Altered expression of GABAa and GABAb receptor subunit mRNAs in the hippocampus after kindling and electrically induced status epilepticus

Neuroscience 134 (2005) 691–704

ALTERED EXPRESSION OF GABAA AND GABAB RECEPTOR SUBUNIT mRNAs IN THE HIPPOCAMPUS AFTER KINDLING AND ELECTRICALLY INDUCED STATUS EPILEPTICUS creases in subunit ␣2 and ␤1–3 mRNA levels in cornu ammonis 3 pyramidal cells are suggestive of impaired GABAA receptor-mediated inhibition. Persistent upregulation of subunits ␤1–3 and ␥2 of the GABAA receptor and of GABABR2 mRNA in granule cells, however, may result in activation of compensatory anticonvulsant mechanisms. © 2005 Published by Elsevier Ltd on behalf of IBRO.

T. NISHIMURA,a,b C. SCHWARZER,a E. GASSER,a N. KATO,c A. VEZZANId AND G. SPERKa* a Department of Pharmacology, Innsbruck Medical University, PeterMayr-Str. 1a, 6020 Innsbruck, Austria b Department of Pediatrics, Tokyo Women’s Medical University, Tokyo, Japan c

Department of Neuropsychiatry, Graduate School of Medicine, University of Tokyo, Bunkyo-ku, Tokyo 113-8655, Japan

Key words: seizures, hippocampus, inhibitory neurotransmission, temporal lobe epilepsy.

d

Department of Neuroscience, Mario Negri Institute for Pharmacological Research, Via Eritrea 62, 20157 Milan, Italy

GABA is the major inhibitory neurotransmitter in the mammalian brain and exerts its actions through two classes of receptors, ionotropic GABAA receptors and the metabotropic GABAB receptors (GABABR) (Bowery, 1993; Mody et al., 1994; Sieghart, 1995). GABAA receptors mediate a fast hyperpolarizing action of GABA by ligand-operated chloride channels constituted of five subunits. Several gene families encode these subunits (␣1–␣6, ␤1–␤3, ␥1– ␥3, ␦, ␧, ␲, ␪). Typically two ␣-, two ␤-, and a ␥-, ␦-, ␧-, ␲, or ␪-subunit participate in the pentameric structure (Schofield et al., 1987; Mehta and Ticku, 1999; Pirker et al., 2000; Sieghart and Sperk, 2002). Considering the numerous possible combinations of these subunits, the existence of a variety of GABAA receptor subtypes with presumably varying physiological properties has been postulated and also demonstrated (Tretter et al., 1997; Jechlinger et al., 1998; Sieghart and Sperk, 2002). GABABR are G-protein-coupled receptors located at pre- and postsynaptic sites (Bowery, 1993; Bettler et al., 1998; Bowery and Enna, 2000; Couve et al., 2000). So far two different genes have been identified encoding two splice variants of GABAB receptor-1 (GABABR1) (GABABR1a and 1b) and GABAB receptor-2 (GABABR2). GABABR1 and GABABR2 form a functionally active heterodimeric complex in the membrane (Kaupmann et al., 1998; White et al., 1998). Stimulation of postsynaptic GABABR causes an increased K⫹ conductance generating late IPSPs (Gahwiler and Brown, 1985). Presynaptic GABABR mediate a suppression of neurotransmitter release by inhibiting voltage-sensitive Ca⫹⫹ channels (Klapstein and Colmers, 1992; Takahashi et al., 1998). Depending on their specific neuronal localization, they may similarly suppress the release of glutamate or of GABA resulting in decreased excitation or inhibition, respectively. There is now strong evidence that impaired GABAergic transmission mediated by GABAA and/or GABABR can cause seizures. Thus, blocking GABAA receptors with bicuculline or picrotoxin results in severe convulsions

Abstract—Epilepsy may result from altered transmission of the principal inhibitory transmitter GABA in the brain. Using in situ hybridization in two animal models of epileptogenesis, we investigated changes in the expression of nine major GABAA receptor subunits (␣1, ␣2, ␣4, ␣5, ␤1-␤3, ␥2 and ␦) and of the GABAB receptor species GABABR1a, GABABR1b and GABABR2 in 1) hippocampal kindling and 2) epilepsy following electrically-induced status epilepticus (SE). Hippocampal kindling triggers a decrease in seizure threshold without producing spontaneous seizures and hippocampal damage, whereas the SE model is characterized by spontaneous seizures and hippocampal damage. Changes in the expression of GABAA and GABAB receptor mRNAs were observed in both models, and compared with those seen in other models and in human temporal lobe epilepsy. The most prominent changes were a relatively fast (24 h after kindling and electrically-induced SE) and lasting (7 and 30 days after termination of kindling and SE, respectively) reduction of GABAA receptor subunit ␦ mRNA levels (by 43–78%) in dentate granule cells, accompanied by increases in mRNA levels of all three ␤-subunits (by 8 –79%) and subunit ␥2 (by 11– 43%). Levels of the minor subunit ␣4 were increased by up to 60% in dentate granule cells in both animal models, whereas those of subunit ␣5 were decreased 24 h and 30 days after SE, but not after kindling. In cornu ammonis 3 pyramidal cells, downregulation of subunits ␣2, ␣4, ␣5, and ␤1–3 was observed in the ventral hippocampus and of ␣2, ␣5, ␤3 and ␥2 in its dorsal extension 24 h after SE. Similar but less pronounced changes were seen in sector cornu ammonis 1. Persistent decreases in subunit ␣2, ␣4 and ␤2 transcript levels were presumably related to SE-induced cell loss. GABAB receptor expression was characterized by increases in GABABR2 mRNA levels at all intervals after kindling and SE. The observed changes suggest substantial and cell specific rearrangement of GABA receptors. Lasting downregulation of subunits ␦ and ␣5 in granule cells and transient de*Corresponding author. Tel: ⫹43-512-507-3710; fax: ⫹43-512-507-2811. E-mail address: [email protected] (G. Sperk). Abbreviations: CA, cornu ammonis; GABABR, GABAB receptor; GABABR1, GABAB receptor-1; GABABR2, GABAB receptor-2; GAD, glutamic acid decarboxylase; ROD, relative optical density; SE, status epilepticus; TLE, temporal lobe epilepsy. 0306-4522/05$30.00⫹0.00 © 2005 Published by Elsevier Ltd on behalf of IBRO. doi:10.1016/j.neuroscience.2005.04.013

691

692

T. Nishimura et al. / Neuroscience 134 (2005) 691–704

(Wood, 1975). Deletion of certain subunits of the GABAA receptor complex, e.g. subunits ␣1, ␤1, ␤3 and ␥2 results in increased seizure susceptibility or limbic seizures in rodents (DeLorey et al., 1998; Karle et al., 2001; Nusser et al., 2001; Prosser et al., 2001; Kralic et al., 2002). Similarly, mice lacking GABABR1 are more susceptible to seizures (Schuler et al., 2001). Recent genetic studies of familial epilepsy syndromes revealed associations with defects of GABAA and GABABR (Noebels, 2003). A rare form of juvenile myoclonic epilepsy is related to a missense mutation of the GABAA receptor ␣1-subunit gene (Cossette et al., 2002), and deletion of the GABAA receptor ␤3-subunit gene in the Angelman syndrome is associated with seizures (Sugimoto et al., 1992). Point mutations of the ␥2-subunit gene were linked to pedigrees with childhood generalized tonic– clonic epilepsy with febrile seizures (Baulac et al., 2001) or generalized absence epilepsy and febrile seizures (Wallace et al., 2001), and truncation of the ␥2-subunit gene causes different epilepsy syndromes (Harkin et al., 2002; Kananura et al., 2002). A polymorphism of the GABABR1 gene was linked to a human temporal lobe epilepsy (TLE) phenotype (Gambardella et al., 2003). Animal models of TLE revealed strong evidence for altered expression of GABAA and GABABR in response to seizure activity or epileptogenesis (Sperk et al., 2003). Pronounced changes in mRNA and protein levels were observed after kainic acid-induced status epilepticus (SE) and subsequent epileptogenesis (Friedman et al., 1994; Schwarzer et al., 1997; Tsunashima et al., 1997; Fritschy et al., 1999; Furtinger et al., 2003a; Straessle et al., 2003), pilocarpine-induced seizures (Rice et al., 1996; Kapur and MacDonald, 1997; Brooks-Kayal et al., 1998; Chandler et al., 2003; Houser and Esclapez, 2003; Peng et al., 2004; Zhang et al., 2004), and electrically induced SE (Kokaia et al., 1994; Kokaia and Kokaia, 2001). Pronounced changes in the expression of both GABAA and of GABABR were observed in the human hippocampus of TLE patients (Wolf et al., 1994; Loup et al., 2000; Munoz et al., 2002; Furtinger et al., 2003b; Pirker et al., 2003; Princivalle et al., 2003). The functional relevance of these changes in seizures and epileptogenesis and the associated neurodegenerative events are still unknown. To address this issue, it is essential to provide a comprehensive description of the changes in the GABA-ergic system using animal models that involve different mechanisms of epileptogenesis and extents of neurodegeneration. We therefore investigated changes in the expression of mRNAs encoding for nine major GABAA receptor subunits and the GABABR in two animal models of TLE in rats: 1) electrical stimulation of the ventral hippocampus inducing self-sustained SE (referred to as “SE rats”) and 2) the classical hippocampal kindling protocol (“kindled rats”). Whereas kindling induces a reduction in seizure threshold with minimal neuronal damage and no spontaneous seizures, the SE model is characterized by late spontaneous seizures and widespread nerve cell loss. For differentiating acute from chronic changes in GABA receptor subunits, we investigated early (24 h) and late time intervals (7 and

30 days, respectively) after completion of kindling or induction of SE.

EXPERIMENTAL PROCEDURES Animals Male Sprague–Dawley rats (250 –280 g, Charles River, Calco, Italy) were housed at constant temperature (23 °C) and relative humidity (60%) with fixed 12 h light/dark cycle and free access to food and water. Procedures involving animals and their care were conducted in conformity with the institutional guidelines that are in compliance with international laws and policies (European Ethics Committees Council Directive 86/609, OJ L 358, 1, 12 December 1987; NIH Guide for the Care and Use of Laboratory Animals, NIH Publication No. 85-23, 1985). All efforts were made to minimize animal suffering and to reduce the number of animals used.

Hippocampal kindling Electrodes were implanted into the dorsal hippocampus under Equithesin anesthesia (9.7 mg/ml sodium pentobarbital in saline, 42.6 mg/ml chloral hydrate in propylenglycol and 21.2 mg/ml MgSO4 in ethanol; 3.5 ml/kg i.p.), at the following coordinates: from bregma (mm), AP ⫺3.5; L ⫾2.3; H 2.9 below the dura mater. The nosebar was set at 2.5 mm below the interaural line. EEG recordings were made using bilateral cortical and hippocampal electrodes in unaesthetized, freely moving rats. Kindling was started 7 days after implantation of electrodes when the animals showed no behavioral signs of discomfort or pain (Gobbi et al., 1998). Rats were allowed to acclimatize in a Plexiglas cage and an EEG recording was acquired for at least 10 min to assess the baseline EEG pattern. Before electrical stimulation, animals were randomly assigned to three groups: controls (implanted, but not stimulated) and two groups of rats evaluated at two different time points after kindling completion (24 h and 7 days, respectively). Constant current stimuli were delivered unilaterally to the dorsal hippocampus through a bipolar electrode (recording electrode) twice daily for 5 days per week at intervals of at least 6 h. Stimulation parameters were 50 Hz, 2 ms monophasic rectangular wave pulses for 1 s. The current intensity ranged from 80 to 200 ␮A. Behavior was observed and duration of afterdischarge was measured in the stimulated hippocampus after each stimulation for every animal. Rats received an average of 28⫾3 stimuli to reach a fully kindled state (three consecutive stage 5 seizures according to Racine, 1972).

Self-sustained limbic SE Rats underwent “continuous” hippocampal stimulation as previously described (Schwarzer et al., 1995; De Simoni et al., 2000). Electrodes were implanted at the following coordinates: from bregma (mm), AP ⫺3.6; L ⫾4.9; H 5.0 below the dura. The nosebar was set at 5 mm below the interaural line. EEG recordings were made in the same way as for classical kindling. Before electrical stimulation, animals were randomly assigned to three groups for controls (implanted, but unstimulated) and two timepoints after SE. Animals were entered into the study only if their afterdischarge thresholds were ⱕ250 ␮A. The stimulus intensity was set to 400 ␮A (50 HZ, 1 ms biphasic square waves in 10 s-trains applied every 11 s) to override postictal refractoriness. Animals were then exposed to a “continuous” electrical stimulation protocol lasting 90 min. The subsequently developed SE abated within 24 h (Bertram et al., 1990). Brain sections. Rats were killed by decapitation at 24 h (n⫽7) or 7 days (n⫽7) following kindling completion (at least three consecutive stage 5 seizures), and 24 h (n⫽10) or 30 days (n⫽8) after SE. Age-matched control rats were killed at each interval

T. Nishimura et al. / Neuroscience 134 (2005) 691–704 (n⫽10 for kindled and 9 for SE rats). Brains were rapidly removed from the skulls, immersed into cold isopentane (⫺40 °C, 3 min), and stored at ⫺70 °C until assayed.

In situ hybridization Brains were first cut horizontally from the base upwards, and 20 ␮m thick sections containing the temporal extension of the hippocampus were collected in cryotome (Microm, Zeiss, Vienna, Austria) at ⫺20 °C. After reaching the ventral hippocampal commissure (app. 4.3 mm below bregma according to Paxinos and Watson (1998)), coronar sections (20 ␮m) were taken from the dorsal hippocampus. Sections were mounted on poly-lysinecoated slides (Menzel-Glaser, Braunschweig, Germany) and stored at ⫺25 °C. For in situ hybridization, custom-synthesized (Microsynth, Balgach, Switzerland) oligo DNA probes for GABAA and GABABR subunits and for glutamic acid decarboxylase (GAD67) mRNAs optimized in our previous studies (Tsunashima et al., 1997; Szabo et al., 2000; Furtinger et al., 2003a) were used (Table 1). Oligonucleotides (10 pmol) were labeled with [35S]-dATP (1300 Ci/mmol, NEN, Vienna, Austria) by reaction with terminal deoxynucleotidyltransferase (Roche, Mannheim, Germany) and precipitated with ethanol/sodium chloride. Incubations with different probes were performed concomitantly on series of matching sections from treated and control rats. Incubation lasted for 16 –18 h (42 °C). Sections were washed several times with 1–2⫻ SSC/50% formamide, dried and exposed to Kodak MR films (Amersham, Buckinghamshire, UK) for 2 to 4 weeks, depending on the intensity of the signal.

Evaluation in situ autoradiographs Autoradiographs were digitized using a Sony VC44 camera connected to a PC via a matrox framegrabber card (Visitron System, Munich, Germany) and evaluated using the public domain NIHImage program (written by Wayne Rasband at the U.S. National Institutes of Health and available from the Internet by anonymous FTP from zippy.nimh.nih.gov.). For quantification of in situ hybridization signals, relative optical densities (RODs) were measured over the strata granulosum (lower and upper blade) and pyramidale (cornu ammonis (CA) 1 and CA3b). RODs at the area of the

693

corpus callosum were defined as background and deducted. ROD values were averaged for both hemispheres. Results are presented as mean % of control⫾SEM. Statistical analysis was performed by ANOVA with Dunnett posterior test. Nissl staining and cell counts. Nissl staining was performed with Cresyl Violet in accordance to Paxinos and Watson, 1998). Neuronal cell counts were done at 400⫻ magnification using an optical grid following the suggestions of Coggeshall and Lekan (1996) by an investigator unaware of the treatment of the animals. Data were calculated as mean number of neurons per counted area and are given as % of control⫾SEM. Statistical analyses were done using ANOVA and Dunnett’s multiple comparison test.

RESULTS Neuropathological changes in the hippocampus of kindled and SE rats Neuronal cell counts of principal cells yielded essentially the same results for the dorsal and ventral hippocampus. Whereas there was minimal neuronal damage in the classically kindled animals, losses in CA1 pyramidal neurons were seen in SE rats. In agreement with our previous results (Schwarzer et al., 1995, 1996; Gobbi et al., 1998), no change in granule cell numbers was observed either after kindling or SE (100.7⫾2.24% and 103.0⫾2.21% of controls after 7 and 30 days, respectively). Reduced numbers of CA3 pyramidal neurons (by 27.1⫾6.93%; P⬍0.001) were observed only in the dorsal hippocampus of SE rats 30 days after treatment, while no such loss was observed in its ventral extension (100.9⫾4.13% of control). In the sector CA1 a modest, statistically not significant, reduction of pyramidal neurons was found in the ventral hippocampus of kindled rats (91.7⫾3.59% and 90.8⫾ 4.96% of controls after 24 h and 1 week, respectively), leaving the dorsal part unaffected. In contrast, in the SE model significant reductions in CA1 pyramidal cell numbers were observed in both, the ventral (by 20.5⫾3.39%,

Table 1. Sequence of synthetic oligo-DNA probes used for in situ hybridization Subunit

GABAA receptor subunits ␣1 ␣2 ␣4 ␣5 ␤1 ␤2 ␤3 ␥2 ␦ GABABR R1a R1b R2 GAD67

Sequence

Accession

Bases

No. of bases

CCT GGC TAA GTT AGG GGT ATA GCT GGT TGC TGT AGG AGC ATA TGT AGG ATC TTT GGA AAG ATT CGG GGC GTA GTT GGC AAC GGC TAC AGC CAA GTC GCC AGG CAC AGG ACG TGC AGG AGG GCG AGG CTG ACC CCG TTC CCA GTC CCG CCT GGA AGC TGC TCC TTT GGG ATG TTT GGA GGA TGC CTG TCC AGC CCT CGT CCG AAG CCC TCA CGG CTG CTC AGT GGT ACT GTT TGA AGA GGA ATC TAG TCC TTG CTT CTC ATG GGA GGC TGG CTG TCT CCC ATG TAC CGC CCA TGC CCT TCC TTG GGC ATG CTC TGT CAT TTG GAT CGT TGC TGA TCT GGG ACG GAT ATC AAT GGT AGG GGC GCGAATGTGTATCCTCCCGTGTCTCCAGGCTCCTGTTCGGCAGTCTTC GAG GGA GAA GAG GAC AAT GGC GTT CCT CAC GTC CAT CTC TGC CCT GGT CCA TGT CAC AGG CCA CTG TGG AGG TGA TGC GGA TGC TGT AT

XM220350 XM223378 L08493 X51992 X15466 X15467 X15468 XM220329.21

1138–1182 1450–1494 133–177 1474–1518 1295–1339 1505–1549 1282–1326 1087–1131 1222–1269 1081–1125 489–532

45 45 45 45 45 45 45 45 48 45 44

TCG ATC TCA TAG TCC ACA GGC AGG AAG TTG ATG GCC TTC ACC T CCT CGG GTG AGG CCG CGG GAG ATG AGG GGA GTG AGA GAT GTA TGT GGT CTT CTC TGG TGT GTC TTG TAG CTG CAT GGT GAC TTC TTC C CAC GGG TGC AAT TTC ATA TGT GAA CAT ATT GGT ATT GG CAG TTG ATG TC

Y10369 Y10370 AJ011318

327–369 290–325 2707–2758

43 36 52

739–787

43

L08496

X57572

694

T. Nishimura et al. / Neuroscience 134 (2005) 691–704

P⬍0.001, and 59.1⫾11.0%, P⬍0.001, after 24 h and 30 days, respectively) and dorsal (by 36.1⫾6.41%, P⬍0.001, after 30 days only) hippocampus. GABAA and GABABR subunit mRNAs in the hippocampus of controls Essentially the same probes as in our previous experiments were used for in situ hybridization allowing comparison of the data (Tsunashima et al., 1997; Furtinger et al., 2003a). Respective film autoradiographs are shown for the major GABAA receptor subunits (Figs. 1–3; ␣1, ␣2, ␣4, ␣5, ␤1, ␤2, ␤3, ␥2 and ␦), GABABR (Fig. 5; GABABR1a, GABABR1b and GABABR2) and GAD67 mRNA (Fig. 6) in the ventral hippocampus of controls and at two intervals after kindling and electrically-induced SE. Significant changes in GABAA receptor subunit expression are shown in high resolution dark field photomicrographs for the dorsal hippocampus in Fig. 4. Quantitative evaluations of film autoradiographs are included for both, the dorsal and ventral hippocampus, in kindled and in SE rats and shown in Tables 2– 4. Control rats In agreement with previous studies (Wisden et al., 1992; Tsunashima et al., 1997), GABAA receptor subunit tran-

scripts were heterogeneously distributed (Figs. 1– 4). In granule cells, high mRNA levels were observed for subunits ␣2, ␤1, ␤2, ␤3, ␥2 and ␦, whereas subunits ␣1, ␣4 and ␣5 were less prominent (Figs. 1, 2, 4). For subunits ␣1, ␤2, ␥2 numerous mRNA positive interneurons were found in the dentate hilus and in the hippocampus proper while in pyramidal cells, subunits ␣1, ␣2, ␣5, ␤1, ␤2, ␤3 and ␥2 were prevalent (Figs. 1– 4). High transcript levels were also observed for all three GABABR types throughout the pyramidal and granule cell layers as well as in interneurons of the dentate gyrus and hippocampus proper (Fig. 5). As described previously, expression of GABABR2 mRNA was less abundant in pyramidal cells of the sector CA1 than in sectors CA2/CA3 (Furtinger et al., 2003a). Expression of GABAA receptor subunit mRNAs in kindled rats and after SE resulting from sustained electrical stimulation (SE rats) In both animal models, two time intervals representing different states of epileptogenesis have been chosen. In the kindling model, the interval of 24 h after completion of kindling still includes effects of the electrical stimulation, whereas the 7 days interval focuses on the chronic state in kindled rats. In SE rats, the 24 h and 30 days time intervals

Fig. 1. Film autoradiographs from horizontal sections obtained by in situ hybridization experiments for GABAA receptor subunits ␣1 (a– e), ␣2 (f–j), and ␣5 (k– o) are depicted for controls (c, h, m), 24 h (a, f, k) and 7 days after kindling (d, g, l), and 24 h (d, i, n) and 30 days after SE (e, j, o). Arrows in (d) and (i) indicate the pyramidal cell layer, which displays a transient reduction in subunit ␣1 and ␣2 signal 24 h after SE. Less pronounced reduction of subunit ␣2 mRNA was also found 24 h after kindling (f). Scale bar⫽2 mm in o.

T. Nishimura et al. / Neuroscience 134 (2005) 691–704

695

Fig. 2. Film autoradiographs from in situ hybridization experiments for GABAA receptor subunits ␣4 (a–e), ␥2 (f–j), and ␦ (k–o) are depicted for controls (c, h, m), 24 h (a, f, k), and 7 days after kindling (d, g, l), and 24 h (d, i, n) and 30 days after SE (e, j, o). Note the lasting increase in subunit ␥2 mRNA levels paralleled by reduction of subunit ␦ hybridization signal in kindled animals and even more prominent after SE. Scale bar⫽2 mm in o.

reflect sub-acute effects of the SE and changes persisting in the chronically epileptic rats exposing intermittent spontaneous seizures, respectively. Granule cells of the dentate gyrus ␦-Subunit. Among the most conspicuous changes in the granule cell layer was a reduction of ␦-subunit mRNA levels both in kindled and in SE rats (Figs. 2k– o, 4o, p; Table 2). In SE rats, decreases in ␦ subunit mRNA levels reached 72 and 51% after 24 h and 30 days, respectively. They were almost equally prominent in kindled rats reaching decreases by 62 and 32% in the dorsal hippocampus at the 24 h and 30 days intervals, respectively (Table 2). ␤-Subunits. In contrast to subunit ␦, a general trend toward increases in the mRNA levels of all three ␤-subunits was seen in both seizure models. In SE rats, ␤-subunit mRNA levels (with the exception of subunit ␤2 in the ventral hippocampus at the 24 h interval) were increased in the granule cell layer of the dorsal and ventral hippocampus (Figs. 3, 4; Table 2). These increases were significant for subunit ␤1 mRNA levels (by 46 and 49%) in the dorsal and ventral dentate gyrus at 24 h, for ␤2 mRNA only in the dorsal hippocampus at the 24 h and 30 day intervals (by 50 and 79%, respectively), and for subunit ␤3 mRNA in the ventral dentate gyrus (by 65 and 42%) at both time intervals (Figs. 3, 4i, j, m, n; Table 2). In kindled rats, statistically significant increases were

observed for ␤3-subunit mRNA levels in the dorsal dentate gyrus (by 35%) and for subunit ␤2 mRNA in its ventral extension (by 42%) at the 24 h interval (Table 2). Increases in ␤1, ␤2 and ␤3 subunits expression (although not always statistically significant) appeared to be more prominent in granule cells of the dorsal than the ventral hippocampus (Table 2). ␥2-Subunits. In granule cells of SE rats, also subunit ␥2 mRNA levels were slightly increased, being statistically significant for the ventral dentate gyrus only at the 24 h interval (43%; Fig. 2h–j; Table 2). After kindling, ␥2 mRNA levels were slightly increased in the dorsal and ventral extension of the hippocampus and at both time intervals investigated (Table 2). ␣-Subunits. In SE rats, ␣4-subunit mRNA levels appeared to increase in granule cells being statistically significant only in the dorsal hippocampus after 30 days (62% increase; Fig. 4e, f; Table 2), whereas those for the subunit ␣5 were significantly decreased in the ventral dentate gyrus by 33% and 30%, at the 24 h and 30 day intervals, respectively (Fig. 1m– o; Table 2). A tendency for similar increases in ␣4 mRNA levels was seen also in kindled rats, whereas ␣5 mRNA levels were unchanged (Fig. 2a– c; Table 2). For subunit ␣2 mRNA significantly increased levels were found in the dorsal hippocampus 7 days after com-

696

T. Nishimura et al. / Neuroscience 134 (2005) 691–704

Fig. 3. Film autoradiographs from in situ hybridization for GABAA receptor subunit ␤1 (a– e), ␤2 (f–j), and ␤3 mRNA (k– o) are depicted for controls (c, h, m), 24 h (a, f, k) and 7 days after kindling (d, g, l), and 24 h (d, i, n) and 30 days after SE (e, j, o). Note the transient reduction of subunit ␤2 hybridization signal in the pyramidal cell layer 24 h after SE (arrow in i). Scale bar⫽2 mm in o.

pleting electrical kindling, whereas they were not changed in SE rats (Fig. 1f–j; Table 2). For subunit ␣1 mRNA increased levels were observed in the granule cell layer of the dorsal hippocampus by 58%, 24 h after the initial SE (Table 2; Fig. 4 g, h). Pyramidal cell layer In sector CA3 of the Ammon’s horn, expression of all major GABAA receptor subunits (except ␣1) was significantly reduced at the 24 h interval: subunit ␣2 mRNA levels were decreased by 46 and 51% in the dorsal and ventral hippocampus, respectively (Fig. 1h, i; Fig. 4c, d; Table 3), subunit ␣4 mRNA levels in the ventral hippocampus by 47% (Fig. 2c, d; Table 3), subunit ␣5 mRNA by 54 and 60%, in the dorsal and ventral hippocampus respectively (Fig. 1m, n; Table 3), subunit ␤1 mRNA level in the dorsal hippocampus by 20% (Table 3), subunit ␤2 mRNA levels by 36% in the ventral hippocampus (Fig. 3. h, i; Table 3), subunit ␤3 mRNA level in the dorsal hippocampus by 46% (Fig. 4k, l; Table 3), and for subunit ␥2 the mRNA level were decreased by 17% in the dorsal hippocampus (Table 3). The decreases in mRNA levels observed at the early interval after SE faded after 30 days except for ␣5 for which a 26% decrease in mRNA levels was still seen in the ventral hippocampus (Fig. 1o; Table 3).

In sector CA1, similar decreases in transcript levels as those reported above were observed at the 24 h interval. At this time, decreases were significant for subunits ␣1 (by 30%), ␣2 (by 48%), ␣5 (by 67%) and ␤2 (by 51%) in the ventral hippocampus (Figs. 1, 3; Table 4), and for subunit ␣5 (by 40%) in the dorsal hippocampus (Table 4). Thirty days after SE, significant decreases in GABA receptor subunits were found only for subunits ␣2 (by 34%), ␣5 (by 44%) and ␤2 (by 39%; Figs. 1, 3; Tables 4) in the ventral hippocampus. Interestingly, mRNA levels of the “minor” subunit ␣4 were significantly increased in the dorsal and ventral hippocampus (by 62 and 97% respectively) of SE rats (Fig. 2; Table 4). Decreases in GABAA receptor subunits in SE rats may be largely due to cell losses within the pyramidal cell layer that were to a much lesser extent seen in kindled animals. In pyramidal cells (notably in sector CA1 of the dorsal hippocampus) of kindled rats only a tendency for decreased transcript levels was seen for several GABAA receptor subunits (e.g. ␣1, ␣2, ␣4, ␤1, ␤2 and ␥2), reaching statistical significance only for subunit ␣5 at the 24 h interval but not 7 days after the last kindling session (Table 4). In sector CA3, ␣2 subunit mRNA levels were significantly decreased (by 15–29%) in the dorsal and ventral hippocampus, but were increased by 19% in the dorsal hippocampus after 7 days (Table 3). Subunit ␣4 mRNA

T. Nishimura et al. / Neuroscience 134 (2005) 691–704

697

Fig. 4. Darkfield photomicrographs taken from photoemulsion-dipped coronal sections of the dorsal hippocampus of SE rats obtained after in situ hybridization for GABAA receptor subunits ␣1 (a, b), ␣2 (c, d), ␣4 (e, f), ␣5 (g, h), ␤1 (i, j), ␤2 (m, n), ␤3 (k, l) and ␦ (o, p). Photomicrographs show the dentate gyrus (a, b, e, f, i, j, m–p) and pyramidal cell layer CA3 (c, d, g, h, k, l) in controls (a, c, e, g, i, k, m, o) and 24 h after SE (b, d, f, h, j, l, n, p). Note the pronounced increases in subunit ␣1, ␣4, ␤1 and ␤2 labeling paralleled by a massive drop in subunit ␦ signal in the dentate granule cells. In area CA3 the most prominent reductions in labeling intensity was observed for subunits ␣2, ␣5 and ␤3 at this time interval. Scale bars⫽100 and 200 ␮m, respectively in l (for c, d, g, h, k, l) and p (for a, b, e, f, i, j, m–p).

was transiently decreased in the dorsal hippocampus by 43% (Table 3). GABABR mRNA expression in SE and kindled rats In granule cells of SE rats, GABABR2 mRNA was increased in both hippocampal extensions and at both intervals investigated by 17–33% (Table 2; Fig. 5). In SE animals, both GABABR1a and GABABR1b mRNA levels were significantly reduced (by 24 – 41%) in the pyramidal layers of the ventral hippocampus 24 h after SE (Tables 3, 4; Fig. 5). While mRNA levels recovered to control levels after 30 days in area CA3, the reduction persisted in CA1 pyramidal neurons, however reaching significance only for GABABR1a in the dorsal extension (by 25%; Table 4). In pyramidal neurons altered mRNA levels for GABABR2 were detected only in ventral CA1 24 h after SE (increase by 30%; Table 4). Kindling induced significant increases of GABAB2R mRNA levels in the dentate granule cell layer and CA1 and CA3 pyramidal cell layers of the ventral hippocampus by 22– 42% and of GABABR1b mRNA by 16 –18% at the 24 h interval. Interestingly, the dorsal hippocampus, besides a 16% increase in the expression of GABABR1b mRNA in granule cells, was not affected (Tables 2– 4; Fig. 5). In the ventral area CA1 a 26% increase in GABABR2 mRNA levels persisted after 7 days (Table 4).

GAD67 mRNA expression in kindled and SE rats In control rats, GAD67 (Fig. 6) and GAD65 mRNAs (not shown) were expressed in numerous interneurons throughout the hippocampal formation. The granule cell layer was faintly labeled for GAD67 mRNA (Fig. 6). As described previously for the kainaite model (Schwarzer and Sperk, 1995) expression of GAD67 mRNA was significantly increased in the granule cell layer of the ventral dentate gyrus 7 days after the last kindling session and 24 h after SE (by 35 and 39%, respectively; Table 2, Fig. 6). Thirty days after SE, GAD67 mRNA levels displayed high inter-individual variability and a tendency to be decreased in the granule cell layer.

DISCUSSION Our data indicate pronounced changes in the GABA system (GAD67, nine major subunits of GABAA receptors and GABABR) in two animal models of TLE, in kindling and after electrically-induced SE. Whereas the kindling model was applied for investigating changes during epileptogenesis (lowering of seizure threshold), the SE model reflects aspects of vulnerability for spontaneous seizures and neurodegeneration in TLE. Despite complex changes in the expression patterns of GABA receptor subunit mRNAs, there exists a considerable level of overlap. In the following discussion, we attempted to outline analogies in different

698

T. Nishimura et al. / Neuroscience 134 (2005) 691–704

Fig. 5. Film autoradiographs from in situ hybridization experiments for GABABR1a (a– e), GABABR1b (f–j), and GABABR2 (k– o) are depicted for controls (c, h, m), 24 h (a, f, k) and 7 days after kindling (d, g, l), and 24 h (d, i, n) and 30 days after SE (e, j, o). GB1a, GB1b and GB2, GABAB1aR, GABAB1bR and GABAB2R, respectively. Scale bar⫽2 mm in o.

animal models, for identifying changes that are more general in seizure models and therefore may be of pathophysiological relevance. GABAA receptor subunit expression: comparison of changes in different seizure models Dentate gyrus. ␦-Subunit: Decreases in ␦-subunit transcript levels were manifest in both extensions of the hippocampus, in the kindling model as well as in SE rats. They are in accordance with previously reported changes in kainate- (Schwarzer et al., 1997; Tsunashima et al., 1997) and pilocarpine-induced SE (Peng et al., 2004), and in amygdala-kindled rats (Kamphuis et al., 1995). In all these models decreases in ␦ subunit mRNA expression were rapid and persisted for a long time. Thus, after kainic acid-induced seizures, a significant decline in mRNA and in receptor proteins became already manifest at the earliest time intervals investigated, namely 6 and 12 h after the kainate injection, and persisted for 30 days (Schwarzer et al., 1997; Tsunashima et al., 1997). At variance with these findings, Brooks-Kayal et al. (1998) reported significant increases in ␦ mRNA expression in granule cells isolated from the dentate gyrus of pilocarpine-treated rats either during the latent period or in chronically epileptic animals. This difference indicates that changes in mRNA expression may be substantially different in isolated cells than in the native tissue and that they are presumably influenced

by the neuronal circuitry. ␣ Subunits: Changes in subunit ␣1 and ␣2 are more variable and depend on the animal model, hippocampal subfield and time interval after the initial epileptic insult. The early and transient increase in ␣1 mRNA expression observed 12 h after kainate-induced SE in the dorsal hippocampus (Tsunashima et al., 1997) is in line with our present observation in the SE model. Similarly, changes ␣1 subunit expression in granule cells of the human hippocampus of patients with drug resistant TLE are variable and show only a slight decrease in the chronic epileptic state (Loup et al., 2000; Pirker et al., 2003). Consistent with a previous report (Kamphuis et al., 1995), kindling causes a transient increase in subunit ␣2 mRNA expression in granule cells, whereas the more severe epileptic events induced by kainate injection lead to a transient (6 –24 h) decrease followed by a subsequent increase of ␣2 mRNA levels in granule cells of the dorsal hippocampus (Tsunashima et al., 1997). The statistically not significant changes seen in the SE model reveal a similar tendency (present experiments). More clear-cut similarities between seizure models have been reported in the lasting increases in subunit ␣4 mRNA levels in granule cells after kainate- (Tsunashima et al., 1997), pilocarpine- (Brooks-Kayal et al., 1998; Peng et al., 2004) or electrically-induced SE and in kindling (Kamphuis et al., 1995 and present data). It is interesting to note

T. Nishimura et al. / Neuroscience 134 (2005) 691–704

699

kainic acid-induced epilepsy (on the mRNA and protein level; Schwarzer et al., 1997; Tsunashima et al., 1997) and in SE models (Lauren et al., 2003; present results). In isolated granule cells of pilocarpine-treated rats, an increase in ␤3 mRNA is found together with a decrease in ␤1 mRNA expression, both in the latent and chronic state (Brooks-Kayal et al., 1998). In patients with drug resistant TLE, expression of all three ␤-subunits is enhanced as shown on the mRNA and protein level (Pirker et al., 2003). ␥2-Subunit: Changes in subunit ␥2 expression in granule cells are not uniform in all animal models. Increases in ␥2 mRNA expression observed in granule cells of kindled and SE rats are consistent with the increases in ␥2 expression (on the mRNA and protein level) in the dentate of kainate-injected rats (Schwarzer et al., 1997; Tsunashima et al., 1997) and in the pilocarpine model (Peng et al., 2004). However, ␥2 mRNA levels (similar to ␣2) are transiently decreased in the kainate model at the early time intervals after induction of seizures (Tsunashima et al., 1997). In the human TLE only modest or no changes in ␥2 expression are observed (Loup et al., 2000; Pirker et al., 2003).

Fig. 6. Film autoradiographs from in situ hybridization experiments for GAD67 are depicted for controls (a, d), 24 h (b) and 7 days after kindling (c), and 24 h (e) and 30 days after SE (f). Note the transient increase of GAD67 hybridization signal in granule cells (e) followed by a reduction at the later interval after SE (f). Scale bar⫽2 mm in f.

that changes in mRNA expression of ␣4 and ␦ in dentate granule cells are opposite although subunit ␣4 is often associated with the ␦-subunit in functioning GABAA receptors (Sur et al., 1999). In the dentate gyrus, the ␣5-subunit is only expressed to a minor extent; a similar decrease in its mRNA levels as reported here after SE, was found after kainate (Tsunashima et al., 1997) and pilocarpine (Rice et al., 1996; Houser and Esclapez, 2003) seizures. ␤-Subunits: Expression of all GABAA receptor ␤-subunits (notably of subunit ␤3) tends to increase in animal epilepsy models and in human TLE. Thus, mRNA expression is increased in the chronic state in the kindling model (Kamphuis et al., 1994, 1995; Kokaia et al., 1994), in the

Pyramidal cell layer Due to variable degrees of neurodegeneration in the Ammon’s horn in different animal models, results are more difficult to interpret than in granule cells that are relatively spared in experimental models. Some of the decreases in GABAA receptor subunits (␣2, ␣5, ␤3, ␥2, but also ␤1 and ␤2), however, occur rather fast (after 24 h) and are also present in kindled rats. This indicates fast downregulation of these subunits and is consistent with the reduced GABA-ergic function acutely after kainate-induced SE (Sloviter and Damiano, 1981; Franck et al., 1988; Kapur and Coulter, 1995; Mangan and Bertram, 1997; Lauren et

Table 2. Levels of GABAA receptor and GABABR subunit mRNAs in dentate granule cells Kindling 24 h

GABAA receptor subunits ␣1 ␣2 ␣4 ␣5 ␤1 ␤2 ␤3 ␥2 ␦ GABABR GABABR1a GABABR1b GABABR2 GAD67

Kindling 7 days

SE 24 h

SE 30 days

Dorsal

Ventral

Dorsal

Ventral

Dorsal

Ventral

Dorsal

Ventral

93⫾4.8 100⫾6.1 76⫾12.8 111⫾18.9 141⫾22.4 127⫾10.3 135⫾10.5* 112⫾4.9 38⫾3.7**

131⫾12.7 98⫾9.7 159⫾14.8 100⫾9.1 104⫾8.5 141⫾12.2* 109⫾9.7 132⫾16.7 51⫾11.1**

109⫾8.6 127⫾6.7** 114⫾14.0 122⫾11.6 130⫾14.5 147⫾14.8 121⫾5.3 113⫾5.3 68⫾5.6**

98⫾14.4 100⫾8.4 132⫾26.2 89⫾6.6 101⫾6.2 124⫾4.5 108⫾7.8 111⫾12.8 84⫾8.2

158⫾13.3** 90⫾6.4 147⫾25.7 76⫾10.4 149⫾17.9* 150⫾18.8* 120⫾7.0 114⫾9.5 28⫾3.6**

98⫾16.0 84⫾6.5 131⫾30.1 67⫾8.0** 145⫾11.0** 85⫾7.3 156⫾10.1** 143⫾17.3* 22⫾4.1**

118⫾10.9 107⫾5.7 162⫾19.6* 89⫾14.8 130⫾9.8 178⫾28.1** 112⫾10.3 113⫾8.9 57⫾9.5**

110⫾13.7 99⫾11.9 145⫾24.1 70⫾12.0* 120⫾14.1 108⫾25.0 142⫾9.0** 135⫾15.7 49⫾11.8**

116⫾2.4* ND 104⫾6.2 107⫾18.4

99⫾9.3 116⫾2.7** 124⫾3.8* 114⫾9.2

88⫾7.9 ND 105⫾3.5 99⫾9.5

105⫾8.9 95⫾4.1 109⫾4.0 135⫾10.1*

105⫾4.3 ND 117⫾5.8* 115⫾8.7

101⫾7.4 100⫾4.9 126⫾6.5** 139⫾11.2**

106⫾7.2 ND 125⫾3.9** 88⫾6.5

100⫾7.5 109⫾4.3 133⫾14.1** 74⫾9.7

Levels of mRNA were determined in film autoradiographs obtained after in situ hybridization. Data are shown as % of controls (mean⫾SEM). Statistical analysis was done by one way ANOVA with Dunnett post hoc test. ND, not determined. * P⬍0.05; ** P⬍0.01.

700

T. Nishimura et al. / Neuroscience 134 (2005) 691–704

Table 3. Levels of GABAA receptor and GABABR subunit mRNAs in CA3 pyramidal neurons Kindling 24 h

GABAA receptor subunits ␣1 ␣2 ␣4 ␣5 ␤1 ␤2 ␤3 ␥2 GABABR GABABR1a GABABR1b GABABR2

Kindling 7 days

SE 24 h

SE 30 days

Dorsal

Ventral

Dorsal

Ventral

Dorsal

Ventral

Dorsal

Ventral

76⫾10.7 71⫾3.7** 57⫾6.4** 98⫾8.6 72⫾4.3 70⫾9.0 71⫾3.7** 85⫾2.0

112⫾5.5 85⫾4.1* 116⫾9.3 91⫾3.2 85⫾8.5 94⫾8.0 92⫾9.5 116⫾16.3

100⫾8.1 119⫾9.3* 118⫾12.4 123⫾9.2 113⫾9.9 96⫾7.3 119⫾9.3* 109⫾4.3

85⫾12.2 95⫾4.9 104⫾13.7 98⫾6.8 100⫾7.6 93⫾2.9 104⫾7.9 111⫾9.7

115⫾6.8 54⫾4.2** 97⫾10.9 46⫾6.0** 80⫾9.7 89⫾5.8 54⫾4.2** 83⫾7.1*

98⫾13.7 49⫾5.0** 62⫾7.1** 40⫾4.5** 80⫾8.7* 64⫾6.5** 89⫾10.1 110⫾12.9

93⫾6.4 96⫾5.0 117⫾7.3 104⫾21.6 91⫾9.9 128⫾20.3 96⫾5.0 100⫾5.9

113⫾33.8 89⫾8.0 73⫾10.9 74⫾9.6** 110⫾6.8 86⫾8.4 133⫾9.9* 127⫾13.4

97⫾3.6 ND 99⫾3.7

94⫾3.7 118⫾3.3** 122⫾3.4**

95⫾6.6 ND 102⫾3.1

113⫾7.2 94⫾3.2 105⫾4.3

88⫾5.6 ND 88⫾8.8

76⫾6.1** 74⫾6.4** 92⫾7.3

93⫾7.1 ND 103⫾6.1

104⫾8.7 102⫾5.4 107⫾7.1

Levels of GABAA receptor subunit mRNAs were determined in film autoradiographs obtained after in situ hybridization. Data are shown as % of controls (mean⫾SEM). Statistical analysis was done by one way ANOVA with Dunnett post hoc test. ND, not determined. * P⬍0.05; ** P⬍0.01.

Houser and Esclapez (2003) recently reported downregulation of subunit ␣5 (on mRNA and protein level) in sectors CA1 and CA2 in the pilocarpine model, whereas subunit ␣2 expression was preserved. Our previous data in the kainate model did not unequivocally support this finding. Down-regulation of subunit ␣5 did not exceed cell damage-related decreases, especially in sector CA3 (Schwarzer et al., 1997; Tsunashima et al., 1997). Our present results in the SE model (decreases in ␣5 mRNA levels in sectors CA1 and CA3 exceed those of other ␣-subunits), however, are in accordance with Houser and Esclapez (2003). In kindled rats, ␣5 mRNA levels are also downregulated in the ventral hippocampus despite the facts that there was (almost) no hippocampal cell loss and that other GABAA receptor subunits were not significantly altered (present experiments). A striking finding in the SE model is the upregulation of ␤-subunits, notably of subunit ␤3 in CA1 and CA3 sectors

al., 2003). In the kindling model, these changes are greatly attenuated at the later interval. Although decreases in GABA receptors in the hippocampus proper of SE rats (as in the kainate model; Schwarzer et al., 1997; Tsunashima et al., 1997) may be largely due to cell losses, most of these changes seem to be compensated in the chronic state indicating a compensatory increase in expression (notably subunits ␣2 and ␤3 in sector CA3). In sector CA3, subunits ␣1 and ␣4 appeared to be somewhat less affected than subunits ␣2, ␣5 and ␥2 (Tsunashima et al., 1997). On the protein level, considerable reductions were seen in most subunits in both sectors CA1 and CA3, presumably related to neuronal cell death. Interestingly, immunoreactivities for subunits ␣1, ␣2 and ␥2 appeared to be somewhat preserved in sector CA3 at the late interval 30 days after kainate-induced seizures (Schwarzer et al., 1997). This may also result in an increased number of receptors per neuron.

Table 4. Levels of GABAA receptor and GABABR subunit mRNAs in CA1 pyramidal neurons Kindling 24 h

GABAA receptor subunits ␣1 ␣2 ␣4 ␣5 ␤1 ␤2 ␤3 ␥2 GABABR GABABR1a GABABR1b GABABR2

Kindling 7 days

SE 24 h

SE 30 days

Dorsal

Ventral

Dorsal

Ventral

Dorsal

Ventral

Dorsal

69⫾5.7 109⫾6.3 64⫾11.5 101⫾12.8 87⫾8.6 62⫾8.0 98⫾8.4 96⫾2.9

91⫾8.6 91⫾7.4 107⫾7.2 77⫾4.2* 104⫾10.5 91⫾9.9 89⫾11.2 100⫾12.1

90⫾10.0 125⫾11.1 110⫾11.5 112⫾8.8 105⫾7.5 91⫾7.0 107⫾5.6 109⫾4.5

76⫾12.6 93⫾6.3 90⫾17.4 100⫾6.4 110⫾9.3 94⫾3.8 105⫾6.1 104⫾7.5

128⫾12.4 86⫾7.8 162⫾28.2* 60⫾7.8** 94⫾11.9 76⫾10.9 86⫾7.5 95⫾8.4

70⫾10.1* 42⫾5.5** 197⫾26.7** 33⫾4.6** 82⫾9.9 59⫾5.3** 80⫾11.3 110⫾13.9

82⫾16.6 74⫾11.3 106⫾20.1 84⫾20.5 66⫾13.8 95⫾24.5 70⫾14.0 79⫾11.8

97⫾3.6 ND 110⫾7.9

88⫾6.8 118⫾2.7 142⫾4.9**

96⫾8.6 ND 105⫾6.6

98⫾10.7 94⫾5.0 126⫾7.8*

83⫾7.9 ND 95⫾12.4

59⫾7.1** 67⫾8.9** 130⫾8.2**

75⫾11.5* ND 86⫾10.9

Ventral

77⫾10.8 66⫾13.2** 58⫾7.3 56⫾8.0** 92⫾14.6 71⫾9.7** 96⫾17.7 98⫾13.1 77⫾11.2 85⫾11.1 117⫾9.4

Levels of GABAA receptor subunit mRNAs were determined in film autoradiographs obtained after in situ hybridization. Data are shown as % of controls (mean⫾SEM). Statistical analysis was performed by one way ANOVA with Dunnett post hoc test. ND, not determined. * P⬍0.05; ** P⬍0.01.

T. Nishimura et al. / Neuroscience 134 (2005) 691–704

being consistent with previous reports on upregulation of subunit ␤3 in the kindling model (Kamphuis et al., 1994, Kamphuis et al., 1995) and in SE rats (Lauren et al., 2003). This observation is especially important since expression of all ␤-subunits (notably subunits ␤2 and ␤3) is enhanced also in human TLE (Pirker et al., 2003). Notably impairment of the ␤3-subunit has been associated with epilepsy in humans (Sugimoto et al., 1992) and mice (DeLorey et al., 1998) and its protein sequence is altered in a seizure susceptible mouse strain (Kamatchi et al., 1995). Changes in GABABR mRNA expression In the kainate model, we recently observed a biphasic change in the expression of GABABR mRNAs. After initial decreases 3–9 h for GABABR2, 3–12 h for GABABR1b and 3–24 h GABABR1a, increased expression of these receptor proteins was observed in granule cells (Furtinger et al., 2003a). In the SE model only intervals after this initial decrease in GABABR mRNA expression were now investigated. Subsequent increases in receptor mRNA levels in SE rats thus are in good agreement with the previous data in the kainate model (Furtinger et al., 2003a). Functional considerations on changes in GABAA and GABABR mRNA expression in animal models of TLE Taken together, studies in different animal models (and to some extent in human TLE tissue) the following changes appear to take place in the chronic epileptic situation: there is a decrease in the expression of the ␦-subunit paralleled by slight increase in the ␥2-subunit expression (Schwarzer et al., 1997; Tsunashima et al., 1997; Loup et al., 2000; Pirker et al., 2003; Peng et al., 2004; present results). The ␤-subunits tend to increase in their levels at least in animal models exposing spontaneous seizures (Schwarzer et al., 1997; Tsunashima et al., 1997; Brooks-Kayal et al., 1998; Nusser et al., 1998; present results), in kindling (Kamphuis et al., 1994, 1995; present results) and in human TLE (Pirker et al., 2003). Changes in ␣-subunits, were less consistent between seizure models. They included increases in subunits ␣4 and rather variable changes (mostly transient increases) in ␣1 and ␣2 mRNA levels (Schwarzer et al., 1997; Tsunashima et al., 1997; Peng et al., 2004; present results). Functional GABAA receptors are presumably composed of two ␣-, two ␤- and one ␥-, ␦-, ␧- or ␪-subunit. Within dentate granule cells, ␥2 is the most abundant ␥-subunit. Subunit ␦ mRNA (and protein) levels are lower and may amount to not more than 30% of those of the ␥2-subunit. The loss in ␦-subunit therefore could be replaced by ␥2-subunits in granule GABAA receptors. Such a change could result in loss in tonic inhibition of granule cells and thus can crucially contribute to the decreased seizure threshold in epilepsy (Nusser and Mody, 2002; Stell et al., 2003). This is substantiated by the finding that neurosteroid tetrahydrodeoxycorticosterone, acting on ␦-subunit containing GABAA receptors (Stell et al., 2003) was less effective in reducing excitability in pilocarpinetreated rats than in their controls (Peng et al., 2004). Interestingly, two mutations in the human GABAA receptor

701

␦-subunit gene in patients suffering from generalized epilepsy with febrile seizures have been identified recently (Dibbens et al., 2004). In addition to a decrease in subunit ␦-immunoreactivity in the dentate molecular layer, Peng et al. (2004) reported an increased ␦-subunit expression in hippocampal interneurons. Resulting increased inhibition of interneurons may also contribute to an increase in excitability. The major ␣-subunit in the dentate granule cells of the rat is ␣2 and to a lesser extent ␣1 (Sperk et al., 1997). Changes in these subunits are rather variable although transient increases in their expression were observed in the present and previous studies. Increased expression of subunit ␣4 is more frequently observed. Thus, overall limited expression of ␣-subunits could limit formation of additional functioning GABAA receptors in epilepsy. Binding studies, however, revealed increases in muscimol, benzodiazepine and t-butylclophosphorothionate binding in the dentate gyrus, labeling the GABA, the benzodiazepine and chloride channel sites of the GABAA receptor complex, respectively (Burnham et al., 1983; Shin et al., 1985; Nobrega et al., 1989, 1990; Titulaer et al., 1994, 1995b,c). Also functional studies indicate augmented GABA-ergic transmission in the dentate gyrus of kindled rats (Otis et al., 1994; Titulaer et al., 1995a; Buhl et al., 1996; Gibbs et al., 1997; Nusser et al., 1998). At the same time transmission mediated by GABAA receptors seems to be impaired in sectors CA1 and CA3 (Titulaer et al., 1995a,b). Effects resulting from rearrangement of GABAA receptors at individual synapses in the hippocampus and other areas of the epileptic brain have still to be investigated in greater detail. Besides physiological effects on the local excitability of neurons or the hippocampal networks there may be also consequences for the pharmacological treatment of epilepsy patients. Thus the sensitivity for antiepileptic drugs such as barbiturates and benzodiazepines may be significantly altered (Gibbs et al., 1997).

CONCLUSIONS Our present experiments in conjunction with previous studies in experimental animals and in epileptic human tissue suggest substantial and cell specific rearrangement of GABA receptors in TLE. Lasting downregulation of subunits ␦ and ␣5 in granule cells and transient decrease of subunits ␣2 and ␤1–3 mRNA levels in CA3 pyramidal cells indicate impaired GABAA receptor-mediated inhibition. Persisting upregulation of subunits ␤1–3 and ␥2 (and to a lesser extent of ␣1, ␣2 and ␣4) of the GABAA receptor in granule cells may lead to increased efficacy of GABAA receptors as compensatory inhibitory mechanisms. Sustained up-regulation of GABABR2 and (to a lesser extent) of GABABR1 transcripts in principal hippocampal neurons point to augmented GABAB-mediated functions. These may include enhanced presynaptic inhibition of glutamate release aimed at counteracting excitoxicity. Acknowledgment—The work was supported by the Austrian Science Foundation (P17203-B13).

702

T. Nishimura et al. / Neuroscience 134 (2005) 691–704

REFERENCES Baulac S, Huberfeld G, Gourfinkel-An I, Mitropoulou G, Beranger A, Prud’homme JF, Baulac M, Brice A, Bruzzone R, LeGuern E (2001) First genetic evidence of GABAA receptor dysfunction in epilepsy: a mutation in the ␥2-subunit gene. Nat Genet 28:46 – 48. Bertram EH, Lothman EW, Lenn NJ (1990) The hippocampus in experimental chronic epilepsy: a morphometric analysis. Ann Neurol 27:43– 48. Bettler B, Kaupmann K, Bowery N (1998) GABAB receptors: drugs meet clones. Curr Opin Neurobiol 8:345–350. Bowery NG (1993) GABAB receptor pharmacology. Annu Rev Pharmacol Toxicol 33:109 –147. Bowery NG, Enna SJ (2000) Gamma-aminobutyric acid-B receptors: first of the functional metabotropic heterodimers. J Pharmacol Exp Ther 292:2–7. Brooks-Kayal AR, Shumate MD, Jin H, Rikhter TY, Coulter DA (1998) Selective changes in single cell GABAA receptor subunit expression and function in temporal lobe epilepsy. Nat Med 4:1166 – 1172. Buhl EH, Otis TS, Mody I (1996) Zinc-induced collapse of augmented inhibition by GABA in a temporal lobe epilepsy model. Science 271:369 –373. Burnham WM, Niznik HB, Okazaki MM, Kish SJ (1983) Binding of [3H]flunitrazepam and [3H]Ro5-4864 to crude homogenates of amygdala-kindled rat brain: two months post-seizure. Brain Res 279:359 –362. Chandler KE, Princivalle AP, Fabian-Fine R, Bowery NG, Kullmann DM, Walker MC (2003) Plasticity of GABAB receptor-mediated heterosynaptic interactions at mossy fibers after status epilepticus. J Neurosci 23:11382–11391. Coggeshall RE, Lekan HA (1996) Methods for determining numbers of cells and synapses: a case for more uniform standards of review. J Comp Neurol 364:6 –15. Cossette P, Liu L, Brisebois K, Dong H, Lortie A, Vanasse M, SaintHilaire JM, Carmant L, Verner A, Lu WY, Wang YT, Rouleau GA (2002) Mutation of GABRA1 in an autosomal dominant form of juvenile myoclonic epilepsy. Nat Genet 31:184 –189. Couve A, Moss SJ, Pangalos MN (2000) GABAB receptors: a new paradigm in G protein signaling. Mol Cell Neurosci 16:296 –312. DeLorey TM, Handforth A, Anagnostaras SG, Homanics GE, Minassian BA, Asatourian A, Fanselow MS, Delgado-Escueta A, Ellison GD, Olsen RW (1998) Mice lacking the ␤3 subunit of the GABAA receptor have the epilepsy phenotype and many of the behavioral characteristics of Angelman syndrome. J Neurosci 18:8505– 8514. De Simoni MG, Perego C, Ravizza T, Moneta D, Conti M, Marchesi F, De Luigi A, Garattini S, Vezzani A (2000) Inflammatory cytokines and related genes are induced in the rat hippocampus by limbic status epilepticus. Eur J Neurosci 12:2623–2633. Dibbens LM, Feng HJ, Richards MC, Harkin LA, Hodgson BL, Scott D, Jenkins M, Petrou S, Sutherland GR, Scheffer IE, Berkovic SF, Macdonald RL, Mulley JC (2004) GABRD encoding a protein for extra- or peri-synaptic GABAA receptors is a susceptibility locus for generalized epilepsies. Hum Mol Genet 13:1315–1319. Franck JE, Kunkel DD, Baskin DG, Schwartzkroin PA (1988) Inhibition in kainate-lesioned hyperexcitable hippocampi: physiologic, autoradiographic, and immunocytochemical observations. J Neurosci 8:1991–2002. Friedman LK, Pellegrini-Giampietro DE, Sperber EF, Bennett MV, Moshe SL, Zukin RS (1994) Kainate-induced status epilepticus alters glutamate and GABAA receptor gene expression in adult rat hippocampus: an in situ hybridization study. J Neurosci 14: 2697–2707. Fritschy JM, Meskenaite V, Weinmann O, Honer M, Benke D, Mohler H (1999) GABAB-receptor splice variants GB1a and GB1b in rat brain: developmental regulation, cellular distribution and extrasynaptic localization. Eur J Neurosci 11:761–768.

Furtinger S, Bettler B, Sperk G (2003a) Altered expression of GABAB receptors in the hippocampus after kainic-acid-induced seizures in rats. Brain Res Mol Brain Res 113:107–115. Furtinger S, Pirker S, Czech T, Baumgartner C, Sperk G (2003b) Increased expression of gamma-aminobutyric acid type B receptors in the hippocampus of patients with temporal lobe epilepsy. Neurosci Lett 352:141–145. Gahwiler BH, Brown DA (1985) GABAB-receptor-activated K⫹ current in voltage-clamped CA3 pyramidal cells in hippocampal cultures. Proc Natl Acad Sci U S A 82:1558 –1562. Gambardella A, Manna I, Labate A, Chifari R, La Russa A, Serra P, Cittadella R, Bonavita S, Andreoli V, LePiane E, Sasanelli F, Di Costanzo A, Zappia M, Tedeschi G, Aguglia U, Quattrone A (2003) GABAB receptor 1 polymorphism (G1465A) is associated with temporal lobe epilepsy. Neurology 60:560 –563. Gibbs JW 3rd, Sombati S, DeLorenzo RJ, Coulter DA (1997) Physiological and pharmacological alterations in postsynaptic GABAA receptor function in a hippocampal culture model of chronic spontaneous seizures. J Neurophysiol 77:2139 –2152. Gobbi M, Gariboldi M, Piwko C, Hoyer D, Sperk G, Vezzani A (1998) Distinct changes in peptide YY binding to, and mRNA levels of, Y1 and Y2 receptors in the rat hippocampus associated with kindling epileptogenesis. J Neurochem 70:1615–1622. Harkin LA, Bowser DN, Dibbens LM, Singh R, Phillips F, Wallace RH, Richards MC, Williams DA, Mulley JC, Berkovic SF, Scheffer IE, Petrou S (2002) Truncation of the GABAA-receptor ␥2 subunit in a family with generalized epilepsy with febrile seizures plus. Am J Hum Genet 70:530 –536. Houser CR, Esclapez M (2003) Downregulation of the alpha5 subunit of the GABAA receptor in the pilocarpine model of temporal lobe epilepsy. Hippocampus 13:633– 645. Jechlinger M, Pelz R, Tretter V, Klausberger T, Sieghart W (1998) Subunit composition and quantitative importance of hetero-oligomeric receptors: GABAA receptors containing alpha6 subunits. J Neurosci 18:2449 –2457. Kamatchi GL, Kofuji P, Wang JB, Fernando JC, Liu Z, Mathura JR Jr, Burt DR (1995) GABAA receptor beta 1, beta 2, and beta 3 subunits: comparisons in DBA/2J and C57BL/6J mice. Biochim Biophys Acta 1261:134 –142. Kamphuis W, De Rijk TC, Lopes da Silva FH (1994) GABAA receptor beta 1–3 subunit gene expression in the hippocampus of kindled rats. Neurosci Lett 174:5– 8. Kamphuis W, De Rijk TC, Lopes da Silva FH (1995) Expression of GABAA receptor subunit mRNAs in hippocampal pyramidal and granular neurons in the kindling model of epileptogenesis: an in situ hybridization study. Mol Brain Res 31:33– 47. Kananura C, Haug K, Sander T, Runge U, Gu W, Hallmann K, Rebstock J, Heils A, Steinlein OK (2002) A splice-site mutation in GABRG2 associated with childhood absence epilepsy and febrile convulsions. Arch Neurol 59:1137–1141. Kapur J, Coulter DA (1995) Experimental status epilepticus alters gamma-aminobutyric acid type A receptor function in CA1 pyramidal neurons. Ann Neurol 38:893–900. Kapur J, MacDonald RL (1997) Rapid seizure-induced reduction of benzodiazepine and Zn2⫹ sensitivity of hippocampal dentate granule cell GABAA receptors. J Neurosci 17:7532–7540. Karle J, Woldbye DP, Diemer NH (2001) GABAA receptor antisense epilepsy: histological changes following infusion of antisense oligodeoxynucleotide to GABAA receptor gamma 2 subunit into rat hippocampus. Neurol Res 23:39 – 46. Kaupmann K, Schuler V, Mosbacher J, Bischoff S, Bittiger H, Heid J, Froestl W, Leonhard S, Pfaff T, Karschin A, Bettler B (1998) Human gamma-aminobutyric acid type B receptors are differentially expressed and regulate inwardly rectifying K⫹ channels. Proc Natl Acad Sci U S A 95:14991–14996. Klapstein GJ, Colmers WF (1992) 4-Aminopyridine and low Ca2⫹ differentiate presynaptic inhibition mediated by neuropeptide Y,

T. Nishimura et al. / Neuroscience 134 (2005) 691–704 baclofen and 2-chloroadenosine in rat hippocampal CA1 in vitro. Br J Pharmacol 105:470 – 474. Kokaia M, Pratt GD, Elmer E, Bengzon J, Fritschy J-M, Kokaia Z, Lindvall O, Möhler H (1994) Biphasic differential changes in GABAA receptor subunit mRNA levels in dentate gyrus granule cells following recurrent kindling-induced seizures. Mol Brain Res 23:323–332. Kokaia Z, Kokaia M (2001) Changes in GABAB receptor immunoreactivity after recurrent seizures in rats. Neurosci Lett 315:85– 88. Kralic JE, Korpi ER, O’Buckley TK, Homanics GE, Morrow AL (2002) Molecular and pharmacological characterization of GABA(A) receptor alpha1 subunit knockout mice. J Pharmacol Exp Ther 302:1037–1045. Lauren HB, Pitkanen A, Nissinen J, Soini SL, Korpi ER, Holopainen IE (2003) Selective changes in gamma-aminobutyric acid type A receptor subunits in the hippocampus in spontaneously seizing rats with chronic temporal lobe epilepsy. Neurosci Lett 349:58 – 62. Loup F, Wieser HG, Yonekawa Y, Aguzzi A, Fritschy JM (2000) Selective alterations in GABAA receptor subtypes in human temporal lobe epilepsy. J Neurosci 20:5401–5419. Mangan PS, Bertram EH 3rd (1997) Shortened-duration GABAA receptor-mediated synaptic potentials underlie enhanced CA1 excitability in a chronic model of temporal lobe epilepsy. Neuroscience 80:1101–1111. Mehta AK, Ticku MK (1999) An update on GABAA receptors. Brain Res Rev 29:196 –217. Mody I, De Koninck Y, Otis TS, Soltesz I (1994) Bridging the cleft at GABA synapses in the brain. Trends Neurosci 17:517–525. Munoz A, Arellano JI, DeFelipe J (2002) GABABR1 receptor protein expression in human mesial temporal cortex: changes in temporal lobe epilepsy. J Comp Neurol 449:166 –179. Nobrega JN, Kish SJ, Burnham WM (1989) Autoradiographic analysis of benzodiazepine binding in entorhinal-kindled rat brains. Brain Res 498:315–322. Nobrega JN, Kish SJ, Burnham WM (1990) Regional brain [3H]muscimol binding in kindled rat brain: A quantitative autoradiographic examination. Epilepsy Res 6:102–109. Noebels JL (2003) The biology of epilepsy genes. Annu Rev Neurosci 26:599 – 625. Nusser Z, Kay LM, Laurent G, Homanics GE, Mody I (2001) Disruption of GABA(A) receptors on GABAergic interneurons leads to increased oscillatory power in the olfactory bulb network. J Neurophysiol 86:2823–2833. Nusser Z, Mody I (2002) Selective modulation of tonic and phasic inhibitions in dentate gyrus granule cells. J Neurophysiol 87: 2624 –2628. Nusser Z, Sieghart W, Somogyi P (1998) Segregation of different GABAA receptors to synaptic and extrasynaptic membranes of cerebellar granule cells. J Neurosci 18:1693–1703. Otis TS, De Koninck Y, Mody I (1994) Lasting potentiation of inhibition is associated with an increased number of gamma-aminobutyric acid type A receptors activated during miniature inhibitory postsynaptic currents. Proc Natl Acad Sci U S A 91:7698 –7702. Paxinos G, Watson C (1998) The rat brain in stereotaxic coordinates. Sydney: Academic Press. Peng Z, Huang CS, Stell BM, Mody I, Houser CR (2004) Altered expression of the delta subunit of the GABAA receptor in a mouse model of temporal lobe epilepsy. J Neurosci 24:8629 – 8639. Pirker S, Schwarzer C, Czech T, Baumgartner C, Pockberger H, Maier H, Hauer B, Sieghart W, Furtinger S, Sperk G (2003) Increased expression of GABAA receptor beta-subunits in the hippocampus of patients with temporal lobe epilepsy. J Neuropathol Exp Neurol 62:820 – 834. Pirker S, Schwarzer C, Wieselthaler A, Sieghart W, Sperk G (2000) GABAA receptors: immunocytochemical distribution of 13 subunits in the adult rat brain. Neuroscience 101:815– 850. Princivalle AP, Duncan JS, Thom M, Bowery NG (2003) GABAB1a, GABAB1b AND GABAB2 mRNA variants expression in hippocam-

703

pus resected from patients with temporal lobe epilepsy. Neuroscience 122:975–984. Prosser HM, Gill CH, Hirst WD, Grau E, Robbins M, Calver A, Soffin EM, Farmer CE, Lanneau C, Gray J, Schenck E, Warmerdam BS, Clapham C, Reavill C, Rogers DC, Stean T, Upton N, Humphreys K, Randall A, Geppert M, Davies CH, Pangalos MN (2001) Epileptogenesis and enhanced prepulse inhibition in GABAB1-deficient mice. Mol Cell Neurosci 17:1059 –1070. Racine RJ (1972) Modification of seizure activity by electrical stimulation. II. Motor seizure. Electroencephalogr Clin Neurophysiol 32: 281–294. Rice A, Rafiq A, Shapiro SM, Jakoi ER, Coulter DA, DeLorenzo RJ (1996) Long-lasting reduction of inhibitory function and gammaaminobutyric acid type A receptor subunit mRNA expression in a model of temporal lobe epilepsy. Proc Natl Acad Sci U S A 93:9665–9669. Schofield PR, Darlison MG, Fujita N, Burt DR, Stephenson FA, Rodriguez H, Rhee LM, Ramachandran J, Reale V, Glencorse TA, et al. (1987) Sequence and functional expression of the GABA A receptor shows a ligand-gated receptor super-family. Nature 328:221– 227. Schuler V, Luscher C, Blanchet C, Klix N, Sansig G, Klebs K, Schmutz M, Heid J, Gentry C, Urban L, Fox A, Spooren W, Jaton AL, Vigouret J, Pozza M, Kelly PH, Mosbacher J, Froestl W, Kaslin E, Korn R, Bischoff S, Kaupmann K, van der Putten H, Bettler B (2001) Epilepsy, hyperalgesia, impaired memory, and loss of preand postsynaptic GABAB responses in mice lacking GABAB1. Neuron 31:47–58. Schwarzer C, Sperk G (1995) Hippocampal granule cells express glutamic acid decarboxylase-67 after limbic seizures in the rat. Neuroscience 69:705–709. Schwarzer C, Sperk G, Samanin R, Rizzi M, Gariboldi M, Vezzani A (1996) Neuropeptide-immunoreactivity and their mRNA expression in kindling: functional implications for limbic epileptogenesis. Brain Res Rev 22:27–50. Schwarzer C, Tsunashima K, Wanzenbock C, Fuchs K, Sieghart W, Sperk G (1997) GABAA receptor subunits in the rat hippocampus II: altered distribution in kainic acid-induced temporal lobe epilepsy. Neuroscience 80:1001–1017. Schwarzer C, Williamson JM, Lothman EW, Vezzani A, Sperk G (1995) Somatostatin, neuropeptide Y, neurokinin B and cholecystokinin immunoreactivity in two chronic models of temporal lobe epilepsy. Neuroscience 69:831– 845. Shin C, Pedersen HB, McNamara JO (1985) gamma-Aminobutyric acid and benzodiazepine receptors in the kindling model of epilepsy: a quantitative radiohistochemical study. J Neurosci 5: 2696 –2701. Sieghart W (1995) Structure and pharmacology of ␥-aminobutyric acidA receptor subtypes. Pharmacol Rev 47:181–234. Sieghart W, Sperk G (2002) Subunit composition, distribution and function of GABA(A) receptor subtypes. Curr Top Med Chem 2:795– 816. Sloviter RS, Damiano BP (1981) On the relationship between kainic acid-induced epileptiform activity and hippocampal neuronal damage. Neuropharmacology 20:1003–1011. Sperk G, Furtinger S, Schwarzer C, Pirker S (2003) GABA and its receptors in epilepsy. In: Recent advances in epilepsy (Scharfman HE, Binder K, eds), pp 92–103. New York: Kluwer Academic/ Plenum Publishers and Landes Bioscience/Eurekah.com Sperk G, Schwarzer C, Tsunashima K, Fuchs K, Sieghart W (1997) GABAA receptor subunits in the rat hippocampus I: Immunocytochemical distribution of 13 subunits. Neuroscience 80:987–1000. Stell BM, Brickley SG, Tang CY, Farrant M, Mody I (2003) Neuroactive steroids reduce neuronal excitability by selectively enhancing tonic inhibition mediated by delta subunit-containing GABAA receptors. Proc Natl Acad Sci U S A 100:14439 –14444. Straessle A, Loup F, Arabadzisz D, Ohning GV, Fritschy JM (2003) Rapid and long-term alterations of hippocampal GABAB receptors

704

T. Nishimura et al. / Neuroscience 134 (2005) 691–704

in a mouse model of temporal lobe epilepsy. Eur J Neurosci 18:2213–2226. Sugimoto T, Yasuhara A, Ohta T, Nishida N, Saitoh S, Hamabe J, Niikawa N (1992) Angelman syndrome in three siblings: Characteristic epileptic seizures and EEG abnormalities. Epilepsia 33: 1078 –1082. Sur C, Farrar SJ, Kerby J, Whiting PJ, Atack JR, McKernan RM (1999) Preferential coassembly of alpha4 and delta subunits of the gamma-aminobutyric acidA receptor in rat thalamus. Mol Pharmacol 56:110 –115. Szabo G, Kartarova Z, Hoertnagl B, Somogyi R, Sperk G (2000) Differential regulation of adult and embryonic glutamate decarboxylases in rat dentate granule cells after kainate-induced limbic seizures. Neuroscience 100:287–295. Takahashi T, Kajikawa Y, Tsujimoto T (1998) G-protein-coupled modulation of presynaptic calcium currents and transmitter release by a GABAB receptor. J Neurosci 18:3138 –3146. Titulaer MN, Ghijsen WE, Kamphuis W, De Rijk TC, Lopes da Silva FH (1995a) Opposite changes in GABAA receptor function in the CA1-3 area and fascia dentata of kindled rat hippocampus. J Neurochem 64:2615–2621. Titulaer MN, Kamphuis W, Lopes da Silva FH (1995b) Autoradiographic analysis of [35S]t-butylbicyclophosphorothionate binding in kindled rat hippocampus shows different changes in CA1 area and fascia dentata. Neuroscience 66:547–554. Titulaer MN, Kamphuis W, Lopes da Silva FH (1995c) Long-term and regional specific changes in [3H]flunitrazepam binding in kindled rat hippocampus. Neuroscience 68:399 – 406. Titulaer MN, Kamphuis W, Pool CW, van Heerikhuize JJ, Lopes da Silva FH (1994) Kindling induces time-dependent and regional specific

changes in the [3H]muscimol binding in the rat hippocampus: A quantitative autoradiographic study. Neuroscience 59:817–826. Tretter V, Ehya N, Fuchs K, Sieghart W (1997) Stoichiometry and assembly of a recombinant GABAA receptor subtype. J Neurosci 17:2728 –2737. Tsunashima K, Schwarzer C, Kirchmair E, Sieghart W, Sperk G (1997) GABAA receptor subunits in the rat hippocampus III: altered messenger RNA expression in kainic acid-induced epilepsy. Neuroscience 80:1019 –1032. Wallace RH, Marini C, Petrou S, Harkin LA, Bowser DN, Panchal RG, Williams DA, Sutherland GR, Mulley JC, Scheffer IE, Berkovic SF (2001) Mutant GABAA receptor ␥2-subunit in childhood absence epilepsy and febrile seizures. Nat Genet 28:49 –52. White JH, Wise A, Main MJ, Green A, Fraser NJ, Disney GH, Barnes AA, Emson P, Foord SM, Marshall FH (1998) Heterodimerization is required for the formation of a functional GABAB receptor. Nature 396:679 – 682. Wisden W, Laurie DJ, Monyer H, Seeburg PH (1992) The distribution of 13 GABAA receptor subunit mRNAs in the rat brain. I. Telencephalon, diencephalon, mesencephalon. J Neurosci 12:1040 – 1062. Wolf HK, Spanle M, Muller MB, Elger CE, Schramm J, Wiestler OD (1994) Hippocampal loss of the GABAA receptor ␣1 subunit in patients with chronic pharmacoresistant epilepsies. Acta Neuropathol 88:313–319. Wood JD (1975) The role of gamma-aminobutyric acid in the mechanism of seizures. Prog Neurobiol 5:77–95. Zhang G, Raol YH, Hsu FC, Coulter DA, Brooks-Kayal AR (2004) Effects of status epilepticus on hippocampal GABAA receptors are age-dependent. Neuroscience 125:299 –303.

(Accepted 1 April 2005) (Available online 13 June 2005)