- Email: [email protected]
Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
BBRC Biochemical and Biophysical Research Communications 322 (2004) 403–410 www.elsevier.com/locate/ybbrc
Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells Katsumi Kasashimaa,b, Yoshikazu Nakamurab, Tomoko Kozua,* a
b
Research Institute for Clinical Oncology, Saitama Cancer Center, Ina, Saitama 362-0806, Japan Department of Basic Medical Sciences, Institute of Medical Science, University of Tokyo, Shirokanedai, Minato-ku, Tokyo 108-8639, Japan Received 20 April 2004
Abstract MicroRNAs (miRNAs) are highly conserved small non-coding RNAs that regulate gene expression through translational repression by base-pairing with partially complementary mRNAs. The expression of a set of miRNAs is known to be regulated developmentally and spatially, and is involved in differentiation or cell proliferation in several organisms. However, the expression profiles of human miRNAs during cell differentiation remain largely unknown. In an effort to expand our knowledge of human miRNAs, we investigated miRNAs during 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced differentiation of human leukemia cells (HL-60) into monocyte/macrophage-like cells. Several hundred RNAs ranging from 18 to 26 nucleotides were isolated from HL-60 cells with or without TPA-induction, and subsequently characterized by sequencing, database searching, and expression profiling. By removing non-miRNA sequences, we found three novel and 38 known miRNAs expressed in HL-60 cells. These miRNAs could be further classified into subsets of miRNAs that responded differently following TPA induction, either being up-regulated or down-regulated, suggesting the importance of regulated gene expression via miRNAs in the differentiation of HL-60 cells. 2004 Elsevier Inc. All rights reserved. Keywords: MicroRNA; Differentiation; HL-60; TPA; Leukemia
MicroRNAs (miRNAs) have recently been identified as small non-coding RNAs (ca. 22 nucleotides long) that were previously referred to as small temporal RNAs (stRNAs) such as let-7 and lin-4 in Caenorhabditis elegans [1–5]. let-7 and lin-4 RNA are thought to pair with partially complementary sequences in the 3 0 untranslated region (UTR) of target mRNAs and repress their translation by a yet unknown mechanism [1,6]. This type of translational repression is crucial in the developmental timing of C. elegans. miRNAs are produced by Dicer (for double-stranded RNA endoribonuclease) from a foldback hairpin precursor transcript [7], and the resultant mature miRNAs are incorporated into RISC (RNA-induced silencing complex) for subsequent targeting to mRNAs. Small interfer*
Corresponding author. Fax: +81 48 722 1739. E-mail address: [email protected] (T. Kozu).
0006-291X/$ - see front matter 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.07.130
ing RNAs (siRNAs) are similar small RNAs processed by Dicer from long double-stranded RNAs [8], and are also incorporated into RISC as guide RNAs to mRNA. Although they share a similar complex for gene silencing, the output differs; miRNAs repress mRNA translation, whereas siRNAs degrade the target mRNA. The distinct complementarity with their target mRNAs, represented by either the partial complementarity of miRNA or the perfect complementarity of siRNA, is considered to be a main reason that accounts for their different action in relation to gene silencing [9,10]. To date, a large number of miRNAs have been identified in several organisms, including vertebrates and plants [11–14]. The expression of some miRNAs is regulated in a developmental and spatial manner, and the importance of miRNAs for development, cell proliferation, cell death, and morphogenesis has been demonstrated in C. elegans, Drosophila melanogaster, and
404
K. Kasashima et al. / Biochemical and Biophysical Research Communications 322 (2004) 403–410
Arabidopsis thaliana [15–17]. In vertebrates, embryonic stem (ES) cell-specific miRNAs and miRNAs expressed in hematopoietic lineage cells have been cloned from mouse [18,19]. One of these miRNAs, miR-181, was demonstrated to increase B-lineage cells when ectopically expressed in hematopoietic stem/progenitor cells, and indicated the involvement of this miRNA in differentiation [19]. Recently, expression profiling of a set of rat miRNAs in developing brain and miRNAs associated with polysomes in rat cortical neurons was determined, and suggested the involvement of certain miRNAs in brain development [20,21]. Two previous reports in the literature have indicated the involvement of miRNAs in human cancer. One report described a frequent loss of miR-15 and miR-16 in chronic lymphocytic leukemia (CLL) [22], while the other described the specific reduction of certain miRNAs in cancer cells [23]. The precise mechanism of regulated gene expression by miRNAs in mammals and the expression profile of human miRNAs associated with differentiation remain largely unknown. As a first step toward the understanding of regulated gene expression by miRNAs during cell differentiation, we studied the expression profile of miRNAs during 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced differentiation of HL-60 cells. HL-60 is a human promyelocytic leukemia cell line and one of the best studied models of cell differentiation. TPA can induce differentiation of these cells to monocyte/macrophagelike cells through the activation of protein kinase Cb [24,25]. Induction of terminal differentiation is also associated with the activation of stress-activated protein kinase, release of cytochrome c, activation of caspases, and ultimately the induction of apoptosis [26,27]. The expression of several genes including various transcription factors and cytokines is known to be altered during differentiation [28]. In this study, we systemically cloned small RNAs that were expressed during TPA-induced differentiation of HL-60 cells. We identified many miRNAs including known and novel sequences in HL-60 cells and, most interestingly, the expression of certain miRNAs responded quite differently to TPA treatment, either being up-regulated or down-regulated following TPA induction. These results suggest the importance of post-transcriptional regulation of gene expression via miRNAs during terminal differentiation of HL-60 cells.
Materials and methods Cell culture. HL-60, HeLa, and Kasumi-1 cells were grown in RPMI1640 supplemented with 10% FBS. For the differentiation assay, HL-60 cells were seeded at a density of 0.2 · 106 cells/ml and treated with TPA (Sigma Chemical) for 0, 0.5, 3, 6, 12, 24, or 48 h at a final concentration of 16 nM.
RNA extraction and cloning of small RNAs. Total RNA from cultured cells was extracted using ISOGEN (Nippon Gene) according to the manufacturerÕs instructions. Small RNAs were cloned as described by Elbashir et al. [29] with some modifications. Briefly, 50 lg of total RNA was separated on a denaturing 16% polyacrylamide gel and gel slices containing small RNAs consisting of ca. 18–26 nucleotides in length were excised. The small RNAs were then eluted into 0.3 M NaCl at 4 C overnight and recovered by phenol/chloroform extraction followed by ethanol precipitation. The RNA was dephosphorylated using 1 U alkaline phosphatase (Roche) for 30 min at 50 C, and the reaction was stopped by phenol/chloroform extraction. A 5 0 phosphorylated 3 0 adapter oligonucleotide (5 0 -UUUaaccgcatccttctc-3 0 : uppercase, RNA; lowercase, DNA; Dharmacon Research) with 3 0 modification of inverted deoxythymidine (idT) was ligated to the RNA using 20 U T4 RNA ligase (Amersham Bioscience), and the ligated product was subsequently purified using a denaturing 10% polyacrylamide gel. The ligated product was then 5 0 phosphorylated using 10 U T4 polynucleotide kinase (Takara) and purified by phenol/chloroform extraction and subsequent ethanol precipitation. A 5 0 adapter oligonucleotide (5 0 -tactaatacgactcactAAA: uppercase, RNA; lowercase, DNA; Dharmacon Research) was ligated to the phosphorylated ligation product as described above. The new ligation product was gelpurified, and RT-PCR was performed using ReverTra Ace (TOYOBO) and RT-primer (5 0 -GACTAGCTGGAATTCAAGGATGCGGTTA AA-3 0 ). RT-PCR was followed by PCR using a 5 0 primer (5 0 -CAGC CAACGGAATTCATACGACTCACTAAA-3 0 ) and the RT-primer. The PCR product was then digested with EcoRI and concatenated using T4 DNA ligase (Roche). Concatamers consisting of a size range of 200–800 bp were separated on a 1.5% low-melting agarose gel and recovered by phenol extraction and ethanol precipitation. The unpaired ends were filled using Taq polymerase at 72 C for 10 min, and the DNA fragment was directly subcloned into pGEM-T vector (Promega). Colony PCR was performed using M13 forward and reverse primers, and PCR products over 200 bp in length were sequenced directly. Northern blotting. Northern blotting of miRNAs was performed as described [30]. Briefly, 30 lg of total RNA was separated on a denaturing 15% polyacrylamide gel and then electroblotted onto a ZetaProbe GT membrane (BioRad). Following transfer, the membrane was dried and UV-crosslinked. The oligonucleotide probes used were 5 0 labeled using T4 polynucleotide kinase and [c-32P]ATP, and subsequently hybridized to the membrane overnight at 42 C in 7% SDS and 0.2 M Na2PO4 (pH 7.0). The hybridized membrane was washed several times with 2· SSC, 0.1% SDS. The blot was exposed on an imaging plate and the signals were detected using a Fluorescent Image Analyzer FLA-3000 (FUJIFILM). U6 snRNA was used as an internal control for the Northern blotting and detected using a U6 probe (5 0 GCCATGCTAATCTTCTCTGTATC-3 0 ). RT-PCR. Reverse transcription was performed using 3 lg of total RNA and random 9-mer primer with (+) or without () reverse transcriptase. The miRNA23-24 cluster was amplified using the following primers; forward: 5 0 -ATCACATTGCCAGGGATTTCCAAC-3 0 , reverse: 5 0 -CTGTTCCTGCTGAACTGAGCCA-3 0 .
Results and discussion For the cloning of human miRNAs related to differentiation, we employed the well-established in vitro differentiation system utilizing human myeloid leukemia cells, HL-60. TPA can efficiently induce terminal differentiation of HL-60 cells into a monocyte/macrophagelike phenotype. During the course of these investigations we confirmed that over 80% of HL-60 cells displayed
K. Kasashima et al. / Biochemical and Biophysical Research Communications 322 (2004) 403–410
growth arrest and an adherent phenotype that is characteristic of macrophage-like cells (Fig. 1). Following the isolation of total RNA from cells treated (+) or not treated () with TPA, small RNAs consisting of 18–26 nucleotides in length were then obtained by gel purification. Employing the ligation-mediated method [29], small RNAs from TPA (+) and TPA () cells were amplified by RT-PCR and subcloned into a T-vector. In total, 252 and 359 independent clones were isolated from TPA () and TPA (+) cells, respectively, which were subsequently characterized by sequencing and database searching. Results indicated the presence of several kinds of cellular RNA fragments in the library (Table 1). Over one half of the cloned RNAs represented breakdown products of abundant non-coding RNAs such as rRNA, snRNA, snoRNA, and tRNA. The frequency of rRNAs in the TPA (+) library was ca. 2.5-fold higher than that in the TPA () library. We assumed that this was probably due to apoptosis triggered by TPA. Accordingly, the frequency of miRNAs in the TPA (+) library (23.7%) was lower than that of the TPA () library (37.3%). It should be noted, however,
Fig. 1. TPA-induced monocytic differentiation of HL-60 cells. HL-60 cells were incubated in the absence (left panel) or presence (right panel) of 16 nM TPA for 48 h.
Table 1 Small RNAs cloned from TPA treated (+) or untreated () HL60 cells RNA type
Number of isolates TPA ()
miRNA rRNA mRNA snRNA snoRNA tRNA Non-coding cytoplasmic RNA Match with genomea Mitochondrial RNAb Unknown Total a
TPA (+)
94 66 2 10 3 22 0 19 5 31
85 163 5 20 4 8 5 9 17 43
252
359
Sequences that did not form a miRNA-specific hairpin precursor but matched with genomic sequences. b Sequences that did not match with any known sequence.
405
that these frequencies may not necessarily reflect the actual amount of miRNAs in each sample. We identified 94 clones from TPA () and 85 clones from TPA (+) as miRNAs that included known and newly predicted miRNA sequences (Table 1). Of these, 69 clones from TPA () and 69 clones from TPA (+) corresponded to 28 and 24 species of known human miRNAs, respectively (Table 2). The remaining unknown 25 clones from TPA () and 16 clones from TPA (+) contained four newly predicted miRNAs (Table 3). The most abundant clones, 23 from TPA () and 11 from TPA (+), did not match any known miRNAs although identical sequences exist in human chromosomes 3, 5, and 11, and in mouse EST (AK045690). The identical 22-nucleotide sequence on human chromosome 5 (AC022100) is located within a
Table 2 Number of known miRNA isolates from non-induced and TPAinduced HL-60 cells miRNA
TPA ()
TPA (+)
let-7a let-7b let-7d let-7e let-7f miR-15 miR-16 miR-17-5pa miR-17-3pa miR-18 miR-19b miR-20 miR-21 miR-23 miR-24 miR-25 miR-26a miR-26b miR-27 miR-29 miR-29c miR-30a(5p)a miR-30-3pa miR-30c miR-30e miR-92 miR-93 miR-101 miR-124a miR-128 miR-142-5pa miR-142-3pa miR-155 miR-191 miR-221 miR-222 miR-320 miR-339
1 2 3 0 0 5 1 5 0 2 1 1 1 1 0 1 2 1 8 1 0 1 1 1 0 2 1 1 0 1 13 6 0 1 1 0 4 0
3 0 0 1 1 2 0 1 1 0 0 0 12 3 6 1 4 2 10 0 1 0 0 0 1 1 0 0 2 0 9 1 1 0 1 3 1 1
a
-5p and -3p represent the 5 0 arm and 3 0 arm of the same hairpin precursor.
406
K. Kasashima et al. / Biochemical and Biophysical Research Communications 322 (2004) 403–410
Table 3 Novel miRNAs identified in this study miRNA
Number of clones TPA ()
TPA (+)
miR-422b (AC022100) miR-422a (AC015914) miR-423 (AC104984) miR-30e-3p (AL354914) miR-424 (AC004383)
23 0 1 0 1
11 0 0 2 3
a b c d
Sequence (5 0 –3 0 )
Size (nt)
Northern blotting
Hairpin precursors
Location
CUGGACUUGGAGUCAGAAGGCC CUGGACUUAGGGUCAGAAGGCCc AGCUCGGUCUGAGGCCCCUCAG CUUUCAGUCGGAUGUUUACAGC CAGCAGCAAUUCAUGUUUUGAA
22–21 22 22 22 22–21
+ NDd + ND +
H.s.a, M.m.b H.s. H.s., M.m. H.s., M.m. H.s., M.m.
Chromosome Chromosome Chromosome Chromosome Chromosome
5 15 17 1 X
Homo sapiens. Mus musculus. Underlined nucleotides represent identical nucleotides with miR-422b. Not determined.
typical hairpin consisting of ca. 70 nucleotides in length as folded by Mfold [31], which seems to be characteristic for miRNA precursors and is conserved in the mouse sequence (Table 4). The other identical sequences on human chromosomes 3 and 11 are not located within the typical hairpin structure. Therefore, the sequence on human chromosome 5 seemed to be a novel miRNA. Additionally, it was found through homology searching that a similar sequence to the miRNA located in the human genome (AC015914) differs by only two nucleotides to the miRNA and also forms a hairpin precursor structure (Table 4). According to the miRNA registration rule [32], these sequences appeared to belong to the same family and were designated as miR-422b and miR-422a,
Table 4 The predicted hairpin precursor structures of the novel miRNAs by Mfold
Underlined bases represent the mature miRNA sequences.
respectively. Two other novel species were also identified that form hairpin structures that were well conserved between human and mouse (Table 4), and were designated as the novel miRNAs, miR-423, and miR-424. The human miR-424 sequence differs by only one nucleotide when compared to the mouse sequence, and both of them are encoded on their respective X chromosome. These sequences are likely to represent miRNAs of the same family rather than orthologs, since mature sequences of known miRNAs have been perfectly conserved between human and mouse. Moreover, we found another sequence on human chromosome 1 that differed by only one nucleotide when compared to the known miRNA, miR-30a (on chromosome 6). Since this sequence origi-
K. Kasashima et al. / Biochemical and Biophysical Research Communications 322 (2004) 403–410
nates from the 3 0 arm of the hairpin precursor of miR30e, this was designated as miR-30e-3p. The miRNAs cloned in this study displayed different frequencies when the TPA () and TPA (+) libraries were compared (Tables 2 and 3). One could assume that these frequencies might be correlated to the de novo appearance of miRNAs. Northern blot analysis was performed in an effort to verify whether this difference reflected the actual expression profile of miRNAs in HL-60 cells. At first, the expression of the novel miRNAs, miR-422b and miR-424, was monitored. Both miRNAs were detected as bands corresponding to 22 nucleotides in size as determined by Northern blotting (Fig. 2A), however the expression patterns differed. miR-422b was detected almost equally in the TPA () and the TPA (+) samples, and also detected in the human leukemia cell line K562, and in Kasumi-1 cells (Fig. 2A). Although the frequency of miR-422b in the library was high (ca. 19% of total miRNA clones), the overall de novo expression level of miR-422b was relatively low, indicating that the cloning frequency might not always reflect the de novo level of miRNA in each sample. On the other hand, miR-424 was mainly detected in the TPA (+) sample, while very little, if any, was detected in the TPA () sample or in K562 or Kasumi-1 cells. Therefore, miRNA-424 seems to be specifically associated with TPA-induced differentiation. Furthermore, miR-422b and miR-424 were not detected in HeLa cells. The presence of genomic sequences within the HeLa genome that would encode miR-422b and miR-424 was confirmed by genomic PCR (data not shown), and suggested that these miRNAs are specifically expressed in blood cell lineages and play specific roles in the lineages. The expression profile of other miRNAs was determined by Northern blotting. Reduced expression of miR-17-5p, miR-142-5p, miR-142-3p, and miR-320 was observed in the TPA (+) sample (Fig. 2A), which was consistent with the cloning frequency (Table 2). miR-142-5p and miR-142-3p displayed very similar expression profiles, although the amount of miR-1423p expressed was lower than that of miR-142-5p. Since miR-142-5p and miR-142-3p are present on the same precursor transcript, it was not unexpected that their expression profiles were similar. The lower expression of miR-142-3p compared to miR-142-5p might have resulted due to the asymmetry rule of miRNA/siRNA, where one of the miRNA/siRNA strands is more stable and hence more efficiently incorporated into RISC, while the other strand is unstable [33]. Just as was the case with miR-422b and miR-424, miRNA-142-5p and -3p were not expressed in HeLa cells (Fig. 2A). Considering that the homologous miRNA of mouse (miRNA-142-5p) was expressed in hematopoietic lineage cells [19], this miRNA might also be specific for blood cell lineages. A set of miRNAs containing miR-21, miR-23, miR24, and miR-27a displayed increased expression in the
407
Fig. 2. Expression profiles of representative miRNAs during TPAinduced differentiation. (A) Expression levels of the indicated miRNAs in several human cells were investigated by Northern blotting. K562 and Kasumi-1 cells are human leukemia cell lines. As a loading control, RNAs including 5S rRNA and tRNAs were stained with ethidium bromide (EtBr). (B) Schematic representation of previously reported gene clusters for the indicated miRNAs. Arrows represent PCR primers for amplification of the 327 bp RNA fragment containing miR-23, miR-27a, and miR-24. (C) The RNA fragment (miR-2324) was amplified in the TPA (+/) samples by semi-quantitative RT-PCR. As controls, reverse transcriptase was omitted (RT ()) and GAPDH was amplified.
TPA (+) sample (Fig. 2A), which was consistent with the cloning frequency (Table 2). Of these, miR-21 was significantly up-regulated in the TPA (+) sample. It was recently reported that in mouse embryonic stem (ES) cells, the expression of miR-21 dramatically increased following retinoic-acid (RA)-induced differentiation [18]. These results suggested that up-regulation of miR-21 might play a general role in cell differentiation by targeting certain general factors crucial for differentiation. The remaining miRNAs, miR-23, miR-24, and miR-27a, displayed a similar expression profile to that
408
K. Kasashima et al. / Biochemical and Biophysical Research Communications 322 (2004) 403–410
of miR-21, i.e., a high level of expression in the TPA (+) sample and in HeLa cells. However, unlike miR21, they were only weakly expressed in K562 cells (Fig. 2A). These three miRNA sequences are known to be clustered in chromosome 19 and are likely to be processed from a single precursor transcript (Fig. 2B) [3]. Therefore, it was conceivable that increased expression of this polycistronic transcript by TPA might result in the simultaneous induction of these miRNAs. This possibility was tested directly by application of semi-quantitative RT-PCR analysis. As shown in Fig. 2C, the transcript containing miRNA-
23-27a-24 was detected and the expression of which increased following TPA induction of HL-60 cells (Fig. 2C). As further support of this possibility, other known clustered miR-15 and miR-16 sequences (Fig. 2B) displayed a similar expression pattern (Fig. 2A). Considering that several miRNAs are expressed as a clustered sequence unit, it is possible that the expressions of other miRNAs are simultaneously affected by TPA-induced transcriptional regulation. Further, Northern blot analysis was performed at several time points following TPA-induction in an effort to examine the precise expression profiles of the miR-
Fig. 3. Expression profiles of representative miRNAs at various time points following TPA-induction. (A) Expressions levels of the indicated miRNAs in HL-60 cells induced by TPA for 0, 0.5, 3, 6, 12, 24 or 48 h were investigated by Northern blotting. Each column shows the results obtained using the same membrane. U6 snRNA was used as an internal control. Expression levels of each miRNAs were normalized by against U6 snRNA levels. (B) Up-regulated miRNAs 48 h following TPA-induction compared to that of the start point (0 h). Horizontal axis shows time (hours) following TPA-induction. Longitudinal axis represents -fold expression levels of each miRNA, where the expression level of these at 0 h was defined as 1. (C) Down-regulated miRNAs 48 h following TPA-induction compared to that of the start point (0 h). The horizontal and longitudinal axes were the same as described above.
K. Kasashima et al. / Biochemical and Biophysical Research Communications 322 (2004) 403–410
NAs tested above, including additional miRNAs known to be involved in the hematopoietic lineage in mouse (Fig. 3A). By comparison of the expression level at 48 h relative to that of the start point (0 h), the miRNAs were classified into two groups, being up-regulated (Fig. 3B) or down-regulated (Fig. 3C). As shown in Fig. 3B, most of the up-regulated miRNAs increased at a later stage during TPA-induction. In particular, significant up-regulation of miR-21 was observed 24 h following TPA-induction. Therefore, these miRNAs might be involved in the regulation of later, as opposed to early, responsive genes during TPA-induced differentiation. On the contrary, all the down-regulated miRNAs showed mutually similar expression profiles, where expression levels increased at the early stage (0.5 h) and then decreased at the late stage (24–48 h) (Fig. 3C). In the case of miR-17-5p and miR-142-5p, these increased again at 6 h, suggesting a biphasic expression pattern. The observed miRNA expression pattern might play a role in the temporal regulation of gene expression, such as with early responsive genes and/or secondary responsive genes. Interestingly, miR-142-5p, miR181a, and miR-223, which are hematopoietic lineage specific miRNAs in mouse, and miR-15 and miR-16, lost frequently in CLL, were classified into the ÔdownregulatedÕ group. Down-regulation of these miRNAs following temporal up-regulation might be important in the terminal differentiation of HL-60 cells. It has been suggested that the loss or down-regulation of certain miRNAs is closely related to the development of particular human cancers [22,23,34], suggesting that appropriate expression of miRNAs is important for normal cell differentiation and development. In fact, a recent study of expression profiles of human miRNAs in several organs has indicated the close relationship between the expression of certain miRNAs and neuronal differentiation [35]. Therefore, the expression of a subset of miRNAs that leads to gene silencing of target sequences is considered to be an important process during cellular differentiation. In this study, it was found that the expression of a group of miRNAs including miR-21, miR-23, miR-24, and miR-27a increased during TPA-induced differentiation, and suggested their importance in relation to monocytic differentiation of HL-60 cells. In addition to the presence of up-regulation, certain miRNAs such as miR17-5p, miR-142-5p, miR-142-3p, and miR-320 were down-regulated following TPA treatment. Therefore, one might argue that miRNA-induced control of cell differentiation consists of two mechanisms, one concerning gene silencing by up-regulated miRNAs and the other concerning gene activation by terminating miRNA-catalyzed gene silencing. A program, TargetScan, has been developed that predicts mammalian miRNA targets [36]. This program is based on the conserved pairing of the miRNA
409
5 0 region with the target mRNA 3 0 UTR. According to this program, one miRNA could have 1–10 putative targets. Actually, many genes have been predicted as potential targets for the miRNAs associated to TPA-induced differentiation in this study (data not shown). In the case of miR-21, however, no target gene was predicted by TargetScan. This suggested that although pairing sequences with miR-21 may not exist within the 3 0 UTR of potential target mRNAs, they may exist within other regions such as in the 5 0 UTR or coding regions. Identification of mRNAs targeted by miR-21 is essential to further our understanding of cell differentiation and its relation to the mechanism of miRNA action. In summary, the expression of many miRNAs including known and novel sequences was regulated during TPA-induced differentiation of HL-60 cells. Both upregulated or down-regulated expression patterns were observed, depending on the miRNA species in question. Although the precise mechanism concerning this regulation remains unknown, we suggested that the miRNAs examined in this study play an important role in cell differentiation.
Acknowledgments We would like to express our gratitude to Ms. Eri Sakota and Ms. Miho Matsuda for technical assistance, and to Dr. Megumi Sumitani for technical advice. This work was supported by Grants-in-Aid for Scientific Research on Priority Areas from Ministry of Education, Culture, Sports, Science and Technology of Japan (14035253).
References [1] B.J. Reinhart, F.J. Slack, M. Basson, A.E. Pasquinelli, J.C. Bettinger, A.E. Rougvie, H.R. Horvitz, G. Ruvkun, The 21nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans, Nature 403 (2000) 901–906. [2] A.E. Pasquinelli, B.J. Reinhart, F. Slack, M.Q. Martindale, M.I. Kuroda, B. Maller, D.C. Hayward, E.E. Ball, B. Degnan, P. Muller, J. Spring, A. Srinivasan, M. Fishman, J. Finnerty, J. Corbo, M. Levine, P. Leahy, E. Davidson, G. Ruvkun, Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA, Nature 408 (2000) 86–89. [3] M. Lagos-Quintana, R. Rauhut, W. Lendeckel, T. Tuschl, Identification of novel genes coding for small expressed RNAs, Science 294 (2001) 853–858. [4] N.C. Lau, L.P. Lim, E.G. Weinstein, D.P. Bartel, An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans, Science 294 (2001) 858–862. [5] R.C. Lee, V. Ambros, An extensive class of small RNAs in Caenorhabditis elegans, Science 294 (2001) 862–864. [6] M.C. Vella, E.Y. Choi, S.Y. Lin, K. Reinert, F.J. Slack, The C. elegans microRNA let-7 binds to imperfect let-7 complementary sites from the lin-41 3 0 UTR, Genes Dev. 18 (2004) 132–137.
410
K. Kasashima et al. / Biochemical and Biophysical Research Communications 322 (2004) 403–410
[7] G. Hutvagner, J. McLachlan, A.E. Pasquinelli, E. Balint, T. Tuschl, P.D. Zamore, A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA, Science 293 (2001) 834–838. [8] S.W. Knight, B.L. Bass, A role for the RNase III enzyme DCR-1 in RNA interference and germ line development in Caenorhabditis elegans, Science 293 (2001) 2269–2271. [9] J.G. Doench, C.P. Petersen, P.A. Sharp, siRNAs can function as miRNAs, Genes Dev. 17 (2003) 438–442. [10] Y. Zeng, R. Yi, B.R. Cullen, MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms, Proc. Natl. Acad. Sci. USA 100 (2003) 9779–9784. [11] B.J. Reinhart, E.G. Weinstein, M.W. Rhoades, B. Bartel, D.P. Bartel, MicroRNAs in plants, Genes Dev. 16 (2002) 1616–1626. [12] L.P. Lim, N.C. Lau, E.G. Weinstein, A. Abdelhakim, S. Yekta, M.W. Rhoades, C.B. Burge, D.P. Bartel, The microRNAs of Caenorhabditis elegans, Genes Dev. 17 (2003) 991–1008. [13] L.P. Lim, M.E. Glasner, S. Yekta, C.B. Burge, D.P. Bartel, Vertebrate microRNA genes, Science 299 (2003) 1540. [14] A.A. Aravin, M. Lagos-Quintana, A. Yalcin, M. Zavolan, D. Marks, B. Snyder, T. Gaasterland, J. Meyer, T. Tuschl, The small RNA profile during Drosophila melanogaster development, Dev. Cell 5 (2003) 337–350. [15] V. Ambros, MicroRNA pathways in flies and worms: growth, death, fat, stress, and timing, Cell 113 (2003) 673–676. [16] J.C. Carrington, V. Ambros, Role of microRNAs in plant and animal development, Science 301 (2003) 336–338. [17] D.P. Bartel, MicroRNAs: genomics, biogenesis, mechanism, and function, Cell 116 (2004) 281–297. [18] H.B. Houbaviy, M.F. Murray, P.A. Sharp, Embryonic stem cellspecific MicroRNAs, Dev. Cell 5 (2003) 351–358. [19] C.Z. Chen, L. Li, H.F. Lodish, D.P. Bartel, MicroRNAs modulate hematopoietic lineage differentiation, Science 303 (2004) 83–86. [20] A.M. Krichevsky, K.S. King, C.P. Donahue, K. Khrapko, K.S. Kosik, A microRNA array reveals extensive regulation of microRNAs during brain development, RNA 9 (2003) 1274–1281. [21] J. Kim, A. Krichevsky, Y. Grad, G.D. Hayes, K.S. Kosik, G.M. Church, G. Ruvkun, Identification of many microRNAs that copurify with polyribosomes in mammalian neurons, Proc. Natl. Acad. Sci. USA 101 (2004) 360–365. [22] G.A. Calin, C.D. Dumitru, M. Shimizu, R. Bichi, S. Zupo, E. Noch, H. Aldler, S. Rattan, M. Keating, K. Rai, L. Rassenti, T. Kipps, M. Negrini, F. Bullrich, C.M. Croce, Frequent deletions and down-regulation of micro-RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia, Proc. Natl. Acad. Sci. USA 99 (2002) 15524–15529. [23] M.Z. Michael, S.M. OÕConnor, N.G. vanHolst Pellekaan, G.P. Young, R.J. James, Reduced accumulation of specific microRNAs in colorectal neoplasia, Mol. Cancer Res. 1 (2003) 882–891.
[24] D.A. Tonetti, C. Henning-Chubb, D.T. Yamanishi, E. Huberman, Protein kinase C-beta is required for macrophage differentiation of human HL-60 leukemia cells, J. Biol. Chem. 269 (1994) 23230–23235. [25] D.E. Macfarlane, L. Manzel, Activation of beta-isozyme of protein kinase C (PKC beta) is necessary and sufficient for phorbol ester-induced differentiation of HL-60 promyelocytes. Studies with PKC beta-defective PET mutant, J. Biol. Chem. 269 (1994) 4327–4331. [26] Y. Ito, N.C. Mishra, K. Yoshida, S. Kharbanda, S. Saxena, D. Kufe, Mitochondrial targeting of JNK/SAPK in the phorbol ester response of myeloid leukemia cells, Cell Death Differ. 8 (2001) 794–800. [27] A. Laouar, D. Glesne, E. Huberman, Protein kinase C-beta, fibronectin, alpha(5)beta(1)-integrin, and tumor necrosis factoralpha are required for phorbol diester-induced apoptosis in human myeloid leukemia cells, Mol. Carcinog. 32 (2001) 195– 205. [28] X. Zheng, R. Ravatn, Y. Lin, W.C. Shih, A. Rabson, R. Strair, E. Huberman, A. Conney, K.V. Chin, Gene expression of TPA induced differentiation in HL-60 cells by DNA microarray analysis, Nucleic Acids Res. 30 (2002) 4489–4499. [29] S.M. Elbashir, W. Lendeckel, T. Tuschl, RNA interference is mediated by 21- and 22-nucleotide RNAs, Genes Dev. 15 (2001) 188–200. [30] A. Ishizuka, M.C. Siomi, H. Siomi, A Drosophila fragile X protein interacts with components of RNAi and ribosomal proteins, Genes Dev. 16 (2002) 2497–2508. [31] M. Zuker, Mfold web server for nucleic acid folding and hybridization prediction, Nucleic Acids Res. 31 (2003) 3406– 3415. [32] S. Griffiths-Jones, The microRNA Registry, Nucleic Acids Res. 32 (Database issue) (2004) D109–D111. [33] D.S. Schwarz, G. Hutvagner, T. Du, Z. Xu, N. Aronin, P.D. Zamore, Asymmetry in the assembly of the RNAi enzyme complex, Cell 115 (2003) 199–208. [34] J. Takamizawa, H. Konishi, K. Yanagisawa, S. Tomida, H. Osada, H. Endoh, T. Harano, Y. Yatabe, M. Nagino, Y. Nimura, T. Mitsudomi, T. Takahashi, Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival, Cancer Res. 64 (2004) 3753–3756. [35] L.F. Sempere, S. Freemantle, I. Pitha-Rowe, E. Moss, E. Dmitrovsky, V. Ambros, Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation, Genome Biol. 5 (2004) R13. [36] B.P. Lewis, I.H. Shih, M.W. Jones-Rhoades, D.P. Bartel, C.B. Burge, Prediction of mammalian microRNA targets, Cell 115 (2003) 787–798.
Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells Katsumi Kasashimaa,b, Yoshikazu Nakamurab, Tomoko Kozua,* a
b
Research Institute for Clinical Oncology, Saitama Cancer Center, Ina, Saitama 362-0806, Japan Department of Basic Medical Sciences, Institute of Medical Science, University of Tokyo, Shirokanedai, Minato-ku, Tokyo 108-8639, Japan Received 20 April 2004
Abstract MicroRNAs (miRNAs) are highly conserved small non-coding RNAs that regulate gene expression through translational repression by base-pairing with partially complementary mRNAs. The expression of a set of miRNAs is known to be regulated developmentally and spatially, and is involved in differentiation or cell proliferation in several organisms. However, the expression profiles of human miRNAs during cell differentiation remain largely unknown. In an effort to expand our knowledge of human miRNAs, we investigated miRNAs during 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced differentiation of human leukemia cells (HL-60) into monocyte/macrophage-like cells. Several hundred RNAs ranging from 18 to 26 nucleotides were isolated from HL-60 cells with or without TPA-induction, and subsequently characterized by sequencing, database searching, and expression profiling. By removing non-miRNA sequences, we found three novel and 38 known miRNAs expressed in HL-60 cells. These miRNAs could be further classified into subsets of miRNAs that responded differently following TPA induction, either being up-regulated or down-regulated, suggesting the importance of regulated gene expression via miRNAs in the differentiation of HL-60 cells. 2004 Elsevier Inc. All rights reserved. Keywords: MicroRNA; Differentiation; HL-60; TPA; Leukemia
MicroRNAs (miRNAs) have recently been identified as small non-coding RNAs (ca. 22 nucleotides long) that were previously referred to as small temporal RNAs (stRNAs) such as let-7 and lin-4 in Caenorhabditis elegans [1–5]. let-7 and lin-4 RNA are thought to pair with partially complementary sequences in the 3 0 untranslated region (UTR) of target mRNAs and repress their translation by a yet unknown mechanism [1,6]. This type of translational repression is crucial in the developmental timing of C. elegans. miRNAs are produced by Dicer (for double-stranded RNA endoribonuclease) from a foldback hairpin precursor transcript [7], and the resultant mature miRNAs are incorporated into RISC (RNA-induced silencing complex) for subsequent targeting to mRNAs. Small interfer*
Corresponding author. Fax: +81 48 722 1739. E-mail address: [email protected] (T. Kozu).
0006-291X/$ - see front matter 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.07.130
ing RNAs (siRNAs) are similar small RNAs processed by Dicer from long double-stranded RNAs [8], and are also incorporated into RISC as guide RNAs to mRNA. Although they share a similar complex for gene silencing, the output differs; miRNAs repress mRNA translation, whereas siRNAs degrade the target mRNA. The distinct complementarity with their target mRNAs, represented by either the partial complementarity of miRNA or the perfect complementarity of siRNA, is considered to be a main reason that accounts for their different action in relation to gene silencing [9,10]. To date, a large number of miRNAs have been identified in several organisms, including vertebrates and plants [11–14]. The expression of some miRNAs is regulated in a developmental and spatial manner, and the importance of miRNAs for development, cell proliferation, cell death, and morphogenesis has been demonstrated in C. elegans, Drosophila melanogaster, and
404
K. Kasashima et al. / Biochemical and Biophysical Research Communications 322 (2004) 403–410
Arabidopsis thaliana [15–17]. In vertebrates, embryonic stem (ES) cell-specific miRNAs and miRNAs expressed in hematopoietic lineage cells have been cloned from mouse [18,19]. One of these miRNAs, miR-181, was demonstrated to increase B-lineage cells when ectopically expressed in hematopoietic stem/progenitor cells, and indicated the involvement of this miRNA in differentiation [19]. Recently, expression profiling of a set of rat miRNAs in developing brain and miRNAs associated with polysomes in rat cortical neurons was determined, and suggested the involvement of certain miRNAs in brain development [20,21]. Two previous reports in the literature have indicated the involvement of miRNAs in human cancer. One report described a frequent loss of miR-15 and miR-16 in chronic lymphocytic leukemia (CLL) [22], while the other described the specific reduction of certain miRNAs in cancer cells [23]. The precise mechanism of regulated gene expression by miRNAs in mammals and the expression profile of human miRNAs associated with differentiation remain largely unknown. As a first step toward the understanding of regulated gene expression by miRNAs during cell differentiation, we studied the expression profile of miRNAs during 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced differentiation of HL-60 cells. HL-60 is a human promyelocytic leukemia cell line and one of the best studied models of cell differentiation. TPA can induce differentiation of these cells to monocyte/macrophagelike cells through the activation of protein kinase Cb [24,25]. Induction of terminal differentiation is also associated with the activation of stress-activated protein kinase, release of cytochrome c, activation of caspases, and ultimately the induction of apoptosis [26,27]. The expression of several genes including various transcription factors and cytokines is known to be altered during differentiation [28]. In this study, we systemically cloned small RNAs that were expressed during TPA-induced differentiation of HL-60 cells. We identified many miRNAs including known and novel sequences in HL-60 cells and, most interestingly, the expression of certain miRNAs responded quite differently to TPA treatment, either being up-regulated or down-regulated following TPA induction. These results suggest the importance of post-transcriptional regulation of gene expression via miRNAs during terminal differentiation of HL-60 cells.
Materials and methods Cell culture. HL-60, HeLa, and Kasumi-1 cells were grown in RPMI1640 supplemented with 10% FBS. For the differentiation assay, HL-60 cells were seeded at a density of 0.2 · 106 cells/ml and treated with TPA (Sigma Chemical) for 0, 0.5, 3, 6, 12, 24, or 48 h at a final concentration of 16 nM.
RNA extraction and cloning of small RNAs. Total RNA from cultured cells was extracted using ISOGEN (Nippon Gene) according to the manufacturerÕs instructions. Small RNAs were cloned as described by Elbashir et al. [29] with some modifications. Briefly, 50 lg of total RNA was separated on a denaturing 16% polyacrylamide gel and gel slices containing small RNAs consisting of ca. 18–26 nucleotides in length were excised. The small RNAs were then eluted into 0.3 M NaCl at 4 C overnight and recovered by phenol/chloroform extraction followed by ethanol precipitation. The RNA was dephosphorylated using 1 U alkaline phosphatase (Roche) for 30 min at 50 C, and the reaction was stopped by phenol/chloroform extraction. A 5 0 phosphorylated 3 0 adapter oligonucleotide (5 0 -UUUaaccgcatccttctc-3 0 : uppercase, RNA; lowercase, DNA; Dharmacon Research) with 3 0 modification of inverted deoxythymidine (idT) was ligated to the RNA using 20 U T4 RNA ligase (Amersham Bioscience), and the ligated product was subsequently purified using a denaturing 10% polyacrylamide gel. The ligated product was then 5 0 phosphorylated using 10 U T4 polynucleotide kinase (Takara) and purified by phenol/chloroform extraction and subsequent ethanol precipitation. A 5 0 adapter oligonucleotide (5 0 -tactaatacgactcactAAA: uppercase, RNA; lowercase, DNA; Dharmacon Research) was ligated to the phosphorylated ligation product as described above. The new ligation product was gelpurified, and RT-PCR was performed using ReverTra Ace (TOYOBO) and RT-primer (5 0 -GACTAGCTGGAATTCAAGGATGCGGTTA AA-3 0 ). RT-PCR was followed by PCR using a 5 0 primer (5 0 -CAGC CAACGGAATTCATACGACTCACTAAA-3 0 ) and the RT-primer. The PCR product was then digested with EcoRI and concatenated using T4 DNA ligase (Roche). Concatamers consisting of a size range of 200–800 bp were separated on a 1.5% low-melting agarose gel and recovered by phenol extraction and ethanol precipitation. The unpaired ends were filled using Taq polymerase at 72 C for 10 min, and the DNA fragment was directly subcloned into pGEM-T vector (Promega). Colony PCR was performed using M13 forward and reverse primers, and PCR products over 200 bp in length were sequenced directly. Northern blotting. Northern blotting of miRNAs was performed as described [30]. Briefly, 30 lg of total RNA was separated on a denaturing 15% polyacrylamide gel and then electroblotted onto a ZetaProbe GT membrane (BioRad). Following transfer, the membrane was dried and UV-crosslinked. The oligonucleotide probes used were 5 0 labeled using T4 polynucleotide kinase and [c-32P]ATP, and subsequently hybridized to the membrane overnight at 42 C in 7% SDS and 0.2 M Na2PO4 (pH 7.0). The hybridized membrane was washed several times with 2· SSC, 0.1% SDS. The blot was exposed on an imaging plate and the signals were detected using a Fluorescent Image Analyzer FLA-3000 (FUJIFILM). U6 snRNA was used as an internal control for the Northern blotting and detected using a U6 probe (5 0 GCCATGCTAATCTTCTCTGTATC-3 0 ). RT-PCR. Reverse transcription was performed using 3 lg of total RNA and random 9-mer primer with (+) or without () reverse transcriptase. The miRNA23-24 cluster was amplified using the following primers; forward: 5 0 -ATCACATTGCCAGGGATTTCCAAC-3 0 , reverse: 5 0 -CTGTTCCTGCTGAACTGAGCCA-3 0 .
Results and discussion For the cloning of human miRNAs related to differentiation, we employed the well-established in vitro differentiation system utilizing human myeloid leukemia cells, HL-60. TPA can efficiently induce terminal differentiation of HL-60 cells into a monocyte/macrophagelike phenotype. During the course of these investigations we confirmed that over 80% of HL-60 cells displayed
K. Kasashima et al. / Biochemical and Biophysical Research Communications 322 (2004) 403–410
growth arrest and an adherent phenotype that is characteristic of macrophage-like cells (Fig. 1). Following the isolation of total RNA from cells treated (+) or not treated () with TPA, small RNAs consisting of 18–26 nucleotides in length were then obtained by gel purification. Employing the ligation-mediated method [29], small RNAs from TPA (+) and TPA () cells were amplified by RT-PCR and subcloned into a T-vector. In total, 252 and 359 independent clones were isolated from TPA () and TPA (+) cells, respectively, which were subsequently characterized by sequencing and database searching. Results indicated the presence of several kinds of cellular RNA fragments in the library (Table 1). Over one half of the cloned RNAs represented breakdown products of abundant non-coding RNAs such as rRNA, snRNA, snoRNA, and tRNA. The frequency of rRNAs in the TPA (+) library was ca. 2.5-fold higher than that in the TPA () library. We assumed that this was probably due to apoptosis triggered by TPA. Accordingly, the frequency of miRNAs in the TPA (+) library (23.7%) was lower than that of the TPA () library (37.3%). It should be noted, however,
Fig. 1. TPA-induced monocytic differentiation of HL-60 cells. HL-60 cells were incubated in the absence (left panel) or presence (right panel) of 16 nM TPA for 48 h.
Table 1 Small RNAs cloned from TPA treated (+) or untreated () HL60 cells RNA type
Number of isolates TPA ()
miRNA rRNA mRNA snRNA snoRNA tRNA Non-coding cytoplasmic RNA Match with genomea Mitochondrial RNAb Unknown Total a
TPA (+)
94 66 2 10 3 22 0 19 5 31
85 163 5 20 4 8 5 9 17 43
252
359
Sequences that did not form a miRNA-specific hairpin precursor but matched with genomic sequences. b Sequences that did not match with any known sequence.
405
that these frequencies may not necessarily reflect the actual amount of miRNAs in each sample. We identified 94 clones from TPA () and 85 clones from TPA (+) as miRNAs that included known and newly predicted miRNA sequences (Table 1). Of these, 69 clones from TPA () and 69 clones from TPA (+) corresponded to 28 and 24 species of known human miRNAs, respectively (Table 2). The remaining unknown 25 clones from TPA () and 16 clones from TPA (+) contained four newly predicted miRNAs (Table 3). The most abundant clones, 23 from TPA () and 11 from TPA (+), did not match any known miRNAs although identical sequences exist in human chromosomes 3, 5, and 11, and in mouse EST (AK045690). The identical 22-nucleotide sequence on human chromosome 5 (AC022100) is located within a
Table 2 Number of known miRNA isolates from non-induced and TPAinduced HL-60 cells miRNA
TPA ()
TPA (+)
let-7a let-7b let-7d let-7e let-7f miR-15 miR-16 miR-17-5pa miR-17-3pa miR-18 miR-19b miR-20 miR-21 miR-23 miR-24 miR-25 miR-26a miR-26b miR-27 miR-29 miR-29c miR-30a(5p)a miR-30-3pa miR-30c miR-30e miR-92 miR-93 miR-101 miR-124a miR-128 miR-142-5pa miR-142-3pa miR-155 miR-191 miR-221 miR-222 miR-320 miR-339
1 2 3 0 0 5 1 5 0 2 1 1 1 1 0 1 2 1 8 1 0 1 1 1 0 2 1 1 0 1 13 6 0 1 1 0 4 0
3 0 0 1 1 2 0 1 1 0 0 0 12 3 6 1 4 2 10 0 1 0 0 0 1 1 0 0 2 0 9 1 1 0 1 3 1 1
a
-5p and -3p represent the 5 0 arm and 3 0 arm of the same hairpin precursor.
406
K. Kasashima et al. / Biochemical and Biophysical Research Communications 322 (2004) 403–410
Table 3 Novel miRNAs identified in this study miRNA
Number of clones TPA ()
TPA (+)
miR-422b (AC022100) miR-422a (AC015914) miR-423 (AC104984) miR-30e-3p (AL354914) miR-424 (AC004383)
23 0 1 0 1
11 0 0 2 3
a b c d
Sequence (5 0 –3 0 )
Size (nt)
Northern blotting
Hairpin precursors
Location
CUGGACUUGGAGUCAGAAGGCC CUGGACUUAGGGUCAGAAGGCCc AGCUCGGUCUGAGGCCCCUCAG CUUUCAGUCGGAUGUUUACAGC CAGCAGCAAUUCAUGUUUUGAA
22–21 22 22 22 22–21
+ NDd + ND +
H.s.a, M.m.b H.s. H.s., M.m. H.s., M.m. H.s., M.m.
Chromosome Chromosome Chromosome Chromosome Chromosome
5 15 17 1 X
Homo sapiens. Mus musculus. Underlined nucleotides represent identical nucleotides with miR-422b. Not determined.
typical hairpin consisting of ca. 70 nucleotides in length as folded by Mfold [31], which seems to be characteristic for miRNA precursors and is conserved in the mouse sequence (Table 4). The other identical sequences on human chromosomes 3 and 11 are not located within the typical hairpin structure. Therefore, the sequence on human chromosome 5 seemed to be a novel miRNA. Additionally, it was found through homology searching that a similar sequence to the miRNA located in the human genome (AC015914) differs by only two nucleotides to the miRNA and also forms a hairpin precursor structure (Table 4). According to the miRNA registration rule [32], these sequences appeared to belong to the same family and were designated as miR-422b and miR-422a,
Table 4 The predicted hairpin precursor structures of the novel miRNAs by Mfold
Underlined bases represent the mature miRNA sequences.
respectively. Two other novel species were also identified that form hairpin structures that were well conserved between human and mouse (Table 4), and were designated as the novel miRNAs, miR-423, and miR-424. The human miR-424 sequence differs by only one nucleotide when compared to the mouse sequence, and both of them are encoded on their respective X chromosome. These sequences are likely to represent miRNAs of the same family rather than orthologs, since mature sequences of known miRNAs have been perfectly conserved between human and mouse. Moreover, we found another sequence on human chromosome 1 that differed by only one nucleotide when compared to the known miRNA, miR-30a (on chromosome 6). Since this sequence origi-
K. Kasashima et al. / Biochemical and Biophysical Research Communications 322 (2004) 403–410
nates from the 3 0 arm of the hairpin precursor of miR30e, this was designated as miR-30e-3p. The miRNAs cloned in this study displayed different frequencies when the TPA () and TPA (+) libraries were compared (Tables 2 and 3). One could assume that these frequencies might be correlated to the de novo appearance of miRNAs. Northern blot analysis was performed in an effort to verify whether this difference reflected the actual expression profile of miRNAs in HL-60 cells. At first, the expression of the novel miRNAs, miR-422b and miR-424, was monitored. Both miRNAs were detected as bands corresponding to 22 nucleotides in size as determined by Northern blotting (Fig. 2A), however the expression patterns differed. miR-422b was detected almost equally in the TPA () and the TPA (+) samples, and also detected in the human leukemia cell line K562, and in Kasumi-1 cells (Fig. 2A). Although the frequency of miR-422b in the library was high (ca. 19% of total miRNA clones), the overall de novo expression level of miR-422b was relatively low, indicating that the cloning frequency might not always reflect the de novo level of miRNA in each sample. On the other hand, miR-424 was mainly detected in the TPA (+) sample, while very little, if any, was detected in the TPA () sample or in K562 or Kasumi-1 cells. Therefore, miRNA-424 seems to be specifically associated with TPA-induced differentiation. Furthermore, miR-422b and miR-424 were not detected in HeLa cells. The presence of genomic sequences within the HeLa genome that would encode miR-422b and miR-424 was confirmed by genomic PCR (data not shown), and suggested that these miRNAs are specifically expressed in blood cell lineages and play specific roles in the lineages. The expression profile of other miRNAs was determined by Northern blotting. Reduced expression of miR-17-5p, miR-142-5p, miR-142-3p, and miR-320 was observed in the TPA (+) sample (Fig. 2A), which was consistent with the cloning frequency (Table 2). miR-142-5p and miR-142-3p displayed very similar expression profiles, although the amount of miR-1423p expressed was lower than that of miR-142-5p. Since miR-142-5p and miR-142-3p are present on the same precursor transcript, it was not unexpected that their expression profiles were similar. The lower expression of miR-142-3p compared to miR-142-5p might have resulted due to the asymmetry rule of miRNA/siRNA, where one of the miRNA/siRNA strands is more stable and hence more efficiently incorporated into RISC, while the other strand is unstable [33]. Just as was the case with miR-422b and miR-424, miRNA-142-5p and -3p were not expressed in HeLa cells (Fig. 2A). Considering that the homologous miRNA of mouse (miRNA-142-5p) was expressed in hematopoietic lineage cells [19], this miRNA might also be specific for blood cell lineages. A set of miRNAs containing miR-21, miR-23, miR24, and miR-27a displayed increased expression in the
407
Fig. 2. Expression profiles of representative miRNAs during TPAinduced differentiation. (A) Expression levels of the indicated miRNAs in several human cells were investigated by Northern blotting. K562 and Kasumi-1 cells are human leukemia cell lines. As a loading control, RNAs including 5S rRNA and tRNAs were stained with ethidium bromide (EtBr). (B) Schematic representation of previously reported gene clusters for the indicated miRNAs. Arrows represent PCR primers for amplification of the 327 bp RNA fragment containing miR-23, miR-27a, and miR-24. (C) The RNA fragment (miR-2324) was amplified in the TPA (+/) samples by semi-quantitative RT-PCR. As controls, reverse transcriptase was omitted (RT ()) and GAPDH was amplified.
TPA (+) sample (Fig. 2A), which was consistent with the cloning frequency (Table 2). Of these, miR-21 was significantly up-regulated in the TPA (+) sample. It was recently reported that in mouse embryonic stem (ES) cells, the expression of miR-21 dramatically increased following retinoic-acid (RA)-induced differentiation [18]. These results suggested that up-regulation of miR-21 might play a general role in cell differentiation by targeting certain general factors crucial for differentiation. The remaining miRNAs, miR-23, miR-24, and miR-27a, displayed a similar expression profile to that
408
K. Kasashima et al. / Biochemical and Biophysical Research Communications 322 (2004) 403–410
of miR-21, i.e., a high level of expression in the TPA (+) sample and in HeLa cells. However, unlike miR21, they were only weakly expressed in K562 cells (Fig. 2A). These three miRNA sequences are known to be clustered in chromosome 19 and are likely to be processed from a single precursor transcript (Fig. 2B) [3]. Therefore, it was conceivable that increased expression of this polycistronic transcript by TPA might result in the simultaneous induction of these miRNAs. This possibility was tested directly by application of semi-quantitative RT-PCR analysis. As shown in Fig. 2C, the transcript containing miRNA-
23-27a-24 was detected and the expression of which increased following TPA induction of HL-60 cells (Fig. 2C). As further support of this possibility, other known clustered miR-15 and miR-16 sequences (Fig. 2B) displayed a similar expression pattern (Fig. 2A). Considering that several miRNAs are expressed as a clustered sequence unit, it is possible that the expressions of other miRNAs are simultaneously affected by TPA-induced transcriptional regulation. Further, Northern blot analysis was performed at several time points following TPA-induction in an effort to examine the precise expression profiles of the miR-
Fig. 3. Expression profiles of representative miRNAs at various time points following TPA-induction. (A) Expressions levels of the indicated miRNAs in HL-60 cells induced by TPA for 0, 0.5, 3, 6, 12, 24 or 48 h were investigated by Northern blotting. Each column shows the results obtained using the same membrane. U6 snRNA was used as an internal control. Expression levels of each miRNAs were normalized by against U6 snRNA levels. (B) Up-regulated miRNAs 48 h following TPA-induction compared to that of the start point (0 h). Horizontal axis shows time (hours) following TPA-induction. Longitudinal axis represents -fold expression levels of each miRNA, where the expression level of these at 0 h was defined as 1. (C) Down-regulated miRNAs 48 h following TPA-induction compared to that of the start point (0 h). The horizontal and longitudinal axes were the same as described above.
K. Kasashima et al. / Biochemical and Biophysical Research Communications 322 (2004) 403–410
NAs tested above, including additional miRNAs known to be involved in the hematopoietic lineage in mouse (Fig. 3A). By comparison of the expression level at 48 h relative to that of the start point (0 h), the miRNAs were classified into two groups, being up-regulated (Fig. 3B) or down-regulated (Fig. 3C). As shown in Fig. 3B, most of the up-regulated miRNAs increased at a later stage during TPA-induction. In particular, significant up-regulation of miR-21 was observed 24 h following TPA-induction. Therefore, these miRNAs might be involved in the regulation of later, as opposed to early, responsive genes during TPA-induced differentiation. On the contrary, all the down-regulated miRNAs showed mutually similar expression profiles, where expression levels increased at the early stage (0.5 h) and then decreased at the late stage (24–48 h) (Fig. 3C). In the case of miR-17-5p and miR-142-5p, these increased again at 6 h, suggesting a biphasic expression pattern. The observed miRNA expression pattern might play a role in the temporal regulation of gene expression, such as with early responsive genes and/or secondary responsive genes. Interestingly, miR-142-5p, miR181a, and miR-223, which are hematopoietic lineage specific miRNAs in mouse, and miR-15 and miR-16, lost frequently in CLL, were classified into the ÔdownregulatedÕ group. Down-regulation of these miRNAs following temporal up-regulation might be important in the terminal differentiation of HL-60 cells. It has been suggested that the loss or down-regulation of certain miRNAs is closely related to the development of particular human cancers [22,23,34], suggesting that appropriate expression of miRNAs is important for normal cell differentiation and development. In fact, a recent study of expression profiles of human miRNAs in several organs has indicated the close relationship between the expression of certain miRNAs and neuronal differentiation [35]. Therefore, the expression of a subset of miRNAs that leads to gene silencing of target sequences is considered to be an important process during cellular differentiation. In this study, it was found that the expression of a group of miRNAs including miR-21, miR-23, miR-24, and miR-27a increased during TPA-induced differentiation, and suggested their importance in relation to monocytic differentiation of HL-60 cells. In addition to the presence of up-regulation, certain miRNAs such as miR17-5p, miR-142-5p, miR-142-3p, and miR-320 were down-regulated following TPA treatment. Therefore, one might argue that miRNA-induced control of cell differentiation consists of two mechanisms, one concerning gene silencing by up-regulated miRNAs and the other concerning gene activation by terminating miRNA-catalyzed gene silencing. A program, TargetScan, has been developed that predicts mammalian miRNA targets [36]. This program is based on the conserved pairing of the miRNA
409
5 0 region with the target mRNA 3 0 UTR. According to this program, one miRNA could have 1–10 putative targets. Actually, many genes have been predicted as potential targets for the miRNAs associated to TPA-induced differentiation in this study (data not shown). In the case of miR-21, however, no target gene was predicted by TargetScan. This suggested that although pairing sequences with miR-21 may not exist within the 3 0 UTR of potential target mRNAs, they may exist within other regions such as in the 5 0 UTR or coding regions. Identification of mRNAs targeted by miR-21 is essential to further our understanding of cell differentiation and its relation to the mechanism of miRNA action. In summary, the expression of many miRNAs including known and novel sequences was regulated during TPA-induced differentiation of HL-60 cells. Both upregulated or down-regulated expression patterns were observed, depending on the miRNA species in question. Although the precise mechanism concerning this regulation remains unknown, we suggested that the miRNAs examined in this study play an important role in cell differentiation.
Acknowledgments We would like to express our gratitude to Ms. Eri Sakota and Ms. Miho Matsuda for technical assistance, and to Dr. Megumi Sumitani for technical advice. This work was supported by Grants-in-Aid for Scientific Research on Priority Areas from Ministry of Education, Culture, Sports, Science and Technology of Japan (14035253).
References [1] B.J. Reinhart, F.J. Slack, M. Basson, A.E. Pasquinelli, J.C. Bettinger, A.E. Rougvie, H.R. Horvitz, G. Ruvkun, The 21nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans, Nature 403 (2000) 901–906. [2] A.E. Pasquinelli, B.J. Reinhart, F. Slack, M.Q. Martindale, M.I. Kuroda, B. Maller, D.C. Hayward, E.E. Ball, B. Degnan, P. Muller, J. Spring, A. Srinivasan, M. Fishman, J. Finnerty, J. Corbo, M. Levine, P. Leahy, E. Davidson, G. Ruvkun, Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA, Nature 408 (2000) 86–89. [3] M. Lagos-Quintana, R. Rauhut, W. Lendeckel, T. Tuschl, Identification of novel genes coding for small expressed RNAs, Science 294 (2001) 853–858. [4] N.C. Lau, L.P. Lim, E.G. Weinstein, D.P. Bartel, An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans, Science 294 (2001) 858–862. [5] R.C. Lee, V. Ambros, An extensive class of small RNAs in Caenorhabditis elegans, Science 294 (2001) 862–864. [6] M.C. Vella, E.Y. Choi, S.Y. Lin, K. Reinert, F.J. Slack, The C. elegans microRNA let-7 binds to imperfect let-7 complementary sites from the lin-41 3 0 UTR, Genes Dev. 18 (2004) 132–137.
410
K. Kasashima et al. / Biochemical and Biophysical Research Communications 322 (2004) 403–410
[7] G. Hutvagner, J. McLachlan, A.E. Pasquinelli, E. Balint, T. Tuschl, P.D. Zamore, A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA, Science 293 (2001) 834–838. [8] S.W. Knight, B.L. Bass, A role for the RNase III enzyme DCR-1 in RNA interference and germ line development in Caenorhabditis elegans, Science 293 (2001) 2269–2271. [9] J.G. Doench, C.P. Petersen, P.A. Sharp, siRNAs can function as miRNAs, Genes Dev. 17 (2003) 438–442. [10] Y. Zeng, R. Yi, B.R. Cullen, MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms, Proc. Natl. Acad. Sci. USA 100 (2003) 9779–9784. [11] B.J. Reinhart, E.G. Weinstein, M.W. Rhoades, B. Bartel, D.P. Bartel, MicroRNAs in plants, Genes Dev. 16 (2002) 1616–1626. [12] L.P. Lim, N.C. Lau, E.G. Weinstein, A. Abdelhakim, S. Yekta, M.W. Rhoades, C.B. Burge, D.P. Bartel, The microRNAs of Caenorhabditis elegans, Genes Dev. 17 (2003) 991–1008. [13] L.P. Lim, M.E. Glasner, S. Yekta, C.B. Burge, D.P. Bartel, Vertebrate microRNA genes, Science 299 (2003) 1540. [14] A.A. Aravin, M. Lagos-Quintana, A. Yalcin, M. Zavolan, D. Marks, B. Snyder, T. Gaasterland, J. Meyer, T. Tuschl, The small RNA profile during Drosophila melanogaster development, Dev. Cell 5 (2003) 337–350. [15] V. Ambros, MicroRNA pathways in flies and worms: growth, death, fat, stress, and timing, Cell 113 (2003) 673–676. [16] J.C. Carrington, V. Ambros, Role of microRNAs in plant and animal development, Science 301 (2003) 336–338. [17] D.P. Bartel, MicroRNAs: genomics, biogenesis, mechanism, and function, Cell 116 (2004) 281–297. [18] H.B. Houbaviy, M.F. Murray, P.A. Sharp, Embryonic stem cellspecific MicroRNAs, Dev. Cell 5 (2003) 351–358. [19] C.Z. Chen, L. Li, H.F. Lodish, D.P. Bartel, MicroRNAs modulate hematopoietic lineage differentiation, Science 303 (2004) 83–86. [20] A.M. Krichevsky, K.S. King, C.P. Donahue, K. Khrapko, K.S. Kosik, A microRNA array reveals extensive regulation of microRNAs during brain development, RNA 9 (2003) 1274–1281. [21] J. Kim, A. Krichevsky, Y. Grad, G.D. Hayes, K.S. Kosik, G.M. Church, G. Ruvkun, Identification of many microRNAs that copurify with polyribosomes in mammalian neurons, Proc. Natl. Acad. Sci. USA 101 (2004) 360–365. [22] G.A. Calin, C.D. Dumitru, M. Shimizu, R. Bichi, S. Zupo, E. Noch, H. Aldler, S. Rattan, M. Keating, K. Rai, L. Rassenti, T. Kipps, M. Negrini, F. Bullrich, C.M. Croce, Frequent deletions and down-regulation of micro-RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia, Proc. Natl. Acad. Sci. USA 99 (2002) 15524–15529. [23] M.Z. Michael, S.M. OÕConnor, N.G. vanHolst Pellekaan, G.P. Young, R.J. James, Reduced accumulation of specific microRNAs in colorectal neoplasia, Mol. Cancer Res. 1 (2003) 882–891.
[24] D.A. Tonetti, C. Henning-Chubb, D.T. Yamanishi, E. Huberman, Protein kinase C-beta is required for macrophage differentiation of human HL-60 leukemia cells, J. Biol. Chem. 269 (1994) 23230–23235. [25] D.E. Macfarlane, L. Manzel, Activation of beta-isozyme of protein kinase C (PKC beta) is necessary and sufficient for phorbol ester-induced differentiation of HL-60 promyelocytes. Studies with PKC beta-defective PET mutant, J. Biol. Chem. 269 (1994) 4327–4331. [26] Y. Ito, N.C. Mishra, K. Yoshida, S. Kharbanda, S. Saxena, D. Kufe, Mitochondrial targeting of JNK/SAPK in the phorbol ester response of myeloid leukemia cells, Cell Death Differ. 8 (2001) 794–800. [27] A. Laouar, D. Glesne, E. Huberman, Protein kinase C-beta, fibronectin, alpha(5)beta(1)-integrin, and tumor necrosis factoralpha are required for phorbol diester-induced apoptosis in human myeloid leukemia cells, Mol. Carcinog. 32 (2001) 195– 205. [28] X. Zheng, R. Ravatn, Y. Lin, W.C. Shih, A. Rabson, R. Strair, E. Huberman, A. Conney, K.V. Chin, Gene expression of TPA induced differentiation in HL-60 cells by DNA microarray analysis, Nucleic Acids Res. 30 (2002) 4489–4499. [29] S.M. Elbashir, W. Lendeckel, T. Tuschl, RNA interference is mediated by 21- and 22-nucleotide RNAs, Genes Dev. 15 (2001) 188–200. [30] A. Ishizuka, M.C. Siomi, H. Siomi, A Drosophila fragile X protein interacts with components of RNAi and ribosomal proteins, Genes Dev. 16 (2002) 2497–2508. [31] M. Zuker, Mfold web server for nucleic acid folding and hybridization prediction, Nucleic Acids Res. 31 (2003) 3406– 3415. [32] S. Griffiths-Jones, The microRNA Registry, Nucleic Acids Res. 32 (Database issue) (2004) D109–D111. [33] D.S. Schwarz, G. Hutvagner, T. Du, Z. Xu, N. Aronin, P.D. Zamore, Asymmetry in the assembly of the RNAi enzyme complex, Cell 115 (2003) 199–208. [34] J. Takamizawa, H. Konishi, K. Yanagisawa, S. Tomida, H. Osada, H. Endoh, T. Harano, Y. Yatabe, M. Nagino, Y. Nimura, T. Mitsudomi, T. Takahashi, Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival, Cancer Res. 64 (2004) 3753–3756. [35] L.F. Sempere, S. Freemantle, I. Pitha-Rowe, E. Moss, E. Dmitrovsky, V. Ambros, Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation, Genome Biol. 5 (2004) R13. [36] B.P. Lewis, I.H. Shih, M.W. Jones-Rhoades, D.P. Bartel, C.B. Burge, Prediction of mammalian microRNA targets, Cell 115 (2003) 787–798.