules. These results are consistent with those found in human (TheilgaardMo¨nch et al., 2005). Indeed, our findings must be confirmed by studying the co-localization of PMN-AGP with other proteins which are genuine markers for secondary granules, such as lactoferrin, for example (Swain et al., 2000). The present study identified two proteins in PMNs which react with the polyclonal anti-boAGP antibody: an abundant, high MW (50–60 kDa) protein, and a low MW (42–45 kDa) isoform. The low MW isoform is probably the liver-delivered AGP that is endocytosed from plasma and stored in secretory vesicles. Secretory vesicles are promptly mobilized after activation of the cells, and usually a very low concentration of activator (1 ng/ml of PMA) (Swain et al., 2001) is necessary. Therefore, it is conceivable that the plasma AGP aliquot stored in secretory vesicles be immediately exocytosed in the cell culture supernatant. This can be due to the very mild activation caused by manipulations of neutrophils during the isolation procedures. On the contrary, the mobilization of bovine AGP contained in neutrophil granules requires a previous activation of the cell. Plasma- and PMN-AGP are likely to derive from the same gene, since cDNA sequencing revealed that the two proteins share the same amino acid backbone. Both plasma- and PMN-AGP can be completely deglycosylated by PNGase-F treatment, even if the deglycosylation of the two glycoforms revealed a different SDSPAGE profile, the plasma-AGP being only partially

79

deglycosylated. Therefore, the different molecular weights of the two proteins are due to different posttranslational modifications. Remarkably, also human plasma-AGP gave rise to three different bands, with similar MW (TheilgaardMo¨nch et al., 2005). Glycan composition of plasma bovine AGP has been determined (Nakano et al., 2004). Due to its very high content of N-glycolylneuraminic acid, bovine AGP presents on its surface a glycan pattern almost unique among the species studied so far. It is known that PNGase-F does not remove oligosaccharides containing a(1-3)-linked core fucose, which are commonly found on plant glycoproteins. We might not rule out the possibility that some of the bovine AGP glycoforms which are expressed in plasma contain glycan residues that are only partially released by PNGase-F. Apparently these residues are not present on the surface of PMN-AGP, since the treatment with Nglycosidase resulted in a complete deglycosylation of the protein. It becomes evident that the source of AGP in the inflammatory focus is complex: the major component probably derives from plasma, and is produced by liver due to the action of pro-inflammatory cytokines. Other aliquots are probably produced by activated macrophages (Fournier et al., 1999) and endothelial cells (So¨rensson et al., 1999). Even if the concentration of PMN-AGP may be relatively low when compared with that of plasma AGP, we should not rule out the contrasting possibility that its activity may be relevant, since as low as 1 mg/ml may increase the cytosolic [Ca2+] in human neutrophils (Gunnarsson et al., 2007). Most part of proteins expressed by granulocytes are usually produced during their early development, in the so-called intramedullary phase, and stored in their granules (Paape et al., 2003). Yet, notwithstanding their short lifespan, we found that non-activated neutrophils can still synthesize a second wave of AGP. The activation of bovine neutrophils by pro-inflammatory challengers, including LPS, PMA and ZAS did not induce a sensible increase in the AGP expression. Therefore, our results in bovine do not agree with those of other authors who reported an increase of >30-folds of AGP gene expression due to LPS stimulation (Tsukahara et al., 2003). Actually, these data derived from oligonucleotide chip technique which has not been confirmed by quantitative (real-time) PCR. Which is the biological significance of PMN-AGP in the inflammatory focus? There is a strong relationship between the AGP fucosylation degree and an anti-inflammatory function, since hyperfucosylated AGP found in plasma during chronic diseases are thought to antagonize the

80

M.M. Rahman et al. / Veterinary Immunology and Immunopathology 125 (2008) 71–81

adhesion of newly recruited neutrophils, thus competing with these cells in their interaction with E-selectins (Ceciliani and Pocacqua, 2007). We may therefore hypothesize that PMN-AGP glycoforms, which have been shown to be strongly fucosylated (TheilgaardMo¨nch et al., 2005; Ceciliani et al., 2007b) are discharged in the inflammatory environment. There they might be involved in an overall activity of dampening the most dangerous functions of defensive cells (Hochepied et al., 2003) as well as, at least in bovine, the increase of the lifespan of monocytes (Ceciliani et al., 2007a). One further, possible activity of PMN-AGP can be correlated to its belonging to the lipocalin superfamily. AGP is not the first lipocalin to be identified in neutrophils, since a neutrophil gelatinase-associated lipocalin, or NGAL, has been detected in specific granules of human neutrophils (Kjeldsen et al., 1994). It has been speculated that NGAL may participate in regulating the inflammatory response by binding small hydrophobic mediators, including PAF, LTB4, or bacterial molecules, such as LPS. Since AGP may bind several mediators of inflammation (Israili and Dayton, 2001), it is at least conceivable that one of its possible mechanisms of action in the inflammatory focus consists in interfering with biological availability of the inflammatory mediators. Recent findings support the hypothesis for which an acute phase reaction complementary to that of liver can occur and develop locally in the site of inflammation. The acute phase proteins can be locally expressed by surrounding tissues and/or by leukocytes intervening in the inflammatory site. Neutrophils might therefore represent an important source of AGP in the inflammatory environment, together with the plasma, liverdelivered, AGP glycoform. What the specific activity of PMN-AGP can be still remains undisclosed. If also confirmed in bovine, its specific post-translational modification may be related to modulating the local inflammatory environment in an autocrine/paracrine mode. Acknowledgements We thank Dr. Alessio Scarafoni for his help with the densitometric analysis obtained by Imagemaster 1D Software (GE Healthcare), and Prof. Gigliola Canepa for her precious support in the final editing of this paper. This work was financed by Grant FIRST/2004 founded to Dr. Ceciliani, and PRIN 2006 founded to Prof. Paola Sartorelli.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.vetimm. 2008.05.010. References Bennett, M., Schmid, K., 1980. Immunosuppression by human plasma alpha 1-acid glycoprotein: importance of the carbohydrate moiety. Proc. Natl. Acad. Sci. U.S.A. 77 (10), 6109–6113. Borregaard, N., Cowland, J.B., 1997. Granules of the human neutrophilic polymorphonuclear leukocyte. Blood 89 (10), 3503– 3521. Ceciliani, F., Pocacqua, V., Provasi, E., Comunian, C., Bertolini, A., Bronzo, V., Moroni, P., Sartorelli, P., 2005. Identification of the bovine a1-acid glycoprotein in colostrum and milk. Vet. Res. 36, 735–746. Ceciliani, F., Pocacqua, V., 2007. The acute phase protein alpha1-acid glycoprotein: a model for altered glycosylation during diseases. Curr. Protein Pept. Sci. 8 (1), 91–108. Ceciliani, F., Pocacqua, V., Miranda-Ribera, A., Bronzo, V., Lecchi, C., Sartorelli, P., 2007a. alpha(1)-Acid glycoprotein modulates apoptosis in bovine monocytes. Vet. Immunol. Immunopathol. 116 (3–4), 145–152. Ceciliani, F., Pocacqua, V., Lecchi, C., Fortin, R., Rebucci, R., Avallone, G., Bronzo, V., Cheli, F., Sartorelli, P., 2007b. Differential expression and secretion of a1-acid glycoprotein in bovine milk. J. Dairy Res. 74 (3), 374–380. Coomber, B.L., Galligan, C.L., Gentry, P.A., 1997. Comparison of in vitro function of neutrophils from cattle deficient in plasma factor XI activity and from normal animals. Vet. Immunol. Immunopathol. 58 (2), 121–131. Cooray, R., Waller, K.P., Venge, P., 2007. Haptoglobin comprises about 10% of granule protein extracted from bovine granulocytes isolated from healthy cattle. Vet. Immunol. Immunopathol. 119 (3–4), 310–315. Fournier, T., Bouach, N., Delafosse, C., Crestani, B., Aubier, M., 1999. Inducible expression and regulation of the alpha 1-acid glycoprotein gene by alveolar macrophages: prostaglandin E2 and cyclic AMP act as new positive stimuli. J. Immunol. 163, 1883–2890. Gabay, C., Kushner, I., 1999. Acute-phase proteins and other systemic responses to inflammation. N. Engl. J. Med. 340, 448–454. Gennaro, R., Schneider, C., de Nicola, G., Cian, F., Romeo, D., 1978. Biochemical properties of bovine granulocytes. Proc. Soc. Exp. Biol. Med. 157 (3), 342–347. Giulietti, A., Overbergh, L., Valckx, D., Decallonne, B., Bouillon, R., Mathieu, C., 2001. An overview of real-time quantitative PCR: applications to quantify cytokine gene expression. Methods 25, 386–401. Gunnarsson, P., Levander, L., Pa´˚ hlsson, P., Grenedard, M., 2007. The acute-phase protein a1-acid glycoprotein (AGP) induces rises in cyosolic Ca2+ in neutrophil granulocytes vie sialic acid binding immunoglobulin-like lectins (Siglecs). FASEB J. 21 (published online August 3, 2007). Hochepied, T., Berger, F.G., Baumann, H., Libert, C., 2003. a1-Acid glycoprotein: an acute phase protein with inflammatory and immunomodulatory properties. Cytokine Growth Factors Rev. 14 (1), 25–34.

M.M. Rahman et al. / Veterinary Immunology and Immunopathology 125 (2008) 71–81 Israili, Z.H., Dayton, P.G., 2001. Human alpha-1-glycoprotein and its interactions with drugs. Drug Metab. Rev. 33 (2), 161–235. Kjeldsen, L., Bainton, D.F., Sengeløv, Borregaard, N., 1994. Identification of neutrophil gelatinase-associated lipocalin as a novel matrix protein of specific granules in human neutrophils. Blood 83 (3), 799–807. Laine´, E., Couderc, R., Roch-Arveiller, M., Vasson, M.P., Giroud, J.P., Raichvarg, D., 1990. Modulation of human polymorphonuclear neutrophils functions by a1-acid glycoprotein. Inflammation 14 (1), 1–9. Logdberg, L., Wester, L., 2000. Immunocalins: a lipocalin subfamily that modulates immune and inflammatory responses. Biochim. Biophys. Acta 1482, 284–297. McDonald, T.L., Larson, M.A., Mack, D.R., Weber, A., 2001. Elevated extrahepatic expression and secretion of mammary-associated serum amyloid A2 (M-SAA3) into colostrum. Vet. Immunol. Immunopathol. 82, 203–211. Nakano, M., Kakehi, K., Tsai, M., Lee, Y.C., 2004. Detailed structural features of glycan chains derived from alpha1-acid glycoproteins of several different animals: the presence of hypersialylated, Oacetylated sialic acids but not disialyl residues. Glycobiology 14 (5), 431–444. Paape, M.J., Bannerman, D.D., Zhao, X., Lee, J.W., 2003. The bovine neutrophil: structure and function in blood and milk. Vet. Res. 34 (5), 597–627. Petersen, H.H., Nielsen, J.P., Heegaard, P.M., 2004. Application of acute phase protein measurements in veterinary clinical chemistry. Vet. Res. 35, 163–187. Poland, D.C., Garcia Vallejo, J.J., Niessen, H.W., Nijmeye, r, R., Calafat, J., Hack, C.E., Van het Hof, B., Van Dijk, W., 2005. Activated human PMN synthesize and release a strongly fucosylated glycoform of alpha1-acid glycoprotein, which is transiently deposited in human myocardial infarction. J. Leukoc. Biol. 78 (2), 453–461. Quade, M.J., Roth, J.A., 1997. A rapid, direct assay to measure degranulation of bovine neutrophil primary granules. Vet. Immunol. Immunopathol. 58 (3–4), 239–248. Rausch, P.G., Moore, T.G., 1975. Granule enzymes of polymorphonuclear neutrophils: a phylogenetic comparison. Blood 46 (6), 913–919. Rinaldi, M., Moroni, P., Paape, M.J., Bannerman, D.D., 2007. Evaluation of assays for the measurement of bovine neutrophil reactive

81

oxygen species. Vet. Immunol. Immunopathol. 115 (1–2), 107–125. Smith, J.A., 1994. Neutrophils, host defense, and inflammation: a double-edged sword. J. Leukoc. Biol. 56, 672–686. Sorensen, O., Arnljots, K., Cowland, J.B., Bainton, D.F., Borregaard, N., 1997. The human antibacterial cathelicidin, hCAP-18, is synthesized in myelocytes and metamyelocytes and localized to specific granules in neutrophils. Blood 90, 2796–2803. So¨rensson, J., Matejka, G.L., Ohlson, M., Haraldsson, B., 1999. Human endothelial cells produce orosomucoid, an important component of the capillary barrier. Am. J. Physiol. 276 (2 Pt 2), H530–H534. Swain, S.D., Jutila, K.L., Quinn, M.T., 2000. Cell-surface lactoferrin as a marker for degranulation of specific granules in bovine neutrophils. Am. J. Vet. Res. 61 (1), 29–37. Swain, S.D., Siemens, D.W., Hanson, A.J., Quinn, M.T., 2001. Activation-induced mobilization of secretory vesicles in bovine neutrophils. Am. J. Vet. Res. 62 (11), 1776–1781. Theilgaard-Mo¨nch, K., Jacobsen, L.C., Rasmussen, T., Niemann, C.U., Udby, L., Borup, R., Gharib, M., Arkwright, P.D., Gombart, A.F., Calafat, J., Porse, B.T., Borregaard, N., 2005. Highly glycosylated alpha1-acid glycoprotein is synthesized in myelocytes, stored in secondary granules, and released by activated neutrophils. J. Leukoc. Biol. 78 (2), 462–470. Thielen, M.A., Mielenz, M., Hiss, S., Zerbe, H., Petzl, W., Schuberth, H.J., Seyfert, H.M., Sauerwein, H., 2007. Cellular localization of haptoglobin mRNA in the experimentally infected bovine mammary gland. J. Dairy Sci. 90 (3), 1215–1219. Tilg, H., Vannier, E., Vachino, G., Dinarello, C.A., Mier, J.W., 1993. Antiinflammatory properties of hepatic acute phase proteins: preferential induction of interleukin 1 (IL-1) receptor antagonist over IL-1 beta synthesis by human peripheral blood mononuclear cells. J. Exp. Med. 178 (5), 1629–1636. Tsukahara, Y., Lian, Z., Zhang, X., Whitney, C., Kluger, Y., Tuck, D., Yamaga, S., Nakayama, Y., Weissman, S.M., Newburger, P.E., 2003. Gene expression in human neutrophils during activation and priming by bacterial lipopolysaccharide. J. Cell. Biochem. 89, 848–861. Udby, L., Calafat, J., Sorenson, O.E., Borregaard, N., Kjeldsen, L., 2002. Identification of human cysteine-rich secretory protein-3 (CRISP-3) as a matrix protein in a subset of peroxidase-negative granules of neutrophils and in the granules of eosinophils. J. Leukoc. Biol. 72, 462–469.