autophagy pathway

Journal Pre-proof Alpinetin improves intestinal barrier homeostasis via regulating AhR/suv39h1/TSC2/mTORC1/autophagy pathway

Yumeng Miao, Qi Lv, Simiao Qiao, Ling Yang, Yu Tao, Wenxin Yan, Pengfei Wang, Na Cao, Yue Dai, Zhifeng Wei PII:

S0041-008X(19)30380-1

DOI:

https://doi.org/10.1016/j.taap.2019.114772

Reference:

YTAAP 114772

To appear in:

Toxicology and Applied Pharmacology

Received date:

3 June 2019

Revised date:

27 September 2019

Accepted date:

1 October 2019

Please cite this article as: Y. Miao, Q. Lv, S. Qiao, et al., Alpinetin improves intestinal barrier homeostasis via regulating AhR/suv39h1/TSC2/mTORC1/autophagy pathway, Toxicology and Applied Pharmacology (2019), https://doi.org/10.1016/j.taap.2019.114772

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier.

Journal Pre-proof

Alpinetin improves intestinal barrier homeostasis via regulating AhR/suv39h1/TSC2/mTORC1/autophagy pathway Yu meng Miao 1 , Qi Lv 1 , Simiao Qiao, Ling Yang, Yu Tao, Wen xin Yan, Pengfei Wang, Na Cao, Yue Dai * , Zhifeng Wei *

Depart ment of Pharmaco logy of Ch inese Materia Medica, School of Trad itional Ch inese Pharmacy,

Jo u

rn

al

Pr

e-

pr

oo

f

China Pharmaceutical University, 24 Tong Jia Xiang, Nanjing 210009, China

1

These contributed equally to this work: Yumeng Miao, Qi Lv.

* Corresponding author: Depart ment of Pharmacology of Chinese Materia Medica, Ch ina Pharmaceutical University, 24 Tong Jia Xiang, Nanjing 210009, China Tel.: +86 25 83271400; Fax: +86 25 85301528; E-mail address: [email protected]; [email protected]

1

Journal Pre-proof Abstract The injury of intestinal epithelial barrier is considered as the key pathophysiological process in response to gastrointestinal infect ion and inflammat ion, and plays an important role in the in itiation and development of colitis. Alp inetin has been shown to improve intestinal barrier ho meostasis under colitis condition, but the mechanism is still unclear. Here, we showed that alpinetin significantly improved transepithelial electrical resistance (TEER) in TNF-α-stimu lated Caco-2 cells, wh ich was main ly med iated by inhibiting the apoptosis. Mechanistic studies demonstrated that alpinetin marked ly increased the production of autophagosomes , along with obvious regulation of LC3B-II, beclin-1, p62,

oo

f

Atg7 and Atg5 expressions. In addition, it also markedly repressed the activation of mTORC1 signaling pathway, which was ascribed to TSC2 rather than p-AKT, p-ERK, p-AMPKα or PTEN expressions in

pr

Caco-2 and NCM460 cells. Furthermore, the enrich ment of H3K9me3 at TSC2 pro moter reg ion was

e-

decreased and ubiquitin proteasome degradation of suv39h1 was increased. Additionally, alp inetin activated aryl hydrocarbon receptor (AhR) and pro moted co-localization of AhR with suv39h1 in the

Pr

cytoplasm. The relationship between alpinetin-regulated AhR/suv39h1/TSC2/ mTORC1 signals, autophagy and apoptosis of Caco-2 and NCM 460 cells was confirmed by using CH223191, siAhR,

al

siTSC2 and chloroquine. Finally, CH223191 and leucine abolished alpinetin-med iated inhib ition of

rn

intestinal epithelial cells apoptosis, improvement of intestinal ep ithelial barrier and amelioration of colitis.

Jo u

Key words: Alpinetin; Intestinal epithelial barrier; Apoptosis; Autophagy; Colitis

Abbrevi ations: AhR, ary l hydrocarbon receptor; ARNT, aryl hydrocarbon receptor nuclear translocator; CHX,

cycloheximide;

CQ,

chlo roquine;

DAI,

disease

activity

index;

DAPI,

4’,

6-diamid ino-2-phenylindole; DSS, dextran sulfate sodium; EROD, etho xyresorufin O-dealkylase; FICZ, 6-Formylindolo

(3,

2-b)

carbazole;

H&E,

hemato xylin

and

eosin;

ITE,

2-(1’

H-indole-3’-carbonyl)-thiazole -4-carbo xylic acid methyl ester; IECs, intestinal epithelial cells; LSD, least significant difference; 3-M C, 3-methylcholanthrene; PMSF, phenylmethanesulfonyl fluoride; PVDF, polyvinylidene fluoride; Rapa, rapamycin; TCDD, 2, 3, 7, 8-tetrachlorodiben zo-p-dio xin; TEER, transepithelial electrical resistance; TEM, transmission electron microscopy; TSC, tuberous sclerosis complex; UC, ulcerative colitis . 2

Journal Pre-proof Introduction Ulcerative co lit is (UC) is a chronic, id iopathic and inflammatory intestinal disease, which manifests by abdominal pain, d iarrhea, mucus blood and pus, and tenesmus (Ungaro et al., 2017). Current drugs used for UC t reatment possess different side effects, and it is urgent to seek effect ive as well as safe drugs and elucidate their mechanis ms by pharmacological methods (Ding et al., 2013). The etiology and pathogenesis of UC remains poorly understood, but the combination of genetic factors, environmental factors, immune dysregulation, disruption of intestinal mucosal barrier and intestinal flora d isturbance has been identified as the main inducer (de Souza and Fiocchi, 2016). A mong them,

oo

f

damage of intestinal epithelial barrier occupies the predominant position in the in itiation and development of UC. The intestinal ep ithelial barrier forms the body’s largest interface for

pr

communicat ion with the external environ ment, and its disruption in function will eventually lead to the

e-

occurrence of inflammation in colons (Shi et al., 2018; Naganuma et al., 2016). The intestinal barrier main ly includes monolayer of colu mnar intestinal epithelial cells (IECs) and

Pr

epithelial cell-cell junctions (Kurashima and Kiyono, 2017). Ep ithelial cell-cell junctions main ly consist of the tight junctions and adherence junctions. The expressions of various tight junction proteins

al

have been shown decreased in intestinal mucosa samples fro m patients or mice with colitis (Klepsch et

rn

al., 2018). Furthermore, intestinal-specific conditional deletion of claudin-7, one of the predominant intestinal claudins, enhances paracellular organic solute flu x and init iates colonic inflammation in mice

Jo u

(Tanaka et al., 2015). Similarly, the exp ression of E-cadherin is decreased in colons of colit is mice, and saccharomyces boulardii supernatant attenuates the colitis sympto ms via driving E-cadherin expression (Terciolo et al., 2017). More importantly, IECs work as the first line of defense, and the individual epithelial cells are continually removed by apoptosis and replaced by pro liferat ion of neighboring cells to retain the function and fitness of the tissue. Failure to efficiently coord inate the birth and death of cells can lead to dysregulation of cell numbers and compromised barrier function. Autophagy is a degradative process intimately involved in the cellu lar stress response and accumulat ing evidences have demonstrated it as a key regulator of cell apoptosis. Inhibition of autophagy through 3-methyladenine (3-MA) or knockdown of autophagy related 7 (Atg7) result in apoptosis of myoblasts (Baechler et al., 2019); However, act ivation of autophagy protects hepatocytes and IECs fro m apoptosis and limits inflammat ion (Polishchuk et al., 2019; Pott and Maloy, 2018). Furthermore, autophagy also actually participates in the pathogenesis of colitis. Hypoxia ameliorates 3

Journal Pre-proof intestinal inflammation in murine co lit is models by pro moting autophagy and inhibiting activation of mTOR/NLRP3 signaling pathway (Cosin-Roger et al., 2017); Andrographolide significantly ameliorates the development of colitis in mice, and the mechanism is attributed to enhancement of mitophagy and subsequent inactivation of NLRP3 inflammasome (Guo et al., 2014). Alpinetin, the main flavonoid isolated fro m Alpinia katsumadai Hayata, has been demonstrated with ant i-colit is and barrier p rotect ion effects. However, the mechan is ms are still un known (Lv et al., 2018; Tan and Zheng, 2018; He et al., 2016) . Recently, scholars point out that flavonoids like quercetin and furowan in A might possess the ability to imp rove autophagy and cell apoptosis

oo

f

(Rezabakhsh et al., 2018; Ma et al., 2019). In this study, we aim to evaluate the effect of alpinetin on intestinal barrier function, and investigate the underlying mechanisms fro m the angle of

e-

pr

autophagy-regulated IECs apoptosis.

Materials and methods

Pr

Chemicals and reagents

Alpinetin (C16 H14 O4 , MW: 270.28, purity > 98% ) was purchased from Jingzhu b iological technology

al

(Nanjing, China); 6-Fo rmylindolo (3, 2-b) carbazo le (FICZ; PubChem CID: 1863), leucine (PubChem

rn

CID: 6106), chloroquine (CQ; PubChem CID: 2719), rapamycin (Rapa; PubChem CID: 5284616),

Jo u

MG-132 (PubChem CID: 462382), cycloheximide (CHX; PubChem CID: 6197), and F4D (PubChem CID: 49820499) were purchased fro m Sig ma-A ldrich (M O, USA); dextran sulfate sodium (DSS; mo lecular weight 36 000-50 000) was purchased from MP Bio med ical (Aurora, USA); CH223191 (PubChem CID: 3091786) was purchased from Selleckchem (Houston, USA); Fetal bovine serum (FBS) was purchased fro m Biological Industries (Beijing, China); M EM non-essential amino acids was purchased from Life Technologies (Grand Island, NY, USA); rhTNF-α was purchased from PeproTech (Madison, USA); Lipofectamine 2000 was purchased fro m Invitrogen Corp (Carlsbad, USA); Antibodies against β-actin, aryl hydrocarbon receptor (AhR), LC3B, CYP1A 1, H3K9me3, ubiquitin, TSC2, p70S6K, RPS6, p-p70S6K, p-RPS6, AKT, p-A KT, ERK, p-ERK, AMPKα, p -AMPKα, cleaved-caspase 3, beclin-1, p62 and suv39h1 were purchased from Abcam (Camb ridge, UK); HiScript TM QRTSuperMix and AceQ™qPCR SYBR® Green Master M ix were purchased fro m Vazy me Biotech (Piscataway, USA); Pero xidase-conjugated secondary antibodies , Annexin V-FITC/PI 4

Journal Pre-proof apoptosis detection kit and protein A + G agarose were purchased from Bio world Technology, Inc. (Georgia, USA); ChIP assay kit, proteinase K and NP-40 buffer were purchased fro m Beyotime Biotechnology (Shanghai, Ch ina); myelopero xidase (MPO) assay kit was purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China); siAhR was purchased from Genechem (Shanghai, China); siTSC2, siARNT and scrambled RNA were purchased from RiboBio (Guangzhou, Ch ina); ECL reagent was purchased from DiZhao Biotech (Shanghai, Ch ina). Other chemical products used were of the analytical grade.

f

Animals

oo

Female C57BL/6 mice, weighted 20-22 g (8-10 weeks o ld), were purchased from the Co mparat ive Medicine Centre of Yangzhou Un iversity (Yangzhou, China) and housed at room temperature

pr

(22-25 °C) with a controlled 12: 12 h light/dark cycle and free access to standard diet and drinking

e-

water. The animal studies were conducted with the approval of the Animal Eth ics Committee of Ch ina Pharmaceutical Un iversity, and conformed to the National Institute of the Health guidelines on the

Pr

ethical use of animals. Induction of UC and treatments

al

The mice were given 2.5% DSS in sterile distilled water for 7 days follo wed by normal drinking water

rn

for another 3 days. To identify the key role of AhR and mTORC1 p layed in a lpinetin -mediated

Jo u

improvement of intestinal epithelial barrier under colitis condition, the mice were randomly divided into the following groups: Normal group, DSS group, alp inetin (30 mg/ kg) group, CH223191 (10 mg/kg ) group, leucine (100 mg/kg) group, CH223191 + alp inetin group, leucine + alpinetin group and FICZ (1 μg per mouse) group.

The CH223191 and FICZ were diluted in corn o il; alp inetin was diluted in 0.5% carbo xy methyl cellu lose sodium-Na (CM C-Na); leucine was dissolved in normal saline. The alp inetin was orally administered fro m day 1 to 10; FICZ, CH223191 and leucine were intraperitoneally ad min istered fro m day 1 to 10. In addition, the mice in Normal and DSS groups were given an equal volume of vehicle. Disease activity index score evaluation The disease activity index (DAI) score of each mouse including the scores of body weight loss, stool consistency and gross bleeding, and the evaluation criteria was as follows : a) body weight loss: 0 = 1-5%; 2 = 5-10%; 3 = 10-20%; 4 = over 20%; b) stool consistency: 0 = normal; 2 = loose stools; 4 = 5

Journal Pre-proof diarrhea; c) gross bleeding: 0 = negative; 2 = positive; 4 = gross rectal bleeding. Histopathological examination On day 10, mice were sacrificed, and colons were collected. The colon length fro m the cecu m to the anus was measured. Subsequently, the distal of colons were fixed in 10% phosphate -buffered saline (PBS)-buffered formalin at room temperature, and stained with hemato xylin and eosin (H&E) for histological examination. The histological scores were graded based on a modified scoring system that included the follo wing (Sun et al., 2017; Li et al., 2019; Liu et al., 2015): a) the severity of

f

inflammat ion: 0 = none; 1 = mild; 2 = moderate; 3 = severe; b) the lesion depth: 0 = none; 1 = mucosal

oo

layer; 2 = submucosal layer; 3 = muscle layer; 4 = transmu ral; c) crypt damage: 0 = none; 1 = basal 1/3 damaged; 2 = basal 2/ 3 damaged; 3 = only surface epitheliu m intact; 4 = entire crypt and epitheliu m

pr

lost; d) lesion range: 1 = 1%-25%; 2 = 26%-50%; 3 = 51%-75%; 4 = 76%-100%.

e-

MPO activity

Pr

The colons were precisely weighed, and then adequate saline was added to prepare 10% (w/v) homogenates. The activity of MPO, an index of neutrophil infiltration, was measured according to the

al

manufacturer’s instructions.

rn

Intestinal permeability assessment

On day 10, mice were rectally administered with FITC-dextran. Then, blood samples were collected

Jo u

through retro-orbital bleed ing after 4 h. The seru m samples were prepared by centrifugation at 850 g for 20 min, and FITC was measured in 100 μL of serum by using the standard curve of FITC-dextran in serum (excitat ion, 485 n m; emission, 525 n m; Microplate Reader). Then, mice were sacrificed, and other tests were performed. Cell lines The Caco-2 and NCM460 cells were purchased from A merican Type Culture Co llect ion (ATCC, Manassas, Virgin ia, USA). Caco-2 cells were cu ltured in high-glucose DMEM containing 10% FBS and 1% M EM non-essential amino acids, 100 mM sodium pyruvate solution, 100 U/ mL streptomycin and 100 U/ mL penicillin under a hu midified 5% (v/v) CO2 at mosphere at 37 °C. NCM460 cells were cultured in h igh-glucose DMEM containing 10% FBS, 100 U/ mL streptomycin and 100 U/ mL penicillin at 37 °C in 5% (v/v) CO2 atmosphere. 6

Journal Pre-proof Q-PCR assay Total RNA was isolated by using Trizol reagent, the purity and concentration of total RNA was determined by using a Nanodrop NanoVue Plus Spectrophotometer. The isolated RNA (1 000 ng) was reverse transcribed into cDNA by using HiScript TM QRTSuperM ix according to manufacturer’s instructions. Q-PCR was performed by using AceQ™qPCR SYBR® Green Master Mix with no ROX background dye on a Bio-rad CFX96. The primer sequences for the analyzed genes were listed in Table 1.

f

Transient transfection

oo

The transfection of siTSC2, siA RNT or scramb led RNA was performed by using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) at a final concentration of 50 nM according to the manufacturer’s

pr

instructions. The silence efficiency was assessed by western blotting assay 24 h after transfection. Then,

e-

cells were prepared for further analysis.

Pr

Stable transfections

The transfection of siAhR and scramb led RNA were performed at a final t itration of 10 9 PFU/ mL

al

according to the manufacturer’s instructions. The silence efficien cy was assessed by western blotting

ChIP assays

rn

assay 72 h after transfection. Then, cells were prepared for further analysis.

Jo u

The cells were cross-lin ked with 1% paraformaldehyde, and the reaction was stopped with 125 mM Glycine. Then, they were lysed with lysis buffer (50 mM Tris pH 7.8, 10 mM EDTA, and 1% SDS), and chromatin was sonicated (amplitude, 30 w; process time, 4 min; ON time, 4.5 s; OFF time, 9 s) until a range of 300 or 1 000 bp was reached. Samp les were d iluted in d ilution buffer (1% Triton, 2 mM EDTA, 150 mM NaCl, 20 mM Tris pH 7.8) at least six times and then pre-cleared with protein A + G magnetic beads. The cocktails were incubated with the indicated antibodies for overnight, and then pre-cleared with protein A + G magnetic beads for 1 h. The beads were sequentially washed with low salt immune co mplex wash buffer, high salt immune co mplex wash buffer, LiCl immune co mplex wash buffer and TE buffer. Subsequently, the beads were eluted with 0.1 M NaHCO 3 and 1% SDS with constant agitation. The cross-linking was reverted at 65 °C for overnight, and the DNA was purified. The Q-PCR was perfo rmed as demonstrated above, and the primer sequences used in this assay was listed in Table 1. 7

Journal Pre-proof TUNEL assay The apoptosis of IECs was evaluated by using the TUNEL assay according to the manufacturer’s instructions. Briefly, the colonic tissue samples were formalin -fixed and paraffin-embedded. Then, sections were de-paraffin ized, rehydrated and treated with 2 μM proteinase K for permeabi lizat ion. Subsequently, the colonic tissue samples were incubated with the TUNEL reaction mixture at 37 °C for 60 min, and washed for 3 times with PBS at roo m temperature. Lastly, the nuclei was stained with 4’, 6-diamid ino-2-phenylindole (DAPI) for 5 min, and the colonic tissue s amples were visualized by using

f

a confocal microscope.

oo

Annexin V-FITC/PI detection

The apoptosis of Caco-2 and NCM460 cells was detected with the Annexin V-FITC/PI apoptosis

pr

detection kit according to the manufacturer’s instructions. Briefly, the cells were washed with

e-

pre-cooling PBS and re-suspended with 195 µL binding buffer. A 5 µL volu me of Annexin V-FITC was added to the cell suspension and incubated for 10 min at room temperature. The cells were washed for

Pr

2 times with pre-cooling PBS, and then re-suspended with 190 µL bind ing buffer. A 10 µL volu me of PI was added to the cell suspension, and then incubated for 5 min at roo m temperature. Lastly, the

rn

Co-immunoprecipitation

al

apoptotic cells were analyzed on a FACS flow cytometer.

Jo u

The cells were lysed on ice for 15 min in RAPI lysis buffer, and then centrifugated at 13 000 g for 5 min. The supernatants were collected and incubated with the antibody against AhR for overnight at 4 °C with constant rotation. The next day, the cocktails were incubated with the protein A + G beads for 4 h at roo m temperature with constant rotation. The precip itant was collected by centrifugation at 2500 g for 5 min , and washed for 3 times with RAPI lysis buffer to remove non-specific binding proteins. The washed beads were re -suspended with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PA GE) loading buffer, and heated at 95 °C fo r 5 min. The beads were removed by centrifugation at 13 000 g for 1 min, and the supernatant was analyzed by using western blotting assay. Western blotting The cells or colonic t issues were lysed on ice for 30 min in NP-40 buffer containing phenylmethanesulfonyl fluoride (PMSF) p rotease inhibitor. The cell ext racts were centrifuged at 13 000 g for 10 min at 4 °C, and the supernatants were harvested. The protein concentration was quantified by 8

Journal Pre-proof using BCA protein assay kit, and an equal concentration of proteins was loaded by 12-15% SDS-PA GE gel and transferred to polyvinylidene fluoride (PVDF) membranes. The membranes was blocked with 9% non-fat milk, and then incubated with the antibodies against TSC2, ERK, p -ERK, AKT, p-AKT, p-p70S6K, p-RPS6, p-AKT, p70S6K and RPS6 for overnight. The next day, membranes were incubated with secondary antibody, and protein bands were visualized by using ECL and quantified using image lab software. Transepithelial electrical resistance (TEER) measurement For in vitro cellular permeability studies, the Caco-2 cells were seeded in 24-well transwell p lates, on

oo

f

polyester membrane filters (pore size 0.4 μM, surface area 1.12 cm2 ). The co mplete med iu m was added to both the apical and the basal chamber and the complete mediu m was changed every other day up to

pr

21 days. After formatting a co mplete monolayer, the TEER was measured by using an epithelial

e-

Millicell ERS-2 Vo ltohmmeter (Millipore; Bedford, MA, USA). The electrical resistance values were recorded until we got three similar measurements in a ro w, and the TEER were calculated in oh ms cm2

Pr

after subtracting the blank value for the memb rane insert. The TEER values were normalized to the initial values, and expressed as percentages of the initial resistance values.

al

Tranmission electron microscope analysis

rn

Cells were fixed with 2.5% g lutaraldehyde and 1% osmiu m tetro xide successively, and dehydrated with

Jo u

a graded series of ethanol and acetone. After penetrated and embedded, they were sliced by ultramicrotome and electronic dyed with uranyl acetate and lead citrate. Then, transmission electron microscope was used to collect the corresponding images. Statistical analysis

Statistical analysis was performed with SPSS statistical software (SPSS, Chicago, IL, USA), and data were expressed as means ± S.E.M . The mean d ifferences between two groups were co mpared by T test; the mean differences between multip le groups were compared by one-way ANOVA and Fisher’s Least Significant Difference (LSD) test. P < 0.05 was considered to represent a significant difference. Analysis and graphing were performed by using Prism 5.01 software package (GraphPad, San Diego, CA).

9

Journal Pre-proof

Results

Al pinetin ameliorates disruption of intestinal epi thelial barrier through i nhi biting the apoptosis of IECs In vitro, TNF-α is used as a stimulator to cause the loss of intestinal epithelial barrier integrity in Caco-2 cell monolayer, and simulates the disruption of intestinal epithelial barrier function. To determine whether alpinetin could exert protection of intestinal epithelial barrier function, TEER in

f

TNF-α (100 ng/ mL)-stimulated Caco-2 cells was assessed. As shown in Figure 1A, TNF-α (100 ng/mL)

oo

significantly decreased the TEER in Caco-2 cells, and alpinetin (10 μM and 30 μM) marked ly prevented its action.

pr

Furthermore, the epithelial cell-cell junctions and survival of IECs influences the intestinal

e-

epithelial barrier function (Tanaka et al., 2015; Terciolo et al., 2017; Vereecke et al., 2014; Liu et al., 2017). Firstly, the effect of alpinetin on expressions of tight junction proteins claudin-7, occludin as

Pr

well as adherence junction protein E-cadherin was analy zed. Surprisingly, alp inetin (30 μM) could up-regulate the expressions of claudin-7 and occludin but not E-cadherin in TNF-α-treated Caco-2 cells

al

(Figure 1B). Subsequently, flow cytometry assay was conducted to detect the effect of alpinetin on

rn

TNF-α-induced apoptosis of Caco-2 and NCM 460 cells. The results in Figure 1C and S1A showed that TNF-α (100 ng/mL) considerably induced apoptosis of Caco-2 and NCM460 cells, while a lpinetin (10

Jo u

μM and 30 μM) made an evident contrast. Then, the expression of apoptosis-related protein cleaved-caspase-3 was further detected. As illustrated in Figure 1D and S1B, TNF-α (100 ng/mL) elevated the protein level of cleaved-caspase-3 in Caco-2 and NCM 460 cells, and alpinetin (10 μM and 30 μM) showed significant inhibit ion. These results indicated that alpinetin might improve the intestinal barrier function mainly by inhibiting the apoptosis of IECs.

Alpinetin inhibits the apoptosis of IECs by inducing autophagy Autophagy, the conserved intracellular degradation pathway, is init ially characterized for starvation survival in yeast. It has been recognized to be critical for fundamental processes including cell apoptosis and proliferation (Baechler et al., 2019; Polishchuk et al., 2019; Pott and Maloy, 2018). To determine whether alp inetin affected autophagy in Caco -2 and NCM460 cells, transmission electron microscopy (TEM ) was performed to detect autophagic vesicles. As shown in Figure 2A and S2A, 10

Journal Pre-proof alpinetin (10 μM and 30 μM) marked ly improved the production of autophagosomes in TNF-α-stimulated Caco-2 and NCM 460 cells. Additionally, alpinetin (10 μM and 30 μM) pro moted the protein expression of LC3B-II and beclin-1 in TNF-α-stimu lated Caco-2 and NCM 460 cells in a concentration-dependent manner. Level of p62, a protein can be degraded through autophagy, was decreased by alpinetin (10 μM and 30 μM) (Figure 2B and S2B). Finally, the mRNA expressions of Atg7 and Atg5 were increased in alpinetin (10 μM and 30 μM )-incubated Caco-2 and NCM460 cells (Figure 2C and S2C). To further confirm the participation of autophagy in alpinetin -inhibited apoptosis of IECs and

f

subsequent enhanced function of intestinal epithelial barrier, CQ, the autophagy inhibitors, was adopted.

oo

Alpinetin (30 μM) significantly inhibited the apoptosis of Caco-2 and NCM 460 cells as well as

pr

expression of cleaved-caspase 3 induced by TNF-α (100 ng/ mL), and CQ (25 μM) markedly reversed its action (Figure 2D, E and S2D, E). Moreover, CQ (25 μM) d iminished alpinetin (30 μM)-pro moted

e-

function of intestinal epithelial barrier (Figure 2F). These results revealed that alp inetin inhibited the

Pr

apoptosis of IECs and subsequently improved the function of intestinal epithelial barrier via enhancing autophagy.

al

Alpinetin inhibits the activation of mTORC1 signaling pathway via TSC2

rn

Mammalian target of rapamycin co mplex 1 (mTORC1) is an evolutionarily conserved protein kinase complex. Growing ev idences indicate that activation of mTORC1 can inhibit autophagy, while

Jo u

dysfunction of mTORC1 due to deficiency of raptor will drive autophagy (Shende et al., 2011; Lu et al., 2018). Therefore, we speculated that alpinetin might affect the activation of mTORC1 signaling pathway in Caco-2 and NCM460 cells. At present, the phosphorylation of p70S6K and RPS6, substrates used as indicators for the activation of the mTORC1 signaling pathway, in Caco-2 and NCM460 cells was significantly elevated by TNF-α (100 ng/mL). Ho wever, both alp inetin (10 μM and 30 μM) and Rapa (the well-known mTORC1 inhib itor, 5 nM) obviously inhibited the phosphorylation of p70S6K and RPS6 in a concentration-dependent manner (Figure 3A and S3A). These results implied that alpinetin repressed the activation of mTORC1 signaling pathway in Caco-2 and NCM460 cells. On the one hand, PI3K/AKT, ERK and AMPKα locate at the upstream of mTORC1, and respectively show positive or negative regulat ion (Ko matsu et al., 2015; Liu et al., 2018; Pearson et al., 2018). Interestingly, alpinetin (3 μM, 10 μM and 30 μM) did not affect TNF-α-induced phosphorylation 11

Journal Pre-proof of AKT, ERK and AMPKα in Caco-2 and NCM 460 cells (Figure 3B and S3B). On the other hand, phosphatase and tensin homologue deleted on chromosome ten (PTEN) and tuberous sclerosis complex (TSC) 2 are two well recognized negative regulators of mT ORC1, and their exp ressions were further detected (Valvezan et al., 2017; Yun et al., 2016). As shown in Figure 3B, alp inetin (10 μM and 30 μM) exerted obvious promotion of TSC2 expression, but not PTEN in TNF -α-stimu lated Caco-2 and NCM460 cells. To further confirm the impact of alpinetin, Q-PCR assay was then adopted. As expected, alpinetin (10 μM and 30 μM) significantly drove the mRNA expression of TSC2 (Figure 3C and S3C).

f

Alpinetin promotes autophagy by modulating TSC2-mTORC1 signaling pathway

oo

Subsequently, to further evaluate whether TSC2 is functionally involved in the effect of alpinetin on the

pr

inhibit ion of mTORC1 pathway, siTSC2 was used in the present study. As shown in Figure 4A and S4A, all three pairs of siRNA inhibited the TSC2 exp ression to various extents with pair 3 of the best

e-

efficiency. Under this condition, alpinet in (30 μM ) t reatment could not suppress the phosphorylation of

Pr

p70S6K and RPS6 in Caco-2 and NCM460 cells (Figure 4B and S4B). Furthermore, alp inetin-induced autophagy was also inhibited by siTSC2 (Figure 4C-E and S4C-E). Consistently, siTSC2 reversed alp inetin-inhibited apoptosis of Caco-2 and NCM 460 cells and

rn

al

subsequent enhanced function of intestinal epithelial barrier (Figure 4F-H and S4F-G).

promoter

Jo u

Al pinetin increases the expression of TSC2 by i nhi biting H3 K9 me3 modi ficati on at TSC2

Next, the precise mechanism of alpinetin-pro moted TSC2 exp ression was examined. As above-mentioned, alpinetin significantly pro moted both mRNA and protein expression of TSC2, indicating that alp inetin-regulated TSC2 exp ression might be at the transcriptional level. More and more evidence indicated that H3K9me3 mod ification at TSC2 pro moter influences its transcription and subsequent mRNA as well as protein expression. As shown in Figure 5A and S5A, alp inetin (10 μM and 30 μM) markedly suppressed the H3K9me3 modification at TSC2 promoter. Suv39h1, the major histone methyltransferase, could catalyze the modification of H3K9me3 (Shirai et al., 2017). Therefore, the expression of suv39h1 was detected. Interestingly, alp inetin (10 μM and 30 μM) scarcely influenced the mRNA expression of suv39h1, but significantly decreased its protein expression (Figure 5B and S5B). Furthermore , we examined suv39h1 protein stability in the 12

Journal Pre-proof presence of the proteasome inh ibitor M G-132 (5 μM) in TNF-α-stimulated Caco-2 and NCM 460 cells treated with cycloheximide (CHX, 15 μg/ mL), which blocks de novo protein synthesis. The result of pulse-chase experiment indicated that alpinetin (10 μM and 30 μM) facilitated the turnover of suv39h1 protein in TNF-α-stimulated Caco-2 and NCM 460 cells (Figure 5C and S5C). These findings indicated that alpinetin might regulate the expression of suv39h1 by a post-translational mechanism. The degradation of suv39h1 is reported via the ubiquitin-proteasomal pathway. In the present study, to identify whether alpinetin influenced the suv39h1 protein stability through proteasomal pathway, M G-132 was employed. As shown in Figure 5D and S5D, M G-132 (5 μM) recovered

oo

f

alpinetin-reduced protein expression of suv39h1 in TNF -α-stimulated Caco-2 and NCM 460 cells. Moreover, we examined the ubiquit ination of suv39h1 in alpinetin -treated Caco-2 and NCM460 cells

pr

in the presence of MG-132. Expectedly, alpinetin (10 μM and 30 μM) significantly pro moted the ubiquitination of suv39h1 protein (Figure 5E and S5E). These results suggested that alpinetin

e-

accelerated the ubiquitin proteasome degradation of suv39h1 protein.

al

of aryl hydrocarbon receptor (AhR)

Pr

Al pinetin enhances the ubi quitin proteasome degradati on of suv39h1 vi a the non-genomic action

AhR is a pleiotropic receptor, and has dual roles in regulat ing levels of intracellu lar proteins. It wo rks

rn

both as a ligand-activated transcription factor (genomic effect) and as a ligand-dependent E3 ubiquit in

Jo u

ligase (non-genomic effect). On the one hand, AhR could enter into the nuclear, bind to AhR nuclear translocator (ARNT), and thereby regulating the expression of downstream target genes such as CYP1A1 and CYP1B1 (Monteleone et al. 2013). On the other hand, AhR could exist in the cytoplasm, and play the role as E3 ubiquitin ligase (Ohtake et al., 2009). As shown in Figure 6A and S6A, AhR could interact with suv39h1 in alp inetin (10 μM and 30 μM)-treated Caco-2 and NCM460 cells. Subsequently, we detected whether alp inetin -regulated expression of suv39h1 was dependent on non-genomic action of AhR. The Caco-2 and NCM 460 cells were transfected with siA RNT, and expression levels of CYP1A1 and suv39h1 were detected. Notably, alpinetin (30 μM) significantly increased the expression of CYP1A1, and the action was weakened by siARNT. Contrarily, alp inetin-inh ibited expression of suv39h1 was not affected by siARNT (Figure 6B, C and S6B, C). These findings suggested that alpinetin inhib ited suv39h1 expression via the non-genomic action of AhR. 13

Journal Pre-proof To verify the key ro le that AhR p layed in alpinetin-induced ubiquitin proteasome degradation of suv39h1 protein, both CH223191 (an Ah R antagonist) and siAhR were used. As illustrated in Figure 6D , E and S6D, E, both CH223191 and siAhR reversed alpinetin-accelerated ubiquitin proteasome degradation of suv39h1 p rotein. Additionally, alpinetin (30 μM) reduced the H3K9me3 enrich ment at TSC2 pro moter, increased TSC2 exp ression and inhibited activation of mTORC1 signaling pathway, CH223191 (10 μM) and siAhR diminished its action (Figure 6F-H and S6F-H). Further results indicated that alp inetin-induced autophagy, decreased-apoptosis of IECs and eventual protected-function of intestinal epithelial barrier were inhib ited by CH223191 (10 μM) and

oo

f

siAhR (Figure 7A-F and S7A-E).

pr

Al pinetin recovered the function of intestinal epi thelial barrier in mice wi th DSS -induced colitis by regulating the activation of AhR/suv39h1/TSC2/mTORC1/autophag y pathway

e-

To further ascertain the causal link between alp inetin -med iated activation of AhR, regulation of

Pr

suv39h1/TSC2/ mTORC1/autophagy pathway, improvement of intestinal epithelial barrier function and amelioration of co lit is, CH223191 and leucine were ad ministered in co mb ination with alp inetin to mice

al

with DSS-induced colit is. As expected, alpinetin (30 mg/ kg) decreased the expression of suv39h1, increased the expression of TSC2 and eventually inhibited the activation of mTORC1 signaling

rn

pathway, which was markedly weakened by CH223191 (10 mg/kg) (Figure 8A).

Jo u

Furthermore, alp inetin (30 mg/kg)-pro moted autophagy, -inhibited IECs apoptosis, and -imp roved intestinal barrier function was reversed by both CH223191 (10 mg/kg) and leucine (100 mg/ kg) (Figure 8B-F). Finally, CH223191 (10 mg/kg) and leucine (100 mg/kg) also diminished the effect of alpinetin (30 mg/kg) against colitis in mice (Figure 8G-K).

Discussion UC is characterized by the chronic o r recurring inflammation of gastrointestinal tract, which requires the convergence of several abnormalities that affect overlapping layers of homeostatic modules. A healthy and robust intestinal epithelial barrier maintains the intestinal homeostasis, and it is destroyed in patients with Crohn’s disease or UC, and mice with DSS or TNBS-induced colitis (Tanaka et al., 2015; Tercio lo et al., 2017; Vereecke et al., 2014; Liu et al., 2017). Alp ineitn, the novel flavonoid isolated from the seed of Alpinia katsumadai Hayata, yields well anti-co litis and barrier p rotect ion 14

Journal Pre-proof effect (Lv et al., 2018; Tan et al., 2018; He et al., 2016). However, the specific mechanism for alpinetin-enhanced intestinal barrier function is unclear. In vitro, alpinetin significantly elevated the TEER in TNF-α-treated Caco-2 cells, indicating alpinetin might ameliorate the development of colitis by enhancing the intestinal barrier function (Figure 1A). In addition, the intestinal barrier function is med iated by cell-cell junctions that link epithelial cells together into a structural and functional continuum. Disruption of the cell-cell junctions increases intestinal permeab ility and induces the inflammat ion cascade in the colons. Amazingly, alpinetin d id not affect the expression of E-cadherin, while increased the expressions of claudin-7 and occludin only at the concentration of 30 μM in Caco-2

oo

f

cells (Figure 1B). These findings suggested that alpinetin only exerted weak effect on epithelial cell-cell junctions.

pr

Notably, the intestinal epitheliu m is lined by a s ingle layer of epithelial cells, which are critical components of the intestinal mucosal barrier. In colons of mice with TNBS or DSS-induced colit is, the

e-

proportions of apoptotic IECs are increased, and ultimately results in destruction of the intestinal

Pr

barrier function (Vereecke et al., 2014; Liu et al., 2017; Mandić et al., 2017). More impo rtantly, 5-aminosalicylic acid, the standard drug for colitis, significantly reduces peroxynitrite-induced apoptosis in hu man IECs to protect the intestinal barrier function and eventually ameliorates the

al

development of colit is (Sandoval et al., 1991). In the present study, alpinetin significantly reduced the

rn

numbers of apoptotic IECs in vitro (Figure 1C and S1A). Furthermore, the protein level of

Jo u

cleaved-caspase-3, a key regulator for cell apoptosis, in TNF-α-stimulated Caco-2 and NCM460 cells was also markedly decreased (Figure 1D and S1B). These findings indicated that alpinetin pro moted the intestinal barrier function by inhibiting the apoptosis of IECs. Autophagy, a conserved eukaryotic cellu lar degradative process , is commonly activated in response to cellular stresses, including starvation, endoplasmic reticulu m stress and oxidative stress . Multiple studies have provided compelling evidences that it plays an essential ro le in various cellular processes including cell apoptosis (Wang et al., 2018). Genetic or pharmacological inhib ition of autophagy exacerbates myocardial ischemic in jury and chronic cardiac remodeling in mouse model of myocardial ischemia through inducing the apoptosis of cardio myocytes. Conversely, activation of autophagy limits myocardial damage in response to ischemia and reduces chronic ischemic remodeling and heart failu re (Sciarretta et al., 2018). In the present study, alpinetin significantly pro moted autophagy, evidenced by production of autophagic vesicles, promotion of LC3B-II, beclin-1, Atg5 and 15

Journal Pre-proof Atg7 expressions as well as reduction of p62 exp ression (Figure 2A-C and S2A-C). Additionally, CQ reversed alpinetin-repressed IECs apoptosis and enhanced intestinal barrier function, indicat ing that alpinetin inhibited the IECs apoptosis through driving autophagy (Figure 2D-F and S2D-E). The mTOR is an atypical serine/threonine kin ase and belonging to the phosphoinositide kinase-related kinase (PIKK) family. It interacts with specific adaptor proteins and forms 2 d istinct macro molecular co mplexes, which named mTORC1 and mTORC2. Recent evidence has shown that the mTORC2 main ly controls the skeleton and movements of cells, wh ile mTORC1 main ly controls the important cellular processes, including autophagy. Deletion of raptor, who owns the ability to suppress

oo

f

the activation of mTORC1, selectively drives autophagy in human disc NP cells and subsequently represses their apoptosis (Ito et al., 2017). Leucine, the activator for mTORC1, has been reported to

pr

inhibit autophagy in HeLa cells (Sciarretta et al., 2018). In line with this, our data showed that alpinetin significantly inhib ited the activation of mTORC1 signaling pathway (Figure 3A and S3A). The deeper

e-

mechanis ms were investigated, classical upstream kinases (including PI3K/AKT and ERK) and

Pr

negative regulators (including PTEN, TSC2 and AMPKα) were detected, and alpinetin only promoted the expression of TSC2 (Figure 3B, C and S3B, C). Knockdown of TSC2 d iminished the inhibitory effects of alp inetin on activation of mTORC1 signaling pathway (Figure 4A, B and S4A, B).

al

Furthermore, siTSC2 dimin ished alpinetin-pro moted autophagy, inhibited IECs apoptosis and enhanced

rn

intestinal barrier function (Figure 4C-H and S4C-G).

Jo u

Subsequently, the underlying mechanisms fo r alpinetin-pro moted expression of TSC2 were further investigated. In this report, alpinetin not only pro moted the protein but also the mRNA expression of TSC2, which indicated that the expression of TSC2 was regulated at the transcriptional level. The histone methylation has been reported to associate with transcription regulat ion and subsequent expression of target genes. There are four co mmon lysines within h istone H3 (K4, K9, K27, K36). Methylation at H3K9 is usually associated with transcriptional repression, while at H3K4 and H3K36 shows opposite effects. In addition, the methylation at H3K27 has been proved to be linked to several silencing phenomena including homeotic-gene silencing, X inactivation and genomic imprinting (Ell and Kang, 2013; Tu mes et al., 2017). At present, alp inetin significantly inhib ited the H3K9me3 modification at the promoter region of TSC2 (Figure 5A and S5A). Suv39h1 is the major Su (var) 3-9, Enhancer-of-zeste, Trithorax (SET) domain-containing h istone methyltransferase, and main ly influences the expression of target genes through regulating the 16

Journal Pre-proof H3K9me3 modification. The suv39h1 bounds to the SIRT1 pro moter and represses its transcription by promoting the H3K9me3 modificat ion. The MDM 2-mediated suv39h1 degradation induces the transcriptional of p53 through regulating the H3K9me3 modification at its promoter region, and eventually inhibiting the apoptosis of HCT116 cells (Mungamuri et al., 2016). In the present study, alpinetin significantly decreased the protein expression of suv39h1 (Figure 5B and S5B). In addit ion, the half-life of suv39h1 was significantly shortened in alpinetin-treated cells, and M G132 treat ment resulted in increased abundance of suv39h1 proteins, indicat ing a posttranslational regulation mode of suv39h1 (Figure 5C, D and S5C, D). Furthermo re, alpinetin significantly pro moted the ubiquitin of

oo

f

suv39h1 protein, which further confirming that suv39h1 protein was degradation by E3 ubiquitin ligase (Figure 5E and S5E). These findings pushed us to seek the deeper mechanisms for alpinetin-modulated

pr

suv39h1 expression.

AhR, the environmental sensor, is highly expressed at barrier sites such as the skin, lung and gut.

e-

Although, it is orig inally described as a receptor for dio xin and other xenobiotics, physiological ligands

the

development

of

Pr

such as dietary components and tryptophan metabolites serve to drive beneficial functions of AhR in auto-immune

diseases

including

colit is.

The

2-(1’

H-indole-3’-carbonyl)-thiazole -4-carbo xylic acid methyl ester (ITE) can attenuate DSS-induced colitis

al

by increasing the proportions of Treg cells in the spleens, mesenteric ly mph nodes and colon lamina

rn

propria (Goettel et al., 2016). Similarly, 2, 3, 7, 8-tetrachlorodiben zo-p-dio xin (TCDD) inhib its

Jo u

DSS-induced colitis by increasing prostaglandin E2 production in the colons (Takamu ra et al., 2010). Furthermore, Ah R has been recently reported to improve the intestinal barrier function. FICZ attenuates the disruption of intestinal barrier function both in vivo and in vitro through ameliorating the TNF-α/IFN-γ-induced alterations in the exp ressions and localization of tight junction proteins (Yu et al., 2018). More importantly, mu ltiple kinds of flavonoids possess the ability to activate AhR. Baicalein significantly enhances the ethoxyresorufin O-dealkylase (EROD) activity of CYP1A1 in Hep G2 cells; emodin also induces the expression of CYP1A1 in human cancer cell lines (Harada et al., 2015; Zhang et al., 2003). AhR has dual roles in regulating intracellu lar p rotein levels both as a ligand-activated transcription factor and a ligand-dependent E3 ubiquitin ligase. The role o f AhR as a transcription factor is well described, while the function through other systems remains elusive. In the cytoplasm, AhR can interact with vimentin and function as an E3 ubiquit in ligase. Overexpression of AhR in H1299 cells 17

Journal Pre-proof not only accelerates the degradation of mesenchymal vimentin, but also prevents cell invasion in vitro and in vivo (Li et al., 2017). Herein, Ah R could interact with suv39h1 and promote its proteasome degradation (Figure 6A-F and S6A-F). Furthermore, we found that AhR participated in alpinetin-inhibited act ivation of mTORC1, -pro moted autophagy, -decreased IECs apoptosis and -imp roved intestinal barrier function (Figure 6G, H and S6G, H; Figure 7 and S7). Lastly, the causal lin k between activation of AhR, regulation of suv39h1/TSC2/ mTORC1/autophagy signaling pathway, reduction of IECs apoptosis, enhancement of barrier function and alleviation of colit is by alpinetin was confirmed in mice with DSS-induced colitis (Figure 8).

oo

f

In summary, alp inetin significantly pro moted intestinal barrier function through inhibiting the apoptosis of IECs, thereby ameliorat ing colit is in mice. The precise mechanis ms might be summed up

pr

as: activating AhR, pro moting the degradation of suv39h1, boosting the expression of TSC2, and

e-

down-regulating the mTORC1-med iated autophagy pathway.

Pr

Acknowledgments

This work was supported by the Program of the Nat ional Natural Science Foundation of China (NO.

al

81503319), the Natural Science Foundation of Jiangsu Province of China (NO. BK20140662), the

rn

University Innovation Research, the Training Program of China Pharmaceutical Un iversity (G14067), the “Double First-Class” University Pro ject (CPU2018GY10) and Qing Lan Project of Jiangsu

Jo u

Province (2019), and partially supported by the Priority Academic Program Development of Jiangsu Higher Education Institutions. Author contributions

Z.F.W. and Y.D. designed the study. Y.M .M, Q.L., S.M.Q., L.Y., Y.T., W.X.Y., P.F.W. and N.C. performed all the experiments. In addition, Y.M .M and Q.L. prepared the manuscript, which were reviewed and approved by all authors. Conflict of interest The authors have no conflicts of interest. References

18

Journal Pre-proof Baechler, B.L., Bloemberg, D., Quadrilatero, J., 2019. M itophagy regulates mitochondrial network signaling, o xidative stress, and apoptosis during myoblast differentiation. Autophagy 15, 1606-1619. https://doi.org/10.1080/15548627.2019.1591672. Cosin-Roger, J., Simmen, S., Melhem, H., Atrott, K., Frey-Wagner, I., Hausmann, M., de Vallière, C., Spalinger, M.R., Spielmann, P., Wenger, R.H., Zeitz, J., Vavricka, S.R., Rogler, G., Ru iz, P.A., 2017. Hypo xia ameliorates intestinal inflammat ion through NLRP3/ mTOR downregulat ion and autophagy activation. Nat. Commun. 8, 98. https://doi.org/10.1038/s41467-017-00213-3. de Souza, H.S., Fiocchi, C., 2016. Immunopathogenesis of IBD: current state of the art. Nat. Rev. Gastroenterol. Hepatol. 13, 13-27. https://doi.org/10.1038/nrgastro.2015.186. Ding, Z., Ge, J., Wu, X., Zheng, X., 2013. Biblio metrics evaluation of research performance in pharmacology/pharmacy: China relative to ten representative countries. Scientometrics 96 , 829-844. https://doi.org/10.1007/s11192-013-0968-x.

f

Ell, B., Kang, Y., 2013. Transcriptional control of cancer metastasis. Trends Cell Biol. 23, 603 -611.

oo

https://doi.org/10.1016/j.tcb.2013.06.001.

Goettel, J.A., Gandhi, R., Kenison, J.E., Yeste, A., Murugaiyan, G., Sambanthamoorthy, S., Griffith,

pr

A.E., Patel, B., Shouval, D.S., Weiner, H.L., Snapper, S.B., Qu intana, F.J., 2016. AHR activation is protective against colitis driven by T cells in hu manized mice. Cell Rep. 17, 1318 -1329. https://doi.org/10.1016/j.celrep.2016.09.082.

e-

Guo, W., Sun, Y., Liu, W., Wu, X., Guo, L., Cai, P., Wu, X., Wu, X., Shen, Y., Shu, Y., Gu , Y., Xu, Q.,2014. Small mo lecule-driven mitophagy-mediated NLRP3 inflammaso me inhib ition is

Pr

responsible for the prevention of colitis -associated cancer. Autophagy 10, https://doi.org/10.4161/auto.28374.

972-985.

Harada, A., Sugihara, K., Watanabe, Y., Yamaji, S., Kitamu ra, S., Ohta, S., 2015. A ryl hydrocarbon

al

receptor ligand activity of extracts fro m 62 herbal medicines and effect on cytochrome P450 activity. Yakugaku Zasshi 135, 1185-1196. https://doi.org/10.1248/yakushi.15-00153.

rn

He, X., Wei, Z., Wang, J., Kou, J., Liu, W., Fu, Y., Yang, Z., 2016. Alpinetin att enuates inflammatory responses by suppressing TLR4 and NLRP3 signaling pathways in DSS-induced acute colitis. Sci.

Jo u

Rep. 6, 28370. https://doi.org/10.1038/srep28370. Ito, M., Yurube, T., Kakutani, K., Maeno, K., Takada, T., Terashima, Y., Kakiuchi, Y., Take oka, Y., Miyazaki, S., Kuroda, R., Nishida, K., 2017. Select ive interference of mTORC1/RAPTOR protects against human disc cellular apoptosis, senescence, and extracellu lar matrix catabolis m with

A kt

and

autophagy

induction.

Osteoarthritis

Cart ilage

25,

2134-2146.

https://doi.org/10.1016/j.joca.2017.08.019. Klepsch, V., Gerner, R.R., Klepsch, S., Olson, W.J., Tilg, H., Moschen, A.R., Baier, G., Hermann-Kleiter, N., 2018. Nuclear orphan receptor NR2F6 as a safeguard against experimental murine colitis. Gut 67, 1434-1444. https://doi.org/10.1136/gutjnl-2016-313466. Ko matsu, N., Fu jita, Y., Matsuda, M., Aoki, K., 2015. mTORC1 upregulation via ERK -dependent gene expression change confers intrinsic resistance to MEK inhibitors in oncogenic KRas -mutant cancer cells. Oncogene 34, 5607-5616. https://doi.org/10.1038/onc.2015.16. Kurashima, Y., Kiyono, H., 2017. Mucosal ecological network of ep itheliu m and immune cells for gut homeostasis

and

tissue

healing.

Annu.

Rev.

Immunol.

35,

119-147.

https://doi.org/10.1146/annurev-immunol-051116-052424. Li, C.H., Liu, C.W., Tsai, C.H., Peng, Y.J., Yang, Y.H., Liao, P.L., Lee, C.C., Cheng, Y.W., Kang, J.J., 2017. Cytoplasmic aryl hydrocarbon receptor regulates glycogen synthase kinase 3 beta, 19

Journal Pre-proof accelerates vimentin degradation, and suppresses epithelial-mesenchymal transition in non-small cell lung cancer cells. Arch. Toxicol. 91, 2165-2178. https://doi.org/10.1007/s00204-016-1870-0. Li, H., Shen, L., Lv, T., Wang, R., Zhang, N., Peng, H., Diao, W., 2019. Salidroside attenuates dextran sulfate sodium-induced colit is in mice via SIRT1/Fo xOs signaling pathway. Eu r. J. Pharmacol. 861, 172591. https://doi.org/10.1016/j.ejphar.2019.172591. Liu, S., Li, X., Lin, Z., Su, L., Yan, S., Zhao, B., M iao, J., 2018. SEC -induced activation of ANXA7 GTPase

suppresses

prostate

cancer

metastasis.

Cancer

Lett.

416,

11-23.

https://doi.org/10.1016/j.canlet.2017.12.008. Liu, T., Ren, J., Wang, W., Wei, X.W., Shen, G.B., Liu, Y.T., Luo, M., Xu, G.C., Shao, B., Deng, S.Y., He, Z.Y., Liang, X., Liu, Y., Wen, Y.Z., Xiang, R., Yang, L., Deng, H.X., Wei, Y.Q., 2015. Treatment of dextran sodium sulfate-induced experimental colitis by adoptive transfer of

oo

f

peritoneal cells. Sci. Rep. 5, 16760. https://doi.org/10.1038/srep16760.

Liu, Y., Peng, J., Sun, T., Li, N., Zhang, L., Ren, J., Yuan, H., Kan, S., Pan, Q., Li, X., Ding, Y., Jiang, M., Cong, X., Tan, M., Ma, Y., Fu, D., Cai, S., Xiao, Y., Wang, X., Qin, J., 2017. Epithelial EZH2 and

apoptosis.

Proc.

https://doi.org/10.1073/pnas.1700909114.

Nat l.

Acad.

Sci.

USA.

114,

E3796 -E3805.

e-

inflammat ion

pr

serves as an epigenetic determinant in experimental colitis by inhibiting TNFα -med iated

Lu, L., Zhu, F., Zhang, M., Li, Y., Drennan, A.C., Kimpara, S., Ru mball, I., Selzer, C., Cameron, H.,

Pr

Kellicut, A., Kelm, A., Wang, F., Wald mann, T.A., Rui, L., 2018. Gene regulation and suppression of type I interferon signaling by STAT3 in diffuse large B cell ly mphoma. Proc. Natl. Acad. Sci. USA. 115, E498-E505. https://doi.org/10.1073/pnas.1715118115.

al

Lv, Q., Shi, C., Qiao, S., Cao, N., Guan, C., Dai, Y., Wei, Z., 2018. Alp inetin exerts anti-colitis efficacy by activating AhR, regulat ing miR-302/ DNMT-1/ CREB signals, and therefore pro moting Treg

rn

differentiation. Cell Death. Dis. 9, 890. https://doi.org/10.1038/s41419-018-0814-4. Ma, Z., Bao, X. Gu , J., 2019. Furowan in A-induced autophagy alleviates apoptosis and promotes cell cycle arrest via inactivation STAT3/Mcl-1 axis in colorectal cancer. Life Sci 218, 47-57.

Jo u

https://doi.org/10.1016/j.lfs.2018.12.027. Mandić, A.D., Bennek, E., Verdier, J., Zhang, K., Roubrocks, S., Davis, R.J., Denecke, B., Gassler, N., Streetz, K., Kel, A., Hornef, M., Cubero, F.J., Trautwein, C., Sellge, G., 2017. c -Jun N-terminal kinase 2 pro motes enterocyte survival and goblet cell d ifferentiation in the inflamed int estine. Mucosal. Immunol. 10, 1211-1223. https://doi.org/10.1038/mi.2016.125. Monteleone, I., Pallone, F., Monteleone, G., 2013. Aryl hydrocarbon receptor and colitis. Semin. Immunopathol. 35, 671-675. https://doi.org/10.1007/s00281-013-0396-2. Mungamuri, S.K., Qiao, R.F., Yao, S., Manfredi, J.J., Gu, W., Aaronson, S.A., 2016. USP7 enforces heterochromatinization of p53 target promoters by protecting SUV39H1 fro m M DM2 -med iated degradation. Cell Rep. 14, 2528-2537. https://doi.org/10.1016/j.celrep.2016.02.049. Naganuma, M., M izuno, S., Nanki, K., Sugimoto, S., Kanai, T., 2016. Recent trends and future directions for the medical treat ment of ulcerative colitis. Clin. J. Gastroenterol. 9, 329-336. https://doi.org/10.1007/s12328-016-0686-z. Ohtake, F., Fu jii-Kuriyama, Y., Kato, S., 2009. AhR acts as an E3 ubiquitin ligase to modulate steroid receptor functions. Biochem. Pharmacol. 77, 474-484. https://doi.org/10.1016/j.bcp.2008.08.034. Pearson, H.B., Li, J., Meniel, V.S., Fennell, C.M., Waring, P., Montgomery, K. G., Rebello, R.J., Macpherson, A.A., Koushyar, S., Furic, L., Cu llinane, C., Clarkson, R.W., Smalley, M .J., Simpson, 20

Journal Pre-proof K.J., Phesse, T.J., Shepherd, P.R., Hu mbert, P.O., Sansom, O.J., Phillips, W.A., 2018. Identificat ion of Pik3ca mutation as a genetic driver o f prostate cancer that cooperates with pten loss to accelerate progression and castration-resistant growth. Cancer Discov. 8, 764-779. https://doi.org/10.1158/2159-8290.CD-17-0867. Polishchuk, E.V., Merolla, A., Lichtmannegger, J., Ro mano, A., Indrieri, A., Ilyechova, E.Y., Concilli, M., De Cegli, R., Crispino, R., Marin iello, M ., Petru zzelli, R., Ranucci, G., Iorio, R., Pietrocola, F., Einer, C., Borchard, S., Zibert, A., Sch midt, H.H., Di Sch iavi, E., Puchkova, L.V., Franco, B., Kroemer, G., Zischka, H., Polishchuk, R.S., 2019. Activation of autophagy, observed in liver tissues from patients with wilson disease and from ATP7B-deficient animals, protects hepatocytes fro m

copper-induced

apoptosis.

Gastroenterology

156,

1173-1189.e5.

https://doi.org/

10.1053/j.gastro.2018.11.032. Pott, J., Maloy, K.J., 2018. Ep ithelial autophagy controls chronic colitis by reducing TNF-induced

f

apoptosis. Autophagy 14, 1460-1461. https://doi.org/10.1080/15548627.2018.1450021.

oo

Rezabakhsh, A., Rahbarghazi, R., Malekinejad, H., Fathi, F., Montaseri, A., Garjan i, A., 2018. Quercetin alleviates high glucose-induced damage on hu man u mb ilical vein endothelial cells by

pr

promoting autophagy. Phytomedicine 56, 183-193. https://doi.org/10.1016/j.phymed.2018.11.008. Sandoval, M., Liu, X., Mannick, E.E., Clark, D.A., M iller, M.J., 1991. Pero xynitrite -induced apoptosis in human intestinal epithelial cells is attenuated by mesalamine. Gastroenterology 113, 1480 -1488.

e-

https://doi.org/10.1053/gast.1997.v113.p m9352850.

Sciarretta, S., Forte, M ., Frati, G., Sadoshima, J., 2018. New insights into the role of mTOR signaling the

cardiovascular

system.

Pr

in

Circ.

Res.

122,

489-505.

https://doi.org/10.1161/CIRCRESAHA.117.311147.

Sciarretta, S., Yee, D., Nagarajan, N., Bianchi, F., Saito, T., Valenti, V., Tong, M., Del Re, D.P.,

al

Vecchione, C., Schirone, L., Forte, M., Rubattu, S., Sh irakabe, A., Boppana, V.S., Vo lpe, M., Frati, G,, Zhai, P., Sadoshima, J., 2018. Trehalose-induced activation of autophagy improves cardiac after

myocardial

rn

remodeling

infarction.

J.

A m.

Coll.

Cardio l.

71,

1999-2010.

https://doi.org/10.1016/j.jacc.2018.02.066.

Jo u

Shende, P., Plaisance, I., Morandi, C., Pellieu x, C., Berthonneche, C., Zorzato, F., Krishnan, J., Lerch, R., Hall, MN., Rüegg, M.A., Pedrazzini, T., Brin k, M., 2011. Cardiac raptor ablation impairs adaptive hypertrophy, alters metabolic gene expression, and causes heart failure in mice. Circulation 123, 1073-1082. https://doi.org/10.1161/CIRCULATIONAHA.110.977066. Shi, Y., He, C., Ma, C., Yu, T., Cong, Y., Cai, W., Liu, Z., 2018. Smad nuclear interacting protein 1 (SNIP1) inhibits intestinal inflammation through regulation of epithelial barrier function. Mucosal. Immunol. 11, 835-845. https://doi.org/10.1038/mi.2017.95. Shirai, A., Kawaguchi, T., Shimo jo, H., Muramatsu, D., Ishida-Yonetani, M ., Nishimura, Y., Kimu ra, H., Nakayama, J.I., Sh inkai, Y., 2017. Impact of nucleic acid and methylated H3K9 binding activit ies of Suv39h1 on its heterochromatin assembly. Elife 6, e25317. https://doi.org/10.7554/eLife.25317. Sun, C., Zhao, Y., Gao, X., Yuan, Y., Wang, C., Wang, Y., Zhang, L., Gu, Y., Zhang, F., Hu, P., Wang, Z., Li, Z., Sh i, J., Li, S., Cao, K., Ren, B., Yu, M., Liang, W., Li, Z., Ye, J., 2017. Cideb deficiency aggravates dextran sulfate sodium-induced ulcerative co lit is in mice by exacerbating the o xidative burden

in

colonic

mucosa.

Inflamm.

Bowel.

Dis.

23,

1338 -1347.

https://doi.org/10.1097/MIB.0000000000001196. Takamura, T., Harama, D., Matsuoka, S., Sh imokawa, N., Nakamu ra, Y., Oku mu ra, K., Ogawa , H., Kitamura, M., Nakao, A., 2010. Activation of the aryl hydrocarbon receptor pathway may 21

Journal Pre-proof ameliorate dext ran sodium sulfate-induced colitis in mice. Immunol Cell Biol. 88, 685-689. https://doi.org/10.1038/icb.2010.35. Tan, Y., Zheng, C., 2018. Effects of alpinetin on intestinal barrier function, inflammat ion and o xidative stress in dext ran sulfate sodium-induced ulcerative co lit is Mice. A m. J. Med. Sci. 355, 377-386. https://doi.org/10.1016/j.amjms.2018.01.002. Tanaka, H., Takechi, M., Kiyonari, H., Sh ioi, G., Tamura, A., Tsukita, S., 2015. Intestinal deletion of Claudin-7 enhances paracellular organic solute flu x and initiates colonic inflammation in mice. Gut 64, 1529-1538. https://doi.org/10.1136/gutjnl-2014-308419. Tercio lo, C., Dobric, A., Ouaissi, M., Siret, C., Breuzard, G., Silvy, F., March iori, B., Germain, S., Bonier, R., Hama, A., Owens, R., Lo mbardo, D., Rigot, V., André, F., 2017. Saccharo myces boulardii CNCM I-745 restores intestinal barrier integrity by regulation of E-cadherin recycling. J. Crohns. Colitis. 11, 999-1010. https://doi.org/10.1093/ecco-jcc/jjx030.

f

Tumes, D., Papadopoulos, M., Endo, Y., Onodera, A., Hirahara, K., Nakayama, T., 2017. Epigenetic

oo

regulation of T-helper cell d ifferentiation, memory, and plasticity in allerg ic asthma. Immunol Rev. 278, 8-19. https://doi.org/10.1111/imr.12560.

pr

Ungaro, R., Mehandru, S., Allen, P.B., Peyrin-Biroulet, L., Colo mbel, J.F., 2017. Ulcerative co lit is. Lancet 389, 1756-1770. https://doi.org/10.1016/S0140-6736(16)32126-2. Valvezan, A.J., Turner, M., Belaid, A., Lam, H.C., Miller, S.K., McNamara, M.C., Baglin i, C., Housden,

e-

B.E., Perrimon, N., Kwiat kowski, D.J., Asara, J.M., Henske, E.P., Manning, B.D., 2017. mTORC1 couples nucleotide synthesis to nucleotide demand resulting in a targetable metabolic vulnerability.

Pr

Cancer Cell 32, 624-638.e5. https://doi.org/10.1016/j.ccell.2017.09.013. Vereecke, L., Vieira-Silva, S., Billiet, T., van Es, J.H., Mc Gu ire , C., Slowicka, K., Sze, M., van den Born, M., De Hertogh, G., Clevers, H., Raes, J., Rutgeerts, P., Vermeire, S., Beyaert, R., van Loo,

al

G., 2014. A20 controls intestinal homeostasis through cell-specific activ ities. Nat. Co mmun. 5, 5103. https://doi.org/10.1038/ncomms6103.

rn

Wang, P., Shao, B.Z., Deng, Z., Chen, S., Yue, Z., Miao, C.Y., 2018. Autophagy in ischemic stroke. Prog. Neurobiol. 163-164, 98-117. https://doi.org/10.1016/j.pneurobio.2018.01.001.

Jo u

Yu, M., Wang, Q., Ma, Y., Li, L., Yu , K., Zhang, Z., Chen, G., Li, X., Xiao, W., Xu, P., Yang, H., 2018. Aryl hydrocarbon receptor activation modulates intestinal epithelial barrier function by maintaining tight junction integrity. Int. J. Biol. Sci. 14, 69-77. https://doi.org/10.7150/ijbs.22259. Yun, Y.S., Kim, K.H., Tschida, B., Sachs, Z., Noble -Orcutt, K.E., Moriarity, B.S., A i, T., Ding, R., Williams, J., Chen, L., Largaespada, D., Kim, D.H., 2016. mTORC1 Coordinates protein synthesis and immunoproteasome format ion via PRAS40 to prevent accumulation of protein stress. Mol. Cell 61, 625-639. https://doi.org/10.1016/j.molcel.2016.01.013. Zhang, S., Qin, C., Safe, S.H., 2003. Flavonoids as aryl hydrocarbon receptor agonists/antagonists: effects

of

structure

and

cell

context.

Environ.

https://doi.org/10.1289/ehp.6322.

22

Health

Perspect.

111,

1877-1882.

Journal Pre-proof

Figure legends Figure 1. Al pi netin promotes intestinal epithelial barrier functi on by inhi biting apoptosis of intestinal epithelial cells (IECs ). (A) The Caco-2 cells were seeded at the apical side of transwell insert for 21 days, and then treated with alp inetin (3 μM, 10 μM and 30 μM ) for 24 h in the presence of TNF-α (100 ng/ mL). The transepithelial electrical resistance (TEER) was detected by using an epithelial M illicell ERS-2 Vo ltoh mmeter. (B) The Caco-2 cells were treated with alpinetin (3 μM , 10

f

μM and 30 μM) for 24 h in the presence of TNF-α (100 ng/ mL), and the mRNA expressions of claudin

oo

7, occludin and E-cadherin were detected by using Q-PCR assay. (C, D) The Caco-2 cells were treated with alp inetin (3 μM, 10 μM and 30 μM ) for 24 h in the presence of TNF-α (100 ng/ mL). The

pr

proportions of apoptotic cells were detected by using Annexin V-FITC/ PI assay (C); the protein

e-

expression of cleaved caspase-3 was detected by using western blotting assay (D). Data were presented as means ± S.E.M. of three independent experiments. ## P < 0.01 vs. normal group; * P < 0.05 and

P<

Pr

0.01 vs. TNF-α (100 ng/mL) group.

**

al

Figure 2. Al pi netin inhi bits the apoptosis of intestinal epithelial cells (IECs) by inducing

rn

autophagy. (A-C) The Caco-2 cells were treated with alpinetin (3 μM, 10 μM and 30 μM ) for 24 h in the presence of TNF-α (100 ng/mL). The production of autophagic vesicles was detected by using

Jo u

transmission electron microscope (A); the protein exp ressions of LC3B-I, LC3B-II, beclin-1 and p 62 were detected by using western blotting assay (B); the mRNA exp ressions of Atg5 and Atg7 were detected by using Q-PCR assay (C). (D, E) The Caco-2 cells were pre-incubated with chloroquine (CQ, 25 μM) for 2 h, and then treated with alp inetin (30 μM) for 24 h in the presence of TNF -α (100 ng/mL). The protein expression of cleaved-caspase-3 was detected by using western blotting assay (D); the proportions of apoptotic cells were detected by using Annexin V-FITC/PI assay (E). (F) The Caco-2 cells were seeded at the apical side of transwell insert for 21 days, and then pre-incubated with CQ (25 μM) for 2 h. Subsequently, cells were treated with alpinetin (30 μM ) for 24 h in the presence of TNF-α (100 ng/mL), and transepithelial electrical resistance was detected by using an epithelial M illicell ERS-2 Vo ltohmmeter. Data were presented as means ± S.E.M. of three independent experiments. 0.01 vs. normal group; * P < 0.05 and

**

##

P<

P < 0.01 vs. TNF-α (100 ng/mL) group; $$ P < 0.01 vs. alpinetin

(30 μM) group. 23

Journal Pre-proof

Figure 3. Al pinetin inhi bi ts the acti vation of mTORC1 signaling pathway via TSC2. (A-C) The Caco-2 cells were treated with alpinetin (3 μM, 10 μM and 30 μM ) for 24 h in the presence of TNF-α (100 ng/ mL). The protein expressions of p70S6K, RPS6, p -p70S6K and p-RPS6 were detected by using western blotting assay (A); the protein expressions of AKT, p-AKT, ERK, p-ERK, AMPKα, p-AMPKα, PTEN and TSC2 were detected by using western blotting assay (B); the mRNA expression of TSC2 was detected by using Q-PCR assay (C). Data were p resented as means ± S.E.M . of three independent experiments. ## P < 0.01 vs. normal group; * P < 0.05 and ** P < 0.01 vs. TNF-α (100 ng/ mL)

oo

f

group; $ P < 0.05 and $$ P < 0.01 vs. alpinetin (30 μM) group.

pr

Figure 4. Al pinetin promotes autophag y by modulating TSC2-mTORC1 signaling pathway. (A) The Caco-2 cells were transfected with scramble RNA of TSC2-specifica siRNA, and protein levels of

e-

TSC2 was detected by using western blotting assay. (B-G) The Caco-2 cells were transfected with

Pr

siTSC2, and then treated with alp inetin (3 μM, 10 μM and 30 μM) for 24 h in the presence of TNF-α (100 ng/mL). The Caco-2 cells were transfected with siTSC2, and then treated with alpinetin (3 μM , 10 μM and 30 μM ) fo r 24 h in the presence of TNF-α (100 ng/mL). The protein expressions of p70S6K,

al

RPS6, p -p70S6K and p-RPS6 were detected by using western blotting assay (B); The mRNA

rn

expressions of Atg5 and Atg7 were detected by using Q-PCR assay (C); the production of autophagic

Jo u

vesicles was detected by using transmission electron microscope (D); the protein expressions of LC3B-I, LC3B-II, beclin-1 and p62 were detected by using western blotting assay (E); the proportions of apoptotic cells were detected by using Annexin V-FITC/ PI assay (F); the protein expression of cleaved-caspase-3 was detected by using western blotting assay (G). (H) The Caco-2 cells were seeded at the apical side of transwell insert for 21 days, and then transfected with siTSC2 for 24 h. Subsequently, cells were treated with alp inetin (30 μM) for 24 h in the presence of TNF -α (100 ng/mL), and transepithelial electrical resistance was detected by using an epithelial M illicell ERS-2 Voltoh mmeter. Data were presented as means ± S.E.M. of three independent experiments. ## P < 0.01 vs. normal group; ** P < 0.01 vs. TNF-α (100 ng/ mL) group; $ P < 0.05 and $$ P < 0.01 vs. alpinetin (30 μM ) group.

Figure 5. Al pinetin promotes the expression of TSC2 through inhi biting H3 K9 me3 modi fication 24

Journal Pre-proof at its promoter region. (A, B) The Caco-2 cells were treated with alp inetin (3 μM, 10 μM and 30 μM) for 24 h in the presence of TNF-α (100 ng/ mL), the modification of H3K9me 3 at TSC2 pro moter region was detected by using chromatin immunoprecipitation assay (A); the mRNA and protein expression of suv39h1 was detected by using Q-PCR and western blotting assays, respectively (B). (C) The Caco-2 cells were treated with alp inetin (30 μM ) for 24 h in the presence of TNF -α (100 ng/mL), and then pulse-chased in the presence of cycloheximide (CHX, 15 μg/mL). The protein exp ression of suv39h1 was detected by using western blotting assay. (D) The Caco-2 cells were pre -incubated MG-132 (5 μM) for 2 h, and then treated with alp inetin (30 μM) for 24 h in the presence of TNF -α (100

f

ng/mL). The p rotein exp ression of suv39h1 was detected by using western blotting assay. (E) The

oo

Caco-2 cells were treated with alpinetin (30 μM ) for 24 h in the presence of TNF-α (100 ng/mL), and

pr

then treated with M G-132 (5 μM) fo r 6 h. The cell lysates were immunoprecipitated with a control Ig G or anti-suv39h1 antibody, immunoprecip itates and input were probed for Ub and suv39h1 by using

e-

western blotting assay. Data were presented as means ± S.E.M. of three independent experiments. ## P <

Pr

0.01 vs. normal group; * P < 0.05 and ** P < 0.01 vs. TNF-α (100 ng/mL) group.

Figure 6. Al pi netin regulates the signals of H3 K9 me3/TSC2/ mTORc1 via aryl hydrocarbon

al

receptor (AhR). (A) The Caco-2 cells were treated with alp inetin (3 μM , 10 μM and 30 μM) for 24 h

rn

in the presence of TNF-α (100 ng/ mL), and the association between AhR and suv39h1 was detected by

Jo u

using co-immunoprecip itation assay. (B, C) The Caco-2 cells were transfected with siARNT, and then treated with alpinetin (30 μM) for 24 h in the presence of TNF -α (100 ng/ mL). The protein exp ressions of suv39h1 and CYP1A1 were detected by using western blotting assay. (D) The Caco-2 cells were transfected with siAhR or pre-incubated with CH223191 (10 μM) for 2 h, and then treated with alpinetin (30 μM ) fo r 24 h in the presence of TNF-α (100 ng/ mL). Subsequently, cells were treated with MG-132 (5 μM ) for 6 h, cell lysates were immunoprecipitated with a control Ig G or anti-suv39h1 antibody, immunoprecipitates and input were probed for Ub and suv39h1 by using western blotting assay. (E) The Caco-2 cells were transfected with siAh R or pre-incubated with CH223191 (10 μM) for 2 h, and then treated with alpinetin (30 μM) for 24 h in the presence of TNF-α (100 ng/mL). The protein expression of suv39h 1 was detected by using western blotting assay. (F-H) The Caco-2 cells were transfected with siAhR or pre -incubated with CH223191 (10 μM) for 2 h, and then treated with alpinetin (30 μM) for 24 h in the presence of TNF-α (100 ng/ mL). The mod ification of H3K9me3 at 25

Journal Pre-proof promoter reg ion of TSC2 was detected by using chromatin immunoprecip itation assay (F); the mRNA expression of TSC2 was detected by using Q-PCR assay (G); the protein expressions of TSC2, p70S6K, RPS6, p-p70S6K and p-RPS6 were detected by using western blotting assay (H). Data were presented as means ± S.E.M. of three independent experiments. ## P < 0.01 vs. normal group; * P < 0.05 and

**

P<

0.01 vs. TNF-α (100 ng/mL) group; $ P < 0.05 and $$ P < 0.01 vs. alpinetin (30 μM) group.

Figure 7. Al pineti n regulates the autophag y, apoptosis of intestinal epi thelial cells and eventual improve d-function of intestinal epithelial barrier via aryl hydrocarbon receptor (AhR). (A -E) The

f

Caco-2 cells were t ransfected with siAhR or pre-incubated with CH223191 (10 μM) for 2 h, and then

oo

treated with alpinetin (30 μM ) for 24 h in the presence of TNF -α (100 ng/ mL). The production of

pr

autophagic vesicles was detected by using transmission electron microscope (A); the protein expressions of LC3B-I, LC3B-II, beclin-1 and p62 were detected by using western blotting assay (B);

e-

the mRNA exp ressions of Atg5 and Atg7 were detected by using Q-PCR assay (C); the proportions of

Pr

apoptotic cells were detected by using Annexin V-FITC/PI assay (D); the protein expression of cleaved caspase-3 was detected by using western blotting assay (E). (F) The Caco-2 cells were seeded at the apical side of transwell insert for 21 days, and then pre-incubated with CH223191 (10 μM) for 2 h.

al

Subsequently, cells were treated with alp inetin (30 μM) for 24 h in the presence of TNF -α (100 ng/mL),

rn

and transepithelial electrical resistance was detected by using an epithelial M illicell ERS-2

Jo u

Voltoh mmeter. Data were presented as means ± S.E.M. of three independent experiments. ## P < 0.01 vs. normal group; * P < 0.05 and

**

P < 0.01 vs. TNF-α (100 ng/ mL) group; $ P < 0.05 and $$ P < 0.01 vs.

alpinetin (30 μM) group.

Figure 8. Al pineti n recovered the function of intestinal epi thelial barrier in mice with DSS-induced colitis by regulating AhR/suv39h1/TSC2/mTORC1 pathway. (A-F) Mice were supplied with 2.5% DSS for 7 days, and followed by sterile distilled water alone for another 3 days. The alpinetin (30 mg/kg), CH223191 (10 mg/ kg), leucine (100 mg/kg) and 6-Fo rmylindolo (3, 2-b) carbazole (FICZ, 1 μg per mouse) were ad ministered daily for consecutive 10 days. On day 10, mice were sacrificed, and colons were collected. The protein expressions of suv39h1, TSC2, p70S6K, RPS6, p-p70S6K and p-RPS6 in colons were detected by using western blotting (A); the protein expressions of LC3B-I, LC3B-II, beclin-1 and p62 were detected by using western blotting assay (B); the mRNA 26

Journal Pre-proof expressions of Atg5 and Atg7 were detected by using Q-PCR assay (C); the apoptosis of intestinal epithelial cells was detected by using TUNEL staining (D); the protein exp ression of cleaved caspase-3 in colons was detected by using western blotting assay (E); the content of 4 kDa FITC-Dextran (FD4) in seru m was detected by using a Microplate Reader (F); the loss of body weight was detected (G); the disease activity index (DAI) scores were calculated (H); the colon length was measured (I); the activity of myelopero xidase (MPO) in co lons was detected by using kits (J); the h istological changes were detected by using hemato xylin and eosin (H&E) staining (Scale bar: 50 μm) (K). Data were presented as means ± S.E.M. of six mice in each group. # P < 0.05, ## P < 0.01 vs. normal group; * P < 0.05 and ** P

oo

f

< 0.01 vs. DSS group; $ P < 0.05 and $$ P < 0.01 vs. alpinetin (30 mg/kg) group.

pr

Figure S1. Al pinetin i nhi bits apoptosis of NCM460 cells. (A, B) The NCM460 cells were treated with alp inetin (3 μM, 10 μM and 30 μM ) for 24 h in the presence of TNF-α (100 ng/ mL). The

e-

proportions of apoptotic cells were detected by using Annexin V-FITC/PI assay (A); the protein

Pr

expression of cleaved caspase-3 was detected by using western blotting assay (B). Data were presented as means ± S.E.M. of three independent experiments. ## P < 0.01 vs. normal g roup; ** P < 0.01 vs. TNF-α

al

(100 ng/mL) group.

rn

Figure S2. Al pinetin i nhi bits the apoptosis of NCM460 cells by i nducing autophagy. (A-C) The

Jo u

NCM460 cells were treated with alpinetin (3 μM, 10 μM and 30 μM) for 24 h in the presence of TNF-α (100 ng/mL). The production of autophagic vesicles was detected by using transmission electron microscope (A); the p rotein exp ressions of LC3B-I, LC3B-II, beclin-1 and p 62 were detected by using western blotting assay (B); the mRNA exp ressions of Atg5 and Atg7 were detected by using Q-PCR assay (C). (D, E) The NCM 460 cells were pre-incubated with chlo roquine (CQ, 25 μM ) for 2 h, and then treated with alpinetin (30 μM) for 24 h in the presence of TNF-α (100 ng/mL). The protein expression of cleaved-caspase-3 was detected by using western blotting assay (D); the proportions of apoptotic cells were detected by using Annexin V-FITC/PI assay (E). Data were presented as means ± S.E.M. of three independent experiments.

##

P < 0.01 vs. normal group; * P < 0.05 and

**

P < 0.01 vs.

TNF-α (100 ng/mL) group; $$ P < 0.01 vs. alpinetin (30 μM) group.

Figure S3. Al pineti n restricts the acti vati on of mTORC1 signaling pathway i n NCM460 cells. 27

Journal Pre-proof (A-C) The NCM460 cells were t reated with alpinetin (3 μM, 10 μM and 30 μM) fo r 24 h in the presence of TNF-α (100 ng/mL). The protein expressions of p70S6K, RPS6, p-p70S6K and p-RPS6 were detected by using western blotting assay (A); the protein expressions of AKT, p-AKT, ERK, p-ERK, AMPKα, p-AMPKα, PTEN and TSC2 were detected by using western blotting assay (B); the mRNA exp ression of TSC2 was detected by using Q-PCR assay (C). Data were p resented as means ± S.E.M. of three independent experiments.

##

P < 0.01 vs. normal group; * P < 0.05 and

**

P < 0.01 vs.

TNF-α (100 ng/mL) group; $ P < 0.05 and $$ P < 0.01 vs. alpinetin (30 μM) group.

oo

f

Figure S4. Al pinetin promotes autophag y in NCM460 cells via regulating TSC2-mTORC1 pathway. (A) The NCM 460 cells were transfected with scramb le RNA of TSC2-specifica siRNA, and

pr

protein levels of TSC2 was detected by using western blotting assay. (B-G) The NCM 460 cells were transfected with siTSC2, and then treated with alpinetin (3 μM, 10 μM and 30 μM) fo r 24 h in the

e-

presence of TNF-α (100 ng/mL). The NCM 460 cells were transfected with siTSC2, and then treated

Pr

with alp inetin (3 μM, 10 μM and 30 μM) for 24 h in the presence of TNF-α (100 ng/mL). The protein expressions of p70S6K, RPS6, p-p70S6K and p-RPS6 were detected by using western blotting assay (B); The mRNA exp ressions of Atg5 and Atg7 were detected by using Q-PCR assay (C); the production

al

of autophagic vesicles was detected by using transmission electron microscope (D); the protein

rn

expressions of LC3B-I, LC3B-II, beclin-1 and p62 were detected by using western blotting assay (E);

Jo u

the proportions of apoptotic cells were detected by using Annexin V-FITC/PI assay (F); the protein expression of cleaved-caspase-3 was detected by using western blotting assay (G). Data were presented as means ± S.E.M. of three independent experiments. ## P < 0.01 vs. normal g roup; ** P < 0.01 vs. TNF-α (100 ng/mL) group; $ P < 0.05 and $$ P < 0.01 vs. alpinetin (30 μM) group.

Figure S5. Al pinetin promotes the expression of TSC2 in NCM460 cells through inhi bi ting H3 K9 me3 modification. (A, B) The NCM 460 cells were treated with alpinetin (3 μM, 10 μM and 30 μM) for 24 h in the presence of TNF-α (100 ng/ mL), the modification of H3K9me3 at TSC2 pro moter region was detected by using chromatin immunoprecipitation assay (A); the mRNA and protein expression of suv39h1 was detected by using Q-PCR and western blotting assays, respectively (B). (C) The NCM460 cells were treated with alp inetin (30 μM) for 24 h in the presence of TNF-α (100 ng/mL), and then pulse-chased in the presence of cycloheximide (CHX, 15 μg/mL). The protein exp ression of 28

Journal Pre-proof suv39h1 was detected by using western blotting assay. (D) The NCM460 cells were pre -incubated MG-132 (5 μM) for 2 h, and then treated with alp inetin (30 μM) for 24 h in the presence of TNF -α (100 ng/mL). The p rotein exp ression of suv39h1 was detected by using western blotting assay. (E) The NCM460 cells were treated with alpinetin (30 μM ) for 24 h in the presence of TNF-α (100 ng/ mL), and then treated with M G-132 (5 μM) fo r 6 h. The cell lysates were immunoprecipitated with a control Ig G or anti-suv39h1 antibody, immunoprecip itates and input were probed for Ub and suv39h1 by using western blotting assay. Data were presented as means ± S.E.M. of three independent experiments. ## P <

oo

f

0.01 vs. normal group; * P < 0.05 and ** P < 0.01 vs. TNF-α (100 ng/mL) group.

Figure S6. Al pinetin regulates the signals of H3 K9 me3/TSC2/ mTORc1 in NCM460 cells via aryl

pr

hydrocarbon receptor (AhR). (A) The NCM 460 cells were treated with alpinetin (3 μM, 10 μM and 30 μM) for 24 h in the presence of TNF-α (100 ng/ mL), and the association between AhR and suv39h1

e-

was detected by using co-immunoprecipitation assay. (B, C) The NCM460 cells were transfected with

Pr

siARNT, and then treated with alpinetin (30 μM ) for 24 h in the presence of TNF-α (100 ng/ mL). The protein expressions of suv39h1 and CYP1A1 were detected by using western blotting assay. (D) The NCM460 cells were transfected with siAhR or pre -incubated with CH223191 (10 μM ) for 2 h, and then

al

treated with alp inetin (30 μM) for 24 h in the presence of TNF-α (100 ng/ mL). Subsequently, cells were

rn

treated with MG-132 (5 μM) for 6 h, cell lysates were immunoprecipitated with a control IgG or

Jo u

anti-suv39h1 antibody, immunoprecipitates and input were probed for Ub and suv39h 1 by using western blotting assay. (E) The NCM 460 cells were transfected with siAhR or pre-incubated with CH223191 (10 μM) for 2 h, and then treated with alpinetin (30 μM ) for 24 h in the p resence of TNF-α (100 ng/mL). The protein exp ression of suv39h1 was detected by using western blotting assay. (F-H) The NCM460 cells were transfected with siAhR or pre-incubated with CH223191 (10 μM ) for 2 h, and then treated with alpinetin (30 μM ) for 24 h in the presence of TNF-α (100 ng/mL). The modification of H3K9me3 at promoter reg ion of TSC2 was detected by using chromatin immunoprecipitation assay (F); the mRNA expression of TSC2 was detected by using Q-PCR assay (G); the protein expressions of TSC2, p 70S6K, RPS6, p -p70S6K and p-RPS6 were detected by using western blotting assay (H). Data were presented as means ± S.E.M. of three independent experiments. ## P < 0.01 vs. normal group; * P < 0.05 and

**

P < 0.01 vs. TNF-α (100 ng/ mL) group; $ P < 0.05 and $$ P < 0.01 vs. alp inetin (30 μM)

group. 29

Journal Pre-proof

Figure S7. Al pineti n regulates the autophag y and apoptosis of NCM460 cells via aryl hydrocarbon receptor (AhR). (A-E) The NCM460 cells were transfected with siAhR or pre-incubated with CH223191 (10 μM ) for 2 h, and then treated with alp inetin (30 μM) for 24 h in the presence of TNF-α (100 ng/ mL). The production of autophagic vesicles was detected by using transmission electron microscope (A); the protein expressions of LC3B-I, LC3B-II, beclin-1 and p62 were detected by using western blotting assay (B); the mRNA expressions of Atg5 and Atg7 were detected by using Q-PCR assay (C); the proportions of apoptotic cells were detected by using Annexin V-FITC/PI assay

f

(D); the protein exp ression of cleaved caspase-3 was detected by using western blotting assay (E). Data

**

P < 0.01 vs. TNF-α (100 ng/ mL) group; $ P < 0.05 and $$ P < 0.01 vs. alp inetin (30 μM)

pr

0.05 and

oo

were presented as means ± S.E.M. of three independent experiments. ## P < 0.01 vs. normal group; * P <

Jo u

rn

al

Pr

e-

group.

30

Journal Pre-proof Table 1 Primers used in quantitative PCR and ChIP Sequence (5’-3’)

Primers

suv39h1 (human)

Atg5 (mouse)

Atg5 (human)

Atg7 (mouse)

Reverse

CAAAGAGGTCCAAAACAATCG

Forward

CATGTACGTTGCTATCCAGGC

Reverse

CTCCTTAATGTCACGCACGAT

Forward

TGACGATAGCCTGAAAAACCTC

Reverse

AAGTTGGAGAAGACGTATCGAG

Forward

GAAGATCCGCGAACAGGAAT

Reverse

CCTTGTGGAACTGCTTGAGG

Forward

AGTCAAGTGATCAACGAAATGC

Reverse

TATTCCATGAGTTTCCGGTTGA

Forward

GATGGGATTGCAAAATGACAGA

Reverse

GAAAGGTCTTTCAGTCGTTGTC

f

TSC2 (human)

GACATTTGAGAAGGGCCACAT

oo

GAPDH (human)

Forward

pr

GAPDH (mouse)

Forward

GTGTACGATCCCTGTAACCTAG GATGCTATGTGTCACGTCTCTA

e-

Reverse

TSC2 promoter (mouse)

Reverse

GGCAGGATAGCAAAACCAATAG

Forward

CTTCTACAAATGGACCTCT

Reverse

AGCCTACACTACCTCCTAA

Forward

TATTGGCTGGGCAGGGTC

Reverse

TGGAAGAGTTGGACTTAGGGT

rn

Jo u

E-cadherin (human)

TGTATAACACCAACACACTCGA

al

Occludin (human)

Claudin-7 (human)

Forward

Pr

Atg7 (human)

Forward

AAAGCCTCAGGTCATAAACA

Reverse

TGGGTTGGGTCGTTGTAC

Forward

ACAAAGCCCAGGTCACGC

Reverse

AGCCACTCAGCAGGTCAGG

31

Jo u

rn

al

Pr

e-

pr

oo

f

Journal Pre-proof

32

Journal Pre-proof

Highlights 1. Alpinetin inhibits apoptosis of intestinal epithelial cells by modulating autophagy 2. Alpinetin induces autophagy of intestinal epithelial cells via TSC2/mTORC1 signals 3. Alpinetin increases TSC2 via aryl hydrocarbon receptor-related degradation of suv39h1

Jo u

rn

al

Pr

e-

pr

oo

f

4. Alpinetin ameliorates dextran sulfate sodium-induced colitis

33

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15