Altered DNA copy number in patients with different seizure disorder type: By array-CGH

Brain & Development 29 (2007) 639–643 www.elsevier.com/locate/braindev

Original article

Altered DNA copy number in patients with different seizure disorder type: By array-CGH Hye Sung Kim a, Sung-Vin Yim b, Kyung Hee Jung b, Long Tai Zheng b, Young-Hoon Kim a,c, Kweon-Haeng Lee a,d, Seung-Yun Chung e,*, Hyoung Kyun Rha

a

a Catholic Neuroscience Center, The Catholic University of Korea, Seoul 137-701, Republic of Korea Department of Pharmacology, College of Medicine, Kyung Hee University, Seoul 130-701, Republic of Korea c Department of Pediatrics, Uijeonbu St. Mary’s Hospital, The Catholic University of Korea, Gyeonggi-do 480-717, Republic of Korea d Department of Pharmacology, College of Medicine, The Catholic University of Korea, Seoul 137-701, Republic of Korea Department of Pediatrics, Our Lady of Mercy Hospital Medical College, The Catholic University of Korea, Incheon 403-720, Republic of Korea b

e

Received 23 November 2006; received in revised form 30 March 2007; accepted 23 April 2007

Abstract Epilepsy is one of the most common but genetically complex neurological disorders in children. Previous studies have showed that chromosomal abnormalities confer susceptibility to epilepsy. To identify new chromosomal abnormalities associated with epilepsy, DNA samples from patients with idiopathic generalized epilepsy (IGE), partial epilepsy (PE), and febrile seizures (FS) were analyzed using array comparative genome hybridization technique (array-CGH). Genomic aberrations were detected throughout whole chromosome. The most frequently altered loci were gains noted in: 1p (60%), 5p (55%), 8q (55%), 10q (55%), and losses in 7q (55%). The most frequent chromosomal aberrations for each seizure type were: IGE-1p (60%), 5p (55%), and 10q (55%), PE-11p (45%), 21q (45%) and FS-8q (55%), and losses in 7q (55%). To validate the array-CGH results, real time PCR was performed for several genes (EPM2AIP1, OSM, AFP, CYP19A1, SLC6A13, and COL6A2). The results from the real time PCR were consistent with those from the array-CGH. Therefore, we found that the three types of seizures disorder studied have different chromosomal aberrations. These results might be used for further investigation of the pathogenesis of epilepsy. Ó 2007 Elsevier B.V. All rights reserved. Keywords: Epilepsy; Chromosomal aberration; Array-CGH; Real time PCR; (IGE), Idiopathic generalized epilepsy; (PE), Partial epilepsy; (FS), Febrile seizures

1. Introduction Epilepsy is characterized by recurrent unprovoked seizures. This disorder affects up to 3% of the population at some time during the lifespan with the peak incidence during childhood and old age [1]. Although there have been many attempts to elucidate the cause of epilepsy, the results to date have not been satisfactory [1]. *

Corresponding author. Tel.: +82 32 510 5523; fax: +82 32 503 9724. E-mail address: [email protected] (S.-Y. Chung). 0387-7604/$ - see front matter Ó 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.braindev.2007.04.006

Recently, the use of genetic linkage and karyotype analysis have provided powerful tools for investigating genetic aberrations, and revealing clues to the identification of genes linked to epilepsy [2]. A variety of chromosomal abnormalities have been found in patients with epilepsy [3]. Array-based comparative genomic hybridization (array-CGH) has provided another useful technique for genetic investigations [4–6]. It offers high resolution, accuracy, and sensitivity for genetic analysis [4,7]. This method has proven to be particularly powerful for mapping disease associated regions in the genome.

640

H.S. Kim et al. / Brain & Development 29 (2007) 639–643

Array-CGH now used to detect chromosome aberrations provides a number of advantages over prior methodologies [4,8,9]. Therefore, this study was designed to identify candidate regions important for the three types of seizure disorder using high-resolution array-CGH and real time PCR.

2. Patients and methods 2.1. Patients Peripheral blood samples from 60 patients (35 men and 25 women; IGE (20), PE (20), FS (20); age 5.8 ± 4.1 yrs) were recruited from the Department of Pediatrics at Our Lady of Mercy Hospital and Uijeongbu St. Mary’s Hospital, the Catholic University of Korea. Informed consent was obtained in accordance with the Institutional Review Board (IRB). The syndromic diagnosis derived from a list of accepted epilepsy syndrome [10]. Task force has included three such conditions in the recommended list of epilepsy syndrome: generalized epilepsy with febrile seizures plus, familial focal epilepsy with variable foci, and idiopathic generalized epilepsies. Idiopathic generalized epilepsies with variable phenotypes, and the reflex epilepsies. Idiopathic generalized epilepsies derived from four types (1 juvenile myoclonic epilepsy, 1 childhood absence epilepsy, 3 juvenile absence epilepsy, and 15 epilepsy) with generalized tonic–clonic seizures. Partial epilepsy derived from two types; idiopathic and symptomatic. Twenty samples used in our research were only idiopathic. 2.2. Methods Array-CGH was performed using MACArrayäKaryo 4K BAC-chip (Macrogen, Seoul, Korea) which contains 4096 bacterial artificial chromosome (BAC) clones in triplicate of the whole human genome with a resolution of about 1 Mbp. All procedures were performed as previously described [8]. Array-CGH data was analyzed for determination of the Cy3:Cy5 ratio for each array element by MAC Viewer v1.6.3 Software (Macrogen, Seoul, Korea). In this study, it was used several samples, IGE (sample number; ige1, ige14), PE (sample number; pe6, pe9), and FS (sample number; fs2, fs19).

3. Results We identified several chromosomal regions with aberrations. Table 1 shows the frequency of aberrant chromosome regions. Regions with recurrent DNA copy number gain were more frequent than those with copy

number loss. There were a total of 62 aberrant chromosomal regions identified. Copy number changes were selected from the log2 ratio above or below 2 standard deviations (SD). The most frequent chromosomal aberrations in the IGE were gains in: 1p (60%), 5p (55%), and 10q (55%). DNA gains in 5p have been reported to be related to seizure by prior studies [11]. The most frequent chromosomal aberrations in PE were gains in 11p (45%) and 21q (45%). DNA gains in 21q were also found to be related to seizure in a study reported by Yamanouchi et al. [2]. The most frequent chromosomal aberrations noted in FS were gains in 8q (55%) and losses 7q (55%). DNA gains in 8q and losses in 7q were also found to be related to seizure [12,13]. For identification of candidate regions related to epilepsy, we selected genes included in the high frequency regions and analyzed these genes according to the seizure disorder type (Table 2). The most frequent chromosomal aberrations were gains at 8q24.3. This region includes the SCRT1 gene and showed a 40% frequency in IGE, 20% in PE and 55% in FS. SCRT1 is a member of the Snail family of C2H2-type zinc finger transcription factors. It codes for a neural-specific transcriptional repressor that binds to E-box motifs [14]. PKHD1 and SYN3 are known to be epilepsy related genes [15,16]. PKHD1 was identified in IGE samples in our array-CGH. Copy number gains in IGE were identified in 40% of samples. SYN3 has been shown to have relevance to PE [15]. In the array-CGH analysis, copy number gains of PE were identified in 35% of samples. SLC6A12, one of the solute carrier of family 6, a neurotransmitter transporter, betaine/GABA showed copy number aberrations in over 35% of in all three seizure types [17]. To confirm the array-CGH results, DNA copy numbers between seizure disorder patients and normal samples were evaluated by real time PCR. As for the array CGH results, several frequently altered loci including gain of 3p, 4q, 12p, 15q, 21q, and 22q in IGE, PE, and FS were found. In each subtypes, we selected six related genes that might represent putatively candidate genes involved in the epilepsy. These genes were confirmed by real time PCR with two specimens that were common to the candidate target genes in each subtypes. Table 3 shows the primers used for six epilepsy related genes: (EPM2AIP1, OSM, AFP,CYP19A1, SLC6A13, and COL6A2). Fig. 1 shows a comparison between the array CGH and real time PCR results. The arrayCGH values were represented by linear-ratios and the N-value was delineated by real time PCR. The relative fold increases by real time PCR of six genes in the region where gains were noted: EPM2AIP1, OSM in IGE and AFP, CYP19A1 in PE and SLC6A13, COL6A2 in FS were showed a higher fold change, which consistent with those observed in the array-CGH finding of DNA copy gains in 3p, 4q, 12p, 15q, 21q, and 22q. Array-CGH and

H.S. Kim et al. / Brain & Development 29 (2007) 639–643

641

Table 1 Chromosomal aberrations which showed frequency more than 30% in 60 seizure disorder patients Region

IGE

Region

PE

Gains 1p11.2 2p13.1 3p22.3a 4q31.21 5p15.33 6q22.33 7q11.23 8q24.22 9q34.11 10q26.3 11p15.4 12p13.33

12/20(60%) 7/20(35%) 6/20(30%) 8/20(40%) 11/20(55%) 10/20(50%) 8/20(40%) 9/20(45%) 8/20(40%) 11/20(55%) 10/20(50%) 9/20(45%)

1p13.2 2p21

7/20(35%) 6/20(30%)

4q13.3a

8/20(40%)

6p21.33 7p32.2 8q23.1

7/20(35%) 8/20(40%) 6/20(30%)

10q11.23 11p15.4 12p13.33 13q14.2

8/20(40%) 9/20(45%) 7/20(35%) 6/20(30%)

14q21.1 15q26.3 16q22.1 17q25.3 18q23 19p13.3 20q13.13 21q22.3 22q12.2a 22q13.33 Xq25

7/20(35%) 10/20(50%) 10/20(50%) 9/20(45%) 6/20(30%) 10/20(50%) 8/20(40%) 6/20(30%) 9/20(45%) 10/20(50%) 6/20(30%)

15q21.2a 16p12.1 17p12 18q21.1 19q13.2 20q12 21q22.2 22q13.31

6/20(30%) 7/20(35%) 6/20(30%) 6/20(30%) 6/20(30%) 7/20(35%) 9/20(45%) 8/20(40%)

Yp11.22

6/20(30%)

7q22.1

6/20(30%)

16p12.3

6/20(30%)

Losses 7q22.1

7/20(35%)

22q11.21

7/20(35%)

a

Region

FS

2p21 3p23

6/20(30%) 6/20(30%)

5p15.33

6/20(30%)

7q35 8q24.3 9q34.12

7/20(35%) 11/20(55%) 7/20(35%)

11p15.4 12p13.33a

7/20(35%) 6/20(30%)

17q25.3

8/20(40%)

19p13.3 20q13.13 21q22.3a

6/20(30%) 6/20(30%) 9/20(45%)

Xq28

7/20(35%)

7q22.1 15q11.2

11/20(55%) 6/20(30%)

22q11.1

6/20(30%)

Verified by real time PCR.

Table 2 Candidate genes found in array-CGH and their frequencies in seizure disorder patients

SCRT1 PKHD1 SYN3 SLC6A12

Total Total Total Total

male/female male/female male/female male/female

23 15 13 22

13/10 9/6 8/5 15/7

Age

IGE

PE

FS

2.8 ± 2.2 4.8 ± 4.2 7.7 ± 2.8 4.9 ± 3.2

8(40%) 8(40%) 2(10%) 7(35%)

4(20%) 5(25%) 7(35%) 7(35%)

11(55%) 3(15%) 4(20%) 8(40%)

*IGE, idiopathic generalized epilepsy. PE, partial epilepsy. FS, febrile seizures.

Table 3 Primers used for real time PCR analysis Gene name

Type of seizure disorder

Primer forward

Primer reverse

Chromosomal region

EPM2AIP1 OSM AFP CYP19A1 SLC6A13 COL6A2

IGE IGE PE PE FS FS

50 50 50 50 50 50

50 50 50 50 50 50

3p22.3 22q12.2 4q13.3 15q21.2 12p13.33 21q22.3

ATGATTGGTGAGAACTCAGG 3 0 TCACTTTACCTCTGTGGACC 3 0 TCAGACATGAAATGACTCCA 3 0 GACCCTTGCTGTGAATTAAG 3 0 GACCTGGAGTGGATAAGACA 3 0 CTGTTTTGTGCTGAAAGGTT 3 0

CCTAAGCCAATTGTTCAGAC 3 0 GTGGGTCTGCTTTTACAGAG 3 0 GGACATATGTTTCATCCACC 3 0 TTGAAGTGCATCATGTGAAT 3 0 TGGATTTAATGGAATGAAGG 3 0 AGCGTCCAGAGAAGACTGTA 3 0

642

H.S. Kim et al. / Brain & Development 29 (2007) 639–643

Fig. 1. Comparison of array-CGH and real time PCR results: IGE (EPM2AIP1 (3p22.3), OSM (22q12.2)), PE (AFP (4q13.3), CYP19A1 (15q21.2)), FS (SLC6A13 (12p13.33) and COL6A2 (21q22.3)). Each samples are depicted (x axis) and the fold difference of array CGH was depicted by linearratios, and N-value was delineated in real time PCR (y axis). A threshold level of >1 (linear-ratio and N-value) indicates significant DNA gain.

real time PCR data were well corresponded well with respect to chromosomal copy number changes delineated for each of the samples.

4. Discussion In this study, we screened for chromosomal aberrations in 60 patients with seizure disorder. The goal of the current research was to determine three types of specific copy number abnormalities. Currently array-CGH is regarded as the most powerful technique, allowing for the simultaneous quantitative analysis of all regions of large genomes [4,7]. Methodologically, several techniques, such as array-CGH, fluorescence in situ hybridization (FISH) and loss of heterozygosity (LOH), have been used to detect and map chromosomal changes. Of classical cytogenetic methods, FISH and real time PCR have been used empirically to confirm arrayCGH [18,19]. In addition, real time PCR has been used for measuring DNA copy number changes at each subtelomeric region of human chromosomes due to low cost, simplicity, and flexibility. However, FISH carried several limits. It is difficult to prepare samples, and it takes so much time to be analyzed. FISH analysis has also been limited in resolution by the density and location of markers used in the analysis [8]. By using the real time PCR, array-CGH result confirmed. Our results identified several candidate regions for epilepsy. These findings are consistent with prior studies [20–22]. The array-CGH results were evaluated as being significant when the frequency being more than 30% in 60 epilepsy samples. To confirm the arrayCGH results, chromosomal aberrations were re-analyzed with real time PCR. In this study, real time PCR was used for validation and quantification of the identified genomic changes. Of the more than

30% frequency clone, epilepsy related aberrations in the chromosome were selected for real time PCR. In the gained region, six genes EPM2AIP1 (3p22.1), OSM (22q12.2), AFP (4q13.3), CYP19A1 (15q21.1), SLC6A13 (12p13.3), and COL6A2 (21q22.3), the relative fold increases in real time PCR corresponded well with those in array-CGH results (UCSC genome browser: May 2004). The oncostatin M (OSM) gene is a member of a cytokine family that includes leukemia-inhibitory factor, granulocyte colony-stimulating factor, and interleukin 6 [21]. By array-CGH, the most frequent chromosomal aberrations in FS were gains in 8q and showed that the region included the SCRT1 with 55% frequency. In 8q24.3, GRINA is also present. It is worth studying the expression of GRINA in different types of seizure disorders, since GRINA codes for ionotropic glutamate receptor [23]. GRINA is not included using MACArrayä-Karyo 4K BAC-chip (Macrogen, Seoul, Korea). Therefore, we have not identified GRINA copy number changes in chromosomal regions in patients with epilepsy. The EPM2AIP1 gene for laforin, the product of the EPM2A gene, which is mutated in an autosomal recessive form of adolescent progressive myoclonus epilepsy, has been also been reported [20]. Cytochrome p450AROM, aromatase (CYP19A1) is an important enzyme involved in androgen activity in the brain [22]. The collagen, type VI, alpha 2 (COL6A2) gene is associated with cortical dysplasia [24]. In summary, we detected the genomic regions in the genome highly likely to harbor critical epilepsy-related genes: these regions included high-level gain/amplification or loss/high-magnitude deletions. Real time PCR was used for validation of the array-CGH results of regions with either gain or loss. These findings may be

H.S. Kim et al. / Brain & Development 29 (2007) 639–643

used for starting points for further investigations to determine the pathology of epilepsy.

[11]

Acknowledgement

[12]

This study was supported by a Grant of the Korean Health 21 R&D Projects, Ministry of Health Welfare, Republic of Korea (00-PJ3-PG6-GN02-0002).

[13]

References [1] Berkovic SF, Mulley JC, Scheffer IE, Petrou S. Human epilepsies: interaction of genetic and acquired factors. Trends Neurosci 2006;29:391–7. [2] Yamanouchi H, Imataka G, Nakagawa E, Nitta A, Suzuki N, Hirao J, et al. An analysis of epilepsy with chromosomal abnormalities. Brain Dev 2005;27:370–7. [3] Goldman AM, Potocki L, Walz K, Lynch JK, Glaze DG, Lupski JR, et al. Epilepsy and chromosomal rearrangements in SmithMagenis Syndrome [del(17)(p11.2p11.2)]. J Child Neurol 2006;21:93–8. ˚ , Fioretos T, [4] Paulsson K, Heidenblad M, Mo¨rse H, Borg A Johansson B. Identification of cryptic aberrations and characterization of translocation breakpoints using array CGH in high hyperdiploid childhood acute lymphoblastic leukemia. Leukemia 2006;20:2002–7. [5] Rucker FG, Bullinger L, Schwaenen C, Lipka DB, Wessendorf S, Frohling S, et al. Disclosure of candidate genes in acute myeloid leukemia with complex karyotypes using microarray-based molecular characterization. J Clin Oncol 2006;24:3887–94. [6] Weber RG, Hoischen A, Ehrler M, Zipper P, Kaulich K, Blaschke B, et al. Frequent loss of chromosome 9, homozygous CDKN2A/p14(ARF)/CDKN2B deletion and low TSC1 mRNA expression in pleomorphic xanthoastrocytomas. Oncogene 2007;26:1088–97, Epub 2006 Aug 7.. [7] Schoumans J, Johansson B, Corcoran M, Kuchinskaya E, Golovleva I, Grander D, et al. Characterisation of dic(9;20)(p11–13;q11) in childhood B-cell precursor acute lymphoblastic leukaemia by tiling resolution array-based comparative genomic hybridisation reveals clustered breakpoints at 9p13.2 and 20q11.2. Br J Haematol 2006;135:492–9. [8] Moon HJ, Yim SV, Lee WK, Jeon YW, Kim YH, Ko YJ, et al. Identification of DNA copy-number aberrations by array-comparative genomic hybridization in patients with schizophrenia. Biochem Biophys Res Commun 2006;344:531–9. [9] Rosenberg C, Knijnenburg J, Bakker E, Vianna-Morgante AM, Sloos W, Otto PA, et al. Array-CGH detection of micro rearrangements in mentally retarded individuals: clinical significance of imbalances present both in affected children and normal parents. J Med Genet 2006;43:180–6. [10] Engel Jr J. International League Against Epilepsy (ILAE). A proposed diagnostic scheme for people with epileptic seizures and

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

643

with epilepsy: report of the ILAE Task Force on Classification and Terminology. Epilepsia 2001;42:796–803. Stanley WS, Powell CM, Devine GC, Ellingham T, SamangoSprouse CA, Vaught DR, et al. Mosaic 5p tetrasomy. Am J Med Genet 1993;45:774–6. Fong GC, Shah PU, Gee MN, Serratosa JM, Castroviejo IP, Khan S, et al. Childhood absence epilepsy with tonic–clonic seizures and electroencephalogram 3–4-Hz spike and multispikeslow wave complexes: linkage to chromosome 8q24. Am J Hum Genet 1998;63:1117–29. Mizugishi K, Yamanaka K, Kuwajima K, Kondo I. Interstitial deletion of chromosome 7q in a patient with Williams syndrome and infantile spasms. J Hum Genet 1998;43:178–81. Tateno M, Fukunishi Y, Komatsu S, Okazaki Y, Kawai J, Shibata K, et al. Identification of a novel member of the snail/ Gfi-1 repressor family, mlt 1, which is methylated and silenced in liver tumors of SV40 T antigen transgenic mice. Cancer Res 2001;61:1144–53. Suzuki T, Delgado-Escueta AV, Alonso ME, Morita R, Okamura N, Sugimoto Y, et al. Mutation analyses of genes on 6p12-p11 in patients with juvenile myoclonic epilepsy. Neurosci Lett 2006;405:126–31. Oti M, Snel B, Huynen MA, Brunner HG. Predicting disease genes using protein–protein interactions. J Med Genet 2006;43:691–8. Gong Y, Zhang M, Cui L, Minuk GY. Sequence and chromosomal assignment of a human novel cDNA: similarity to gammaaminobutyric acid transporter. Can J Physiol Pharmacol 2001;79:977–84. Hurst CD, Fiegler H, Carr P, Williams S, Carter NP, Knowles MA. High-resolution analysis of genomic copy number alterations in bladder cancer by microarray-based comparative genomic hybridization. Oncogene 2004;23:2250–63. Holzmann K, Kohlhammer H, Schwaenen C, Wessendorf S, Kestler HA, Schwoerer A, et al. Genomic DNA-chip hybridization reveals a higher incidence of genomic amplifications in pancreatic cancer than conventional comparative genomic hybridization and leads to the identification of novel candidate genes. Cancer Res 2004;64:4428–33. Ianzano L, Zhao XC, Minassian BA, Scherer SW. Identification of a novel protein interacting with laforin, the EPM2a progressive myoclonus epilepsy gene product. Genomics 2003;81:579–87. Jankowsky JL, Patterson PH. Differential regulation of cytokine expression following pilocarpine-induced seizure. Exp Neurol 1999;159:333–46. Stoffel-Wagner B, Watzka M, Schramm J, Bidlingmaier F, Klingmuller D. Expression of CYP19 (aromatase) mRNA in different areas of the human brain. J Steroid Biochem Mol Biol 1999;70:237–41. Bonaglia MC, Giorda R, Tenconi R, Pessina M, Pramparo T, Borgatti R, et al. A 2.3 Mb duplication of chromosome 8q24.3 associated with severe mental retardation and epilepsy detected by standard karyotype. Eur J Hum Genet 2005;13:586–91. Yao G, Chen XN, Flores-Sarnat L, Barlow GM, Palka G, Moeschler JB, et al. Deletion of chromosome 21 disturbs human brain morphogenesis. Genet Med 2006;8:1–7.