Alteration of xylose reductase coenzyme preference to improve ethanol production by Saccharomyces cerevisiae from high xylose concentrations

Bioresource Technology 102 (2011) 9206–9215

Contents lists available at ScienceDirect

Bioresource Technology journal homepage: www.elsevier.com/locate/biortech

Alteration of xylose reductase coenzyme preference to improve ethanol production by Saccharomyces cerevisiae from high xylose concentrations Mingyong Xiong a,b, Guohua Chen a,b, John Barford a,⇑ a b

Department of Chemical and Biomolecular Engineering, The Hong Kong University of Science and Technology, Kowloon, Hong Kong, China Centre for Green Products and Processing Technologies, Fok Ying Tung Graduate School, The Hong Kong University of Science and Technology, Nansha, Guangzhou, China

a r t i c l e

i n f o

Article history: Received 23 March 2011 Received in revised form 12 June 2011 Accepted 14 June 2011 Available online 9 August 2011 Keywords: Xylose Xylose reductase Ethanol Redox imbalance Saccharomyces cerevisiae

a b s t r a c t A K270R mutation of xylose reductase (XR) was constructed by site-direct mutagenesis. Fermentation results of the F106X and F106KR strains, which carried wild type XR and K270R respectively, were compared using different substrate concentrations (from 55 to 220 g/L). After 72 h, F106X produced less ethanol than xylitol, while F106KR produced ethanol at a constant yield of 0.36 g/g for all xylose concentrations. The xylose consumption rate and ethanol productivity increased with increasing xylose concentrations in F106KR strain. In particular, F106KR produced 77.6 g/L ethanol from 220 g/L xylose and converted 100 g/L glucose and 100 g/L xylose into 89.0 g/L ethanol in 72 h, but the corresponding values of F106X strain are 7.5 and 65.8 g/L. The ethanol yield of F106KR from glucose and xylose was 0.42 g/g, which was 82.3% of the theoretical yield. These results suggest that the F106KR strain is an excellent producer of ethanol from xylose. Ó 2011 Elsevier Ltd. All rights reserved.

1. Introduction Xylose is the second most abundant carbohydrate polymer in nature after glucose. Glucose and xylose are two major components of hydrolyzates from lignocellulose (Jeffries, 1985). Saccharomyces cerevisiae (S. cerevisiae), most commonly used in the conversion of glucose into ethanol, has the advantages of high ethanol productivity, high tolerance to ethanol and high inhibitor tolerance of cellulose hydrolysate. S. cerevisiae is, however, unable to utilize xylose (Salusjärvi et al., 2006). It can metabolize xylulose, an isomer of xylose, to ethanol at a fast rate (Jeppsson et al., 1996). Xylose can be converted to xylulose by S. cerevisiae via the introduction of two pathways from other organisms. In one pathway, XYL1 encoding for NADPH-linked xylose reductase (XR) and XYL2 encoding for NAD-linked xylitol dehydrogenase (XDH) are introduced from the xylose fermenting yeast, Pichia stipitis (P. stipitis) (Hou et al., 2007; Johansson et al., 2001). In the other pathway, XI encoding for xylose isomerase is introduced from bacteria and fungus (Brat et al., 2009; Harhangi et al., 2003; Kuyper et al., 2003; van Maris et al., 2007). Xylulose is then phosphorylated by xylulokinase (XK) to xylulose 5-phosphate, which is further metabolized through the pentose phosphate pathway (PPP) and glycolysis to form ethanol. However, the difference in cofactor preference of XR (NADPH/NADP+) and XDH (NAD+/NADH) leads to the formation of xylitol and an excess accumulation of NADH ⇑ Corresponding author. Tel.: +852 2358 7237; fax: +852 2358 3707. E-mail address: [email protected] (J. Barford). 0960-8524/$ - see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.biortech.2011.06.058

which cannot be recycled through respiration under oxygen-limited conditions (Matsushika et al., 2009a). To avoid the formation of xylitol, xylose can be converted into xylulose directly by XI, but the activity of XI and ethanol productivity were very slow (Dmytruk et al., 2008; Harhangi et al., 2003; Karhumaa et al., 2007; Madhavan et al., 2009). Overexpression of xylulose kinase by encoding with XK or the four enzymes of the non-oxidative pathway by encoding with TAL1, TKL1, RPE1 and RKI1, from S. cerevisiae, can improve ethanol production significantly (Ho et al., 1998; Karhumaa et al., 2005; Kuyper et al., 2003). However, the method by which xylitol production is decreased and ethanol production augmented is still an important issue in the conversion of xylose into ethanol efficiently (Matsushika et al., 2009a). In recent years, protein engineering has been used to modify the coenzyme specificity of XR and XDH to increase the ethanol production and decrease xylitol production. It has been reported that several NADH-preferring XR mutations, such as K270R, K270M and R276H, have positive effect on improving ethanol production and decreasing xylitol excretion (Kostrzynska et al., 1998; Watanabe et al., 2007a,b). In addition, one S. cerevisiae strain harboring NADH-preferring XR mutations from Candida tenuis, has shown improved ethanol production with decreased xylitol formation (Petschacher and Nidetzky, 2008). On the other hand, one ARSdR XDH mutation with multiple site-directed mutagenesis (D207A/I208R/ F209S/N211R), which involved a complete reversal of coenzyme specificity toward NADP+, was confirmed to increase ethanol production from xylose with an accompanied decrease in xylitol excretion (Watanabe et al., 2007c). In addition to improving the

M. Xiong et al. / Bioresource Technology 102 (2011) 9206–9215

ethanol yield, the use of higher concentrations of initial sugar in xylose fermentation decreases the cost of ethanol production from lignocellulose. It was recently reported in the literature that knocking out the genes FPS1 and GPD2 associated with GLN1 overexpression in the yeast can increase the carbon flux from glucose to ethanol (Cao et al., 2007; Kong et al., 2006, 2007a,b). Ethanol formation from xylose used the glycolysis pathway. To obtain the maximum ethanol production in the present study, we first constructed an H106 strain with FPS1 and GPD2 knockout, and GLN1 overexpression as in the original strain. To increase the carbon flux from xylose to glycolysis, four genes of TAL1, TKL1, RPE1 and RKI1 were integrated into the chromosome of H106 strain to form the F106 strain. The F106 strain was transformed with the wild type XR and K270R genes associated with XDH and XK to create F106X and F106KR strains. The strategy used in the present work, to modify the industrial yeast, is described in Fig. 1. To investigate the effect of the K270R mutation, we compared the ethanol production between two recombinant S. cerevisiae strains of F106X and F106KR in different substrate concentration. The fermentation results indicated that the F106KR strain increased xylose consumption and ethanol production significantly in comparison to the F106X strain. The recombinant strain carrying the K270R mutation completely

9207

consumed 200 g/L xylose in 72 h and produced 77.6 g/L ethanol. Further, F106KR strain fully consumed 100 g/L glucose and 100 g/ L xylose after 48 h fermentation, and produced 89.0 g/L ethanol. According to the literature to date (Matsushika et al., 2009a), F106KR was the first strain to consume 200 g/L xylose in 72 h.

2. Methods 2.1. Yeast strains, plasmids and media S. cerevisiae haploid strains used in this study were derived from the diploid industrial strains YC-DM (Angel Yeast, China). The genomic DNA used in this study was extracted from W303-1A (Thomas and Rothstein, 1989) and CBS6054 (Jeffries et al., 2007), respectively. Yeast cells were grown in YPD medium (Yeast extract, 10 g/L; Peptone, 20 g/L; Dextose, 20 g/L). YNB without amino acids (Difco) supplemented with 2% (w/v) glucose and amino acids according to the demand of the strains and 5-fluoroorotic acid medium (5-FOA) was used for yeast growth and selection of transformants (Sambrook and Russell, 2001). The strains, plasmids and primers used in this study are listed in Tables 1–3.

Fig. 1. The xylose metabolism pathway in the Saccharomyces cerevisiae yeast. Abbreviations: XR, xylose reductase (EC 1.1.1.113); XDH, xylitol dehydrogenase (EC 1.1.1.9); XK, xylulokinase (EC 2.7.1.17); TKL1, transketolase (EC 2.2.1.1); TAL1, transaldolase (EC 2.2.1.2); RKI1, ribose-5-phosphate isomerase (EC 5.3.1.6); RPE1, L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4); FPS1, plasma membrane channel of glycerol; GPD2, NAD-dependent glycerol 3-phosphate dehydrogenase (EC 1.1.1.8); GLN1, glutamine synthetase (EC 6.3.1.2). XR, XDH, XK, TKL1, TAL1, RKI1, RPE1 and GLN1 were overexpressed, FPS1 and GPD2 were deleted in this study.

9208

M. Xiong et al. / Bioresource Technology 102 (2011) 9206–9215

Table 1 The strains used in this study. Strain

Genetype

Reference

YC-DM W303-1A CBS6054 H106 F106

MAT a/a MATa leu2-3112 ura3-1 trp1-92 his3-11,15 ade2-1 can1-100 Pichia. Stipitis CBS 6054 MATa ura3 fps1D gpd2D PGK1p-GLN1-GLN1t MATa ura3 fps1D gpd2D PGK1p-GLN1-GLN1t PDC1p-TKL1-TKL1t/PGK1p-TAL1-TAL1t/TPI1p-RKI1-RKI1t/ADH1pRPE1-RPE1t MATa fps1D gpd2D PGK1p-GLN1-GLN1t PDC1p-TKL1-TKL1t/PGK1p-TAL1-TAL1t/TPI1p-RKI1-RKI1t/ADH1p-RPE1RPE1t/ ADH1p-XYL1-ADH1t /PGK1p-XYL2-PGK1t /PGK1p-XKS1-PGK1t MATa fps1D gpd2D PGK1p-GLN1-GLN1t PDC1p-TKL1-TKL1t/PGK1p-TAL1-TAL1t/TPI1p-RKI1-RKI1t/ADH1p-RPE1RPE1t/ ADH1p-XYL1(K270R)-ADH1t/PGK1p-XYL2-PGK1t/PGK1p-XKS1-PGK1t

Angel Yeast, China Thomas and Rothstein (1989) Jeffries et al. (2007) This work This work

F106X F106KR

This work This work

Table 2 The plasmids used in this study. Plasmids

Marker and description

Reference

pUC18-RKUR YCp33-HO-KanMX pUC18-PGK1p-GLN1 pUC-3X pUC-3XK270R pUC-TTRR

AMP URA3,HO/KanMX AMP, PGK1p-GLN1 AMP, ADH1p-XYL1-ADH1t/PGK1p-XYL2-PGK1t/PGK1p-XKS1-PGK1t AMP, ADH1p-XYL1(K270R)-ADH1t/ PGK1p-XYL2-PGK1t/PGK1p-XKS1-PGK1t AMP, PDC1p-TKL1-TKL1t/PGK1p-TAL1-TAL1t/TPI1p-RKI1-RKI1t/ADH1p-RPE1-RPE1t

Kong et al. (2007b) Hou (2009) This work This work This work This work

2.2. pUC18-PGK1p-GLN1 plasmid construction For GLN1 overexpression, plasmid pUC18-PGK1p-GLN1 that harbors the 50 portion of the GLN1 ORF (553 bp from ATG start codon) was fused to the PGK1 promoter (721 bp upstream of ATG start codon) and, upstream of the PGK1 promoter, a DNA fragment corresponding to positions 243 to 732 with respect to the ATG start codon of the GLN1 gene, was constructed as follows: (1) pUC18-RKUR was digested with PstI and filled in this restriction site, resulting in plasmid pUC18-RKURP. (2) The first 490 bp GLN1 promoter was PCR amplified with primers GLN1-1U and GLN1-1D. The resulting PCR product was digested by HindIII–SphI and then ligated with the same enzyme pair digested pUC18RKURP, resulting in plasmid pUC18-RKURP-GLN1p. (3) Primers GLN1-2U and GLN1-2D were used to amplify portion of the GLN1 ORF. The PCR product was digested by BamHI–EcoRI and then ligated with the same enzyme pair digested pUC18-RKURP-GLN1p, creating plasmid pUC18-RKURP-GLN1p-GLN1o. (4) Primers PGK1-U and PGK1-D were used to amplify a DNA fragment upstream of the PGK1 ORF that contains the promoter of the gene. This PCR product was digested by BamHI and PstI, and then ligated with the same enzyme pair (BamHI and PstI) digested pUC18RKURP-GLN1p-GLN1o, and the resulting plasmid was designated pUC18-PGK1p-GLN1. 2.3. pGU-3X and pGU-3XK270R plasmid construction To construct the pGU-3X plasmid, four intermediate plasmids (pUC18-ADH1p-XYL1-ADH1t, pUC18-PGK1p-XYL2-PGK1t, pUC18PGK1p-XKS1-PGK1t and pUC18-GEA2t-URA3p) should be constructed first. In this pGU-3X plasmid, XYL1 was under the control of an ADH1 strong promoter, both XYL2 and XKS1 were under the control of a PGK1 strong promoter. The purpose of this plasmid is to integrate the three genes of XYL1, XYL2 and XKS1 into the chromosome site between the genes of GEA2 and URA3. Moreover, this integration can recover the auxotroph of the URA3 single site mutation. The plasmid pUC18-ADH1p-XYL1-ADH1t was constructed as follows: (1) the first 665 bp of ADH1 promoter was PCR amplified with primers ADH1-U and ADH1-D. The resulting PCR product was digested by BamHI–EcoRI and then ligated with pUC18, which resulted in the plasmid pUC18-ADH1p being formed; (2) the

325 bp of ADH1 terminator was amplified by primer pairs of ADH1T-U and ADH1T-D. The PCR product was digested by BsiWI–XhoI and then inserted into the same digestion sites of pUC18-ADH1p to form plasmid pUC18-ADH1p-ADH1t. (3) Primers XYL1-U and XYL1-D were used to amplify the ORF of XYL1 using the genomic DNA of P. stipitis as template, which was inserted into the SmaI–BsiWI site of pUC18-ADH1p-ADH1t to form pUC18ADH1p-XYL1-ADH1t. The plasmid pUC18-PGK1p-XYL2-PGK1t was constructed as follows: (1) the 721 bp of PGK1 promoter was amplified by primers PGK1X2-U and PGK1X2-D. The PCR product was digested by PstI–BamHI and ligated with pUC18 to form pUC18-PGK1p. (2) Primers PGK1X2T-U and PGK1X2T-D were used to amplify PGK1 terminator (423 bp), this fragment was digested by XbaI–BamHI and then ligated with pUC18-PGK1X2 to create plasmid pUC18PGK1p-PGK1t. (3) XYL2 ORF was obtained by PCR with primers XYL2-U and XYL2-D using genomic DNA of P. stipitis as template, which was digested by SalI–XbaI and then ligated with pUC18PGK1p-PGK1t to form pUC18-PGK1p-XYL2-PGK1t plasmid. The plasmid pUC18-PGK1p-XKS1-PGK1t was constructed as follows: (1) primers PGK1XK1-U and PGK1XK1-D were used to amplify the promoter of PGK1 (721 bp). This PCR product was digested by HindIII–SphI and ligated with pUC18 to form pUC18-PGK1p plasmid. (2) PGK1 terminator (423 bp) was amplified by PCR with primers PGK1XK1T-U and PGK1XK1T-D, which was digested by SalI–EcoRI and then inserted into the same sites of pUC18-PGK1p to create pUC18-PGK1p-PGK1t. (3) Primers XKS1-U and XKS1-D was used to PCR amplify the ORF of XKS1, and this PCR product was digested by SphI–SalI and then ligated with pUC18-PGK1pPGK1t to build plasmid pUC18-PGK1p-XKS1-PGK1t. The plasmid pUC18-GEA2t-URA3p was constructed as follows: (1) the GEA2T fragment (145 bp) of the GEA2 terminator was obtained by PCR amplification with primers GEA2T-U and GEA2T-D (carrying SpeI, PstI, BamHI, XhoI and XbaI restriction sites), and this PCR product was digested by HindIII–XbaI and ligated with pUC18 to form plasmid pUC18-GEA2t. (2) Primers of URA3-U and URA3-D was used to amplify part of URA3 gene (542 bp), which was digested by XbaI–EcoRI and then ligated with pUC18-GEA2t to build plasmid pUC18-GEA2t-URA3p. To construct plasmid pGU-3X, pUC18-PGK1p-XKS1-PGK1t, pUC18-PGK1p-XYL2-PGK1t and pUC18-PGK1p-XYL1-PGK1t were digested by SpeI–PstI, PstI–BamHI and BamHI–XhoI, respectively,

M. Xiong et al. / Bioresource Technology 102 (2011) 9206–9215 Table 3 Primers used in this study. GLN1-1U

50 -GGGCCC AAGCTT TAAACCCAGTACCCGCATACG

GLN1-1D

50 -GGGCCC GCATGC ATGGCAAACAATATGCGTCG

GLN1-2U

50 -GGGCCC GGATCC CTGCAGATGGCTGAAGCAAGCATCGA 50 -TGGAAACGTTAGCGTGACAA

GLN1-2D PGK1-U

50 -GGGCCC GGATCC AGGCATTTGCAAGAATTACTC

PGK1-D

50 -GGGCCC CTGCAG TGTTTTATATTTGTTGTAAAAAGTAG

ADH1-U

50 -GGGCCC GGATCC CAAACCCATACATCGGGATT

ADH1-D

50 -GGGCCC GAATTC CTCGAG CGTACG CCCGGG TGTATATGAGATAGTTGATTG

ADH1T-U

50 -GGGCCC CGTACG GCGAATTTCTTATGATTTATG

ADH1T-D

50 -GGGCCC CTCGAG GTGTGGAAGAACGATTACAA

XYL1-U

50 -GGGCCC CCCGGG ATGCCTTCTATTAAGTTGAAC

XYL1-D

50 -GGGCCC CGTACG TTAGACGAAGATAGGAATCT

PGK1X2-U

50 -GGGCCC CTGCAG AGGCATTTGCAAGAATTACTC

PGK1X2-D

50 -GGGCCC GTCGAC TGTTTTATATTTGTTGT AAAAA GTAG

PGK1X2T-U

50 -GGGCCC TCTAGA ATTGAATTGAATTGAAATCG

PGK1X2T-D

50 -GGGCCC GGATCC GTTGCAAGTGGGATGAGCTT

XYL2-U

50 -GGGCCC GTCGAC ATGACTGCTAACCCTTCCTTGG

XYL2-D

50 -GGGCCC TCTAGA TTACTCAGGGCCGTCAATGA

PGK1XK1-U

50 -GGGCCC AAGCTT ACTAGTAGGCATTTGCAAGAATT ACTC

PGK1XK1-D

50 -GGGCCC GCATGC TGTTTTATATTTGTTGTAAAAA GTAG

PGK1XK1T-U

50 -GGGCCC GTCGAC ATTGAATTGAATTGAAATCG

PGK1XK1T-D

50 -GGGCCC GAATTC CTCGAGGGATCCCTGCAGGTTGCAA GTGGGATGAGCTT

XKS1-U

50 -GGGCCC GCATGC ATGTTGTGTTCAGTAATTCA

XKS1-D

50 -GGGCCC GTCGAC TTAGATGAGAGTCTTTTCCA

GEA2T-U

50 -GGGCCC AAGCTT ACTAGTAGATGCTAAGAGAT AGTGAT

GEA2T-D

50 -GGGCCC TCTAGA CTCGAG GGATCC CTGCAG ACTAGT TTTATGGACCCTGAAACCAC 50 -GGGCCCTCTAGAGTCGACGCTTTTCAATTCATCTTTT 50 -GGGCCCGAATTCACTAGTCGCAGAGTACTGCAATTTGA

URA3-U URA3-D K270R-U

50 -ATCATTCCAAGGTCCAACACTG

K270R-D

50 -CAGTGTTGGACCTTGGAATGAT

4PDC1-U

50 -GGGCCC AAGCTT GGATCCGAGATAAGCACACTGCACCC

4PDC1-D

50 -GGGCCC GAATTC ACTAGTTTTGATTGATTTGACTGTGT

4PGK1-U

50 -GGGCCC AAGCTT GGATCCAGGCATTTGCAAGAATTACTC

4PGK1-D

50 -GGGCCC CTGCAG AGATCTTGTTTTATATTTGTTGTAAAAAGTAG

4ADH1-U

50 -GGGCCC AAGCTT CTCGAGCAAACCCATACATCGGGATT

4ADH1-D

50 -GGGCCC GAATTC GTCGACTGTATATGAGATAGTTGATT

4TPI1-U

50 -GGGCCC TCTAGA AAATGGACTGATTGTGAGGG

4TPI1-D

50 -GGGCCC GAATTC ACTAGTTTTTAGTTTATGTATGTGTT

HOG1-U

50 -GGGCCC AAGCTT GTTAACTAAGCAATCTCTTGG CCAGCT

HOG1-D

50 -GGGCCC TCTAGA AGATCTGCATGCCTCGAGTTCGA TCACGAGCTCTACTGC

HOG2-U

50 -GGGCCC GGATCC CCCGGGTTGAGAAGTCCCAC AGCACAT

HOG2-D

50 -GGGCCC GAATTC GTTAACAACCGGGATTTGA CGTCTAA

4PGK1-U

50 -GGGCCC AAGCTT GGATCCAGGCATTTGCAA GAATTACTC

4PGK1-D

50 -GGGCCC CTGCAG AGATCTTGTTTTATATTTGTTGTAA AAAGTAG

4PDC1-U

50 -GGGCCC AAGCTT GGATCCGAGATAAGCACAC TGCACCC

4PDC1-D

50 -GGGCCC GAATTC ACTAGTTTTGATTGATTTGACTGTGT

4ADH1-U

50 -GGGCCC AAGCTT CTCGAGCAAACCCATACAT CGGGATT

4ADH1-D

50 -GGGCCC GAATTC GTCGACTGTATATGAGATA GTTGATT

4TPI1-U

50 -GGGCCC TCTAGA AAATGGACTGATTGTGAGGG

4TPI1-D

50 -GGGCCC GAATTC ACTAGTTTTTAGTTTATGTATGTGTT

4TAL1-U

50 -GGGCCC GGATCC ATGTCTGAACCAGCTCAAAAG

4TAL1-D

50 -GGGCCC CTGCAG ACTAGTAAGGTGGTTCCGG ATGTTTT

4TKL1-U

50 -GGGCCC TCTAGA ATGACTCAATTCACTGACAT

4TKL1-D

50 -GGGCCC GAATTC ACTAGTTCACAGGGTTTCAA TTAGCC

4RPE1-U

50 -GGGCCC CTCGAG ATGGTCAAACCAATTATAGC

4RPE1-D

50 -GGGCCC GAATTC CCCGGGTTGGTTGACGCAAG CGCTAA

4RKI1-U

50 -GGGCCC TCTAGA ATGGCTGCCGGTGTCCCAAA

4RKI1-D

50 -GGGCCC GAATTC GTCGACACCAACCTTGGTG TGTCATC 50 -CCAAGTACGCTCGAGGGTACATTCTAATGCATTAAAAG ACA CGACGT TGTAAAACGACG 50 -ATCAGTCTATATTATTTGTTTCTTTTTCTTGTCTGTTTTC CAC AGGAAAC AGCTATGAC 50 -GAAGGCGCAATTCAGTAGTT 50 -AAGATTCATAGCTTAACCTA 50 -CTCTTTCCCTTTCCTTTTCCTTCGCTCCCCTTCCTTATCA ACG ACGTTGT AAAACGACG 50 -GCAACAGGAAAGATCAGAGGGGGAGGGGGGGGGAGA GTGT CACAG GAAACAGCTATGAC 50 -TTCTCTACCCTGTCATTCTA 50 -TTGTGTTAGTGTACAGGGTG

DFPS1-U DFPS1-D CFPS1-U CFPS1-D DGPD2-U DGPD2-D CGPD2-U CGPD2-D

9209

9210

M. Xiong et al. / Bioresource Technology 102 (2011) 9206–9215

and then the resulting 2960 bp, 2249 bp and 1959 bp fragments were inserted into the corresponding restriction sites of plasmid pUC-GEA2t-URA3p to form plasmid pGU-3X. To construct plasmid of pGU-3XK270R, plasmid of pUC18ADH1p-XYL1K270R-ADH1t was formed by using site-directed mutagenesis with primers K270R-U and K270R-D (Edelheit et al., 2009). The 1959 bp fragment of ADH1p-XYL1K270R-ADH1t resulted from pUC18-ADH1p-XYL1K270R-ADH1t digested with BamHI and XhoI, was replaced the same 2.0 kb fragment of pUC18-ADH1pXYL1K270R-ADH1t plasmid, to form the plasmid of pGU-3XK270R.

2.4. Construction of pUC-TTRR plasmid The four genes (TAL1, TKL1, RKI1 and RPE1) in the non-oxidative phosphate pathway were integrated into the non-functional site of chromosome VII (+18,248 bp). In this plasmid, TAL1 was under the control of a PGK1 strong promoter, TKL1 was under the control of a PDC1 strong promoter, RKI1 was under the control of a TPI1 strong promoter, and RPE1 was under the control of an ADH1 strong promoter. Moreover, this plasmid carried a selective marker of KanMX to make yeast cells have G418 antibiotics. The methods to construct pUC-TTRR (pUC18-TAL1/TKL1/RKI1/RPE1) plasmid were described as following. Five plasmids (pUC-PDC1p, pUC-PGK1p, pUC-ADH1p, pUCTPI1p and pUC-HOG1) were first constructed. Primers 4PDC1-U and 4PDC1-D were used to amplify the PDC1 promoter (648 bp), and this PCR fragment was digested by HindIII–EcoRI. The digested fragment was inserted into the same restriction sites of the pUC18, and the resulting plasmid was pUC-PDC1p. The PGK1 promoter (721 bp) was amplified by primers 4PGK1-U and 4PGK1-D and then digested by HindIII–PstI. The digested fragment was inserted into the same restriction sites of the pUC18, and the resulting plasmid was pUC-PGK1p. Primers 4ADH1-U and 4ADH1-D were used to amplify the ADH1 promoter (665 bp), and this PCR fragment was digested by HindIII–EcoRI. The digested fragment was inserted into the same restriction sites of the pUC18, and the resulting plasmid was pUC-ADH1p. The TPI1 promoter (619 bp) was amplified by primers 4TPI1-U and 4TPI1-D and then digested by XbaI–EcoRI. The digested fragment was inserted into the same restriction sites of the pUC18, and the resulting plasmid was pUC-TPI1p. Primers HOG1-U and HOG1-D were used to amplify the fragment from 17535 bp to 18247 bp in the chromosome VII, and this fragment was digested with HindIII–XbaI. This digested fragment was inserted into the same restriction site of pUC18, and the resulting plasmid was designated pUC-HOG1. Secondly, another five plasmids of pUC-PDC1p-TKL1, pUCPGK1p-TAL1, pUC-ADH1p-RPE1, pUC-TPI1p-RKI1 and pUC-HOG1KanMX were constructed. The ORF and terminator of TKL1 (2374 bp from start codon ATG) were amplified by PCR using primers 4TKL1-U and 4TKL1-D. This PCR product was digested with XbaI– EcoRI. This digested fragment was ligated with the pUC-PDC1p vector digested SpeI–EcoRI, and the resulting plasmid was designated pUC-PDC1p-TKL1. Primers 4TAL1-U and 4TAL1-D were used to amplify the ORF and terminator of TAL1 (1308 bp), and this PCR product was digested with BamHI–PstI. This digested PCR product was ligated with the pUC-PGK1p vector digested with BglII–PstI to form plasmid pUC-PGK1p-TAL1. The ORF and terminator of RPE1 (1048 bp) were amplified by PCR using primers 4RPE1-U and 4RPE1-D, and this PCR product digested with XhoI–EcoRI was ligated with the pUC-ADH1p vector digested SalI–EcoRI to form plasmid pUC-ADH1p-RPE1. Primers 4RKI1-U and 4RKI1-D were used to amplify the ORF and terminator of RKI1 (1083 bp), and this PCR product digested with XbaI–EcoRI was ligated with the pUC-TPI1p vector digested with SpeI–EcoRI to form plasmid pUC-TPI1p-RKI1. The YCp33HO-KanMX was digested with SphI–BglII and the 1414 bp fragment

carrying KanMX was inserted into the same restriction sites of plasmid pUC-HOG1 to form the plasmid pUC-HOG1-KanMX. Thirdly, two plasmids of pUC-TKL1-RKI1-RPE1 and pUC-HOG1KanMX-TAL1-HOG2 were created. The TPI1p-RKI1 fragment was obtained from pUC-TPI1p-RKI1 after XbaI–EcoRI digestion, and this fragment was ligated with the pUC-PDC1p-TKL1 vector digested with SpeI–EcoRI to form plasmid pUC-TKL1-RKI1. The ADH1pRPE1 fragment was obtained from pUC-ADH1p-RPE1 after XhoI– EcoRI digestion, and this fragment was ligated with the pUC-TKL1-RKI1 vector digested with SalI–EcoRI to form plasmid pUC-TKL1-RKI1-RPE1. The HOG2 fragment from +19,397 bp to +19,997 bp in the chromosome VII was amplified by primers HOG2-U and HOG2-D, and this PCR product digested with BamHI–EcoRI was inserted into the same restriction sites of the vector plasmid pUC-HOG1-KanMX to form plasmid pUC-HOG1-KanMXHOG2. The PGK1p-TAL1 fragment was obtained from plasmid pUC-PGK1p-TAL1 after BamHI–SpeI digestion, and this fragment was ligated with the pUC-HOG1-KanMX-HOG2 vector digested with BglII–XbaI to form plasmid pUC-HOG1-KanMX-TAL1-HOG2. Finally, the fragment of TKL1-RKI1-RPE1 was obtained from pUCTKL1-RKI1-RPE1 after BamHI–SmaI digestion, and then this fragment was inserted into the same restriction sites of plasmid pUC-HOG1KanMX-TAL1-HOG2 to form the final plasmid pUC-TTRR. 2.5. Construction of yeast strain To delete FPS1 and GPD2, plasmid pUC18-RYUR was PCR amplified with primers DFPS1-U and DFPS1-D, DGPD2-U and DGPD2-D. The PCR product was then used to transform the yeast. Transformants were isolated on minimal medium lacking uracil and checked by diagnostic PCR for the correct integration of the RYUR cassette. The isolates, in which the targeted gene deletion had occurred, were incubated on FOA plates to select for loop-out of the URA3 gene through homologous recombination between the repeat sequences flanking the URA3 gene in the deletion cassette. To replace the GLN1 promoter with the PGK1 promoter in the genome, pUC18-PGK1p-GLN1 was digested by HindIII–EcoRI and the linearized plasmid was used for yeast transformation. Isolation and verification of the transformants and subsequent loop-out of the vector sequence, including the URA3 gene, were performed essentially as described above. To construct the strains overexpressed the genes in the non-oxidative pathway, the plasmid pUC-TTRR was digested with HpaI and this digested fragment was used to transform target strains, and then the strains integrated with the genes can be obtained. The plasmids pUC-3X and pUC-3XK270R, containing a fragment to recover the ura3 mutation, were chromosomally integrated into the URA3 locus of target strains, and then the strains of F106X carrying wild type XR and F106KR carrying the XR with K270R mutation, were obtained. 2.6. Fermentation conditions The recombinant yeast strains were first cultivated aerobically in YPD medium overnight at 30 °C. Cells were centrifuged at 3000 rpm and 4 °C and then washed twice with sterile water. Yeast cells were transferred to 50 ml shake flasks with 30 ml of YP medium (10 g/L yeast extract, 20 g/L peptone) carrying 55, 110, 165 and 220 g/L xylose, 50 g/L glucose and 50 g/L xylose, 100 g/L glucose and 100 g/L xylose to ferment at 30 °C and 120 rpm. The biomass in the initial inocula was 4 g/L, and flasks were sealed with sealing film (Parafilm M, USA). The cultures were aerobic initially and gradually became oxygen limited as the cultivation proceeded. Fermentation experiments were performed in triplicate and one representative experiment was shown.

9211

M. Xiong et al. / Bioresource Technology 102 (2011) 9206–9215 Table 4 Activities of XR, XDH and XK in cell extracts of F106X and F106KR. Strain

F106X F106KR

XR (U/mg)

XDH (U/mg)

XK (U/mg)

NADPH

NADH

NAD+

NADP+

0.155 ± 0.005 0.107 ± 0.003

0.021 ± 0.002 0.682 ± 0.013

0.320 ± 0.018 0.454 ± 0.011

0.012 ± 0.001 0.013 ± 0.001

2.7. Preparation of cell extracts and measurement of enzyme activity The recombinant S. cerevisiae strains were cultivated in YP medium with 20 g/L xylose overnight at 30 °C. The cells were harvested by centrifugation at 13,000g for 5 min at 4 °C and washed with sterile water twice. The cells were resuspended in a lysis buffer described previously (Eliasson et al., 2000), and then the protein was extracted using a vortex with 200 ll glass. The lysates were centrifuged at 14,000g for 10 min at 4 °C, and the supernatants were then analyzed for their XR, XDH, and XK activities. Protein concentrations in the cell-free extracts were determined with a Bio-Rad protein assay. One unit of enzyme activity was defined as the amount of enzyme that reduced or oxidized 1 lmol NAD(P)+ or NAD(P)H per minute. These enzyme activities were determined with a Cary 50 MPR microplate reader coupled to a Cary 50 Bio UV–Visible spectrophotometer (Varian, Inc.).

0.270 ± 0.011 0.299 ± 0.026

After removal of medium, the filter was washed with 15 mL of DDI water, dried in a microwave oven for 20 min at 300 W and then weighed. Cell dry weight was determined in triplicate. 3. Results and discussion 3.1. Enzyme activities The specific activities of XR, XDH and XK in cell extracts of F106X and F106KR are summarized in Table 4. The NADPH-preferred XR activity of F106KR is 31% lower than that of F106X. XR activity in the F106KR strain, which is NADH dependent, is about 34-fold that of the F106X strain. In addition, the specific activities of NAD+-linked XDH and XK of F106KR strain increased by 10% when compared to the F106X strain. This data suggests that the K270R mutation partially changes the XR coenzyme preference from NADPH to NADH.

2.8. Metabolite analysis and cell dry weight determination 3.2. Anaerobic ethanol fermentation from xylose Glucose, xylose, xylitol, organic acids, glycerol and ethanol were analyzed using a Waters Alliance 2695 HPLC (Waters, Milford, USA) containing an Aminex HPX 87H column (Bio-Rad, USA) with a mobile phase of 5 mM H2SO4 together with Waters 2410 refractive-index detector. The flow rate was 0.6 mL/min, and the column temperature and detection temperature were 30 and 55 °C, respectively. Cell dry weight was determined by filtering 5 mL culture through a 0.45 lm pre-weighed glass fiber filter (Michigan, USA).

Fig. 2 shows the ethanol production from strain F106X with YP medium containing 55, 110, 165 and 220 g/L xylose as the sole carbon source. Biomass concentration was increased as the fermentation time was extended and achieved a maximum value after 72 h of 17.0 g/L in 55 g/L xylose, 19.0 g/L in 110 g/L xylose, 16.2 g/L in 165 g/L xylose, and 11.9 g/L in 220 g/L xylose. Strain F106X consumed 51.7 (93.2%), 63.5 (58.3%), 43.1 (25.9%), and 28.4 g/L

Fig. 2. Time-dependent ethanol fermentation profiles of F106X in YPX medium with xylose of 55 g/L (a), 110 g/L (b), 165 g/L (c), and 220 g/L (d). Symbols: open squares, xylose; closed squares, xylitol; closed stars, ethanol; closed diamonds, glycerol; open circles, biomass.

9212

M. Xiong et al. / Bioresource Technology 102 (2011) 9206–9215

Table 5 Summary of the 72 h fermentation of xylose by F106X and F106KR. Parameter

F106X

Initial xylose concentration (g/L) Maximum ethanol concentration (g/L) Maximum xylose consumption rate (g/Lh) Maximum ethanol production rate (g/Lh) Maximum biomass (g/L) Ethanol yield (g/g) Xylitol yield (g/g) Glycerol yield(g/g)

55.5 12.3 1.08 0.44 17.0 0.24 0.29 0

F106KR 109.0 15.7 1.03 0.51 19.0 0.25 0.30 0

(12.7%) xylose after 72 h, and produced 12.3, 15.7, 11.4, and 7.5 g/L ethanol with 15.2, 19.3, 12.2, and 7.9 g/L xylitol formation. Ethanol production in all conditions was less than the xylitol formation, and biomass formation showed a similar trend with varying xylose concentration. The xylose consumption rate and ethanol productivity of strain F106X in 55, 110, 165, and 220 g/L xylose were 0.72 and 0.17, 0.88 and 0.22, 0.60 and 0.16, 0.39 and 0.10 g/Lh, respectively, after 72 h. It is apparent that the xylose consumption rate and ethanol productivity increased when xylose concentration was below 110 g/L, and then dropped quickly when xylose concentration was above 110 g/L. These results suggest that F106X strain had a strong growth inhibition when xylose concentration was over 110 g/L. Lower xylose consumption rates also resulted in no glycerol production during fermentation, because oxygen cannot be rapidly consumed in culture flask. The main fermentation parameters of strain F106X are listed in Table 5. The fermentation results of strain F106KR, under the same conditions as strain F106X, are shown in Fig. 3. The biomass concentrations of the F106KR strain, achieved after xylose was almost fully consumed, were 19.8, 24.8, 26.8, and 27.3 g/L. This is markedly different from the F106X strain in trend, because the biomass increased with xylose concentration. After only 36 h, almost all the xylose was consumed in 55 g/L and 110 g/L xylose, with 19.5 g/L

166.7 11.4 0.83 0.45 16.2 0.26 0.28 0

223.4 7.5 0.78 0.39 11.9 0.26 0.28 0

55.3 19.5 2.96 1.21 19.4 0.36 0.11 0.03

111.3 39.8 5.34 2.09 24.8 0.36 0.11 0.03

168.1 60.1 5.13 2.07 26.8 0.36 0.11 0.04

221.1 77.6 4.19 1.51 27.3 0.37 0.10 0.05

and 38.8 g/L ethanol production. After 48 h, F106KR consumed 97.7% of 165 g/L xylose to produce 58.5 g/L ethanol with 20.6 g/L xylitol formation. F106KR produced 77.6 g/L ethanol with 21.7 g/ L xylitol from 95.9% of 221.1 g/L xylose after 72 h. Ethanol production in strain F106KR increased linearly with initial xylose concentration. The average ethanol yield in these four xylose concentrations was almost 0.36 g/g, which corresponded to 70.6% of the theoretical yield. The intracellular redox balance between XR and XDH kept the ethanol yield constant in strain F106X and strain F106KR. However, the value of ethanol yield (0.36 g/g) in strain F106KR increased about 44.0% when compared to strain F106X. Xylitol yield in strain F106KR was around 0.11 g/g, which was about 62.1% lower than that of the F106X strain. These results indicated that K270R mutation of XR significantly contributed to an increase in ethanol yield and a decrease in xylitol yield. The xylose consumption rate and ethanol productivity of strain F106KR in 55, 110, 165, and 220 g/L xylose were 1.49 and 0.54, 2.29 and 0.82, 2.77 and 1.00, 2.95 and 1.08 g/Lh, respectively. Compared to F106X, the biomass formation, the xylose consumption rate and ethanol productivity increased with xylose concentration, which indicated that F106KR did not have the substrate inhibition even when xylose concentration was over 110 g/L. Table 5 summarizes the main fermentation parameters of strain F106KR.

Fig. 3. Time-dependent ethanol fermentation profiles of F106KR in YPX medium with xylose of 55 g/L (a), 110 g/L (b), 165 g/L (c), and 220 g/L (d). Symbols: open squares, xylose; closed squares, xylitol; closed stars, ethanol; closed diamonds, glycerol; open circles, biomass.

M. Xiong et al. / Bioresource Technology 102 (2011) 9206–9215

9213

Fig. 4. Time-dependent ethanol fermentation profiles of F106X in YPDX medium with 50 g/L glucose and 50 g/L xylose (a), with 100 g/L glucose and 100 g/L xylose (b). Symbols: closed uptriangles, glucose; open squares, xylose; closed squares, xylitol; closed stars, ethanol; closed diamonds, glycerol; open circles, biomass.

3.3. Anaerobic fermentation results in sugar mixture The fermentation results of strain F106X in a 50 g/L glucose and 50 g/L xylose medium, 100 g/L glucose and 100 g/L xylose were shown in Fig. 4. F106X fully consumed 50 g/L glucose and 100 g/ L glucose after 8 h and 12 h, producing 25.2 g/L and 49.5 g/L ethanol. In 50 g/L glucose and 50 g/L xylose medium, 36.6 g/L ethanol with 20.5 g/L xylitol were produced from 100% glucose and 96.0% xylose after 48 h. After 72 h, in 100 g/L glucose and 100 g/L xylose medium, F106X consumed only 53.0% xylose and produced the maximum ethanol of 65.8 g/L with 20.3 g/L xylitol. The yields of ethanol and xylitol from fully consumed sugar in these two medium were 0.36 and 0.17 g/g, and 0.40 and 0.12 g/g. The increase of ethanol yield at high sugar concentration was mainly due to 47% xylose not being consumed after 72 h fermentation in 100 g/ L glucose and 100 g/L xylose. Fig. 5 compares the fermentation results of strain F106KR under the same fermentation conditions as strain F106X. The glucose consumption in F106KR has a similar trend to F106X. After 8 h and 12 h, 28.1 g/L and 51.7 g/L ethanol was produced, mainly from glucose. Furthermore, F106KR also consumed 19.8% xylose in 50 g/ L glucose and 50 g/L xylose, whereas F106X only consumed 7.4% xylose after 8 h, suggesting F106KR had a much higher consumption rate for xylose. These results were consistent with that from xylose fermentation. After 36 h, 95.6% xylose was consumed and 43.6 g/L ethanol produced by F106KR in 50 g/L glucose and 50 g/L xylose medium. By comparison, F106KR converted 94.0% xylose and produced 86.9 g/L ethanol with 12.6 g/L xylitol. The maximum ethanol production in these two media were 44.3 g/L after 36 h and

89.0 g/L after 48 h, respectively. The yields of ethanol and xylitol were 0.42 and 0.066 g/g, and 0.43 and 0.064 g/g. The main parameters of cofermentation from glucose and xylose were summarized in Table 6. In contrast to xylose fermentation, the ethanol yield from cofermentation of glucose and xylose increased significantly as compared to xylose fermentation, which was consistent with many other reports in the literature (Matsushika et al., 2008, 2009b; Matsushika and Sawayama, 2010). Previous published work reported deletions of FPS1 and GPD2 increased ethanol production significantly from glucose (Guo et al., 2009; Zhang et al., 2007), because knockout of FPS1 and GPD2 resulted in much more carbon was used to synthesize ethanol. However, decrease of glycerol will increase the NADH accumulation in the cell and inhibit the growth rate (Guo et al., 2009). Therefore, overexpression of GLN1 or GLT1 could consume excess NADH, recover the growth rate and increase the ethanol production (Cao et al., 2007; Kong et al., 2007a,b). In the present study, we used the same strategy to modify our strain, and then increase the ethanol production from xylose. We first constructed a genetic strain with deletions of FPS1 and GPD2 associated with GLN1 overexpression as an original strain. Moreover, to increase the carbon flux from xylose to glycolysis pathway, four genes of TAL1, TKL1, RKI1 and RPE1 in the non-oxidative phosphate pathway were also over expressed. We found that deletions of FPS1 and GPD2 associated with GLN1 overexpression actually increased the xylose consumption rate and ethanol production significantly (data not published). However, xylitol formation is still a big issue since the redox is imbalanced in the yeast cells (Table 4). The yield of xylitol was larger than the ethanol yield in all xylose concentration

Fig. 5. Time-dependent ethanol fermentation profiles of F106KR in YPDX medium with 50 g/L glucose and 50 g/L xylose (a), with 100 g/L glucose and 100 g/L xylose (b). Symbols: closed uptriangles, glucose; open squares, xylose; closed squares, xylitol; closed stars, ethanol; closed diamonds, glycerol; open circles, biomass.

9214

M. Xiong et al. / Bioresource Technology 102 (2011) 9206–9215

Table 6 Summary of the 72 h fermentation of glucose and xylose by F106X and F106KR. Parameter

F106X

F106KR

Initial gluose concentration (g/L) Initial xylose concentration (g/L) Maximum ethanol concentration (g/L) Maximum glucose consumption rate (g/ Lh) Maximum xylose consumption rate (g/ Lh) Maximum ethanol production rate (g/Lh) Maximum biomass (g/L) Ethanol yield (g/g) Xylitol yield (g/g) Glycerol yield (g/g)

53.7 52.5 38.0 6.71

108.4 104.0 65.8 9.06

53.4 52.1 44.3 6.68

106.7 102.6 89.0 9.24

1.41

1.10

4.04

4.38

3.15 18.9 0.36 0.17 0.04

4.18 19.1 0.40 0.12 0.05

3.51 20.9 0.42 0.07 0.04

4.39 20.5 0.43 0.06 0.05

in the strain carrying wild type XR. Especially, the biomass formation and the xylose consumption rate dropped drastically when xylose concentration was bigger than 110 g/L, suggesting the strain carrying wild type XR had strong substrate inhibition. K270R of XR was proven to be a positive mutation for the augmentation of ethanol yield by adjusting the redox balance in the yeast cell (Bengtsson et al., 2009; Watanabe et al., 2007b). The results of the enzyme assay shown that K270R actually changed the coenzyme alteration of XR from preferred NADPH-dependent to NADH-dependent. However, the effect of K270R mutation was never used to produce ethanol from high xylose concentration, especially concentrations greater than 200 g/L. Compared to the strain carrying wild type XR, the biomass formation, xylose consumption rate and ethanol productivity of K270R strain increased with xylose concentration increase. The strain carrying K270R mutation of XR overcame the substrate inhibition when xylose concentration was less than 220 g/L.

4. Conclusion The K270R mutation of XR significantly altered the coenzyme preference of NADH to NADPH, which led to a higher xylose consumption rate, ethanol yield and ethanol productivity under different xylose concentrations as compared to F106X strain. To our knowledge, F106KR is the first strain from published literature to ferment over 200 g/L xylose in 72 h with 77.6 g/L ethanol formation, and convert 100 g/L glucose and 100 g/L xylose fully to 89.0 g/L ethanol after 48 h. Thus, strain F106KR is an excellent strain to ferment xylose or co-ferment glucose and xylose. Acknowledgements The financial supports from The Hong Kong University of Science and Technology under project RPC06/07.EG16 and from the Fok Ying Tung Foundation under project NRC07/08.EG01 are gratefully acknowledged. The authors would like to thank Prof. P. Ma of Tianjin University for providing strains and plasmids on this study. We are also grateful for the constructive comments from and discussions with Prof. N. Li and Prof. D. Benfield of Biology Department, HKUST. References Bengtsson, O., Hahn-Hagerdal, B., Gorwa-Grauslund, M.F., 2009. Xylose reductase from Pichia stipitis with altered coenzyme preference improves ethanolic xylose fermentation by recombinant Saccharomyces cerevisiae. Biotechnol. Biofuels 2, 9. Brat, D., Boles, E., Wiedemann, B., 2009. Functional expression of a bacterial xylose isomerase in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 75 (8), 2304– 2311.

Cao, L., Zhang, A., Kong, Q., Xu, X., Josine, T.L., Chen, X., 2007. Overexpression of GLT1 in fps1Delta gpdDelta mutant for optimum ethanol formation by Saccharomyces cerevisiae. Biomol. Eng. 24 (6), 638–642. Dmytruk, O.V., Voronovsky, A.Y., Abbas, C.A., Dmytruk, K.V., Ishchuk, O.P., Sibirny, A.A., 2008. Overexpression of bacterial xylose isomerase and yeast host xylulokinase improves xylose alcoholic fermentation in the thermotolerant yeast Hansenula polymorpha. FEMS Yeast Res. 8 (1), 165–173. Edelheit, O., Hanukoglu, A., Hanukoglu, I., 2009. Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies. BMC Biotechnol. 9, 61. Eliasson, A., Christensson, C., Wahlbom, C.F., Hahn-Hagerdal, B., 2000. Anaerobic xylose fermentation by recombinant Saccharomyces cerevisiae carrying XYL1, XYL2, and XKS1 in mineral medium chemostat cultures. Appl. Environ. Microbiol. 66 (8), 3381–3386. Guo, Z.P., Zhang, L., Ding, Z.Y., Wang, Z.X., Shi, G.Y., 2009. Interruption of glycerol pathway in industrial alcoholic yeasts to improve the ethanol production. Appl. Microbiol. Biotechnol. 82 (2), 287–292. Harhangi, H.R., Akhmanova, A.S., Emmens, R., van der Drift, C., de Laat, W.T., van Dijken, J.P., Jetten, M.S., Pronk, J.T., Op den Camp, H.J., 2003. Xylose metabolism in the anaerobic fungus Piromyces sp. strain E2 follows the bacterial pathway. Arch. Microbiol. 180 (2), 134–141. Ho, N.W., Chen, Z., Brainard, A.P., 1998. Genetically engineered Saccharomyces yeast capable of effective cofermentation of glucose and xylose. Appl. Environ. Microbiol. 64 (5), 1852–1859. Hou, L., 2009. Novel methods of genome shuffling in Saccharomyces cerevisiae. Biotechnol. Lett. 31 (5), 671–677. Hou, J., Shen, Y., Li, X.P., Bao, X.M., 2007. Effect of the reversal of coenzyme specificity by expression of mutated Pichia stipitis xylitol dehydrogenase in recombinant Saccharomyces cerevisiae. Lett. Appl. Microbiol. 45 (2), 184–189. Jeffries, T.W., 1985. Emerging technology for fermenting D-xylose. Trends Biotechnol. 3 (8), 208–212. Jeffries, T.W., Grigoriev, I.V., Grimwood, J., Laplaza, J.M., Aerts, A., Salamov, A., Schmutz, J., Lindquist, E., Dehal, P., Shapiro, H., Jin, Y.S., Passoth, V., Richardson, P.M., 2007. Genome sequence of the lignocellulose-bioconverting and xylosefermenting yeast Pichia stipitis. Nat. Biotechnol. 25 (3), 319–326. Jeppsson, H., Yu, S., Hahn-Hagerdal, B., 1996. Xylulose and glucose fermentation by Saccharomyces cerevisiae in chemostat culture. Appl. Environ. Microbiol. 62 (5), 1705–1709. Johansson, B., Christensson, C., Hobley, T., Hahn-Hagerdal, B., 2001. Xylulokinase overexpression in two strains of Saccharomyces cerevisiae also expressing xylose reductase and xylitol dehydrogenase and its effect on fermentation of xylose and lignocellulosic hydrolysate. Appl. Environ. Microbiol. 67 (9), 4249–4255. Karhumaa, K., Hahn-Hagerdal, B., Gorwa-Grauslund, M.F., 2005. Investigation of limiting metabolic steps in the utilization of xylose by recombinant Saccharomyces cerevisiae using metabolic engineering. Yeast 22 (5), 359–368. Karhumaa, K., Garcia Sanchez, R., Hahn-Hagerdal, B., Gorwa-Grauslund, M.F., 2007. Comparison of the xylose reductase-xylitol dehydrogenase and the xylose isomerase pathways for xylose fermentation by recombinant Saccharomyces cerevisiae. Microb. Cell Fact. 6, 5. Kong, Q.X., Gu, J.G., Cao, L.M., Zhang, A.L., Chen, X., Zhao, X.M., 2006. Improved production of ethanol by deleting FPS1 and over-expressing GLT1 in Saccharomyces cerevisiae. Biotechnol. Lett. 28 (24), 2033–2038. Kong, Q.X., Cao, L.M., Zhang, A.L., Chen, X., 2007a. Overexpressing GLT1 in gpd1Delta mutant to improve the production of ethanol of Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 73 (6), 1382–1386. Kong, Q.X., Zhang, A.L., Cao, L.M., Chen, X., 2007b. Over-expressing GLT1 in a gpd2Delta mutant of Saccharomyces cerevisiae to improve ethanol production. Appl. Microbiol. Biotechnol. 75 (6), 1361–1366. Kostrzynska, M., Sopher, C.R., Lee, H., 1998. Mutational analysis of the role of the conserved lysine-270 in the Pichia stipitis xylose reductase. FEMS Microbiol. Lett. 159 (1), 107–112. Kuyper, M., Harhangi, H.R., Stave, A.K., Winkler, A.A., Jetten, M.S., de Laat, W.T., den Ridder, J.J., Op den Camp, H.J., van Dijken, J.P., Pronk, J.T., 2003. High-level functional expression of a fungal xylose isomerase: the key to efficient ethanolic fermentation of xylose by Saccharomyces cerevisiae? FEMS Yeast Res. 4 (1), 69– 78. Madhavan, A., Tamalampudi, S., Ushida, K., Kanai, D., Katahira, S., Srivastava, A., Fukuda, H., Bisaria, V.S., Kondo, A., 2009. Xylose isomerase from polycentric fungus Orpinomyces: gene sequencing, cloning, and expression in Saccharomyces cerevisiae for bioconversion of xylose to ethanol. Appl. Microbiol. Biotechnol. 82 (6), 1067–1078. Matsushika, A., Sawayama, S., 2010. Effect of initial cell concentration on ethanol production by flocculent Saccharomyces cerevisiae with xylose-fermenting ability. Appl. Biochem. Biotechnol.. Matsushika, A., Watanabe, S., Kodaki, T., Makino, K., Inoue, H., Murakami, K., Takimura, O., Sawayama, S., 2008. Expression of protein engineered NADP+dependent xylitol dehydrogenase increases ethanol production from xylose in recombinant Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 81 (2), 243– 255. Matsushika, A., Inoue, H., Kodaki, T., Sawayama, S., 2009a. Ethanol production from xylose in engineered Saccharomyces cerevisiae strains: current state and perspectives. Appl. Microbiol. Biotechnol. 84 (1), 37–53. Matsushika, A., Inoue, H., Murakami, K., Takimura, O., Sawayama, S., 2009b. Bioethanol production performance of five recombinant strains of laboratory and industrial xylose-fermenting Saccharomyces cerevisiae. Bioresour. Technol. 100 (8), 2392–2398.

M. Xiong et al. / Bioresource Technology 102 (2011) 9206–9215 Petschacher, B., Nidetzky, B., 2008. Altering the coenzyme preference of xylose reductase to favor utilization of NADH enhances ethanol yield from xylose in a metabolically engineered strain of Saccharomyces cerevisiae. Microb. Cell Fact. 7, 9–20. Salusjärvi, L., Pitkänen, J., Aristidou, A., Ruohonen, L., Penttilä, M., 2006. Transcription analysis of recombinant Saccharomyces cerevisiae reveals novel responses to xylose. Appl. Biochem. Biotechnol. 128 (3), 237–261. Sambrook, J., Russell, D., 2001. Molecular Cloning: A Laboratory Manual, third ed. Cold Spring Harbor Laboratory Press. Thomas, B.J., Rothstein, R., 1989. Elevated recombination rates in transcriptionally active DNA. Cell 56 (4), 619–630. van Maris, A.J., Winkler, A.A., Kuyper, M., de Laat, W.T., van Dijken, J.P., Pronk, J.T., 2007. Development of efficient xylose fermentation in Saccharomyces cerevisiae: xylose isomerase as a key component. Adv. Biochem. Eng. Biotechnol. 108, 179– 204.

9215

Watanabe, S., Abu Saleh, A., Pack, S.P., Annaluru, N., Kodaki, T., Makino, K., 2007a. Ethanol production from xylose by recombinant Saccharomyces cerevisiae expressing protein-engineered NADH-preferring xylose reductase from Pichia stipitis. Microbiology 153 (Pt 9), 3044–3054. Watanabe, S., Pack, S.P., Saleh, A.A., Annaluru, N., Kodaki, T., Makino, K., 2007b. The positive effect of the decreased NADPH-preferring activity of xylose reductase from Pichia stipitis on ethanol production using xylose-fermenting recombinant Saccharomyces cerevisiae. Biosci. Biotechnol. Biochem. 71 (5), 1365–1369. Watanabe, S., Saleh, A.A., Pack, S.P., Annaluru, N., Kodaki, T., Makino, K., 2007c. Ethanol production from xylose by recombinant Saccharomyces cerevisiae expressing protein engineered NADP+-dependent xylitol dehydrogenase. J. Biotechnol. 130 (3), 316–319. Zhang, A., Kong, Q., Cao, L., Chen, X., 2007. Effect of FPS1 deletion on the fermentation properties of Saccharomyces cerevisiae. Lett. Appl. Microbiol. 44 (2), 212–217.