Alterations of the p15, p16, and p18 genes in osteosarcoma

ELSEVIER

Alterations of the p 15, p 16, and p 18 Genes in Osteosarcoma C. W. Miller, A. Aslo, M. J. Campbell, N. Kawamata, B. C. Lampkin, and H. P. Koeffler

A B S T R A C T : Activation of cyclin-dependent kinases (CDKs) by interaction with cyclins regulates progression through cell cycle checkpoints. This process is counterbalanced by CDK inhibitors (CDKIs), which can h~hibit progression through the cell cycle. Because CDKI expression acts to inhibit cellular proliferation, CDKIs may have a role as tumor suppressors. One class of CDKIs, characterized by the presence of ankyrin repeats, has at least four members(p15INK48, p16 xuK4, p18, and p19). Two of these, p151N~4B and p16 INK4,have been mapped to chromosome 91321, a region of frequent loss in a wide variety of cancers. Alterations of p16 INK4 have been detected in various tumors and cell lines. We analyzed p15 INK4B,p16 INK4, and p18 alterations in 52 osteosarcomas (including 11 explants), and 23 other various sarcomas. Single-stranded conformation polymorphism analysis [polymerase chain reaction (PCRSSCP)] of the coding regions of these CDKI genes detected a missense mutation of p l 6 INr4 exon 1 in one soft tissue sarcoma. Southern blotting detected complete deletion of p15 INK4f~ and p16 INK4 genes h~ osteosarcomas from 2 patients and a soft tissue sarcoma from another individual. Loss of heterozygosity (LOH) at chromosome 91221 was observed with a microsatellite probe closely linked to the INK4 genes in the latter case. Deletions of both p15 mK4Band p16 INK4genes were detected in five of eight osteosarcoma cell lines. By contrast, no alterations of p l 8 were detected in any sample. Together these data suggest that alterations of the p15 inK48and p161NK4genes, but not p18, may occur in ~ 5 % of sarcomas. However, deletions of the p15 INK4Band p16 IN~4genes are frequent in osteosarcoma cell lines and probably have a role in tumor cell growth in culture. Notably, all seven detectable deletions involved both p15 INK4Band p16 INK4genes, suggesting that both contribute individual tumor suppressor activity.

INTRODUCTION

Genetic alterations define progression from a normal to a cancer cell. In s u p p o r t of this hypothesis, several molecular alterations occur in osteosarcoma and other sarcomas. Best s t u d i e d are alterations ablating normal function of p53 and Rb (retinoblastoma susceptibility locus product) [1-5]. Both these lesions affect regulation of the cell cycle and thus control of proliferation [6, 7]. Diverse lines of evidence have s h o w n that the cell cycle is regulated by c y c l i n - d e p e n d e n t kinases (CDK), activated by interaction with specific cyclins [8]. Recent studies demonstrate the

From the Division of Hematology/Oncology, Department of Medicine, UCLA School of Medicine, Cedars-Sinai Research Institute (C. W. M., A. A., M. J. C., N. K., H. P. K.), Los Angeles, California; and Hematology and Oncology, Children's Hospital (B. C, L.), Cincinnati, Ohio. Address reprint requests to: Carl. W. Miller, M.D., Division of Hematology/Oncology, Department of Medicine, UCLA/CedarsSinai Research Institute, 5019 Davis Building, 8700 Beverly Boulevard, Los Angeles, CA 90048. Received May 30, 1995; accepted August 2, I995. Cancer Genet Cytogenet86:136-142 [1996) © Elsevier Science Inc., 1996 655 Avenue of the Americas, New York, NY 10010

existence of CDK inhibitors (CDKI), including p21 way1 (also k n o w n as MDA-6, CIPI, SDI1, and CAP20) [9-14], p27 K~el [15-17], p28 IcK1 [18], p57 kip2 [19], p15 INK4B (also k n o w n as MTS2) [20, 21], p16 INK4 (also k n o w n as MTS1 and CDKN2) [22], p18 [21, 23], and p19 [23, 24]. Each CDKI b i n d s to a specific CDK, or set of CDKs, inhibiting kinase activity. Protein sequence homology defines p21 wAvl, p27 K~vl, and p57 Ktv2 as one class of CDKI [16, 17, 19], and p15 INK4B,p16 ~NK4,p18, and p19 in a second [20, 21, 23, 25]. The first CDKI described, p21 wAF1, was i n d e p e n d e n t l y detected as a CDKI, as a p r o d u c t of p53-activated transcription and as a protein that accumulated in senescent h u m a n fibroblasts and during differentiation of a melanoma cell line [9-14]. Together, these characteristics suggest a role for p21 wAF1 in carcinogenesis. However, no alterations of p21 wAw were detected after screening of a large n u m b e r of tumors and cell lines [26]. One form of familial m e l a n o m a has been m a p p e d by reverse genetics to c h r o m o s o m e 9p21. This region was narrowed to an area i n c l u d i n g p 1 5 INK4B and p16 INK4 [25, 27]. Deletions of p16 rN~4 were detected in 58 of 99 melanoma cell lines, and point mutations of p16 INK4, of w h i c h

0165-4608/96/$15.00

SSDI 0165-4608(95)00216-C

Alterations of p15, p16, and p18 in Osteosarcoma 10 were nonsense mutations, were described in 14 melanoma cell lines [25]. Examination of the p16 INK4gene in affected individuals with :Familial melanoma detected fewer alterations; one group of investigators noted missense mutations of p16 ~NK4 in :2 of 38 families, and a second group noted a variety of changes in 6 of 18 families [28, 29]. Homozygous deletion of the region including p16 INK4is c o m m o n in cell lines encompassing many types of neoplasm; e.g., in one study, :t33 of 290 (46%) and in a second 26 of 46 (56%) cell lines had deletions of p16 ~NK4[25, 27]. In a wide variety of tumors with loss of heterozygosity (LOH) affecting chromosome 9p, in the region of the INK4 genes, few had alterations of the p16 INK4gene [30, 31]. In many types of tumor, p16 iNK4alterations are more c o m m o n in cell lines than in primary tumors: e.g., myeloid leukemias, in which p16 KNK4genes were detected in 6 of 19 leukemia cell lines and 0 of 45 leukemia samples [32]; five of 13 bladder cell lines as compared with 6 of 31 tumors [33]; 3 of 9 head and neck squamous cell lines as compared with 0 of 68 primary tumors [34]. By contrast, p16 INK4 alterations occur more frequently in acute B-cell precursor lymphocytic leukemias (33%) [35], T-cell lymphocytic leukemias (75%) [36], adult T-cell leukemia (27%) [37], glioblastoma (40%) [38, 39], pancreatic adenocarcinoma explants (66%) [40], squamous esophageal tumors (33%) [41], and non-small cell lung cancers (30%) [42]. Together these observations support a role for p16 ~NK4as a tumor suppressor that is especially important in some neoplasms. Furthermore, alteration of p16 INK4appear to target the characteristics that favor growth in culture. The p16 ~NK4tumor suppressor is the prototype of a family of related CDKI. Recent investigations established that p15 INK~B, p18, and p19 ,:an bind and inhibit CDK4 and CDK6 and thus act as a CDKI with properties simmilar to p16 INK4 [20-25]. This functional similarity is reflected in protein structure; all four contain highly conserved ankyrin domains [21, 23, 25]. Growth arrest of cells treated with transforming growth factor-[~ (TGF-~) is associated with increased accumulation of p15 INK4Bbut not of p16 INK4, suggesting that p15 ~NK4B[nay have an important role in regulating proliferation [20]. Because all of these CDKI block entry into S-phase and thus initiation of DNA synthesis and proliferation, all are candidate tumor suppressor genes. Deletion frequently targets the p15 INK4Bgene, but these almost always include deletion of the p16 ~NK4gene. A single example of p18 LOH was detected in a set of 71 lung tumors [42]. To assess the frequency of INK gene alterations in h u m a n osteosarcoma and other sarcomas, we used Southern blots to scan for deletions or rearrangements and used single-strand conformation polymorphism (SSCP) to detect mutations of both genes. We also analyzed LOH using a marker in the vicinity of p16 ~NK4in a limited number of samples.

MATERIALS AND METHODS Samples Bone marrow (BM) DNA from a normal individual was used as a standard for intact and normal p15 INK4B,p16 TM,

137 and p18 genes. Cell line MOLT-4 DNA, previously demonstrated to have a deletion of the p16 ~NK4gene, was used as a control for contamination and background amplification [27]. Cell line HL-60 DNA was used as a control for mutation of p16 INK4 exon 2. Eighty-seven samples from 75 patients were examined: 52 osteosarcomas, 7 soft tissue sarcomas, 6 leiomyosarcomas, 4 Ewing sarcomas, and 6 other sarcomas. Matched normal DNA was available for 8 sarcomas. Eleven of the osteosarcomas were maintained as explants in mice; none were passaged >10 times. Tumor material was acquired with assistance from the NCI Cooperative Human Tissue Network. Metastatic tissues were available for four of the tumors. Eight osteosarcoma cell lines were studied: U2OS, HOS, OSACL, SAOS, MG63, G292, HT161, and HS781.

Primers, PCR, SSCP, and Sequencing Primers for amplifying p16 ~NK4were as follows: Exon I was amplified with primers p16XIS4--GGAGAGGGGGAGAACAGACAACGG and 1108--GCGCTACCTGATTCCAATTC, yielding a fragment of ~ 2 7 0 basepairs (bp). Exon 2 was amplified in its entirety with primers pl6X2S2--ACCCTGGCTCTGACCATTCTGTTCT and p16X2A2--GTACAAATTCAGATCATCAGTCC, yielding a fragment 371 bp long. Exon 1 of p15 ~NK4B was amplified with primers 4BS1--CTGCGCGTCTGGGGGCTGC and 4BA1---CCTCCCGAAACGGTTGACTTC, yielding a 163-bp fragment; exon 2 of p 1 5 INK4B w a s amplified with 4BS2--CCGGCCGGCATCTCCCATA and 4BA2--CGTTGTGGGCGGCTGGGGAACCT, and the resulting fragment was 350 bases long. A fragment 157-bp long representing exon 1 of p l 8 was amplified with primers 18E1f--TCTTTCCTGATCGTCAGGA and 18EIR--CCAACCTGCAGCGCAGT; exon 2, a 263-bp basepair fragment was amplified with primers 18E2F--TTCCAGGTTATGAAACTTGG and 18E2R--TTATTGAAGATTTGTGGATCC. Primer sequences were based on GenBank entries $69805 and L36844 for p15 INK4B, U12818 and U12819 for p16 INK4, and HSU17074 for p18 [20-22]. Oligonucleotides were synthesized by the CSMC Molecular Biology Core. Polymerase chain reaction (PCR) was performed with 100 ng DNA, 0.2 mM dNTP, 1.5 mM MgC12, Taq polymerase (GIBCO-BRL, Gaithersburg, MD) in the reaction buffer provided by the supplier. Samples were labeled by the addition of 1 ~ci 32p-dCTP to each sample. Thermal cycler parameters were 95°C for 30 s, 55°C for 30 s, and 72°C for 60 s for 35 cycles [43]. Electrophoresis for SSCP analysis was performed twice, once through a 5% MDE gel (A.T. Biochem) and a second time through a 6.5% polyacrylamide gel, each containing 10% glycerol. Before electrophoresis, 1 ~l sample was added to 10 ~1 formamide containing 0.2% each of bromophenol blue and xylene cyanol, heated to 95°C for 5 min, and placed on ice. After electrophoresis at 6 W for 18-24 h, the gel was dried and exposed with XOMAT film (Kodak, Rochester, NY) [44]. A polymorphism at codon 148 in exon two of p16 tNK4 has been described [41]. Codon numbering is based on the translation given for Genbank entry U12818 [22]. The first methionine codon was not included in the first cDNA to

138 be described and appears to be a more likely start of translation. To differentiate between m u t a t i o n and polymorp h i s m at exon 2, PCR p r o d u c t with shifted bands were digested with SaclI and separated on 3.5% agarose gels. The c o d o n 148 alanine allele is digested; the threonine allele is not. Shifted bands, and bands from normal controls were excised from dried a c r y l a m i d e gels, s u s p e n d e d in water, and reamplified for direct sequencing. Direct sequencing, using 3~P-end labeled primers, a p p l i e d the cycle sequencing kit from GIBCO-BRL [43].

Southern Blotting Sufficient intact material was available for 66 samples from 56 patients for analysis by Southern blotting. Five to 10 ~g of each sample, digested with 50 U EcoRI for 2 h, was separated on 1% agarose gels at 50 V. The gel was d e n a t u r e d twice with 1.5 M NaC1/0.5 M NaOH for 30 m i n each time, then neutralized twice for 30 m i n with 2 M a m m o n i u m acetate, 0.2 M NaOH, and then transferred to Biotrans n y l o n m e m b r a n e with the last buffer. Filters were b a k e d at 80°C u n d e r v a c u u m for 2 h. Prehybridization and hybridization were performed in 5 × SSC (standard saline citrate 1 × = 0.15 M NaCI, 0.015 M Na citrate, 0.01 m M EDTA), 50% formamide, 10% dextran sulfate, 0.02% bovine serum albumin, 0.02% Ficoll, 0.02% polyvinylpyrollidone, 100 ~g/ml sheared fish DNA, 0.5% s o d i u m dodecyl sulfate (SDS), and 1 mM EDTA. For hybridization, 5 × 106 d p m / m l 3~p r a n d o m p r i m e d probe was used. Hybridization was at 42°C overnight. Filters were rinsed sequentially w i t h decreasing concentrations of SSC; the final rinse was 0.1 × SSC at 65°C [1]. Exon II of p16 INK4was detected with the 3' KpnI fragment of the cDNA clone p 16, a gift from David Beach [22]. This fragment is specific for p161NK4 and does not detect the vicinal p15 INK4Bgene [22]. Exon I was detected by probing with the fragment amplified by primers p16XIS4 and 1108. The 0.5 kilobase (kb) insert of clone pUC-p18C was used as a probe for p18 [21]. Both probes were proven unique by h y b r i d i z a t i o n to Southern blots of normal DNA and DNA with a deletion of both INK4 genes digested w i t h m u l t i p l e enzymes. A probe corresponding to the homologous region of p15 INK4B and p16 INK4 was generated from genomic DNA by primers p16X2S2 and P16X2IA1 [22]. The coding region of m y e l o p e r o x i d a s e cDNA pMPO2 was used as a control for DNA loading and integrity [45]. LOH at Chromosome 9p P o l y m o r p h i s m at locus D9S171, located near p15 INK4Band p16 INK4 on c h r o m o s o m e 9p21, was used to assess LOH in m a t c h e d samples. Amplification conditions were identical to those already described with primers AGCTAAGTGAACCTCATCTCTGTCT and CCCTAGCACTGATGGTATAGTCT. Primer sequences and amplification conditions were retrieved from the Genome Database [46]. Fragment size was resolved by separation on sequencing gels and autoradiography was performed as already described. Sample set i n c l u d e d all sarcomas for w h i c h m a t c h e d normal tissue controls were available, as well as explant samples.

C.W. Miller et al,

RESULTS Examination of Sarcomas for Point Mutation of the p15 INK4B,p16 r~4 and p18 Genes SSCP analysis was used to detect p o i n t mutations, small deletions, and insertions in 75 sarcomas. We detected one shift in exon 1 of p16 INK4in a sample of soft tissue sarcoma (A66 in Fig. 1). Sequencing detected a G to C transversion resulting in the substitution of a proline for an arginine at codon 24. Identical shifts in exon 2 of p16 ~NK4were detected in four samples; the shift was homozygous in one case. Failure to digest with SaclI s h o w e d that these four cases could be attributed to the p r e v i o u s l y described alan i n e / t h r e o n i n e p o l y m o r p h i s m at codon 148 (previously codon 140). No shifts were detected in the three osteosarcoma cell lines with intact p16 INK4genes. No mutations were detected in exon 1 and 2 of p15 INK4B. The pattern of exon 2 of p151NK4Bsuggested the presence of a p o l y m o r p h i s m , with the same pattern detected in both tumor and m a t c h e d normal DNA samples. No shifts were detected for p18 in these samples.

P16 EXON 1 N

M

H

66

67

Figure 1 Single-strand conformational polymorphism (SSCP) for exon 1 of p16 INK4. Samples were amplified with primers p16XIS4 and 1108, yielding a fragment of ~270 bp, denatured in formamide at 95°C, and separated by electrophoresis through 6.5% polyacrylamide TBE gel containing 10% glycerol. After electrophoresis, the gel was exposed to Kodak XOMAT AR film for 12 h. Samples indicated at the origins of the lanes; N; normal human bone marrow; M, MOLT4 cell line having a deletion of p15 INK4Band p161NK4;H, HL-60 cell line having a normal p16 INK4 exon 1; sample A66, soft tissue sarcoma with a mutation at codon 24; sample A67, a soft tissue sarcoma having a normal pattern.

Alterations of p15, p16, and p18 in Osteosarcoma

54

p15

>

p16

>

55

139

60

80

H

M

0

U

N

EXON 2

MPO Figure 2 Deletion of the p15 INK4Band p16~NK4genes. Southern blots were probed sequentially for the conserved region of the INK4 genes (top) and the myeloperoxidase gene (bottom). Identity of band is indicated (left). Samples nos. 54 and 55 are a primary osteosarcoma and its metastasis, respectively; nos. 60 and 80, osteosarcoma samples with intact p15 INK4Band p16 INK~genes; the next four lanes contain DNA from cell lines HOS, MG63, OSAcl, and U2OS, respectively; each lacks p16~NK4;the final lane N is normal human bone marrow DNA.

Deletions of p 1 5 INK4Band p 1 6 INK4 in Sarcomas The p16 cDNA KpnI fragment, specific for exons 2 and 3 of p16 INK4, detects a 4-kb b a n d in a Southern blot of an EcoRI digest of normal h u m a n DNA. A second probe, homologous to both p]5 INK4~ and p16 INK4, produced by PCR amplification of the homologous region of exon 2 of these genes, detected a 4- and an 8-kb band; we deduced that the larger b a n d represents exon 2 of p15 ~NK4B.Southern blots detected deletion of both p15 INK4Band p16 INK4in four samples from 3 patients, 2 with osteosarcoma a n d 1 with soft tissue sarcoma. One osteosarcoma had a deletion of the p15 ~N~4Band p l @ JK4 genes i n both a primary tibial tumor a n d a lung metastasis (Figure 2) (samples 54 and 55). Normal muscle DNA from this patient had normal p15 INK4Band p16 INK4genes (Fig. 2, sample 60). The eight osteosarcoma cell lines were examined for deletions of p15 ~NK4Band p16 ~NK4genes: Deletions of both genes were detected in five cell lines; G292 (data not

shown), HOS, U2OS, OSACL, and MG63 (Fig. 2, samples H, M, O, and U). In no case was either gene deleted alone. The mutational and deletional data for primary sarcomas and sarcoma cell lines are summarized in Table 1. By contrast, deletions of the p18 gene were not detected in either tumors or in cell lines. LOH of Chromosome 9p i n Sarcomas LOH near the p16 gene was examined with a microsatellite marker, D9S171, in eight sarcomas, all having matched normal controls. Five of the eight samples were informative for this locus. Paired samples from 1 patient displayed a clear loss of one allele. The osteosarcoma from this patient had been s h o w n to have a deletion of the p16 JNK4gene. Status of the marker was not remarkable in explants; 8 of 11 were heterozygous, indicating that LOH at this locus is not frequent in explants.

DISCUSSION Table 1

p151NK4Band p16 INK4alterations in osteosarcoma and other sarcomas

Tumor Osteosarcoma

Type

Tumors Explants Cell lines Leiomyosarcoma Tumors Soft tissue Tumors Ewing sarcoma Tumors Other sarcomas Tumors Totale

Mutations/totala Deletions/totalb'~ 0/41 0/11 0/8 0/6 ld/7 0/4 0/6 1/75

2/29 0/11 5/8 0/2 1/7 0/4 0/3 3/56

aNumberof mutations detected/total number of patient samples. bNumberof deletionsdetected/total number of patient samples. CAlldeletionsinclude p15INK4B. dSoft tissue sarcoma with arginine to proline alterations at codon 24 in exon 1. eExcludingcell lines.

In our study, coding m u t a t i o n of the p16 INK4and deletions affecting both the p15 INK4e and p16 ~NK4gene were infrequent in osteosarcoma and the other sarcomas. Neither alterations of the p18 gene nor coding mutations of p15 ~N~4Bwere detected. Deletions, but not point mutations, of p15 INK4Band p16 ~NK4were detected i n 2 of 52 osteosarcomas examined; both were from the same patient. No alterations were detected in the 7 leiomyosarcomas, 4 Ewings sarcomas, 2 rhabdomyosarcomas, 2 epithelioid sarcomas, and single samples of malignant fibrous histiocytoma, liver sarcoma, and liposarcoma. The low rate of alterations of p15 ~NK4~and p16 ~NK4in osteosarcoma tumors is not surprising in light of the infrequent LOH affecting chromosome 9p21 in these tumors [47, 48]. However, two of seven soft tissue sarcomas had alterations; deletion of both p15 It~K4Band p161N~4 genes was detected in one soft tissue sarcoma and a m u t a t i o n in exon i of the p16 INK4gene was noted in another. Five of 8 osteosarcoma cell lines had

140

C.W. Miller et al.

53

54

Table 2

T u m o r suppressor characteristics of osteosarcoma cell lines

Sample INK4 SAOS HS781 Ht161 G292 HOS MG63 OSAcl U2OS

>

Figure 3 Loss of heterozygosity affecting locus D9S171. Polymorphic locus D9S171 was amplified and separated on a sequencing gel, which was then dried and exposed overnight. Sample no. 53 is matched normal DNA for osteosarcoma sample no. 54. deletions of both p15 INK4B and p16 INK4 genes; no p o i n t mutations of either INK4 gene were detected in the three n o n d e l e t e d samples. The high prevalence of p16 INK4 deletions has been noted before in other types of tumor cell lines [25, 27, 32-34]. Eleven serially passaged osteosarcoma explants used in these studies d i d not acquire p151NK4B and p16 ~NE4gane alterations. In contrast, a s t u d y of the p16 INK4gene in pancreatic a d e n o c a r c i n o m a s h o w e d alterations in 78% of the explants [41]. Our data suggest a role for alterations of p16 INK4in establishing cell lines from

+ + + -

p53

Rb

Deleted Mutant Rearranged Rearranged Mutant Mutant ~ Wild-type Wild-type

Deleted ND ND Wild-type Wild-type Wild-type ND Wild-type

Amplified References

MYC

MDM2

[1, 55] [1] [54, 51] [50, 55] [52, 55] [1, 55] [53] [1, 50, 52]

osteosarcomas but not for establishing growth of h u m a n tumors in i m m u n o d e f i c i e n t mice. Mutation of p16 INK4was detected in only one soft tissue sarcoma, substituting a pro]ine at codon 24 with an arginine. This mutation has not been described previously. Codon 24 is in a region similar to the cyclin box, where a proline might disrupt helix formation. This position is not conserved in the closely related p15 INK4B.However, in the absence of functional data, or identification of unaffected carriers of this allele, the effect of this alteration is unclear. Mutational status of the p53 gene is i n d e p e n d e n t of p15 INK4Band p16 INK4alterations in osteosarcoma cell lines. Three of the five osteosarcoma cell lines with deleted INK4 genes (G292, MG63, and HOS), have altered p53 genes (Table 2) [1, 49-53]. One cell line, OsaC1, with a deleted INK4 locus and an intact p53 gene has an amplified MDM2 gene, w h i c h m a y inactivate p53 function (Table 2) [54]. The p53 gene is also altered in two of three cell lines with intact INK4 genes: SAOS2 and HT161 (Table 2) [1, 51]. This observation suggests that the p53 and INK4 genes make different contributions to the transformed p h e n o t y p e of the cell lines. Lung cancer cell lines expressing p161NK4lacked expression of Rb, and lines expressing Rb were deficient in p16 INK4 expression [56]. This relationship a p p e a r e d to be absolute for small cell lung cancer; lung cancer cell lines expressing both Rb and p16 ~NK4were not detected [56]. A concurrently p u b l i s h e d study extended similar observations to a w i d e variety of cell lines [57]. Significantly, this study s h o w e d that expression of p a p i l l o m a virus (HPV) E7, w h i c h inhibits Rb function, correlated with high expression of p16 INK4by those cells, whereas HPV E6 expression, w h i c h inactivates p53, does not increase expression of p16 [57]. In agreement w i t h this observation, cell line SAOS2, w h i c h has a rearranged Rb gene, has an intact INK4 locus [55, 57]. Previous studies of Rb in osteosarcoma have established that alterations affect the Rb gene in as m a n y as 60% of p r i m a r y samples [5]. The relative frequent occurrence of Rb disruption in osteosarcomas m a y account for the rarity of p16 alterations in this tumor. The structural and functional similarities of p15 ~NK4B, and p18 to p16 INK4suggests that these two genes m a y also be tumor suppressor genes. In our samples p16 ~NK4 and p15 INK4B are always deleted together. Analysis of melanoma cell lines for loss of a sequence-tagged site (STS) closely linked to p151NK4~ s h o w e d that both genes were

Alterations of p15, p16, and p18 in Osteosarcoma

deleted in three quarters of cell lines w i t h deleted p16 INK4 genes [25]. A t e n d e n c y for loss of both p151NK4B and p16 INK4 has also been reported for glioblastoma multiforme and for T-cell acute lymphoblastic l e u k e m i a [35, 37]: By contrast, p18 was not deleted in any of our samples and only one heterozygous deletion was noted in 71 lung cancers [42]. Alternately, p15 INK4B delLetions may be the result of its proximity to p16 INK4. The authors thank Ava Chen, Diana Velasquez, Agnes Silla, and Mylinh Huynh for excellent technical assistance; Marge Epstein for secretarial assistance; Seisho Takeuchi, Tsuyoshi Nakamaki, and Adrian F. Gombart for help in determining efficient PCR amplification conditions; and the National Institutes of Health, The Parker Hughes Fund, and the Concern Foundation for support.

REFERENCES 1. Masuda H, Miller C, Koefflar HP, Battifora H, Cline MJ (1987): Rearrangement of the p53 gene in human osteogenic sarcomas. Proc Natl Acad Sci USA 84:7716-7719. 2. Toguchida J, Yamaguchi T, Ritchie B, Beanchamp RL, Dayton SH, Herrera GE, Yamamuro T, Kotoura Y, Sasaki MS, Little JB (1992): Mutation spectrum of the p53 gene in bone and soft tissue sarcomas. Cancer Res 52:6194-6199. 3. Friend SH, Bernards R, Rogelj S, Weinberg RA, Rapaport JM, Albert DM, Dryja TP (1986): A human DNA segment with properties of the gene that predisposes to retinoblastoma and osteosarcoma. Nature 323:643-646. 4. Fung YK, Murphree AL, T'Ang A, Qian J, Hinrichs SH, Benedict WF (1987): Structural evidence for the authenticity of the human retinoblastoma gene. Science 236:1657-1661. 5. Wadayama B, Toguchida J, Shimizu T, Ishizaki K, Sasaki MS, Kotoura Y, Yamamuro T (1994): Mutation spectrum of the retinoblastoma gene in osteosarcomas. Cancer Res 54:30423048. 6. Kern SE (1994): p53: Tumor suppression through control of the cell cycle. Gastroenterology 106:1708-1711. 7. Ewen ME (1994): The cell cycle and the retinoblastoma protein family. Cancer Metastasis Rev 13:45-66. 8. Hunter T (1993): Breaking the cycle. Cell 75:839-841. 9. Xiong Y, Harmon GJ, Zhang H, Casso D, Kobayashi R, Beach D (1993): p21 is a universal inhibitor of cyclin kinases. Nature 366:701-704. 10. Harper JW, Adami GR, Wei N, Keyomarsi K, Elledge SJ (1993): The p21 Cdk-interacting protein Cipl is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75:805-816. 11. el-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent ]M, Lin D, Mercer WE, Kinzler KW, Vogelstein B (1993): WAF1, a potential mediator of p53 tumor suppression. Cell 75:817-825. 12. Jiang H, Fisher PB (1993): Use of a sensitive and efficient subtraction hybridization protocol for the identification of genes differentially regulated during the induction of differentiation in human melanoma cells. Mol Cell Differ 1:285-299. 13. Noda A, Ning Y, Venable SF, Pereira-Smith OM, Smith JR (1994): Cloning of senescent cell-derived inhibitors of DNA synthesis using an expression screen. Exp Cell Res 211:9098. 14. Gu Y, Turck CW, Morgan DO (1993): Inhibition of CDK2 activity in vivo by an associated 20K regulatory subunit. Nature 366:707-710. 15. Polyak K, Kato JY, Solomon MJ, Sherr CJ, Massague J, Roberts

141

16.

17.

18.

19.

20. 21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

JM, Koff A (1994): p27Kipl, a cyclin-Cdk inhibitor, links transforming growth factor-beta and contact inhibition to cell cycle arrest. Genes Dev 8:9-22. Polyak K, Lee MH, Erdjument-Bromage H, Koff A, Roberts JM, Tempst P, Massague J (1994): Cloning of p27Kip1, a cyclin-dependent kinase inhibitor and a potential mediator of extracellular antimitogenic signals. Cell 78:59-66. Toyoshima H, Hunter T (1994): p27, a novel inhibitor of G1 cyclin-Cdk protein kinase activity, related to p21. Cell 78:6774. Hengst L, Dulic V, Slingerland JM, Lees E, Reed SI (1994): A cell cycle-regulated inhibitor of cyclin-dependent kinases. Proc Natl Acad Sci USA 91:5291-5295. Matsuoka S, Edward M, Bai C, Parker S, Zhang P, Baldini A, Harper JW, Elledge SJ (1995): p57KIP2, a structurally distinct member of the p21CIP1 Cdk-inhibitor family, is a candidate tumor suppressor gene. Genes Dev 9:650-662. Hannon GJ, Beach D (1994): p15INK4B is a potential effector of TGF-beta-induced cell cycle arrest. Nature 371:257-261. Guan KL, Jenkins CW, Li Y, Nichols MA, Wu X, O'Keefe CL, Matera AG, Xiong Y (1994): Growth suppression by p18, a p16INK4/MTS1- and p14INK4B/MTS2-related CDK6 inhibitor, correlates with wild-type pRb function. Genes Dev 8:2939-2952. Serrano M, Hannon GJ, Beach D (1993): A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4. Nature 366:704-707. Hirai H, Roussel MF, Kato J, Ashmun RA, Sherr CJ (1995): Novel INK4 proteins, p19 and p18, are specific inhibitors of the cyclin D-dependent kinases CDK4 and CDK6. Mol Cell Biol 15:2672-2681. Ka Ming Chan F, Zhang J, Cheng L, Shapiro DN, Winoto A (1995]: Identification of human and mouse p19, a novel CDK4 and CDK6 inhibitor with homology to p16ink4. Mol Cell Biol 15:2682-2688. Kamb A, Gruis NA, Weaver-Feldhaus J, Liu Q, Harshman K, yTavtigian SV, Stockert E, Day RS, Johnson BE, Skolnick MH (1994): A cell cycle regulator potentially involved in genesis of many tumor types. Science 264:436-440. Shiohara M, el-Deiry WS, Wada M, Nakamura T, Takeuchi S, Yang R, Chen DL, Vogelstein B, Koeffler HP (1994): Absence of WAF1 mutations in a variety of human malignancies. Blood 84:3781-3784. Nobori T, Miura K, Wu DJ, Lois A, Takabayashi K, Carson DA (1994): Deletions of the cyclin-dependent kinase-4 inhibitor gene in multiple human cancers. Nature 368:753-756. Hussussian CJ, Struewing JP, Goldstein AM, Higgins PAT, Ally DS, Sheahan MD, Clark CH, Tucker MA, Dracopoli NC (1994): Germline p16 mutations in familial melanoma. Nat Genet 8:15-21. Kamb A, Shattuckeidens D, Eeles R, Liu Q, Gruis NA, Ding W, Hussey C, Tran T, Miki Y, Weaver-Feldhaus J, McClure M, Aitken JF, Anderson DE, Bergman W, Frants R, Goldgar DE, Green A, MacLennan R, Martin NG, Meyer LJ, Youl P, Zone JJ, Skolnick MH, Cannon-Albright LA (1994): Analysis of the p16 gene (cdkn2) as a candidate for the chromosome 9p melanoma susceptibility locus. Nat Genet 8:22-26. Cairns P, Mao L, Merlo A, Lee DJ, Schwab D, Eby Y, Tokino K, Riet P, Blaugarund JE, Sidransky D (1994): Rates of p16(mts1) mutations in primary tumors with 9p loss. Science 265:415416. Ueki K, Rubio MP, Ramesh V, Correa KM, Rutter JL, von Deimling A, Buckler AJ, Gusella JF, Louis DN (1994): Mtsl/ cdkn2 gene mutations are rare in primary human astrocytomas with allelic loss of chromosome 9p. Hum Mol Genet 3:1841-1845. Ogawa S, Hirano N, Sato N, Takahashi T, Hangaishi A, Tanaka

142 K, Kurosawa M, Tanaka T, Mitani K, Yazaki Y, Hirai H (1994): Homozygous loss of the cyclin-dependent kinase 4-inhibitor (p16) gene in human leukemias. Blood 84:2431-2435. 33. Spruck CH, Gonzalez-Zulueta M, Shibata A, Simoneau AR, Lin MF, Gonzalez F, Tsai YC, Jones PA (1994): p16 gene in uncultured tumours. Nature 3706:183-184. 34. Zhang SY, Klienszanto AJP, Sauter ER, Shafarenko M (1994): Higher frequency of alterations in the p16/cdkn2 gene in squamous cell carcinoma cell lines than in primary tumors of the head and neck. Cancer Res 54:5050-5053. 35. Hebert J, Cayuela JM, Berkeley J, Francois S (1994): Candidate tumor-suppressor genes MTS (p16 INK4^) and MTS2 (p15 INK4B)display frequent homozygous deletions in primary cells from T- but not B-cell lineage acute lymphoblastic leukemias. Blood 84:4038-4044. 36. Hatta Y, Hirama T, Miller CW, Yamada Y, Tomonaga M, Koeftier HP (1995): FIomozygous deletions of the p15 (MTS2) and p16 (CDKN2/MTS1) genes in adult T-cell leukemia. Blood 85:2699-2704. 37. Jen J, Harper WJ, Bigner SH, Papadopoulos N, Markowitz S, Willson JKV, Kinzler KW, Vogelstein B (1994): Deletion of p15 and p16 in brain tumors. Cancer Res 54:6353-6358. 38. Schmidt EE, Ichimura K, Reifenberger G, Collins VP (1994): CDKN2 (p16/MTS1) gene deletion or CDK4 amplification occurs in the majority of glioblastomas. Cancer Res 54:63216324. 39. Mori T, Miura K, Aoki T, Nishihira T, Mori S, Nakamura Y (1994): Frequent somatic mutation of the mtsl/cdk4i (multiple tumor suppressor cyclin-dependent kinase 4 inhibitor) gene in esophageal squamous cell carcinoma. Cancer Res 54:3396-3397. 40. Hayashi N, Sugimoto Y, Tsuchiya E, Ogawa M, Nakamura Y (1994): Somatic mutations of the MTS (multiple tumor suppressor) 1/CDK41(cyclin-dependent kinase-4 inhibitor) gene in human primary non-small cell lung carcinomas. Biochem Biophys Res Commun 202:1426-1430. 41. Caldas C, Hahn SA, da Costa LT, Redston MS, Schutte M, Seymour AB, Weinstein CL, Hruban RH, Yeo SY, Kern SE (1994): Frequent somatic mutations and homozygous deletions of the p16 (MTS1) gene in pancreatic adenocarcinoma. Nat Genet 8:27-32. 42. Okamoto A, Hussain SP, Hagiwara K, Spillare EA, Rusin MR, Demetrick DJ, Serrano M, Harmon GJ, Shiseki M, Zariwala M, Harris CC (1995): Mutations in the p16INK4/MTS1/CDKN2, p15INK4B/MTS2, and p18 genes in primary and metastatic lung cancer. Cancer Res 55:1448-1451. 43. Miller CW, Simon KJ, Aslo A, Yokota J, Buys CHCM, Terada M, Koeffler HP (1992): P53 mutation in human lung tumors. Cancer Res 52:1695-1698. 44. Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T (1994): Detection of polymorphisms of human DNA by gel

C . W . M i l l e r et al.

45.

46.

47.

48.

49.

50.

51.

52.

53.

54.

55.

56.

57.

electrophoresis as single-strand conformation polymorphisms. Proc Natl Acad Sci USA 86:2766-2770. Johnson KR, Nauseef WN, Care A, Wheelock MJ, Shane S, Hudson S, Koeffler HP, Selsted M, Miller C, Rovera G (1994): Characterization of cDNA clones for human myeloperoxidase: Predicted amino acid sequence and evidence for multiple RNA species. Nucleic Acids Res 15:2013-2028. Fasman KH, Cuticchia AJ, Kingsbury DT (1994): The GDB human genome data base anno 1993. Nucleic Acids Res 22:3462-3469. Scheffer H, Kruize YC, Osinga J, Kuiken G, Oosterhuis JW, Leeuw JA, Schraffordt Koops H, Buys CH (1991): Complete association of loss of heterozygosity of chromosomes 13 and 17 in osteosarcoma. Cancer Genet Cytogenet 53:45-55. Yamagnchi T, Toguchida J, Yamamuro T, Kotoura Y, Takada N, Kawaguchi N, Kaneko Y, Nakamura Y, Sasaki MS, lshizaki K (1992): Allelotype analysis in osteosarcomas: Frequent allele loss on 3q, 13q, 17p, and 18q. Cancer Res 52:24192423. Romano JW, Ehrhart JC, Duthu A, Kim CM, Appella E, May P (1989): Identification and characterization of a p53 gene mutation in a human osteosarcoma cell line. Oncogene 4: 1483-1488. Diller L, Kassel J, Nelson CE, Gryka MA, Litwak G, Gebhardt M, Bressac B, Ozturk M, Baker SJ, Vogelstein B, Friend S (1990): p53 functions as a cell cycle control protein in osteosarcomas. Mol Cell Biol 10:5772-5781. Miller CW, Aslo A, Tsay C, Slamon D, Ishizaki K, Toguchida J, Yamamuro T, Lampkin B, Koeffler HP (1990): Frequency and structure of p53 rearrangements in human osteosarcoma. Cancer Res 50:7950-7954. Chandar N, Billig B, McMaster J, Novak J (1992): Inactivation of p53 gene in human and murine osteosarcoma cells. Br J Cancer 65:208-214. Oliner JD, Kinzler KW, Meltzer PS, George DL, Vogelstein B (1992): Amplification of a gene encoding a p53-associated protein in human sarcomas. Nature 358:80-83. Bogenmann E, Moghadam H, DeClerck YA, Mock A (1987): c-myc amplification and expression in newly established human osteosarcoma cell lines. Cancer Res 47:3808-3814. Shew JY, Ling N, Yang XM, Fodstad O, Lee WH (1994): Antibodies detecting abnormalities of the retinoblastoma susceptibility gene product (pp110RB) in osteosarcomas and synovial sarcomas. Oncogene 4:205-214. Otterson GA, Kratzke RA, Coxon A, Kim YW, Kaye FJ (1994): Absence of p16(ink4) protein is restricted to the subset of lung cancer lines that retains wildtype RB. Oncogene 9: 3375-3378. Tam SW, Shay JW, Pagano M (1994): Differential expression and cell cycle regulation of the cyclin-dependent kinase 4 inhibitor p16 rNK4.Cancer Res 54:5816-5820.